WO2003020931A2 - Sirna knockout assay method and constructs - Google Patents

Sirna knockout assay method and constructs Download PDF

Info

Publication number
WO2003020931A2
WO2003020931A2 PCT/EP2002/009670 EP0209670W WO03020931A2 WO 2003020931 A2 WO2003020931 A2 WO 2003020931A2 EP 0209670 W EP0209670 W EP 0209670W WO 03020931 A2 WO03020931 A2 WO 03020931A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
polynucleotide
rna
sequences
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2002/009670
Other languages
English (en)
French (fr)
Other versions
WO2003020931A3 (en
Inventor
Gert-Jan Arts
Ellen Vera Langemeijer
Ivo Piest
Helmuth Hendrikus Gerardus Van Es
Godefridus Augustinus Maria Michiels
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Galapagos Genomics NV
Original Assignee
Galapagos Genomics NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=26980845&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2003020931(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Galapagos Genomics NV filed Critical Galapagos Genomics NV
Priority to AU2002339458A priority Critical patent/AU2002339458A1/en
Priority to DE60225586.4T priority patent/DE60225586T3/de
Priority to CA002457419A priority patent/CA2457419A1/en
Priority to EP02776950.4A priority patent/EP1444346B2/en
Priority to JP2003525634A priority patent/JP2005501557A/ja
Publication of WO2003020931A2 publication Critical patent/WO2003020931A2/en
Publication of WO2003020931A3 publication Critical patent/WO2003020931A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/12Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/30Production chemically synthesised
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/30Production chemically synthesised
    • C12N2330/31Libraries, arrays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus

Definitions

  • the present invention relates to polynucleotide constructs, methods for their preparation, and preparations for their use in methods that lower the amount of RNA and/or protein production in cells based on the intracellular expression of small interfering polyribonucleic acid molecules.
  • Genomics research over the last decades has resulted in a nearly complete map of all human genes and opened-up new directions in medical research.
  • new disciplines of science have emerged such as proteomics and functional genomics.
  • Traditional pharmaceutical companies with substantial R&D budgets are interested in getting access to new functional genomics and proteomics platform technologies. What is needed is better screening technologies for identification of new therapeutic targets as well as better target validation approaches.
  • functional genomics has the potential to make a significant difference for the treatment of all human diseases.
  • knockdown or knockout approaches are used to study gene function in mammalian cells (e.g. antisense, antibodies, ribozymes, aptamers, zinc finger proteins, chimeric RNA-DNA oligos, etc. ) .
  • antisense e.g. antisense, antibodies, ribozymes, aptamers, zinc finger proteins, chimeric RNA-DNA oligos, etc.
  • these technologies are not robust and efficient nor they can be generically applied to all genes and all cell types.
  • RNA interference is the post-transcriptional process of gene silencing mediated by double stranded RNA (dsRNA) that is homologous in sequence to the silenced RNA and is observed in animals and plants.
  • dsRNA double stranded RNA
  • the dsRNA is processed into 21-23 nucleotides (nts) molecules, called small interfering RNAs (siRNAs), which guide the sequence-specific degradation of the target RNA (Sharp, 2001) .
  • RNA interference in C. elegans has been followed by numerous examples of organisms where introduction of dsRNA can induce the sequence specific silencing effect.
  • Mature siRNA duplexes are precisely processed to form a duplexed RNA of 21-23 nts long with 3' overhangs of 2- or 3- nts; they do not contain modified nucleotides and have a 5' phosphate (not essential for its function) and a 3' hydroxyl group.
  • a siRNA duplex with 2- or 3-nts overhangs is more active than duplexes with blunt ends or 4-nts overhangs.
  • Extensions at the 3' terminus of 17 or-up nts at either the sense strand or the antisense strand results in a loss of activity to cleave the complementary target strand. This indicates that the correct 3' terminus of the antisense strand is essential for the maintaining the activity of the siRNA duplex to degrade the sense target RNA (Elbashir et al., 2001b) .
  • RNAi to transposon silencing in C. elegans .
  • Co-suppression by posttranslational gene silencing (PGTS) in plants seems to function by a related mechanism mediated by small guide RNAs of approximately 22 nts.
  • RNAi RNAi RNAi RNAi RNAi RNAi RNAi .
  • the RDE-1 gene family consists of a large number of members (24 in C. elegans) that is well conserved. Members of the RDE-1 family contain conserved PIWI- and PAZ-do ains of unknown functions. RDE-1 homologues are found in various species and RDE-1 family members have been implicated to act in various processes; RNAi, PTGS in plants, embryogenesis in Drosophila, expression and regulation of small temporal RNAs.
  • Dicer protein is a member of the RNase III family that is conserved in several species. Dicer contains a helicase domain, 1-2 dsRNA binding domains, 2 RNase III type domains and a PAZ domain. Dicer is required for the generation of the functional 21 nucleotides long siRNAs from longer dsRNA complexes (Bernstein et al., 2001).
  • stRNAs small temporal RNAs
  • stRNAs small temporal RNAs
  • the stRNAs are processed from longer precursor transcripts. Mature let- 7 RNA has also been detected in humans and precursors with conserved secondary structures have been predicted (Pasquinelli et al., 2000) .
  • Dicer has a dual function: processing of dsRNA into siRNA as well as processing of let-7 precursors into mature let-7 stRNA.
  • the products, the stRNA and the siRNA have some characteristics that are different and some characteristics that are shared.
  • stRNA and siRNA include (1) both sense and antisense strands of mature siRNAs are present in the cell; only the antisense strand of mature stRNAs is detectable, (2) the duplexed region of stRNAs contains some G- U base pairs and mismatches in contrast to siRNAs that have 100% complementary duplexes, and (3) the mode of action for siRNA is RNA degradation, while let-7 stRNA is believed to result in a translational block.
  • stRNAs and siRNAs share the characteristics that (1) both RNA species are involved in repression of gene expression, (2) both, mature siRNAs and mature stRNAs are 21-22 nts long, (3) both are produced from duplexed, longer precursor RNAs, and (4) the processing into active forms of both stRNA and siRNA is mediated by the same enzyme, Dicer.
  • RNAi provides researchers with an additional genetic tool to study gene functions.
  • C. elegans chromosomes I and III have now systematically been analyzed for phenotypic effects.
  • the RNAi approach creates extra possibilities in developmental studies.
  • Classical knockouts with lethal effects during development could never be analyzed in later developmental stages.
  • With RNAi the onset of the effect may be varied and roles in later stages of development may be studied.
  • RNAi in mammalian cells has been problematic since introduction of long (>30 base pairs) dsRNA results in two major intracellular responses: activation of the double stranded RNA dependent protein kinase PKR, which results in a general block of protein synthesis, and activation via 2' -5'- oligoadenylate synthetase of RNase L, which attacks all RNAs .
  • PKR double stranded RNA dependent protein kinase
  • dsRNA-dependent protein kinase PLR
  • PKR interferon- inducible sRNA-dependent protein kinase
  • eIF2-alpha eukaryotic translation initiation factor 2
  • eIF2 bound to GTP delivers the initiator tRNA methionine to the small ribosomal subunit and eIF2 is released as the GDP-bound form.
  • eIF2 In order to get continuous ongoing translation, eIF2 has to be recycled from the GDP- to the GTP-bound state. Phosphorylation of eIF2-alpha by PKR prevents this recycling and thereby blocks the initiation of translation. As a consequence, dsRNA leads to a general translational block in mammalian cells.
  • dsRNA is also known to activate the interferon-induced ( 2 r -5') oligoadenylate synthetase. Upon activation, this enzyme polymerizes ATP into 2 ' -5' -linked nucleotide oligomers (also indicated by 2-5A) .
  • the 2-5A oligomers activate the ribonuclease RNase L that results in RNA degradation.
  • ADAR nuclear dsRNA-specific adenosine deaminase
  • ADAR nuclear dsRNA-specific adenosine deaminase
  • ADAR acts selectively on particular substrates, like mRNAs for brain glutamate receptors (gluR) , its activity shows very little sequence specificity and can act on any dsRNA molecule above a certain minimum length.
  • This generic modifying activity results in deamination of adenosine- into inosine-residues resulting in unwinding of the dsRNA helix.
  • RNAi in mammalian systems is possible.
  • RNAi can be used in a panel of mammalian cell lines (Elbashir et al., 2001a).
  • the approach is based on direct transfection of the 21-23 nts siRNA duplexes into the cells. This circumvents the intracellular responses mentioned above and results in sequence-specific silencing of endogenous and heterologous genes .
  • siRNA transfection approach An important bottleneck in the siRNA transfection approach is its limited applicability to target different cell types, especially primary cells.
  • Primary cells are closest to the in vivo situation and often have the highest physiological relevance.
  • Non-viral DNA or siRNA transfection technologies have severe limitations with regard to these cells and are not efficient and reliable. Practical use of these approaches needs significant optimisation of conditions, and in general lack the robustness necessary for large-scale applications.
  • the gene transfer reagents used are often toxic, yielding lower levels of viable transduced cells. In essence, they do not allow a generic siRNA application for a wide variety of cell types, including primary cell types such as T cells, B cells, mast cells, endothelial cells, synoviocytes and lung epithelial cells.
  • transfection of the siRNA gives a short knock-down effect. For a prolonged knock-down effect in cells several additional transfections are necessary.
  • Genomics scale implementation of knocking down genes in mammalian cells has been hampered by the lack of a reliable, robust and efficient gene transfer technology (see above) applicable in a wide range of cell lines and primary cell types.
  • the present invention overcomes the limitations recognized by the prior art, and finds applications in numerous fields, such as genomics studies, viral production and protein production.
  • the production of recombinant viruses is sometimes complicated by the expression of exogenous sequences that encode lethal or toxic proteins that interfere with viral production.
  • the prior art discloses systems for the temporary shut-down of protein production including the Tet-repression system and the Ecdyson system. These systems are however time-consuming and involve difficult cloning steps to introduce the constructs into the vectors.
  • Another disadvantage of the prior art repression systems is that to express the exogenous gene, one often must add a compound that suppresses the suppressor system itself to turn on gene expression.
  • the present invention may be applied to every viral packaging and protein production system to improve production by the selective knock-down of lethal or recombinant proteins during the viral or producing cell production phases respectively.
  • the present invention relates to isolated polynucleotides, and vectors including the same, useful for the down regulation or degradation of a specific RNA molecule in a host cell, consisting essentially of a first polynucleotide sequence consisting of about 17 to about 23 nucleotides and complementary to about 17 to about 23 nucleotides of said RNA sequence in said host cell, said first sequence covalently linked to a second sequence capable of forming a loop structure when said second sequence is RNA, wherein said first sequence consists essentially of a RNA sequence, or a single stranded DNA equivalent thereof.
  • Another embodiment of the present invention relates to a self- complementing single stranded polynucleotide, and vectors including the same, comprising a first nucleotide sequence and a third nucleotide sequence covalently linked by a second nucleotide sequence capable of forming a stem-loop structure, when said second sequence is RNA, such that all nucleotides in said first sequence and said third sequences are capable of base pairing with each other, wherein said second nucleotide sequence comprises a stem-loop forming region having a sequence derived from naturally occurring RNA sequences found in RNA molecules and that does not functionally target a specific RNA molecule in a host cell. Most preferably the second sequences are derived from RNA molecules other than mRNA.
  • Another aspect of the present invention relates to a method for reducing the amount of at least one RNA molecule having a unique sequence present in a host cell comprising transfecting said cell with a vector that encodes a self-complementing single stranded polynucleotide described herein, wherein said polynucleotide comprises a first sequence which is complementary to said RNA sequence.
  • Another aspect of the present invention relates to a method for preparing a self-complementing single stranded polynucleotide including complementary sequences covalently linked by a polynucleotide sequence forming a stem loop structure, comprising treating a single stranded polynucleotide consisting essentially of a first polynucleotide sequence covalently linked to a second polynucleotide sequence that includes two nucleotide sequences capable of complementary base pairing and thereby forming a stem-loop structure that has a 3' OH terminus, under conditions such that said first sequence serves as a template starting a the 3' OH terminus for the synthesis of a complementary sequence thereto.
  • Another aspect of the present invention relates to a method of preparing a vector including the sequence of a polynucleotide according to the invention, wherein said self-complementing polynucleotide is a DNA sequence and further comprises a fourth sequence linked to the free end of said first sequence, and wherein said polynucleotide is denatured, converted into a double stranded polynucleotide, and ligated into a vector capable of transfecting a host cell and transcribing said polynucleotide .
  • Another aspect of the present invention relates to a method of determining the function of a naturally occurring polynucleotide sequence comprising transfecting a host cell with a vector according to the invention, said vector including a polynucleotide sequence complementary to said naturally occurring polynucleotide and detecting a change in cellular phenotype.
  • aspects of the invention relate to libraries of vectors, and vectors, consisting essentially of polynucleotide according to the invention. Further aspects of the invention relate to methods of lowering the amounts of RNA or protein translated from RNA in a subject, comprising the administration of a vector according to the present invention, and transfecting cells in said subject, in an amount effective to lower the amounts of said RNA in said transfected cells.
  • the present invention provides for the temporary knock-down of proteins, such as lethal proteins, during virus or recombinant protein production, thereby allowing (1) the replication and packaging of virus that include sequences encoding for lethal proteins, or (2) the optimal production of recombinant protein.
  • Knock-down constructs described herein below are transfected into any selected packaging cell and such transfected cells are used directly.
  • the knock-down system uses virus constructs that are used directly to infect cells and no further compound is required by the method to induce virus or protein production Brief Description of the Drawings
  • Figure 1 shows the repression of luciferase activity of pGL3- fusion constructs containing let-7 target sequences by let-7 siRNAs in PER.C6/E2A cells.
  • PER.C6/E2A cells are transiently transfected with the pGL3-fusion constructs containing let-7 target sequences in either orientation (pGL3-tLet-7F, pGL3- tLet-7R) or pGL3-control lacking let-7 sequences, in combination with each of the siRNA duplexes siRNA GL3.1, siRNA let-7.1, siRNA GL2.1, or no siRNA.
  • Co-transfection of siRNA let-7.1 specifically represses luciferase activity of the reporters pGL3-tLet7F and pGL3-tLet7R, but not the pGL3- control.
  • Co-transfection of the positive control siRNA GL3.1 shows repression of all the reporter constructs (pGL3-tLet-7F, pGL3-tLet-7R, pGL3-control) .
  • Figure 2 is a table presenting the results of a DNA database search using the C. elegans let-7 guide sequence as a probe. Three perfect matches were found on the human genome, in chromosomes 9, 11, 19, 21, 22 and X.
  • Figure 3 describes plasmid pIPspAdapt Let-7 gene D formed by the insertion of the Xba I/Hind III fragment of Let-7 gene D into the Avr II/Hind III sites of pIPspAdapt ⁇ -deltaPolyA.
  • Figure 4 depicts the reprogramming of Let-7 RNA to another target sequence.
  • Plasmid constructs containing Let7gene22A-F are used as templates for two separate PCR reactions.
  • Primer Let-7. N19-R4 is used in combination with a forward primer, for instance, Let7gene22 Fl-3.
  • Primer Let-7. N19-F4 is used in combination with a reverse primer, for instance, Let7gene22 Rl-2.
  • the products of these two separate PCR reactions are used as template for a final PCR reaction. Only the outside primers Let7gene22 Fl-3 and Let7gene22 Rl-2 are used in this final PCR reaction.
  • the PCR products obtained from this final reaction are cloned into pIPspAdapt ⁇ -deltaPolyA using the same strategy as described for the Let7gene22A-F fragments.
  • Figure 5 shows the process generating a library from randomly produced/isolated sRNAs .
  • Figure 6 shows the process for the preparation of constructs that code for individual chimera sRNA that may include RNA associated with unknown function and that is automatable and useful in the construction of a library of chimera sRNA.
  • Figure 7 is a schematic representation of the construction and use of an adenoviral chimeric sRNA library.
  • Figure 8 is a schematic representation of the luciferase-based reporter constructs and siRNA constructs used in example 2
  • Figure 9 depicts down-regulation of the reporters containing the target sequences that corresponds to the sequences of the co-transfected RNAs.
  • Figure 10 is a comparison of the wild-type let-7 loop, which is 30 nucleotides in length, and a shorter, 12-nucleotide loop based on the wild type let-7 loop.
  • the bolded nucleotides represent those nucleotides deleted from the wild-type let-7 loop to generate the 12 nucleotide Loop 12 (L12) .
  • FIG 11 depicts additional loop sequences tested for knockdown efficiency. These loops (Ll, L2, L3, L4, L5, L6, Lll, and L12) vary in size from 11 to 16 nucleotides.
  • Figure 12 shows the knock-down efficiencies of constructs comprising loop sequences varying in length from 11 to 30 nucleotides. These constructs are synthesized in the context of a GL2 target/guide. The knock-down efficiencies were measured in a transient transfection experiment as described in Example 3.
  • Figure 13A is a schematic illustration of human Let-7 genomic constructs .
  • Figure 13B is a schematic illustration of Let-7-based expression plasmids to replace the RNAs.
  • Figure 14 shows transient transfection of let-7 based expression plasmids on PER.C6/E2A cells, and a comparison of knock-down efficiency of different length loop sequences of let-7 based expression plasmids.
  • Figure 15 is a schematic representation of the reprogrammed let-7 chimeric clones and luciferase-based reporter constructs pGL3-control, or pGL3-tLet-7F, or pGL3-tLet-7R, or pGL2.
  • Figure 16 depicts luciferase reporter levels for the reprogrammed let-7 chimeric clones.
  • Figure 17 depicts northern blots showing the expression of the RNA species derived from the construct pIPspAdapt-Let-7-gGL3 in PER.C6.E2A cells.
  • Figure 18 depicts the expression plasmids containing sequences other than let-7 or GL3 that also express chimeric RNA molecules with the correct length and expected sequence.
  • Figure 19 depicts how the Let-7 promoter is replaced by elements of the human U6 snRNA promoter.
  • the first nucleotide of the transcript is a G and the transcription termination signal is a string of 5 or more Ts.
  • the expressed RNA contains a guide sequence of 19-21 nts (directed against a target) and a sequence able to base pair with the guide sequence connected by a loop sequence.
  • Figure 20 shows northern blots of samples of cells transfected with the U6-based promoter expression adenoviral vectors. The blots show expression of the RNA species and processing into a species of a size comparable to that of endogenous Let-7 RNA. Lane 1 contains uninfected cells, lane 2 contains cells infected with U6 (+1) L12 gLet7 lane 3 contains cells infected with U6 (+1) L13 gLet7.
  • Figure 21 is a comparison of knock-down efficiency of the reporter plasmids with the target Let-7 sequences with different promoters and different loops sequences.
  • the loop L12 (SEQ ID NO: 30) is depicted in Figures 10 and 11.
  • the loop L13 (SEQ ID NO: 66) is 14 nucleotides in length.
  • Figure 22 is a transfection experiment with adenoviral super- infection of Ad-EGFP. Infection of adenovirus had no effect on the knock-down activity obtained by the transiently transfected plasmids under the conditions used in this example .
  • Figure 23 depicts northern blots of samples of cells infected with the adenoviral Let-7 based promoter expression constructs showing expression of the RNA species and processing into a species of a size comparable to that of synthetic siRNAs.
  • Figure 24 shows a knock-down efficiency comparison of two viral U6-promoter based expression constructs with different loop sequences, and the successful knock-down by viral expression constructs.
  • Figure 25A is a schematic representation of the cloning strategy for library construction showing utilization of Sapl sites and an e. coli. death gene.
  • Figure 25B is a schematic representation of the cloning strategy for library construction. Adenoviral vector development for 56 nt inserts.
  • Figure 26 is a schematic representation of the cloning strategy for library construction. Adenoviral vector development for 51 nt inserts.
  • Figure 27 shows the successful knock-down of endogenous GNAS by adenoviral knock-down constructs as measured by real time PCR. The results show that the knock-down effect is dependent on MOI.
  • Figure 28 shows the specificity of the adenoviral knock-down constructs targeted against endogenous GNAS.
  • Figure 29 A-C show the successful knock-down of several endogenous mRNA by adenoviral knock-down constructs as measured by real time PCR. The knock-down effect is dependent on MOI and time.
  • Figure 30 shows the functional knock-down of GNAS.
  • Adenoviral constructs encoding sRNA targeted against GNAS give a specific knock-down of GNAS on the functional level.
  • Chimeric RNA as used herein means an RNA molecule constructed from at least two polynucleotide sequences that covalently linked together and that derived from at least two different RNA molecules that may or may not be in the same or different species.
  • Lethal protein means proteins that may kill the cell in which the protein is produced, if produced in a lethal amount. Lethal proteins include proteins that induce apoptosis, such as Bax, Bcl-Xs, Bad and Bak, Fas, and Caspl, and proteins that inhibit viral replication, inhibit proliferation or inhibit protein synthesis both at the level of transcription or translation. Further specific examples of toxic proteins are full length Tiam, Rac, Rho, and Ras.
  • siRNA as used herein means a double stranded short interfering RNA molecule of no larger than about 23 nucleotides in length.
  • the scientific literature describes siRNA as mediating the sequence specific degradation of a target mRNA.
  • sRNA as used herein means a single or double stranded RNA molecule of less than about 25 nucleotides. sRNA comprises both stRNA and siRNA molecules.
  • stRNA as used herein means a single stranded small temporal RNA molecule that is complementary to a 3' untranslated region in RNA in a host cell.
  • “Stem-loop” as used herein means a single stranded polynucleotide including two sequences of base pairs that complement each other and that permit the formation of a complementing duplex structure in the single-stranded polyribonucleotide, and a non-complementing loop sequence linking said two sequences of base pairs.
  • the complementing base pairs making up the stem portion of the loop consist of at least two, and more preferably at least three base pairs in length.
  • the stem base pair(s) correspond to the complementing sequence of the first and third sequences
  • one or more of the second sequence complementing stem base pairs can double as a first and third sequence complementing base pair. Under these special circumstances, the stem portion of the second sequence would be considered to contain only one complementing base pair, or no complementing base pairs.
  • Target sequence as used herein means a polyribonucleotide sequence present in RNA in a host cell.
  • Transfecting means any way of introducing a nucleic acid into a cell as is known by a person skilled in the art. It includes but is not limited to transduction by e.g. calcium phosphate or liposomes based reagents, infection by e.g. viral vectors, phages, electroporation, via a soaking process, or introduction of the nucleic acid using a physical method like micro-injection or DNA coated particle bombardment .
  • the self-complementing single stranded polynucleotide according to the present invention comprises a first guide sequence and a second sequence capable of forming a stem-loop structure within said second sequence when said second sequence is RNA.
  • a preferred embodiment of the polynucleotide includes a third sequence, which complements the first guide sequence and is covalently linked to the distal end of the second sequence.
  • all nucleotides in said first and third sequences base pair.
  • the preferred self- complementing polynucleotides comprise a second nucleotide sequence that comprises a stem-loop forming region derived from RNA molecules other than mRNA.
  • the present invention provides for either the first or third sequences to be a guide sequence that functions to direct the stRNA, siRNA, sRNA or chimeric RNA encoded by the single stranded polynucleotide to an RNA having a complementary sequence in the host cell system.
  • the first and third polynucleotide sequences have a length consisting of about 17 to about 23 nucleotides, and preferably from about 19 to about 22 nucleotides, and most preferably about 19 or about 21 nucleotides, all of which correspond to a sequence found in a specific RNA.
  • the RNA in the host cell may be a RNA molecule such as mRNA, tRNA, snRNA, rRNA, mtRNA, or structural RNA, or an RNA found in the host cell, which RNA is present as a result of a viral, bacterial or parasitic infection.
  • Preferred RNA molecules are mRNA molecules.
  • the RNA in the host cell may be a known RNA coding for a known RNA molecule or a protein of known function, or may not be known to be associated with any particular protein or cellular function.
  • stem-loop sequences are based on stem-loop regions known to those persons skilled in the art to be present in RNA molecules such as, tRNA, snRNA, rRNA, mtRNA, or structural RNA sequences.
  • RNA molecules such as, tRNA, snRNA, rRNA, mtRNA, or structural RNA sequences.
  • Persons skilled in the art can readily identify stem-loop RNA structures using predictive computer modeling programs such as Mfold (M. Zuker, D.H. Mathews & D.H. Turner Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide In RNA Biochemistry and Biotechnology, 11-43, J. Barciszewski & B.F.C.
  • RNAstructure Mothews, D.H.; Sabina, J. ; Zuker, M.; and Turner, D.H., "expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structures", Journal of Molecular Biology, 1999, 288, 911-940), RNAfold in the Vienna RNA Package (Ivo Hofacker, Institut fur theoretician Chemie, ahringerst . 17,A-1090 Wien, Austria ), Tinoco plot (Tinoco, I. Jr., Uhlenbeck, O.C. & Levine, M.D.
  • RNA stem-loop structures are also found in databases such as the Small RNA Database (Karthika Perumal, Jian Gu, Yahua Chen and Ram Reddy Department of Pharmacology, Baylor College of Medicine, USA) , Database of non-coding RNAs (Erdman VA,
  • 5S ribosomal RNA database (Szymanski M, Barcizewska MZ, Erdman VA, Barciszewski J, "5S ribosomal RNA database” (2002) Nucleic Acid Res. 30: 176-178), The Nucleic Acid Database Project (NDB) at Rutgers University
  • RNA stem-loop sequence which can then be modified to eliminate multiple loop regions to result in a shorter, more easily synthesized stem-loop sequence.
  • More preferred stem loop sequences are derived from the let-7 nucleotide sequence, or some portion thereof, or an artificially generated polynucleotide sequence based thereon
  • Most preferred stem-loop regions consist essentially of a let- 7 sequence found in the host cell or some portion thereof, some other naturally occurring RNA sequence or some portion thereof, or an artificial polynucleotide sequence capable of forming a loop structure when such polynucleotide is RNA.
  • stem loop sequences that are more easily synthesized and handled are prepared.
  • Most preferred stem loop sequences are derived from the let-7 nucleotide sequences.
  • the loop structure is preferably about 4 to about 30 nucleotides in length, a more preferred length is about 4 to about 13 nucleotides, and a most preferred length is about 6 to about 12 nucleotides in length.
  • a special embodiment of loop sequences comprise those artificial sequences based on known RNA loop sequences consisting of about 11 to about 16 nucleotides. Examples of preferred loop sequences are listed in Figures 10 and 11.
  • a particularly preferred polynucleotide of the present invention further comprises a fourth nucleotide sequence consisting essentially of an RNA sequence, a single stranded DNA equivalent thereof, wherein said fourth sequence is covalently linked to a free end of either the first or third sequence, and wherein said RNA sequence is capable of being cleaved enzymatically in the host cell thereby resulting in the in situ preparation of a RNA polynucleotide that has first or third sequences with a free 3' and 5' -end.
  • a further embodiment of the present polynucleotide invention further comprises a fifth nucleotide sequence consisting essentially of an RNA sequence, or a single stranded DNA equivalent thereof, which is covalently linked to a free end of said first or third sequence.
  • the fifth RNA sequence is capable of being cleaved enzymatically in the host cell thereby resulting in the in situ preparation of a RNA polynucleotide that has first and third sequences with a free 3' and 5' -end.
  • Said fourth and fifth nucleotide sequence can be preferably derived from precursor RNAs, such as ribozymes, precursor tRNA, precursor rRNA, precursor microRNAs, RNAs recognized by ribozymes, or RNAs recognized by RNase P.
  • Ribozymes cleave themselves such that a free 3' -or 5' -end at the said first or third nucleotide sequence is produced.
  • ribozymes cleave the RNA sequences recognized by them, thereby producing free 3' -or 5' -end at the said first or third nucleotide sequence.
  • Enzymes present in the host cell process precursor RNAs.
  • Such fourth and fifth nucleotide sequences are preferably designed such that they are cleaved by enzymes present in the host cell.
  • the aforesaid fourth and fifth sequences may also be derived from "overhang” sequences found naturally, such as sequence that extend beyond the complementing portion of RNAs in the " icroRNA” family.
  • MicroRNAs iRNAs
  • iRNAs belong to an expanding class of non-coding RNAs of 21-24 nucleotides with let-7 RNA and lin-4 RNA as founding members.
  • MicroRNA molecules are found in the genomes of a variety of species, including worms, flies, humans and plants, and are typically expressed from approximately 70 nts long hairpin-structured RNA precursors. These hairpin-structured precursors can also exist in a cluster of several precursors.
  • RNA Ribonucleic acid
  • Examples of identified miRNAs are described in Lagos-Quintana, M et al. Science (2001) 294: 853, Lau, et al. Science (2001) 294: 858, Lee and Ambros Science (2001) 294: 862.
  • a most preferred dsDNA polynucleotide according to present invention comprises a fourth sequence that functions to permit the directional cloning thereof into a DNA vector, as described in more detail below.
  • the dsDNA polynucleotide sequences may contain restriction sites at either end that are susceptible for cleavage by one restriction enzyme or two different restriction enzymes to enable efficient cloning.
  • the resulting termini of the dsDNA oligonucleotides preferably have overhanging nucleotide sequences (either 5' or 3' overhanging) that match the vector insertion sites.
  • the dsDNA polynucleotide containing the cleavable restriction sites at the termini can be generated by standard molecular biological techniques, for example, by annealing two complementary ssDNA oligonucleotides.
  • two annealed DNA oligonucleotides, with only restriction sites at their 5' termini can be enzymatically extended at their complementary 3' termini to make the fully complementary double stranded DNA.
  • the person skilled in the art is able to utilize blunt end cloning techniques and PCR to develop alternative routes of synthesis to achieve the directional cloning described herein.
  • the aforesaid fourth and fifth sequences may or may not be transcribed from the DNA sequence present in a DNA vector of the present invention, but may function as part of the upstream promoter or downstream termination signal. Consequently the fourth sequence may incorporate the start signal for RNA polymerase to transcribe, and the fifth sequence comprise a stop signal, such as a multiple "T" sequence, that transcribes into an RNA fifth sequence of multiple "U” nucleotides. Upon transcription the fourth sequence may not be transcribed into RNA except for one to about five, and more preferably one to about three "G" nucleotides .
  • the process of preparing the self-complementing polynucleotide uses an intermediate polynucleotide consisting essentially of a first sequence consisting of about 17 to about 23 nucleotides, said first sequence covalently linked to a second sequence capable of forming a loop structure, wherein said first sequence consists essentially of a RNA sequence, a single stranded DNA equivalent thereof, or a RNA or DNA sequence complementary to said RNA sequence.
  • mRNA sequences that are sequences that code for protein, are a special embodiment of the methods and compositions according to the present invention.
  • the self-complementing single-stranded polynucleotides may be prepared by chemically synthesis.
  • the process of synthesis requires that the target sequence of the RNA be known, an 17 to 23 nt sequence corresponding thereto prepared, and the synthesis continued to add the stem-loop sequence of about 4 to about 30 nucleotides, more preferably, from 6 to about 13 nucleotides.
  • the isolated synthetic polynucleotide may be used to prepare a vector for use as an intermediate in the practice of the present invention, or further lengthened to include the complementing third sequence. In practice, from about two to about five sequences are chosen from a single RNA sequence for the preparation of a corresponding number of self-complementing polynucleotides and vectors containing the same.
  • the present method uses this "redundant" set of self- complementing single stranded polynucleotides and vectors including the same, to determine the optimum choice of RNA sequence that targets only one unique RNA that may exist among a family of RNA having homologous sequence regions.
  • one sequence targeted against multiple RNA targets can be designed when knock-down of more than one RNA target, e.g. RNAs belonging to a family, is desired.
  • Another method of preparing the self-complementing polynucleotide including said third sequence involves treating a single stranded polynucleotide consisting essentially of a first polynucleotide sequence covalently linked to a second polynucleotide sequence that includes two nucleotide sequences capable of complementary base pairing and thereby forming a stem-loop structure and that has a 3' OH terminus, under conditions such that said first sequence serves as a template starting at the 3' OH terminus for the synthesis of a complementary sequence thereto.
  • the polynucleotide produced as a result of the extension reaction using the template or by chemical synthesis comprises a first nucleotide sequence and a third nucleotide sequence covalently linked by a second nucleotide sequence capable of forming a stem-loop structure such that all nucleotides in said first sequence and said third sequences are capable of base pairing with each other.
  • the third sequence complementary to said first sequence is covalently linked to the distal end of said second sequence.
  • said second nucleotide sequence contains at least one nucleotide sequence capable of being cleaved enzymatically.
  • a more preferred embodiment comprises a second sequence have at least two enzymatic cleavage sites.
  • a particularly preferred intermediate polynucleotide comprises a second polynucleotide sequence encoding the stem portion of said stem-loop structure including at least one of said enzymatic cleavage sites.
  • Another special embodiment comprises a polynucleotide intermediate wherein at least one enzymatic cleavage site is at the 5' and/or 3' ends of said second sequence.
  • Enzymatic cleavage sites consist of nucleotide sequences containing at least four to about eight base pairs and are known to persons skilled in the art. Such sequences may add from about two to about twenty additional nucleotides to the length of the second sequence and be substituted for the complementing nucleotides defining the 5' and 3' ends of the loop sequences.
  • Such elongated sequences may consist of from about twelve to about 50 nucleotides.
  • Preferred elongated artificial loop sequences consist of from about ten to about 36 nucleotides.
  • the present invention also relates to vector constructs comprising the self-complementing polynucleotide and a promoter sequence positioned upstream of the first sequence of said polynucleotide.
  • the self-complementing DNA polynucleotide sequence of the present invention may be inserted preferably into a plasmid DNA vector, an adenovirus DNA viral vector, an adeno-associated virus vector, or a herpes vector, and the RNA self-complementing polynucleotide may be inserted into preferably into a retrovirus vector.
  • DNA plasmid vector may be delivered alone or complexed with various vehicles.
  • the DNA, DNA/vehicle complexes, or the recombinant virus particles are locally administered to the site of treatment, as discussed below.
  • recombinant vectors capable of expressing the present polynucleotides are locally delivered as described below, and persist in target cells. Once expressed, the self- complementing RNA molecule is processed and is guided to the endogenous target RNA, where it functions to degrade the target RNA.
  • Preferred promoter sequences include the microRNA promoters such as the let-7 promoter sequences, and the promoters including the pol III promoters and the pol II promoters.
  • the pol III promoters include those promoters selected from the group consisting of 5S rRNA, tRNAs, VA RNAs, Alu RNAs, HI, and U6 small nuclear RNA promoters.
  • the pol II promoters include those such as CMV, RSV, MMLV, tet-inducible, and IPTG- inducible promoters.
  • Promoters that may also be used in the expression vectors of the present invention include both constitutive promoters and regulated (inducible) promoters.
  • the promoters may be prokaryotic or eukaryotic depending on the host.
  • prokaryotic (including bacteriophage) promoters useful for practice of this invention are lad, lacZ, T3, T7, lambda P r , Pi, and trp promoters.
  • eukaryotic (including viral) promoters useful for practice of this invention are ubiquitous promoters (e . g. HPRT, vimentin, actin, tubulin), intermediate filament promoters (e.g.
  • tissue-specific promoters e.g. actin promoter in smooth muscle cells, or Fit and Flk promoters active in endothelial cells
  • animal transcriptional control regions which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift, et al .
  • mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder, et al . (1986) Cell 45:485-95), albumin gene control region which is active in liver (Pinkert, et al . (1987) Genes and Devel . 1:268-76), alpha-fetoprotein gene control region which is active in liver (Krumlauf, et al . (1985) Mol . Cell . Biol . , 5:1639-48; Hammer, et al . (1987) Science 235:53-8), alpha 1-antitrypsin gene control region which is active in the liver (Kelsey, et al .
  • beta-globin gene control region which is active in myeloid cells (Mogram, et al . (1985) Na ture 315:338- 40; Kollias, et al . (1986) Cell 46:89-94), myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead, et al . (1987) Cell 48:703-12), myosin light chain-2 gene control region which is active in skeletal muscle (Sani, (1985) Na ture 314:283-6), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason, et al . (1986) Science 234:1372-8).
  • promoters which may be used in the practice of the invention include promoters which are preferentially activated in dividing cells, promoters which respond to a stimulus (e.g. steroid hormone receptor, retinoic acid receptor) , tetracycline-regulated transcriptional modulators, cytomegalovirus immediate-early, retroviral LTR, metallothionein, SV-40, Ela, and MLP promoters.
  • a stimulus e.g. steroid hormone receptor, retinoic acid receptor
  • tetracycline-regulated transcriptional modulators e.g. steroid hormone receptor, retinoic acid receptor
  • cytomegalovirus immediate-early e.g. steroid hormone receptor, retinoic acid receptor
  • tetracycline-regulated transcriptional modulators e.g. steroid hormone receptor, retinoic acid receptor
  • cytomegalovirus immediate-early e.g. steroid hormone receptor, retinoic acid receptor
  • ssRNA virus recombinant retrovirus
  • dsDNA adenovirus
  • viral packaging systems such as ssDNA viruses, for example, adenovirus-associated virus (AAV)
  • AAV adenovirus-associated virus
  • ssRNA viruses such as, for example, Sindbis virus, HIV, and Semliki Forest viruses
  • dsDNA viruses such as for example, Epstein Barr virus, herpes simplex virus, baculovirus or vaccinia viruses are useful as vector backbone constructs in the present invention.
  • Epstein Barr virus herpes simplex virus
  • baculovirus or vaccinia viruses are useful as vector backbone constructs in the present invention.
  • Each of these systems has a different host range.
  • the polynucleotide is ligated into the multiple cloning site of a Sindbis virus DNA vector, i.e., pSinRepS, operatively linked to the Sindbis subgenomic promoter and polyadenylation site; the polynucleotide replaces the Sindbis virus structural protein genes.
  • pSinRepS Sindbis virus DNA vector
  • the recombinant Sindbis vector encoding the oligonucleotide DNA is linearized, transcribed into RNA and co-transfected into vertebrate (BHK-21, Vero) or invertebrate cells (Drosophila) with RNA transcribed from the helper vector, pDH-BB, that encodes the viral structural proteins.
  • the recombinant Sindbis genomic RNA acts as an mRNA, is translated into the Sindbis virus polymerase, and expresses the sRNA from the subgenomic promoter and the structural proteins from the helper RNA. Because of Sindbis virus' host range, the recombinant Sindbis virus can be packaged and used to express the encoded sRNA in mammalian, avian, reptilian, mosquito and Drosophila cells
  • HSV-1 Herpes Simplex virus type 1
  • Wild type HSV-1 is a human neurotropic virus, making them especially suitable as a vector for gene transfer to the nervous system.
  • non-lytic recombinant HSV-1 has a broad host range.
  • Recombinant HSV-1 viruses can be made replication deficient by deletion of one the immediate-early genes .
  • Retroviruses like murine leukemia virus, are single stranded RNA viruses that are commonly used in the clinical and research area.
  • the major advantage of retroviral gene delivery is their stable integration into target cells.
  • Lentiviruses like human immunodeficiency virus (HIV) , belong to the retrovirus family and have been used as an alternative since lentiviral vectors can infect non-dividing cells as well as dividing cells and integrate with high efficiency (Chang LJ, Gay EE, The molecular genetics of lentiviral vectors—current and future perspectives, Curr Gene Ther. 2001 Sep; 1(3): 237- 51) .
  • Retroviruses can also be used to transduce sRNA.
  • the polynucleotide is cloned into an AAV expression vector.
  • AAV AAV expression vector
  • 293 cells are infected with adenovirus type 5; 4 hours later the infected cells are co-transfected with the AAV expression plasmid-oligonucleotide DNA construct and an AAV helper plasmid, pAAV/Ad (Samulski et al., (1989) J. Virol. 63:3822- 3828).
  • AAV AAV helper plasmid
  • the 293 cells undergo cytopathology, becoming spherical and lose their ability to adhere to a tissue culture surface. Following development of maximal cytopathology the supernatant is harvested and, if necessary, concentrated (Halbert et al . 1997. J. Virol. 71:5932-5941) .
  • vaccinia virus expression a replication competent vaccinia virus can be used.
  • the polynucleotide is operatively linked to a vaccinia virus promoter, for example, P 11.
  • vaccinia virus strain MVA is used because it expresses recombinant genes but contains a deletion that renders it replication incompetent in many mammalian cells. Therefore, the polynucleotide can be expressed in target host mammalian cells without the development of vaccinia virus induced cytopathology.
  • the recombinant vaccinia virus is produced by infecting chicken embryo fibroblasts (CEF) with vaccinia and co-transfecting a transfer vector into which has been ligated the polynucleotide of the invention and a marker gene (beta galactosidase) functionally linked to a vaccinia promoter, such as Pll, and flanked by genomic sequences.
  • CEF chicken embryo fibroblasts
  • a marker gene beta galactosidase
  • the construct is inserted into the vaccinia genome by homologous recombination.
  • Recombinant viruses can be identified by in situ staining for beta-galactosidase expression with X-gal (Wyatt et al. (1995) Virology 210:202-205).
  • Additional vector systems include the non-viral systems that facilitate introduction of DNA encoding the self-complementing single-stranded RNA, or the RNA itself into a patient.
  • a DNA vector encoding a desired sequence can be introduced in vivo by lipofection.
  • Synthetic cationic lipids designed to limit the difficulties encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al . (1987) Proc. Na tl . Acad. Sci . USA 84:7413-7); see Mackey, et al . (1988) Proc . Na tl . Acad. Sci .
  • cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, (1989) Na ture 337:387-8).
  • Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications WO 95/18863 and WO 96/17823, and in U.S. Patent No. 5,459,127.
  • lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages and directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, for example, pancreas, liver, kidney, and the brain.
  • Lipids may be chemically coupled to other molecules for the purpose of targeting.
  • Targeted peptides e.g., hormones or neurotransmitters, and proteins for example, antibodies, or non-peptide molecules could be coupled to liposomes chemically.
  • Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, for example, a cationic oligopeptide ⁇ e . g.
  • the more preferred viral vectors useful in the practice of the present invention are the El-deleted adenoviral vectors, with the El, E2A deleted vectors being most preferred.
  • the more preferred adenoviral vectors include the El-deleted adenoviral serotype 5 vectors, with the El, E2A deleted vectors being most preferred.
  • Vectors may also be prepared from other adenoviral serotypes and corresponding packaging cells that include sequences for viral proteins deleted from such vector backbones.
  • the most preferred adenoviral vector/packaging cell combinations are those combinations where the packaging cell and vector do not include any overlapping adenoviral sequences, which overlap would provide the statistical possibility of the production of replication competent adenoviral particles.
  • Preferred packaging cells useful in the production of such vectors include the 293 and 911 cells, with the most preferred cells being the PER.C6 cell line.
  • the modified PER.C6/E2A cell line is a special embodiment complementing the El, E2A deleted adenoviral vector constructs, with non-overlapping adenoviral El, E2A sequences, and is most preferred in the practice of the present invention.
  • the vectors of the present invention as described herein are also useful in methods of lowering the amounts of RNA or protein translated from RNA in a host cell, or subject, comprising transfecting said cell or subject with a vector that encodes a polynucleotide comprising a promoter operably linked to a first sequence consisting of about 17 to about 23 nucleotides and complementary to about 17 to about 23 nucleotides of said mRNA sequence in said host cell or subject, said first sequence covalently linked to a second sequence capable of forming a loop structure.
  • Preferred vectors according to the present invention comprise the aforesaid first nucleotide sequence and a third nucleotide sequence covalently linked by a second nucleotide sequence capable of forming a stem-loop structure such that all nucleotides in said first sequence and said third sequences are capable of base pairing with each other, and wherein said second nucleotide sequence comprises a stem-loop forming region derived from naturally occurring RNA sequences found in RNA molecules other than mRNA, such as for example, tRNA, snRNA, rRNA, mtRNA, or structural RNA sequences.
  • Preferred stem loop sequences are derived from the let-7 nucleotide sequence, or some portion thereof, or an artificially generated polynucleotide sequence based thereon.
  • the administration of the aforesaid vector to a subject comprises the administration of an amount of vector effective to lower the amounts of said RNA in said transfected cells of said subject .
  • the preferred vector of the present invention including a polynucleotide comprising a promoter operably linked to a sequence of a self-complementing polynucleotide, may be prepared by denaturing the self-complementing polynucleotide, converting the resulting denatured polynucleotide into a double stranded polynucleotide, and ligating the double stranded polynucleotide into a vector capable of transfecting a host cell and transcribing said polynucleotide.
  • the self-complementing polynucleotide may be chemically synthesized as two single stranded polynucleotides, which are capable of being annealed to each other followed by ligation into the vector.
  • the ligation may be accomplished preferably into an adapter plasmid that may be used to form a transfectable viral vector particle by co-transfection with a helper molecule in a packaging cell line.
  • a further embodiment of the vector construct encoding the self-complementing polynucleotide is wherein said second nucleotide sequence contains at least one nucleotide sequence capable of being cleaved enzymatically.
  • a more preferred embodiment comprises a second sequence have at least two enzymatic cleavage sites.
  • said second sequence which can be any length, can be removed by enzymatic cleavage and replaced by a stem-loop sequence.
  • the second nucleotide sequence encodes for a gene useful for the facilitation of cloning stem-loop sequences into the vector.
  • the gene useful for the facilitation of cloning stem-loop sequences into the vector is the E. coli ccdB death gene.
  • the present vectors may be administered to a patient by a variety of methods. They may be added directly to target tissues, complexed with cationic lipids, packaged within liposomes, or delivered to target cells by other methods known in the art. Localized administration to the desired tissues may be done by catheter, infusion pump or stent, with or without incorporation of the self-complementing polynucleotide in biopolymers. Alternative routes of delivery include, but are not limited to, intravenous injection, intramuscular injection, subcutaneous injection, aerosol inhalation, oral
  • tablette or pill form topical, systemic, ocular, intraperitoneal and/or intrathecal delivery.
  • the viral vectors used in the gene therapy methods of the present invention are replication defective.
  • Such replication defective vectors will usually lack at least one region that is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part) , or be rendered non-functional by any technique known to a person skilled in the art. These techniques include the total removal, substitution, partial deletion or addition of one or more bases to an essential (for replication) region. Such techniques may be performed in vi tro (on the isolated DNA) or in si tu, using the techniques of genetic manipulation or by treatment with mutagenic agents.
  • the replication defective virus retains the sequences of its genome that are necessary for encapsidating the viral particles.
  • Retroviral vector systems are integrating viruses that infect dividing cells, and their construction is known in the art. Retroviral vectors can be constructed from different types of retrovirus, such as, MoMuLV ("murine Moloney leukemia virus” MSV ("murine Moloney sarcoma virus"), HaSV ("Harvey sarcoma virus”); SNV ("spleen necrosis virus”); RSV ("Rous sarcoma virus”) and Friend virus.
  • Lentivirus vector systems such as human immunodeficiency virus (HIV) or equine lentivirus may also be used in the practice of the present invention.
  • adeno- associated viruses are utilized.
  • the AAV viruses are DNA viruses of relatively small size that integrate, in a stable and site-specific manner, into the genome of the infected cells. They are able to infect a wide spectrum of cells without inducing any effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies.
  • DNA vectors in vivo can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter ⁇ see, e . g. , Wilson, et al . (1992) J. Biol . Chem . 267:963-7; Wu and Wu, (1988) J. Biol . Chem .
  • the present invention in a particular embodiment, relates to a composition comprising a self-complementing polynucleotide that is used to down-regulate or block the expression of specific polypeptides or specific non-coding RNA molecules.
  • the nucleic acid encodes a self- complementing sRNA molecule covalently linked by a stem-loop RNA sequence.
  • the nucleic acid is operably linked to signals enabling expression of the nucleic acid sequence and is introduced into a cell utilizing, preferably, recombinant vector constructs, which will express the polynucleic acid once the vector is introduced into the cell.
  • suitable vectors include plasmids, adenoviruses, adeno-associated viruses, retroviruses, and herpes viruses.
  • the present invention provides biologically compatible compositions comprising the polynucleotides and/or vectors of the present invention.
  • a biologically compatible composition is a composition, that may be solid, liquid, gel, or other form, in which the polypeptide, polynucleotides, vector, or antibody of the invention is maintained in an active form, e.g., in a form able to effect a biological activity.
  • a nucleic acid would be able to replicate, transcribe, translate a message, or hybridize to a complementary nucleic acid; and a vector would be able to transfect a target cell.
  • a preferred biologically compatible composition is an aqueous solution that is buffered using, e.g., Tris, phosphate, or HEPES buffer, containing salt ions. Usually the concentration of salt ions will be similar to physiological levels.
  • Biologically compatible solutions may include stabilizing agents and preservatives.
  • the biocompatible composition is a pharmaceutically acceptable composition.
  • compositions can be formulated for administration by topical, oral, parenteral, intranasal, subcutaneous, and intraocular, routes.
  • Parenteral administration is meant to include intravenous injection, intramuscular injection, and intraarterial injection or infusion techniques.
  • the composition may be administered parenterally in dosage unit formulations containing standard, well-known nontoxic physiologically acceptable carriers, adjuvants, and vehicles as desired.
  • compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • Pharmaceutical compositions for oral use can be prepared by combining active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethylcellulose, or sodium carboxymethyl-cellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores may be used in conjunction with suitable coatings, such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinyl-pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinyl-pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsuAe-s ⁇ made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • Preferred sterile injectable preparations can be a solution or suspension in a nontoxic parenterally acceptable solvent or diluent.
  • pharmaceutically acceptable carriers are saline, buffered saline, isotonic saline (e.g. monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride, or mixtures of such salts), Ringer's solution, dextrose, water, sterile water, glycerol, ethanol, and combinations thereof.
  • 1, 3-butanediol and sterile fixed oils are conveniently employed as solvents or suspending media. Any bland fixed oil can be employed including synthetic mono- or di-glycerides . Fatty acids such as oleic acid also find use in the preparation of injectables.
  • the composition medium can also be a hydrogel, which is prepared from any biocompatible or non-cytotoxic homo- or hetero-polymer, such as a hydrophilic polyacrylic acid polymer that can act as a drug absorbing sponge. Certain of them, such as, in particular, those obtained from ethylene and/or propylene oxide are commercially available.
  • a hydrogel can be deposited directly onto the surface of the tissue to be treated, for example during surgical intervention.
  • compositions of the present invention comprise a replication defective recombinant viral vector and the polynucleotide identified by the present invention.
  • a special embodiment of the composition invention includes also a transfection enhancer, such as poloxamer.
  • a poloxamer is Poloxamer 407, which is commercially available (BASF, Parsippany, NJ) and is a non-toxic, biocompatible polyol.
  • a poloxamer impregnated with recombinant viruses may be deposited directly on the surface of the tissue to be treated, for example during a surgical intervention. Poloxamer possesses essentially the same advantages as hydrogel while having a lower viscosity.
  • the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • the composition may comprise a cytotoxic agent, cytokine or growth inhibitory agent.
  • cytotoxic agent cytokine or growth inhibitory agent.
  • Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes .
  • the active ingredients of the present invention may also be entrapped in microcapsules prepared, for example, by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-
  • microcapsules respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroe ulsions .
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroe ulsions for example, macroe ulsions.
  • Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly (2-hydroxyethyl-methacrylate) , or poly (vinylalcohol) ) , polylactides (U.S. Patent No. 3,773,919), copolymers of L-glutamic acid and.
  • sustained-release preparations include polyesters, hydrogels (for example, poly (2-hydroxyethyl-methacrylate) , or poly (vinylalcohol) ) , polylactides (U.S. Patent No. 3,773,919), copolymers of L-glutamic acid and.
  • gamma-ethyl-L-glutamate non-degradable ethylene-vinyl acetate
  • degradable lactic acid- glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D- (-) -3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid- glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
  • the present invention provides methods of treatment that comprise the administration to a human or other animal of an effective amount of a composition of the invention.
  • a therapeutically effective dose refers to that amount of the present polynucleotide that ameliorates the symptoms or condition.
  • Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population) .
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
  • Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • the exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect.
  • compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half- life and clearance rate of the particular formulation.
  • recombinant viruses may be used to introduce DNA encoding the self-complementing single stranded polynucleotides, as well as the self-complementing single stranded RNA.
  • Recombinant viruses according to the invention are generally formulated and administered in the form of doses of between about 10 4 and about 10 14 pfu. In the case of AAVs and adenoviruses, doses of from about 10 ⁇ to about 10 11 pfu are preferably used.
  • the term pfu (“plaque-forming unit”) corresponds to the infective power of a suspension of virions and is determined by infecting an appropriate cell culture and measuring the number of plaques formed. The techniques for determining the pfu titre of a viral solution are well documented in the prior art.
  • Al- Self-complementing polynucleotides according to the present invention may be administered in a pharmaceutically acceptable carrier. Dosage levels may be adjusted based on the measured therapeutic efficacy.
  • the self-complementing polynucleotide is synthesized and may be chemically modified to resist degradation by intracellular nucleases.
  • Synthetic oligonucleotides can be introduced to a cell using liposomes. Cellular uptake occurs when an oligonucleotide is encapsulated within a liposome. With an effective delivery system, low, non-toxic concentrations of the polynucleotide molecule can be used to degrade the target RNA.
  • liposomes that are conjugated with cell-specific binding sites may direct a polynucleotide to a particular tissue.
  • the polynucleotide vector is transferred into the target tissue using one of the vector delivery systems herein.
  • This transfer is carried out either ex vivo in a procedure in which the nucleic acid is transferred to cells in the laboratory and the modified cells are then administered to the human or other animal, or in vivo in a procedure in which the nucleic acid is transferred directly to cells within the human or other animal.
  • an adenoviral vector system is used to deliver the expression vector.
  • a tissue specific promoter is utilized in the expression vector as described above .
  • Non-viral vectors may be transferred into cells using any of the methods known in the art, including calcium phosphate co- precipitation, lipofection (synthetic anionic and cationic liposomes), receptor-mediated gene delivery, naked DNA injection, electroporation and bio-ballistic or particle acceleration.
  • the present invention may be used in in vitro validation of drug targets, screening for novel drug targets by knocking down genes in cellular assays, and in animal studies for in vivo target validation development of therapeutics.
  • the subject invention relates also to methods and compositions for the high throughput delivery and expression in a host of guide nucleic acid(s) targeting RNA of known or unknown function.
  • Methods are described for infecting a host with the adenoviral vectors that express the self-complementing RNA molecules including the guide nucleic acid(s) in the host, identifying an altered phenotype induced in the host by the knockdown of the target RNA nucleic acids, and thereby assigning a function to the product (s) encoded by the target nucleic acids.
  • the methods can be fully automated and performed in a multiwell format to allow for convenient high throughput analysis of sample nucleic acid libraries, which samples code for the guide sequences for use in this method.
  • the present invention may be used to prepare libraries of vectors, consisting essentially of the polynucleotide constructs as described herein. These libraries may be prepared as single element, compartmentalized, or discrete elements, wherein each element consists essentially of a vector coding for a unique nucleotide sequence. Alternatively, a library comprising pools of vectors may be prepared.
  • the libraries may be used to assist in the elucidation of the functions of host cell RNA molecules including the unique polynucleotide residing in each compartment of said library, or in other words, determining the function of a naturally occurring polynucleotide sequence comprising transfecting a host cell with a vector according to the invention, said vector including a polynucleotide sequence complementary to a portion of said naturally occurring polynucleotide and detecting a change in cellular phenotype.
  • Each vector in the library may be introduced into one or more cells and changes in protein expression, or phenotype observed.
  • the vectors may comprise plasmids, naked RNA, or included in a viral vector construct.
  • more than one vector thereby introducing more than one guide sequence can be introduced into a single host cell.
  • Preferred viral vectors include the adenoviral, retroviral and AAV-vectors . More preferred are the adenoviral vectors, and most preferred are the adenoviral vectors that comprise a replication deficient construct that may be multiplied in a packaging cell having complementary sequences to the sequence contained in the vector itself.
  • the present invention provides for the temporary knock-down of proteins, such as lethal proteins, during virus production, thereby allowing the replication and packaging of virus that include sequences encoding for lethal proteins.
  • sRNA can be used to knock-down gene expression during viral production with any virus and in any viral packaging cell line. Accordingly, the present invention relates to a method of producing viral vectors encoding a toxic protein comprising
  • a preferred method of the present invention uses viral packaging cells that are stably transfected with said polynucleotide .
  • Viral production using adenovirus retrovirus or alphavirus benefit from such knock down methods, and examples of packaging cells include adenoviral packaging cells, such as PER.C6 cells, and derivatives thereof, HEK293 cells, 293 and 911 cells, among others.
  • adenoviral packaging cells such as PER.C6 cells, and derivatives thereof, HEK293 cells, 293 and 911 cells, among others.
  • sRNA knock-down methodology is useful for improving recombinant protein production.
  • Such protein production methods benefit from the down-modulation of heterologous protein expression prior to achieving the optimal production cell titre for protein production.
  • the present invention may be applied to every viral packaging and protein production system without a need for optimization. Knock-down constructs described herein may be transfected into any selected packaging cell and such transfected cells are used directly.
  • the present invention uses virus constructs that are used directly to infect cells and no further compound is required by the system to induce virus or protein production.
  • sequences between transcription start and the 5' end of the expression cassette that is used to express exogenous genes can be used to knock down the expression of those exogenous genes during virus production.
  • Polynucleotides of the present invention which polynucleotides includes guiding sequences targeted against the sequence between transcription start and the 5' end of the expression cassette, are co- transfected with the viral plasmid (s) carrying the sequence for the toxic protein, into the packaging cells.
  • a vector according to the invention encoding polynucleotides that down-modulate expression of target sequences, either by inhibiting translation or by break down of the mRNA, are used.
  • the vector can be used transiently or used to generate a stable derivative of the packaging cell line .
  • Example 1 A reporter assay system based on let-7 target sequence to monitor repression
  • Example 1 describes development of a reporter assay system that provides a method for measuring knockdown of a readily assayed gene. This system is used to determine if siRNAs and chimeric RNAs can decrease expression of the readily assayed luciferase gene.
  • the system consists of two components. The first component is a reporter DNA molecule based on the pGL3 luciferase reporter vector (available from Promega) , which has been modified to include a let-7 target sequence derived from the human let-7 sequence found on chromosome 22.
  • These reporter constructs are designated as follows: The names start with a ⁇ p' indicating that the construct is in a plasmid, then the name of the reporter gene follows (e.g.
  • pGL3- tLet7 describes a plasmid containing the GL3 gene as reporter and Let7 sequences as target for the knockdown RNA.
  • the second component is a siRNA or a plasmid expressing siRNA or chimeric RNAs.
  • siRNAs are double stranded short interfering RNA molecules no larger than about 23 nucleotides in length.
  • Chimeric RNAs as used herein refer to an RNA molecule constructed from at least two polynucleotide sequences that are covalently linked together and derived from at least two
  • siRNA GL3.1 is a duplex siRNA targeted against the GL3 gene.
  • a reporter construct, a siRNA, and an internal control used to normalize luciferase activity are combined together and used to transfect host cells and the luciferase activity measured. If the siRNA knocks down expression of luciferase mRNA, a reduction of luciferase activity is seen relative to controls.
  • the reporter system is described below. The description is meant only as an example and is in no way limiting to the invention.
  • the reporter system is based on the pGL3 luciferase reporter vector (Promega) .
  • the let-7 target DNA sequence (5'- ACTATACAACCTACTACCTCA-3' SEQ ID NO: SEQ ID NO: 1) is introduced just outside of the GL3 coding region in a pGL3- reporter vector, such that it expresses a GL3 mRNA that contains the let-7 target sequence.
  • A. Construction pGL3-tLet-7 reporter constructs The pGL3-control vector (GenBank Accession Number U47296) is linearized at its unique Xba I site, which is immediately 3' of the GL3 coding sequence.
  • the double stranded let-7 target DNA sequence is generated using complementary DNA oligonucleotides (Oligo 1 and Oligo 2) .
  • Oligo 1 and Oligo 2 are designed such that upon annealing, the double stranded let-7 target DNA thus generated has 5' overhangs on each end that are compatible with an Xba I restriction site.
  • Annealing of Oligo 1 and Oligo 2 is accomplished by mixing the oligos in equimolar amounts to a final concentration of 0.5 n ole/Dl each in annealing buffer [10 mM Tris-HCI (pH 7.9), 10
  • the Let-7 target DNA sequence is SEQ ID NO: SEQ ID NO: 1:
  • the annealed Oligos 1 and 2 give the following double stranded structure : Seal site: (AGTACT)
  • Underlined nucleotides denote the Xba I compatible ends.
  • the cloning of the oligos into the vector results in an extra Sea I site (bolded nucleotides) , which facilitates the selection of clones with the insert and enables the discrimination between clones with an insert in the forward (F) orientation or clones with an insert in the reverse (R) orientation.
  • the original Xba I site from the starting pGL3-control vector is destroyed by the cloning process and thus is absent in the clones with inserts.
  • the clones are tested for presence of the insert by performing PCR on the transformed bacteria directly, using the following primers:
  • A8- OLIGO 3 5'-CATCTTCGACGCAGGTGTCGCA-3' (SEQ ID NO: 4) (position 1668-1689 according to Promega catalog and U47296 sequence)
  • OLIGO 4 5'-CCATCGTTCAGATCCTTATCGA-3' (SEQ ID NO: 5) (position 2210-2189 according to Promega catalog and U47296 sequence)
  • the given positions are based on the pGL3-control vector (Accession number U47296) .
  • PCR products generated from clones without an insert are 543 base pairs; with an insert in either forward (F) or reverse (R) orientation PCR products are 569 base pairs.
  • the orientation of the insert is analyzed further by a second round of PCR using two primer combinations:
  • Oligo 1 SEQ ID NO: 2
  • Oligo 3 SEQ ID NO: SEQ ID NO: 4
  • PCR with let-7 target sequence in R orientation produces a DNA fragment of 297 bp; F orientation will produce no DNA product.
  • Oligo 1 SEQ ID NO: 2
  • Oligo 4 SEQ ID NO: SEQ ID NO: 5
  • PCR with let-7 target sequence in F orientation gives a DNA fragment of 302 bp; R orientation will produce no DNA product.
  • pGL3-tlet-7F The plasmid generated by successful cloning of let-7 target DNA sequences in the forward orientation into the Xba I site of pGL3 will be known as pGL3-tlet-7F.
  • pGL3-tlet-7R the plasmid generated by successful cloning of let-7 target DNA sequences in the reverse orientation into the Xba I site of pGL3 will be known as pGL3-tlet-7R. Both clones pGL3-tlet-7F and pGL3- tlet-7R are used in further experiments.
  • siRNAs siRNAs
  • siRNAs that target pGL3 and pGL2 are as described in Elbashir et al. (2001) Na ture 411:494-498.
  • siRNAs are double stranded RNAs that include the target sequence and its complement. Two uridine residues are added to the 3' end of the RNAs.
  • siRNA-GL2.1- sense 5' -CGUACGCGGAAUACUUCGAUU-3' SEQ ID NO: 7
  • siRNA-GL3.1- sense 5' -CUUACGCUGAGUACUUCGAUU-3' SEQ ID NO: 10.
  • siRNA-let7.1 Let-7 Target DNA Sequence
  • RNA oligo pair is annealed as described in Elbashir et al. (2001) Na ture 411:494-498 in order to obtain the duplexed siRNA.
  • the let-7 targeting system is tested by transfecting a DNA/RNA mixture consisting of three components into host cells (for example HeLa or PER.C6/E2A cells) :
  • Luciferase-based reporter construct a. pGL3-control (Promega), or b. pGL3-tLet-7F, or c. pGL3-tLet-7R
  • siRNA-GL3.1 Duplexed siRNA a. siRNA-GL3.1, or b. siRNA-let-7.1, or c. siRNA-GL2.1 Day 1:
  • HeLa or PER.C6/E2A cells are seeded 20 hrs prior to transfection in 96-well format at 4.5 x 10 4 cells/100 ⁇ l medium (DMEM +10% heat inactivated Fetal Bovine Serum for HeLa cells; DMEM +10% non-heat inactivated Fetal Bovine Serum for PER.C6/E2A cells) /well.
  • siRNA-GL3 . 1 3 . 66 . 5 ng siRNA-GL3 . 1 , or
  • siRNA-let-7.1 66.5 ng siRNA-let-7.1, or 66.5 ng siRNA-GL2.1, or no siRNA
  • LipofectAMINE2000 (0.8 ⁇ l) and OptiMEM (24.2 ⁇ l) are incubated for 7-10 minutes at room temperature and added to each DNA/RNA mixture. This mixture (final volume 50 ⁇ l) is incubated for 15-25 minutes at room temperature and subsequently added to the cells from which the medium has been removed. The cells are incubated for 48 hrs in a 37°C incubator under 10% C0 2 .
  • the cells are harvested, lysed, and firefly luciferase and renilla luciferase activities measured using the Dual Luciferase kit (Promega) according to the manufacturer's instructions.
  • the absolute firefly luciferase value (luc) of each sample is divided by its internal absolute renilla luciferase value (ren) to obtain the relative luc/ren-value. These relative luc/ren-values are compared to the control sample where no siRNA is included.
  • FIG. 1 The results of transient transfection on PER.C6/E2A are shown in Figure 1. It shows the repression of luciferase activity of pGL3-fusion constructs containing let-7 target sequences by let-7 siRNAs in PER.C6/E2A cells.
  • PER.C6/E2A cells are transiently transfected with the pGL3-fusion constructs containing let-7 target sequences in either orientation (pGL3- tLet-7F, pGL3-tLet-7R) or pGL3-control lacking let-7 sequences, in combination with each of the siRNA duplexes siRNA GL3.1, siRNA let-7.1, siRNA GL2.1, or no siRNA.
  • Co-transfection of siRNA let-7.1 specifically represses luciferase activity of the reporters pGL3-tLet7F and pGL3- tLet7R, but not the pGL3-control .
  • Co-transfection of the positive control siRNA GL3.1 shows repression of all the reporter constructs (pGL3-tLet-7F, pGL3-tLet-7R, pGL3- control) .
  • This example describes preparation of let-7-based chimeric RNAs, which are tested for the ability to knock down gene expression in the system described in Example 1.
  • the two complementary RNA strands of the siRNA-duplexes of Example 1 are covalently linked using an RNA loop structure, making a single RNA molecule containing both siRNA strands. This results in a molecule folding into an RNA-duplex with a loop structure on one side of the duplex and a 3' overhang of 2 uridine residues on the other side of the duplex. Molecules containing this loop structure and the sequences are referred to as chimeric RNAs.
  • the constructs are referred to as follows: loop RNA followed by the gene they are targeted against, e.g. loop RNA GL2.2 is a chimeric RNA molecule containing a loop directed against GL2.
  • the extension .2' is to indicate that the RNA contains a loop in contrast to the extension ⁇ .l' used in Example 1 indicating a duplex RNA without a loop structure.
  • the loop structure used here is the let-7 loop and meant as an example and in no way intended to limit to the invention.
  • Such a chimeric RNA molecule is shown below (see also sR- hLet7.2-as below).
  • the complementary RNA regions are shown in uppercase, while the loop region and 3' uridines are shown in lowercase.
  • the loop region is also underlined.
  • RNA molecules During an annealing reaction, the complementary regions of the above chimeric RNA molecule anneal and form a stem-loop as shown below. A siRNA molecule is shown for comparison.
  • chimeric RNAs having 5' and 3' extensions can be generated.
  • the sequence of the 5' and 3' extensions are based upon adjacent let-7L RNA sequence:
  • extension sequences differ from the extensions described by Hutvagner et al. (2001) Science 293:834-838 by one base in order to increase the transcriptional efficiency of T7 RNA Polymerase.
  • a chimeric RNA molecule with 5' and 3' extensions is shown below. The 5' and 3' extensions are bolded.
  • Synthesis of chimeric let-7 siRNAs can be accomplished by in vi tro transcription of the chimeric RNA using T7 RNA Polymerase, as described below.
  • the template for the polymerase is DNA cloned into pUC19.
  • Example 2 cells are transfected by a mixture of DNA and RNA.
  • the RNA component also contains samples with Loop-RNA versions.
  • the DNA/RNA mixture consists of the following components : 1. Luciferase-based DNA reporter construct a. pGL3-control, or b. pGL3-tLet-7F, or c. pGL3-tLet-7R
  • Annealed RNA a. Duplexed siRNA-GL2.1, siRNA (small RNA duplex with overhangs) targeted against GL2, or b. Duplexed siRNA-GL3.1, siRNA (small RNA duplex with overhangs) targeted against GL3, or c. Annealed Loop RNA-GL3.2, siRNA with a connecting loop targeted against GL3 or d. Duplexed siRNA Let 7.1, siRNA (small RNA duplex with overhangs) targeted against Let-7 sequences, or e. Annealed Loop RNA-Let-7.2, siRNA with a connecting loop targeted against Let-7 sequences The luciferase-based reporter constructs and the RNAs are schematically represented in Figure 8.
  • Figure 9 shows down- regulation of the reporters containing the target sequences that corresponds to the sequences of the co-transfected RNAs.
  • the siRNA GL3.1 causes a specific reduction of the expression levels of all reporters since they all carry the target sequence.
  • the siRNA Let-7.1 shows only repression of the reporters pGL3-tLet7F and pGL3- tLet7R, but not of the pGL3-control .
  • the control siRNA GL2.1 shows no significant repression of any reporter construct.
  • RNAs with both strands connected with a loop work as well as the siRNA consisting of two independent strands .
  • the template for RNA Polymerase is double stranded DNA.
  • DNA template is generated by PCR using overlapping oligos that are complementary at their 3' ends.
  • the oligos are shown below.
  • T7-pre-hLet7L.3-F (SEQ ID NO: 19):
  • Pre-hLet7L.3-R (SEQ ID NO: 20): 5'-CGCATGAATT CGCCGGCACT TCAGGTGAG GTAGTAGGTT GTATAGTTAT CCCATAGCAG GGCAGAG-3'
  • the oligonucleotide pairs (T7-pre-hLet7L.3-F with Pre- hLet7L.3-R; T7-pre-GL3.3-F with Pre-GL3.3-R) are mixed in a 1:1 molar ratio to 40 ⁇ M in 50 mM Tris-HCI pH 7.9, 10 mM MgCl 2 , 100 mM NaCl buffer. The mixture is incubated for 5 min at 95 °C, three min at 65 °C and the 3' ends are allowed to anneal by slowly (30 min.) decreasing the temperature to 20°C. In the diagram below, forward (F) oligos are shown in uppercase and reverse (R) oligos are shown in lowercase.
  • extension mixture (40 ⁇ l final volume) consisting of 10 mM Tris-HCI pH 7.5, 5 mM MgCl 2 , 7.5 mM dithiothreitol, 33 ⁇ M of each dNTP, 20 U DNA Polymerase I, Large (Klenow) fragment for 15 minutes at room temperature.
  • the DNA fragments generated by the extension of the oligos are shown in their entirety below.
  • the sequences are given as double stranded DNA; upper strand (uppercase) 5' to 3' ; lower strand (lowercase) 3' to 5' .
  • T7 promoter nts 9-26
  • cloning sites Hind III site (nts 4-9); EcoR I site (nts 119-124); restriction site for linearization Cac8I or Nae I (nts 113- 118) .
  • PCR products are digested with Hind III and EcoR I and cloned into pUCl9 digested with the same enzymes using published methods (Sambrook et al.)
  • the templates are linearized with Cac8I or Nae I and used for in vitro transcription with T7 RNA Polymerase (Promega) according to the manufacturer's instructions. Afterwards the template DNA is removed with DNase (Promega) according to the manufacturer's instructions.
  • the in vi tro synthesized RNA is self-annealed using the same annealing protocol as for the siRNA oligo-mixtures in Example 1. Transfections are performed as described in Example 1, except that the self-annealed RNA replaces the siRNA used in Example 1.
  • the linear sequences of the chimeric RNAs generated using this method are shown below along with a stem-loop representation of each chimeric RNA.
  • the uppercase sequences are the regions that are able to basepair within the RNA, one of the sequences is able to anneal to the target sequence; in these cases, the first uppercase region.
  • RNA molecules are composed as follows: ⁇ s' stands for siRNA, ⁇ R' stands for RNA, and ⁇ h' indicates human sequence. Whenever Pre is present in the name it indicates that the molecules contains 5'- and 3'- extensions .
  • let-7 siRNAs connected by the let-7 loop and containing 5' and 3' extensions are connected by the let-7 loop and containing 5' and 3' extensions:
  • the uppercase sequences are the regions of complementarity within the RNA molecule, one of the sequences is able to base pair with the target sequence; in these cases, the first uppercase region.
  • RNAs sR-hLet7.2-as and sR-GL3.2-as are chemically synthesized, and can also be generated using the above procedure .
  • the size of the wild type Let-7 connecting loop is 30 nts (5'-GUUUGGGGCUCUGCCCUGCUAUGGGAUAAC-3' _£SEQ ID NO: 75).
  • the size of the oligo is preferably not too long to make efficient oligo synthesis possible.
  • the loop sequence is 30 nt and can be shortened (see Figure 10 and Figure 11) .
  • Different loop sequences are selected, based on the wild type Let-7 loop sequence or other microRNA loop sequences (Lagos- Quintana, M et al. Science (2001) 294: 853, Lau, et al. Science (2001) 294: 858, Lee and Ambros Science (2001) 294: 862
  • the selected derivatives of the Let-7 loop are based on the predicted secondary folding of the Let-7 loop.
  • Two stable structures of the Let-7 loop are predicted (see SEQ ID NOS: 35 to 41, and 45 below) .
  • the bulging 12 nucleotides and the predicted GGG/CCC stem in the loop are deleted in structure 2 resulting in loop L12, (SEQ ID NO: 30) (see also Figure 10 and Figure 11) .
  • Deleting the UGGG/CCUG part of the predicted stem and the bulged nucleotides in the loop in structure 1 results in loop Lll (SEQ ID NO: 31) .
  • the selected loops of the micro RNAs are chosen since they are shorter and have the same organization of 5' -guide-loop- basepairing sequence-3' as the Let-7 RNA. Loops of microRNAs with the reverse organization, 5'- basepairing sequence-loop- guide-3' , might also be functional. Constructs are synthesized in the context of a GL2 guide sequence using PCR as described above and their knock-down efficiencies on GL2 reporter are measured in a transient transfection experiment as described in Example 3 and compared to the wild type Let-7 loop ( Figure 12) . All loops show knock-down effects, which are specific for GL2 and do not effect GL3 reporter. Loop sequences as short as 12 nucleotides (e.g. L12) still specifically knock-down the GL2 reporter.
  • 12 nucleotides e.g. L12
  • This example describes a DNA expression construct producing siRNA, and the identification and cloning of the human let-7 promoter and human let-7 genomic sequence in a DNA vector.
  • the let-7 promoter is used in the expression construct to produce siRNAs.
  • other promoters can be used as well. Included in this Example are:
  • a DNA database search using let-7 guide sequence as a probe results in three perfect matches on the human genome, on chromosomes 9, 11, and 22, and five near perfect matches on chromosomes 9, 21, X, 19 and 5 (see also Pasquinelli et al. (2000) Na ture 408:86-89):
  • RNA structures are predicted that fold into RNA duplex structures similar to let-7 RNA (schematically shown below) .
  • Figure 2 the potential structure is divided into the segments: 5' extension, let-7- antisense, loop, let7-sense, and 3' extension. The let-7- antisense sequence is underlined.
  • the endogenous promoter for let-7 is cloned using PCR on human genomic DNA. Primers are designed for all three genomic locations flanking the let-7 sequences (e.g., 5'- TGAGGTAGTAGGTTGTATAGT-3' SEQ ID NO: 32) . Two different reverse primers, which anneal 3' of the 3' let-7 extension sequence, are utilized. In addition, three different forward primers, which anneal 5' of the 5' let-7 extension, are used. In order to ensure that a fully functional, but yet minimal let-7 promoter is identified, the three forward primers anneal at different distances upstream from the let-7 transcription initiation site. The following examples use the sequences derived from chromosome 22. Similarly, the sequences from the other chromosomes can be used. The primers for chromosome 22 are listed below. Oligonucleotides (5' to 3' ) for location
  • Hs22_11680 Homo sapiens chromosome 22:
  • pIPspAdapt6-deltaPolyA was constructed from pIPspAdapt ⁇ as follows. pIPspAdapt6 was grown in the methylase negative E. coli strain DM1 to prevent methylation of the second Xba-site. The DNA was isolated and digested with Xba I, thereby excising a 142 bp fragment containing the poly A signal. The religated vector is called pIPspAdapt ⁇ -deltaPolyA.
  • Let7gene22A-F are transfected into mammalian cells (as described in Example 1) and tested for expression of let-7 RNA and its effect on repressing pGL3-tlet7. This is done by different means: Repression of luciferase activity from pGL3-tLet7-F, or pGL3- tLet7-R reporter.
  • Let7gene22A, Let7gene22B, and Let7gene22C represent different lengths of the genomic sequences of the Let7 gene on chromosome 22. These fragments are cloned into pIPspAdapt ⁇ -deltaPolyA plasmids. Reporter constructs are used to test the Let-7 expression plasmids Let7gene22A, Let7gene22B, Let7gene22C in an experiment similar to Example 1, but with the following deviation:
  • the Let-7-based expression plasmids replace the RNAs, as schematically illustrated in Figure 13A-B.
  • the DNA mixture consisting of the following three components is transfected into host cells (for example HeLa or PER.C6/E2A cells) : 4. Luciferase-based reporter construct a. pGL3-control (Promega), or b. pGL3-tLet-7F, or c. pGL3-tLet-7R
  • Let-7 based expression constructs a. pIPspAdapt-Let-7gene A (containing fragment Let7gene22A) , or b. pIPspAdapt-Let-7gene B (containing fragment Let7gene22B) , or c. pIPspAdapt-Let-7gene C (containing fragment Let7gene22C)
  • HeLa or PER.C6/E2A cells are seeded 20 hrs prior to transfection in 96-well format at 4.5 x 10 4 cells/100 ⁇ l medium (DMEM +10% heat inactivated Fetal Bovine Serum for HeLa cells; DMEM +10% non-heat inactivated Fetal Bovine Serum for PER.C6/E2A cells) /well.
  • DNA mixtures are prepared in 25 ⁇ l (total volume)
  • LipofectAMINE2000 (0.8 ⁇ l) and OptiMEM (24.2 ⁇ l) are incubated for 7-10 minutes at room temperature and added to each DNA mixture. This mixture (final volume 50 ⁇ l) is incubated for 15-25 minutes at room temperature and subsequently added to the cells from which the medium has been removed. The cells are incubated for 48 hrs in a 37°C (HeLa) or 39°C (Per.C6/E2A) incubator under 10% C0 2 .
  • HeLa 37°C
  • Per.C6/E2A 39°C
  • the cells are harvested, lysed, and firefly luciferase and renilla luciferase activities measured using the Dual Luciferase kit (Promega) according to the manufacturer's instructions.
  • the absolute firefly luciferase value of each sample is divided by its internal absolute renilla luciferase value to obtain the relative luc/ren-value. These relative luc/ren-values are compared to the control sample where no or non-related plasmid is used.
  • the results of the transient transfection on PER.C6/E2A cells are shown in Figure 14.
  • RNA levels of GL3 luciferase are measured for sequence specific degradation using Taqman PCR (PE Applied Biosystems) according to the manufacturer's instructions.
  • RNA is isolated using TRIzol Reagent (Life Technologies) , according to the manufacturer's protocol, followed by DNase treatment using 0.1 U/ ⁇ l RQ1 RNase (DNase free; Promega) for 20 min at 37 °C.
  • a single tube reaction is performed for the cDNA synthesis and the subsequent Taqman PCR reaction containing 100 ng total RNA in a total volume of 25 ⁇ l consisting of Ix TaqMan buffer A (PE Applied Biosystems), 5 mM MgCl 2 , 300 ⁇ M total dNTPs, 300 nM luc-1-For, 300 nM luc-1-Rev, ' 150 nM luc-1-probe, 0.025 U/ ⁇ l AmpliTaq Gold, 0.1 U/ ⁇ l RNase Inhibitor, and 0.25 U/ ⁇ l MultiScribe Reverse Transcriptase.
  • the Taqman analysis is performed on an ABI Prism 7700 Sequence Detector apparatus.
  • the plasmid constructs containing Let7gene22A-F are transfected into mammalian cells and harvested for RNA isolation.
  • the RNA is analyzed by Northern blotting for let-7 RNA expression as described in Pasquinelli et al . (2000) Na ture 408:86-89.
  • reprogramming refers to the replacement of let-7 guide sequences with guide sequences based upon some other RNA sequence.
  • the GL3 sequence is used in this example.
  • the reprogrammed constructs are made by removing the let-7 guide sequence and its complement and replacing them with GL3 guide sequence and its complement.
  • Such a reprogrammed chimeric RNA would target RNA containing the GL3 target sequence as opposed to RNAs containing the let-7 target sequence.
  • These constructs are based on the plasmids having the Let7gene22A-F fragments .
  • the new guide sequence and a sequence able to basepair with the guide sequence are introduced into the constructs using PCR.
  • a GL3 sequence is introduced; two primers consisting of a forward (Let-7.N19-F4) and reverse primer (Let-7.N19-R4) are designed anti-parallel and pointing away from each other, each containing let-7 sequences at their 3' end, the new target sequence internally (N19) , and let-7 loop sequences at their 5' end.
  • the 5' sequences of the primers are complementary for 14 bases.
  • N19 is the target sequence of interest; for GL3 the N19 is:
  • new guide sequences and sequences that can base pair with the guide sequences are introduced into the construct pIPspAdapt-Let-7gene C using PCR with a similar strategy as described in Example 3A.
  • the new N19 guide sequences are:
  • the clones generated have the names: plasmid_name- promoter_name-guide sequence, e.g., pIPspAdapt-Let-7-gLet7- 100%, pIPspAdapt-Let-7-gGL3, pIPspAdapt-Let-7-gGL2, and pIPspAdapt-Let-7-gEGFP, respectively.
  • the g' before the guide sequence is introduced to differentiate promoter sequences (e.g. let-7) from guide sequences (e.g. gLet-7)
  • the Let-7 target and guide sequences are made 100% complementary in the clone pIPspAdapt-Let-7-gLet7-100% to enable complete base pairing in this region within the RNA.
  • the natural let-7 RNA is not 100% complementary in this region; it contains 2 non-canonical base pairs (G-U base pairs) and a bulged-out U.
  • the activity of the clones is tested as described above in the luciferase reporter assay, using luciferase-based reporter constructs (pGL3-control, or pGL3-tLet-7F, or pGL3-tLet-7R, or pGL2) .
  • luciferase-based reporter constructs pGL3-control, or pGL3-tLet-7F, or pGL3-tLet-7R, or pGL2
  • plasmid pIPspAdapt-Let-7-gLet-7-100% shows reduction of pGL3-tLet-7-F
  • plasmid pIPspAdapt-Let-7-gGL3 shows reduction of all three reporters containing the GL3 target sequence (pGL3-control, pGL3-tLet-7F, pGL3-tLet-7R)
  • plasmid pIPspAdapt-Let-7-gGL2 shows reduction of only the pGL2 reporter. No non-specific effects are observed, also confirmed by the plasmid pIPspAdapt-Let-7-gEGFP, which did not repress expression of any of the reporters.
  • RNA is transcribed from the DNA expression constructs
  • expression analysis is performed using Northern blotting.
  • Cells are transfected with the chimeric expression DNA constructs and analyzed by Northern blotting, exemplified as follows:
  • HeLa, U20S, PER.C6/E2A cells are seeded 24 hrs prior to transfection in 6-well format at 30 x 10 4 cells in 2 ml medium per well. For infection experiments 15 x 10 4 cells in 2 ml medium per well is used. (DMEM +10% heat inactivated Fetal Bovine Serum for HeLa cells and U20S cells; DMEM +10% non-heat inactivated Fetal Bovine Serum +10 mM MgCl2 for PER.C6/E2A cells) /well. Day 2 :
  • LipofectAMINE2000 (4 ⁇ l) and OptiMEM (246 ⁇ l) are incubated for 7-10 minutes at room temperature and added to each DNA mixture. This mixture (final volume 500 ⁇ l/well) is incubated for 15-25 minutes at room temperature and subsequently added to the cells. The cells are incubated for 24, 48, or 72 hrs in a 37°C incubator under 10% C0 2 .
  • the cells are harvested using TriZol (Invitrogen) according to the manufacturer's descriptions. Briefly, cells are washed with 1-2 ml PBS, and lysed in 1 ml TriZol. Samples of 6 wells are pooled and glycogen is added to 50 ug/ml . Chloroform is added (0.2 ml per ml TriZol used). The samples are vortexed, incubated for 5 min., spun at 9300 g for 15 min. The aqueous phase is transferred to a fresh tube. Isopropanol (0.5 ml per ml TriZol) is added and spun at 7500 g for 5 min. Pellet is washed with 80% ethanol, and dissolved in RNase-free water. The concentration of the RNA samples is determined by UV absorption (A260) or by RiboGreen (Molecular Probes) measurement using the manufacturer's descriptions.
  • RNA is prepared for gel analysis.
  • the RNAs are mixed with the denaturing loading dye (TBE Urea sample buffer; Biorad) ) and denatured by heating for 3 minutes at 90°C just before loading onto the 15% polyacrylamide IxTBE- gel (Biorad) .
  • the gel is run for 50 min at 200 V.
  • the gel is blotted onto Hybond N+ filter (Amersham) using the Transblot semi-dry Electroblotter (Biorad) for 30 min. at 0.2 A/blot with a maximum of 25 V.
  • the blotted filter is hybridized with a probe using the Rapid Hyb solution (Amersham) according to the manufacturer's descriptions.
  • the probes are made by 5' end labeling using standard procedures with [ 32 P]D-ATP of the oligonucleotides complementary to the guide sequences.
  • FIG 17 the expression of the RNA species derived from the construct pIPspAdapt-Let-7-gGL3 is shown.
  • Northern blots of RNA preparations of PER.C6.E2A cells transfected with Let- 7-based expression constructs are hybridized with a 32 P-end labelled probe recognizing the GL3 guiding sequences (GL3 probe sequence: 5' -CTTACGCTGAGTACTTCGA-3' SEQ ID NO: 9).
  • the processed RNA species co-migrates with the synthetic GL3 siRNA duplex (21 nts) that has been loaded as a size marker. No signal is detectable in control samples with unrelated sequences .
  • PPAR gamma (ace. Number NM_005037; nts 173-191;
  • IGF2R (ace. Number NM_000876; nts 510-528;
  • Figure 18 shows that expression plasmids containing sequences other than let-7 or GL3 also express chimeric RNA molecules with the correct length and expected sequence.
  • Example 4 RNA polymerase III promoter-based expression
  • the expression of the chimeric RNAs are dependent upon the activity of the let-7 promoter.
  • the let-7 promoter is replaced with a heterologous promoter to be used for chimeric RNA expression.
  • the preferred promoter is ubiquitously active. This example describes the cloning of the constructs from Example 3 into a vector containing a ubiquitously active promoter, in particular, a promoter recognized by RNA polymerase III (pol III promoter) .
  • pol III promoters endogenously produce various small, structured RNAs, e.g.: 5S rRNA, tRNAs, VA RNAs, Alu RNAs, HI, and U6 small nuclear RNA.
  • suitable promoters include CMV, RSV, MMLV, tet-inducible, and IPTG-inducible promoters.
  • Pol III promoters are frequently chosen for expression of therapeutic antisense RNAs or ribozyme RNAs (Medina and Joshi (1999)). The pol III promoters from Medina and Joshi are used to determine the appropriate promoter for transcription of siRNAs, stRNAs and chimeric RNAs.
  • siRNA stRNAs and chimeric RNAs using expression constructs based on pol III promoters.
  • An example of this approach is a fusion of a siRNA to the 3' end of a tRNA transcribed from a pol III promoter.
  • the siRNA consists of either an stRNA sequence or a chimeric RNA, which consists of a guide sequence connected via a loop structure to the complementary guide sequence. The relative order of guide sequence and complementary guide sequence can be reversed.
  • the loop structure may be derived from the let-7 loop derived from C. elegans, drosophila, or human origin, such as found on chromosomes 9, 11 and 22.
  • the chimeric RNA molecule is processed by the endogenous cellular processing machinery; for example, an siRNA moiety fused to the 3' end of a tRNA would be processed by endogenous molecules including tRNA 3' processing endoribonuclease, thereby releasing the siRNA moiety.
  • the site for cleavage can also artificially be introduced, e.g. a ribozyme target sequence in combination with introduction of the cognate ribozyme.
  • the activity of the promoter is artificially adapted to obtain an inducible pol III expression system. For example, as described in Meissner et al. (2001) Nuc Acids Res 29:1672- 1682.
  • the Let-7 promoter is replaced by a R ⁇ A polymerase III promoter.
  • the Let-7 promoter is replaced by elements of the human U6 snR ⁇ A promoter.
  • Figure 19 For efficient promoter activity the first nucleotide of the transcript is a G and the transcription termination signal is a string of 5 or more Ts.
  • the expressed R ⁇ A contains a guide sequence of 19-21 nts (directed against a target) and a sequence able to basepair with the guide sequence connected by a loop sequence.
  • the genomic human U6 gene (Accession number M14486) is cloned by a PCR based strategy using human genomic D ⁇ A.
  • the region to be cloned starts at nucleotide -265 upstream of the transcription start site until nucleotide +198 downstream of the transcription start site.
  • the primers used are:
  • the transcribed U6 snRNA sequence is replaced from nt +2 to nt +102 by an RNA sequence capable of down-regulating target sequences.
  • These RNA sequences preferably contain a guiding sequence, connecting loop, and sequence able to basepair with the guiding sequence, using an assembly PCR strategy, similar to the strategy for replacing the guide/target sequences of the Let-7 genes (see Example 3 above) .
  • the first 5' G-nucleotide and the 3' termination signal UUUUU are kept intact.
  • the target sequence directed against the pGL3- tLet-7 reporters is used.
  • the guide sequence described for the Let-7 based promoter (TGAGGTAGTAGGTTGTATA, SEQ ID NO: 58) is shifted 1 nucleotide compared to the guide sequence for the U6-based promoter (GAGGTAGTAGGTTGTATAG; SEQ ID NO: 59) in order to obtain a G-nucleotide at position 1 in the U6 context. Transcription is much more effective if the starting nucleotide is a G.
  • the guide sequence used is completely complementary to the target sequence.
  • pIPspAdapt-U6 (+1) -Ll2-glet7 is a pIPspAdapt plasmid with a U6(+l) promoter followed by a let7 guiding sequence and containing the L12 loop sequence (SEQ ID NO: 30) .
  • GJA 142 (SEQ ID NO: 61)
  • pIPspAdapt-U6 (+1) -L13-glet7 is a pIPspAdapt plasmid with a U6(+l) promoter followed by a let7 guiding sequence and containing the L13 loop sequence (SEQ ID NO: 66) .
  • GJA143 (SEQ ID NO: 63) 5' -GTTGTGCTATCAACTATACAACCTACTACTTTTTACATCAGGTTG-3'
  • RNA sequence (guide underlined) :
  • the RNA sequence starts with 5'-G(G/A) (G/A) to enable base pairing with the 3' terminus of the RNA (...UUUU-3' ) .
  • the underlined Us do basepair with the extreme 5' end of the RNA. This results in a 2 nts overhang at the 3' end. Constructs that do not have G(G/A) (G/A) as starting sequence are also possible; they have 5 nts overhang at the 3' end (see below) .
  • hU6(-265)-Fl-XbaI (SEQ ID NO: 56) 5' -GcacgTTCTAGAAGGTCGGGCAGGAAGAGGGCCT-3'
  • U6-R2 GJA 142 (SEQ ID NO: 61)
  • U6-F2 GJA 141: (SEQ ID NO: 60) 5' -GTTTGCTATAACTATACAACCTACTACTTTTTACATCAGGTTG-3' hU6(+198)-Rl-HindIII (SEQ ID NO: 57)'
  • Two primers consisting of a forward (U6 -F2/GJA141, SEQ ID NO: 60) and reverse primer (U6 -R2/GJA142, SEQ ID NO: 61) are designed anti-parallel and pointing away from each other, each containing U6 sequences at their 3' end, the new target sequence internally (N19) , and connecting loop sequences at their 5' end.
  • the 5' sequences of the primers are complementary for 12 bases.
  • the obtained left fragment' and ⁇ right fragment' are gel isolated and combined in a one to one ratio to be the template in the subsequent assembly PCR reaction with the outside primers .
  • PCR products obtained from this step are cloned into pIPspAdapt ⁇ -deltaPolyA using the same strategy as described for the Let7gene22A-F fragments (Example 3) .
  • the obtained plasmids are tested in the reporter system described in Examples 1 to 3.
  • the experiment is performed similarly as described in Example 3 for the Let-7 based plasmids, but in this example these plasmids are replaced by the U6-promoter based plasmids (pIPspAdapt-U6 (+1) - glet7-L12 and pIPspAdapt-U6(+l) - glet7-L13)
  • Northern blots of samples of cells transfected with the U6- based promoter expression plasmids show expression of the RNA species and processing into a species of a size comparable to that of synthetic siRNAs.
  • PER.C6/E2A cells which do not complement E2A deleted adenovectors, are transfected with either siRNA or expression plasmids as described previously in Examples 2 and 3, but with one deviation: 20-24hrs prior to transfection the cells are infected with adenovirus.
  • the viruses which cannot replicate in these cells, express EGFP so it can be determined that the transduction efficiency is over 90% using an MOI of 3. Different viral backbones are tested. (See EP 1191105)
  • the reporter genes with the promoters of the plasmids pGL3- control, pGL3-tLet-7F, pGL3-tLet-7R, and pRL-TK have been recloned into the pIPspAdapt ⁇ -deltapolyA-construct in order to be able to generate adenoviral variants of the reporters.
  • Standard recloning procedures are performed using the following restriction-sites: Hindlll and BamHI for the fragments of pGL3-control, pGL3-tLet-7F, and pGL3-tLet-7R; Bglll (blunt) and BamHI for the fragment of pRL-TK cloned in AvrlI (blunt) /BamHI of the vector pIPspAdapt6.
  • the pIPspAdapt versions of the constructs are tested for functionality in a transient transfection experiment and appear to be active as a plasmid.
  • AdGL3-tLet-7F is an adenovirus with the GL3 reporter gene and the Let-7 target sequence in forward orientation.
  • a co-infection experiment is performed with a combination of adenoviruses containing:
  • U6 promoter-based expression construct e.g. Ad-U6(+1)- L12-gLet-7)
  • the infected cells are HeLa or U20S.
  • the HeLa cells or U20S cells are pre-infected at MOI 1500 for the luciferase reporter constructs together with the internal control (AdRL-TK) at MOI 500. After 4 hours the U6 promoter- based expression constructs are added at MOI 3000 or 8000. These viruses are crude lysates (US 6,340,595). The cells are harvested at 24, 48 and 72 hours post-infection. Northern blots are made to measure the expression level of the knockdown RNA molecules
  • the luciferase activity is measured using the Dual Luciferase Kit as described above. The results are shown in Figure 24.
  • Two U6-promoter based expression constructs with different loop sequences are tested. Both U6 promoter-based expression constructs show a clear sequence specific knock-down of the reporter' virus AdGL3-tLet-7F that contains the Let7 target sequence. No significant repression is seen for AdGL3-virus lacking the let-7 target sequence. This clearly shows that U6- based viral expression constructs have knock-down activity.
  • the expression construct contains a pol III promoter (more preferably an U6-based promoter) , preferably followed by the 19-21 nucleotides guiding sequence (e.g. gGL3 or gLet7) , preferably followed by a connecting loop sequence (e.g. L12 or L13) , preferably followed by a 19-21 nucleotides sequence that is able to base pair with the guiding sequence at the RNA level, followed by a pol III transcription termination signal consisting preferably of 5 or more T residues .
  • a pol III promoter more preferably an U6-based promoter
  • the 19-21 nucleotides guiding sequence e.g. gGL3 or gLet7
  • a connecting loop sequence e.g. L12 or L13
  • the first nucleotide of the transcript is preferably a G nucleotide.
  • This G nucleotide can be the first nucleotide of the guide sequence.
  • an internal sequence of more than 5 T- or A residues should be avoided since this will cause premature transcription termination by pol III.
  • the loop sequence can be L12 : 5' -GUUUGCUAUAAC-3' (SEQ ID NO: 30); or L13: 5'-GUUGUGCUAUCAAC-3' (SEQ ID NO: 66); or another connecting sequence (see for example the data described in Example 2) .
  • the sequence downstream of the connecting loop can base pair with the guiding sequence.
  • the termination signal consisting of 5 U-residues at the 3' terminus in the transcript can be made partially complementary to the 5' terminus of the guiding sequence in such a manner that the transcript is predicted to fold into a duplexed structure having at the 3' terminus an overhang of 2-4 nucleotides.
  • the starting nucleotides of the guiding sequence have to be at position 1 (G) , at position 2 (G or A) , at position 3 (G or A) (see also above) .
  • the sequence downstream of the connecting loop is made complementary to the guiding sequence.
  • the stretch of 3' terminal Us form the overhang.
  • the 19-21 nt guiding sequence is a sequence able to base pair to the target sequence in the target gene.
  • the order of the RNA sections is, going from 5' to 3' : guide sequence, connecting loop, sequence able to base pair with the guide sequence. However this order can be reversed to produce (5' to 3'): sequence able to base pair with the guide sequence, connecting loop, guide sequence. Constructs based on GL2.2 guides in reverse order as described above show efficient expression and processing to RNAs of approx. 21 nts on Northern blots.
  • RNA sequence For knock-down of endogenous RNAs, a sequence of about 17 to about 22 nucleotides is selected corresponding to the target RNA. Multiple sequences from a target mRNA can be selected in order to identify a target sequence that is specific for a particular mRNA. Sequence alignments with other mRNA sequences that have high homology to the target mRNA are utilized to identify those regions of the target mRNA that are unique. Alternatively, if the goal is to knock-down the expression of more than one mRNA, a sequence alignment can be used to identify those regions of high homology to other genes. A target sequence selected from a region of high homology would knock-down all mRNAs comprising that sequence.
  • GNAS gene (NM_000516) is taken as an example but is not limited to the invention as other RNAs can be knocked down using this method.
  • U6-promoter based construct is generated containing a GNAS target sequence (e.g. 5' -CGATGTGACTGCCATCATC-3' (SEQ ID NO: 80).
  • the generation of the construct can be performed e.g. by using PCR-based methods as described in example 4 or using direct cloning of oligonucleotides as in example 11 or any technique known to someone skilled in the art.
  • Ad-U6 (+1) -gGNAS are obtained by methods as described previously (US 6,340,595, US 6,413,776). After introduction into vertebrate cells, RNA is transcribed from the vector with the following predicted sequence :
  • the expression levels of the GNAS mRNA are analyzed by real time PCR analysis as well as by Northern blotting (See figures 27 and 28) .
  • detection can be performed e.g. by with SYBR Green or with Taqman probes.
  • SYBR Green detection is performed using standard techniques with the following primers:
  • HPA-03 For TCCCTCCCGAATTCTATGAGC (SEQ ID NO: 82) HPA-03 Rev GGCACAGTCAATCAGCTGGTAC (SEQ ID NO: 83)
  • additional endogenous genes are selected to demonstrate sequence-specific reduction of the mRNA after viral infection with knock-down viral constructs according to the present invention.
  • the selected genes and the selected sequences that are targeted are identified below. More than one target sequence is selected for two of these genes.
  • IKK beta -2 AGAAUCAUCCAUCGGGAUC (SEQ ID NO: 85)
  • Adenoviruses are produced as described above. U20S cells are infected with MOI 300, 1000 and 3000, and harvested after 24, 48 and 144 hrs post infection. The expression levels of the corresponding mRNAs are determined with real time PCR analysis as described above using the following primer combinations:
  • PPAR gamma (NM_005037) : HPA-01 Rev GGAGCGGGTGAAGACTCATG (SEQ ID NO: 91) HPA-01 For ATTGTCACGGAACACGTGCA (SEQ ID NO: 92)
  • HPA-04 For CAGTGGTGATGATCTCCTGCAA (SEQ ID NO: 93)
  • IKK beta (AF080158) :
  • Figures 29 A-C show a specific reduction of the mRNA levels for the tested targets in a MOI and time dependent manner.
  • GNAS
  • GNAS encodes the G ⁇ subunit of G s , a heterotrimeric G-protein ( ⁇ , ⁇ , ⁇ ) .
  • G proteins interact with 7 transmembrane receptors, the so-called G-protein coupled receptor (GPCR) . Binding of a ligand to the GPCR induces a conformational change of the receptor that results in activation of the G-protein.
  • GPCR G-protein coupled receptor
  • the activated G protein will dissociate into its ⁇ subunit and the ⁇ subunit.
  • the a subunit will interact with adenylate cyclase and in turn activate this enzyme.
  • Adenylate cyclase converts ATP into cAMP.
  • cAMP responsive elements CRE
  • CREBP activated cAMP responsive element binding protein
  • PKA Protein Kinase A
  • the following assay is designed to measure the knock-down of GNAS at a functional level.
  • U20S cells are infected with an adenoviral construct encoding a GPCR ( ⁇ 2 adrenergic receptor) that couples to G s (MOI 500) together with an adenoviral reporter construct carrying CRE elements upstream of a luciferase gene (MOI 750) .
  • the infected cells are co-infected with either an adenoviral construct encoding sRNA (SEQ ID NO: 81) targeted against GNAS or an empty virus (MOI 1500) .
  • SEQ ID NO: 81 adenoviral construct encoding sRNA
  • MOI 1500 empty virus
  • forskolin is added to the triply infected cells.
  • Forskolin increases intracellular cAMP levels by direct activation of adenylate cyclase and therefore is independent of G-protein (GNAS) .
  • Figure 30 shows the results of the functional knock-down measurements of GNAS.
  • the luciferase activity in cells infected with the adenoviral GNAS knock-down construct are much lower than the luciferase levels of the cells that are not infected with the GNAS knock-down construct.
  • the forskolin results show that the cAMP reduction is due to the knock-down of GNAS rather then a general down-stream effect on the signal transduction route leading to the activation of CREBP.
  • This example describes the cloning and expression of human Dicer cDNA. Cloning of Dicer cDNA is accomplished using RT- PCR with mRNA as template. Dicer is co-expressed with the constructs of the previous examples thereby improving processing of RNA transcribed from the constructs. Co- expression of human Dicer is beneficial to the system, since it allows the system to be independent of endogenous Dicer activity that might be low or even absent in certain situations, tissues or developmental stages.
  • Biochemical and genetic data show the involvement of a member of the RNase III family of nucleases, Dicer, in the accurate processing of the double stranded RNA into the active siRNA species (Bernstein et al . (2001) Nature 409:363-366; Knight et al. (2001) Science 293 : 2269-7'1) .
  • the human homologue of Dicer functions to form approximately 22 nts RNAs from dsRNA substrates. Dicer is also required for the maturation of the let-7 sRNA in humans (Hutvagner et al . (2001) Science 293:834- 838).
  • the human Dicer homologue is cloned using reverse transcriptase- PCR and primers based on the sequence Ace. Number NM_030621. Position relative to start of NM_030621 sequence .
  • cloning can be accomplished by first isolating smaller regions of the cDNA. PCR fragments are subcloned and then ligated together in order to obtain the full-length human Dicer cDNA. Different primer combinations are used to generate different sized DNA fragments in order to facilitate cloning of the full-length cDNA. This avoids the problem of obtaining the long cDNA of Dicer. However, cloning in a single round using primers outside the coding region remains possible.
  • the forward primers contain a Hind III site, and the reverse primers contain an Nhe I site for cloning purposes.
  • the full-length cDNA is cloned into the Hind III and Nhe I sites of the pIPspAdapt6 vector.
  • This vector is used for expression in mammalian cells by direct transfection or by making an adenoviral vector carrying the dicer cDNA and expressing it upon (co) infection.
  • Dicer cDNA expression plasmid is combined with constructs described in other examples and introduced into mammalian cells.
  • the co-expression of constructs with Dicer cDNA or its homologues facilitates the processing of the transcribed sRNA.
  • Example 8 Identification of 21-23 nts RNA sequences that are endoqenously expressed and construction of a defined expression library of small RNAs
  • This example describes the identification and isolation of sRNAs .
  • RNAs of 21-23 nts are conserved in a variety of animal species, including Drosophila and humans (Pasquinelli et al.
  • Let-7 RNA is derived from a longer precursor RNA (Hutvagner et al . (2001) Science 293:834-838). It has been reported that upon incubation of long dsRNA in Drosophila extracts, 21-23 nts siRNAs are produced from the dsRNA. These 21-23 nts siRNAs have been isolated, cloned, and sequenced (Elbashir et al. (2001) Genes Dev 15:188-200). Novel endogenous 21-23 nts siRNAs have also been identified in Drosophila using this approach (Elbashir et al. (2001) Genes Dev 15:188-200) .
  • the sRNAs belonging to the let-7 RNA-family are identified as follows. Sequences of human 21-23 nts-RNAs that are endogenous (from different RNA sources; tissues, cell types, etc.) are obtained by cloning them by the method described for Drosophila (Elbashir et al. (2001) Genes Dev 15:188-200).
  • the obtained sequence information is used for the following aspects :
  • the libraries are used to construct an expression library containing these sequences.
  • the library is based, as described in the previous examples, on the expression of chimeric RNAs that have let-7 precursor segments (let-7 5' extension, let-7 loop, and let-7 3' extension sequences) combined with the 21-23 nt RNA sequences.
  • the functions of these 21-23 nt RNAs and their target RNAs are studied by performing cellular assays.
  • the sequence identification of naturally occurring 21-23 nts RNAs facilitates the search for their genomic locations. Identification and characterization of the genomic sequences provides information regarding the production and processing of the members of the family of these sRNAs .
  • Example 9 Construction of an undefined expression library of sRNA species
  • This example describes the cloning of the sRNAs identified in Example 8. It is not necessary to know the sequence of the 21-23 nucleotide RNAs.
  • the method generates a DNA fragment that consists of (in this order) :
  • the 21-23 nucleotide sequence which is preferably antisense to the target sequence
  • DNA fragments are digested with restriction endonucleases and cloned into vectors.
  • the preferred vectors are expression plasmids that contain let-7 or pol III promoters .
  • sRNAs belonging to the family of let-7 RNA are identified by cloning and sequencing.
  • the isolated sRNAs are cloned directly into an expression construct without first identifying their sequence (see Figure 5) :
  • the sRNA is treated with Calf Intestinal Alkaline Phosphatase to remove the 5' phosphate group.
  • step 1 The product of step 1 is ligated at its 3' terminus to the 5' phosphate group of linker 1 to form an intermediate polynucleotide.
  • Linker 1 is an oligonucleotide that can fold into a stem- loop structure and has a terminal 3' OH group that can be used as a primer.
  • a preferred oligonucleotide contains a restriction site in the duplexed portion of the stem- loop. The presence of this restriction site facilitates the later excision and replacement of the linker sequence if necessary. The ligation is performed using T4 RNA ligase.
  • step 2 is phosphorylated at its 5' terminus by T4 polynucleotide kinase.
  • step 3 is ligated at its 5' phosphate terminus to the 3' OH terminus of linker 2.
  • Linker 2 is an oligonucleotide having a 5' terminal OH group.
  • step 4 is treated to allow the 3' terminus of linker 1 to anneal. This is used for an extension reaction using the 3' terminus of linker 1 as a primer with Reverse Transcriptase lacking the RNase H activity.
  • step 5 The product of step 5 is denatured and primer 4 is annealed. Primer 4 is complementary to the extreme 3' terminus of the product of step 5. Note: Linker 2 and primer 5 contain identical sequences. 7. The annealed primer 4 is extended by DNA polymerase or reverse transcriptase or a mixture of both.
  • primer 4 An additional optional round of amplification is performed using primer 4.
  • the amplification is performed by Klenow Fragment DNA polymerase, or T4 DNA polymerase, or a thermal stable DNA polymerase.
  • step 7 is digested by restriction enzyme 1 and cloned into an expression vector with the appropriate site.
  • the expression vector is based on the let-7 gene or pol III promoter based as described in previous examples and can be viral such as adenoviral or can be non-viral.
  • this loop can be replaced by another loop sequence which gives rise to active sRNAs; e.g. the let-7 loop sequence. Cleavage sites are included in linker 1 to make this option possible.
  • Example 10 Construction of an sRNA expression library directed against endogenous RNA targets
  • this example describes methods whereby different 19 nucleotide guide sequences are synthesized and cloned to make a library.
  • an sRNA expression library is constructed.
  • sequences for the sRNA specifying their targets are obtained from databases, cellular extracts or chemically synthesized.
  • the sequences are obtained from databases containing expressed RNA sequences, including but not limited to mRNA, ESTs, SAGE, and may or may not encode proteins including but not limited to kinases, proteases, phosphodiesterases, phosphatases, G-protein coupled receptors, growth factors, upases, ABC transporters, DNAses, RNAses etc.
  • structural RNA sequences e.g.
  • snRNAs can be used. From these collections of oligonucleotides are produced containing these sequences. The mixture of the oligonucleotides is used to clone into the expression construct, using the strategy outlined in Figure 6.
  • Another example is the random generation of 19 nt sequences that produces a library of 4 19 combinations (2.7 x 10 11 ) , which are similarly cloned into an expression construct in accordance with the procedure outlined in Figure 6.
  • an oligonucleotide is synthesized containing the specifying sequence (or random sequence) , N19, flanked on the 5' end by a linker sequence and on the 3' end by a sequence that can fold into a stem-loop structure and has a terminal 3' OH group that can be used as a primer.
  • the 3' terminus is used as a primer in an extension reaction with DNA polymerase or reverse transcriptase.
  • the duplexed portion of the stem-loop includes a restriction site.
  • the 5' linker sequence could also have a restriction site in order to facilitate cloning.
  • step (2) the product of step (1) is denatured and primer 4 is annealed.
  • Primer 4 is complementary to the extreme 3' terminus of the product of step (1) .
  • the extreme 5' terminus of the initial oligonucleotide of step (1) and the primer 4 contain identical sequences. If the 5' linker sequence does not have a restriction site, primer 4 can be designed to have a restriction site in order to facilitate cloning.
  • step (3) the annealed primer 4 is extended by DNA polymerase or a thermal stable DNA polymerase (e.g. Taq) .
  • An optional step (4) provides for further amplification of the construct by a DNA polymerase.
  • step (5) the product of step (3) or optionally step (4) is digested by restriction enzyme 1 (El) and cloned into an expression vector with the appropriate restriction site.
  • the preferred expression vector includes the let-7 or pol III promoter.
  • the described method is especially suited for construction of pooled retroviral or lentiviral or AAV or integrating adenovirus sRNA expression libraries.
  • step (6) if the loop sequence is not functional to obtain the active sRNA species, it can be replaced by another loop sequence which gives rise to active sRNAs; for example, the let-7 loop sequence. Restriction sites recognized by restriction enzymes 3 and 4 (E3 and E4 respectively) are included in the stem-loop sequence to permit replacement.
  • a preferred expression construct produces the siRNAs at levels with the strongest knock-down of the target RNA.
  • an expression construct based on the U6 promoter as described in previous examples is also possible.
  • Oligonucleotides can be designed directed against these targets and used for the construction of knock-down expression clones.
  • the forward (F) oligonucleotides contain the guiding sequences against the targets, followed by the connecting loop sequence, followed by the sequences that are able to basepair to the guiding sequences, however the order of guide sequence and complement can be switched.
  • the reverse (R) oligonucleotides are complementary to the cognate forward oligonucleotide. A specific pair of forward and reverse oligonucleotides is annealed together forming a duplexed structure that is used for cloning into the expression vector.
  • the annealed F and R oligonucleotides either are cloned directly when designed with the appropriated overhangs matching these of the cloning vector, or they are digested with restriction enzymes prior to cloning to generate the appropriated overhangs matching these of the cloning vector.
  • the construction of a library directed against endogenous targets is preferably performed by using a DNA vector construct in which annealed oligonucleotides are cloned directly.
  • a vector is created that is converted into a linear sequence with the enzyme Sap I.
  • Sap I cuts adjacent to its recognition sites (GCTCTTC (N) ⁇ /4 ) .
  • the U6 promoter is used to create both cloning sites with different overhangs.
  • the e is used to improve cloning efficiency.
  • coli lethal gene, ccdB is included in the fragment to be excised.
  • the restriction fragment is not excised and the ccdB gene remains in the plasmid, after transfection no e. coli colonies are formed ( Figure 25A) . Only e. coli containing correct expression plasmids will form colonies.
  • the sequences of the junctions are schematically given in Figure 25B.
  • annealed oligonucleotides have the following sequence to enable direct cloning into the U6 promoter based vector after Sap I digestion as discussed above: Forward oligonucleotide:
  • Reverse oligonucleotide 3'-C-N18*-loop*-N18 -GAAAAAT-5'
  • the first nucleotide is preferably a G-nucleotide. Therefore, in a preferred embodiment, the 19 nt guiding sequence is G-N18.
  • N18*-C is a sequence able to base-pair to the 19 nt guiding sequence (G-N18), loop is the connecting loop sequence, loop* is the complement of loop. See also Figure 25B.
  • oligonucleotides are designed such that they are even smaller, i.e. 51 nt instead of 56 nucleotides:
  • the present invention can also be used to generate random target sequences to produce an undefined library.
  • the target sequences are not known, however they preferably start with a G to facilitate translation by Pol III.
  • These oligonucleotides can produce a library with 4 18 combinations (6.87 10 10 ) .
  • non-viral DNA expression libraries generated as described above can be used in disease relevant cellular assays to screen for knockdown-induced phenotypes by transfecting the
  • DNAs as arrayed collections using DNA transfer methods known in the art, such as lipofectamine or PEI.
  • DNA transfer methods known in the art, such as lipofectamine or PEI.
  • These libraries can also be used to generate collections of cell lines with individual or multiple genes stably knocked down by including a selectable marker in the expression plasmid prior to making the library in said vector.
  • the individual knockdown constructs can be pooled to various degrees, that is in one large pool of constructs, or subsets of such pool.
  • the sets and subsets of pools can then be used in disease relevant assays where the phenotype is a selectable phenotype such as a flow cytometric phenotype (e.g. induction or repression of marker) or growth advantage phenotype.
  • a selectable phenotype such as a flow cytometric phenotype (e.g. induction or repression of marker) or growth advantage phenotype.
  • arrayed adenoviral sRNA expression library refers to a collection of adenoviruses (contained in multiwell plates, for example 96 or 384 well plates) mediating the expression of various (human) sRNAs, in which every well contains a unique recombinant virus carrying a sRNA expression construct targeted against a gene, i.e. one target gene per well. Further details about the concept of arrayed adenoviral libraries can be found in WO 99/64582, US 6,340,595 and 6,413,776 (Arrayed adenoviral libraries for performing functional genomics) .
  • Arrayed adenoviral libraries expressing sRNAs that down-regulate specific endogenous mRNAs can be used to infect cells including disease relevant human primary cell types such as HUVECs. These assays may be used to screen for genes that specifically inhibit a metabolic pathway, such as the NfkappaB pathway, by an expressed sRNA, and thereby inhibit the up-regulation of a cytokine, such as IL8.
  • a metabolic pathway such as the NfkappaB pathway
  • Oligonucleotides are designed to be targeted against specific mRNAs transcribed from specific genes and used for the construction of knock-down adenoviral expression clones.
  • the preferred oligonucleotides are designed such that the first sequence (forward (F) ) contains the guide sequences against the targets, covalently linked to the stem-loop second sequence, which is covalently linked to the third sequence that is able to base-pair with the first sequence.
  • Another embodiment reverses the guide function resulting in the third sequence as the guide sequence.
  • the reverse (R) oligonucleotides are complementary to the cognate forward oligonucleotides.
  • Specific pairs of forward and reverse oligonucleotides are annealed together forming a duplexed structure that is used for cloning into an expression vector based on pIPspAdapt ⁇ (described in WO 99/64582) containing a promoter, for instance the polIII-dependant let-7 or U6 promoter.
  • the expression cassette may further contain (a) unique restriction enzyme recognition sequence (s) to directionally ligate the annealed F and R oligonucleotides that encode for the sRNA sequences against an endogenous mRNA.
  • the single stranded oligonucleotide components may be synthesized and annealed in 96 or 384 well plates to generate the double stranded oligonucleotides.
  • the array of sRNA Adapter plasmids is then, again in an arrayed format, transformed into host microorganisms, such as bacteria, preferably Escherichia coli (strain DH10B) or strains better suited for propagation of constructs containing adenoviral ITRs .
  • host microorganisms such as bacteria, preferably Escherichia coli (strain DH10B) or strains better suited for propagation of constructs containing adenoviral ITRs .
  • Transformed bacteria can be plated and grown on 6 well LB-ampicillin plates, after which a colony picker picks individual bacterial colonies and further inoculates liquid LB growth medium (+ 100 ⁇ g/ml ampicillin) in 96 well plates .
  • the preferred method of this invention is to start the liquid cultures directly from the 96 well E. coli transformation plates without plating and picking individual colonies.
  • the resulting 96 well plates are incubated in a rotary shaker (New Brunswick Scientific, Innova, floor model or equivalent) at 37°C, 300 rpm.
  • a rotary shaker New Brunswick Scientific, Innova, floor model or equivalent
  • After culturing bacteria for about 12 to about 24 hours, about 100 ⁇ l of bacterial cultures are then mixed with 100 ⁇ l of 50% glycerol using a Multimek robot (Beckman Coulter) or equivalent and stored at -80°C.
  • Multimek robot Beckman Coulter
  • a second step in the construction of the adenoviral sRNA expression library is the arrayed purification of DNA of individual plasmids from the primary library in amounts sufficient for adenovirus generation.
  • a bacterial culture is prepared as follows. The glycerol stock plates are thawed and 3 ⁇ l of the bacterial culture is transferred to a 96 well plate filled with 280 ⁇ l of liquid LB growth medium (+ 100 ⁇ g/ml ampicillin) using a CybiWell robot
  • a second step 60 ⁇ l of buffer P2 is added to the resuspended bacterial cells. The solution is gently mixed and a 5 min incubation time is applied to achieve complete cell lysis. Finally, 60 ⁇ l of buffer P3 is added and a mixing step applied for precipitation of proteins and genomic DNA. The 96 well plates are then centrifuged (40 min, 3220 rcf) . The supernatant (100 ⁇ l) is collected and transferred to new V-bottom 96 well plates containing 80 ⁇ l of isopropanol (for precipitation of the plasmid DNA) using a CybiWell robot (CyBio) . The plates containing the pellet are discarded.
  • the 96 well plates are centrifuged (45 min, 2700 rcf) and the supernatant discarded by decanting in a waste container.
  • the pellet is washed with 100 ⁇ l of 70% ethanol and the 96 well plates are centrifuged again (10 min, 2700 rcf) .
  • the supernatant is removed again by decanting in a waste container and the DNA pellets are allowed to dry for 1 h in a laminar airflow cabinet.
  • the DNA is dissolved in 20 ⁇ l of sterile TE buffer (1 mM Tris-HCI (pH7.6), O.l M EDTA).
  • the integrity of the constructs is assessed by restriction enzyme mapping and sequencing of either the whole array or parts thereof. Plates containing the dissolved DNA (further defined as DNA plates) are stored at - 20 °C until further use.
  • the plasmid DNA preparations contained in 96 well plates are quantified. For this purpose, 5 ⁇ l of plasmid DNA is pipetted from the DNA plates and transferred to a 96 well plate containing 100 ⁇ l of TE buffer. 100 ⁇ l of ⁇ quantification solution' is added. This solution is prepared by dissolving 2 ⁇ l of SybrGreen (Molecular Probes) into 10 ml of TE Buffer. After a mixing step, measurement is performed in a Fluorimeter (Fluostar, BMG) with the following settings: emission: 485 nm; excitation: 520 nm, gain: 35.
  • Fluorimeter Fluorimeter
  • a standard curve is generated by performing a measurement using different dilutions (in TE buffer) of a standard DNA sample (lambda DNA) . By fitting results for the individual DNA samples on this curve, DNA concentration per well is calculated. The mean DNA concentration per well for each DNA plate is then calculated. On average, a DNA concentration of 20-100 ng/ ⁇ l of DNA is obtained.
  • the pIPspAdApt6 plasmid versions contain the 5' part (bp 1-454 and bp 3511-6093) of the adenovirus serotype 5 genome in which the El gene is deleted and a promoter (let-7- or pol Ill- derived) is introduced.
  • the sRNA expression derivatives of pIPspAdapt lack the CMV promoter and the SV40 polyadenylation site.
  • Two other materials needed for the generation of recombinant adenovirus particles are a cosmid and a packaging cell line (W099/64582. US 6,340,595).
  • the cosmid contains the main part of the adenovirus serotype 5 genome (bp 3534-35953) from which the E2A gene is deleted.
  • the Per.C6/E2A packaging cell line is derived from human embryonic retina cells (HER) transfected with plasmids mediating the expression of the El and E2A genes.
  • the adenoviral genes that are integrated into the genome of the PER.C6/E2A cell line share no homology with the adenoviral sequences on the adapter plasmid and the cosmid. Consequently, vector stocks that are free of replication competent adenoviruses (RCAs) are prepared.
  • this adapter plasmid is co-transfected with the cosmid into a packaging cell line PER.C6/E2A.
  • the complete Ad5 genome is reconstituted by homologous recombination.
  • the helper and adapter plasmids contain homologous sequences (bp 3535-6093) , which are a substrate for this recombination event.
  • the DNA plates, which are prepared and quantified as described above, are used for transfection of the PER.C6/E2A cell line.
  • the plasmids contained in these plates are linearized by digestion with the PI-PspI restriction enzyme (New England Biolabs) .
  • PI-PspI restriction enzyme New England Biolabs
  • a certain volume of plasmid DNA (representing 66.7 ng of DNA on average, as calculated from the average DNA concentration of each DNA plate) is pipetted from the DNA plates into a V-bottom 96 well plate containing a restriction mix composed of IX restriction buffer (New England Biolabs: lOmM Tris-HCI (pH 8.6), lO M MgCl 2 , 150 mM KCl, 1 mM DTT), lOO ⁇ g/ml BSA and 6 units of PI- Pspl restriction enzyme (from a stock of 20 U/ ⁇ l) .
  • IX restriction buffer New England Biolabs: lOmM Tris-HCI (pH 8.6), lO M MgCl 2 , 150 mM KCl, 1 mM
  • plasmid For each DNA plate, an identical volume of plasmid is used for all wells. Transfer of the DNA samples from the DNA plate to the plate containing the restriction mix and subsequent mixing is performed with a JoBi Well robot (CyBio) . The plates containing the restriction mix are then put in plastic boxes containing humidified paper towels (to avoid evaporation) and incubated at 65°C for 4 hrs.
  • the helper plasmid (pWE/Ad.AflII-rITR ⁇ E2A) (which is prepared in batch using the Qiagen Maxi-prep kits) is also linearized with the Pad restriction enzyme (New England Biolabs) .
  • the transfection of the PER.C6/E2A cells with the linearized adapter and helper plasmids is set up as described below. 0.1867 ⁇ l of linearized helper plasmid (containing 93 ng of DNA) is mixed with 1.11 ⁇ l of serum free 2XDMEM (Life Technologies) to form a "helper mix”. 0.597 ⁇ l of Lipofectamine (Life Technologies) is mixed to 1.11 ⁇ l of 2XDMEM to form a "lipo mix".
  • PER.C6/E2A medium Composed of DMEM (Life Technologies) containing 10% FBS (Life Technologies), 50 ⁇ g/ml gentamycin and 10 mM MgCl 2 ) , but prior to addition of the 30 ⁇ l of the DNA/Lipofectamine mix, the medium is removed from all wells of the plates. An incubation time of three hours at 39°C, 10% C0 2 is then applied. 170 ⁇ l of PER.C6/E2A medium is then added to the plates and an overnight incubation at 39°C, 10% C0 2 is applied.
  • the 96 well plates containing the transfected PER.C6/E2A cells are incubated at 34°C, 10% C0 2 during three weeks. This temperature allows the expression of the E2A factor, which is required for adenoviral replication. During this incubation time, viruses are generated and replicated, as revealed by the appearance of CPE (cytopathic effect) . The percentage of the wells showing CPE is scored manually or using an automated image scanner and appropriate algorithm, which allows for the evaluation of the efficiency of virus production.
  • the 96 well plates are stored at -80°C until further propagation of the viruses.
  • the final virus propagation step is aimed at obtaining a higher percentage of wells showing CPE and more homogenous virus titers.
  • Viruses are propagated according to the following procedure.
  • the transfection plates stored at -80°C are thawed at room temperature for about 1 hour.
  • 20 ⁇ l of the supernatant is transferred onto PER.C6/E2A cells seeded in 96 well plates at a density of 2.25xl0 4 cells/well in 180 ⁇ l of DMEM + 10% FBS.
  • the needles of the dispenser are disinfected and sterilized by pipetting up 60 ⁇ l of 5% bleach three times.
  • the traces of bleach present in the needles are removed by three successive washes with 70 ⁇ l of sterile water. Cells are incubated at
  • modifications to the viral coat proteins can be introduced to obtain a different or improved tropism (EP 1191105) .
  • the arrayed adenoviral libraries described above can be used in disease relevant cellular assays to screen for knockdown induced cellular phenotypes. Such libraries are particularly useful when the adenoviral vector constructs are integrating adenoviral vectors, such as described in US 6,051,430 or WO 99/32647/EP 1042494 and Virology 2001 Sep 30; 288(2): 236-46. Such adenoviral sRNA expression libraries result in a library of cell lines in which individual or multiple genes are stably knocked down.
  • the individual knockdown adenoviruses can be used as arrays but also can be pooled to various degrees i.e. sets of pools or one large pool.
  • the pools can then be used in disease relevant assays including assays with a selectable phenotype such as a flow cytometric phenotype (screening for up-regulation or down regulation of a suitable marker by using, for example, fluorescence-labeled antibodies) or growth advantage phenotype .
  • a selectable phenotype such as a flow cytometric phenotype (screening for up-regulation or down regulation of a suitable marker by using, for example, fluorescence-labeled antibodies) or growth advantage phenotype .
  • This example describes construction of an arrayed AAV sRNA expression library "comprising a collection of adenovirus associated virus (AAV) vectors, that are contained in multiwell plates, for example 96 or 384 well plates, and that mediate the expression of various unique (human) sRNAs. Each well contains a unique recombinant AAV vector carrying an sRNA expression construct targeted against a specific gene.
  • AAV adenovirus associated virus
  • Arrayed AAV libraries expressing sRNAs that down regulate specific endogenous mRNAs can be used to infect cells including disease relevant human primary cell types such as HUVECs, for example to screen for genes that specifically inhibit a metabolic pathway, such as the NfkappaB pathway, by an expressed sRNA, and thereby down-regulate production of one or more cytokines, such as IL8.
  • Oligonucleotides are designed to be targeted against specific mRNAs transcribed from specific genes and used for the construction of knock-down AAV expression clones.
  • the preferred oligonucleotides are designed as described above
  • Example 12 Specific pairs of forward and reverse oligonucleotides are annealed together forming a duplexed structure that is used for cloning into an AAV expression vector consisting of the AAV ITR sequences, an AAV packaging signal (see US 6,140,103) and a promoter, for instance the polIII-dependant let-7 or U6 promoter.
  • the expression cassette may further contain (a) unique restriction enzyme recognition sequence (s) to directionally ligate the annealed F and R oligonucleotides
  • the array of sRNA-AAV ligations is then, again in an arrayed format, transformed into host microorganisms, such as bacteria, preferably Escherichia coli (strain DH10B) or strains better suited for propagation of constructs containing AAV ITRs.
  • host microorganisms such as bacteria, preferably Escherichia coli (strain DH10B) or strains better suited for propagation of constructs containing AAV ITRs.
  • Transformed bacteria can be plated and grown on 6 well LB-ampicillin plates, after which a colony picker picks individual bacterial colonies and further inoculates liquid LB growth medium (+ 100 ⁇ g/ml ampicillin) in 96 well plates followed by plasmid DNA isolation.
  • the preferred method of this invention is to start the liquid cultures directly from the 96 well E. coli transformation plates without plating and picking individual colonies. In both cases the resulting 96 well plates are incubated in a rotary shaker (New Brunswick Scientific, Innova, floor model or equivalent) at 37°C, 300 rpm. After culturing bacteria for about 12 to about 24 hours, about 100 ⁇ l of bacterial cultures are then mixed with 100 ⁇ l of 50% glycerol using a Multimek
  • glycerol stock plates' From these glycerol stock plates' , plasmid DNA can be prepared and quantified as described in Example 12.
  • AAV virions are produced from the arrayed sRNA-AAV plasmids DNAs described under A, using an AAV packaging cell line or a transient AAV packaging system.
  • An AAV packaging cell line or derivative thereof, as described in US 6,140,103 may be used.
  • transient co-transfection of arrayed sRNA-AAV DNA with rep-cap expression constructs without a packaging signal or any other overlap with the sRNA-AAV constructs can be performed on cells infected with psoralene treated adenovirus to provide in trans the necessary helper genes of the helper adenovirus.
  • the cell lines to be transfected are seeded in 96 well plates.
  • Virus production, propagation and titering can be done with methods known to the art of AAV vector technology. After production of AAV sRNA- viruses in 96 well plates they can be re-aliquoted using a liquid handler into 384 well aliquot plates and stored at - 80°C until further use.
  • the arrayed AAV libraries described above can be pooled to various degrees, that is in one large pool of retroviruses, or subsets of such retrovirus pool.
  • the sets and subsets of pools can be used in disease relevant cellular assays to screen for knock-down induced phenotypes.
  • these AAV sRNA expression libraries can be used to generate collections of cell lines with individual or multiple genes that are stably knocked-down.
  • the Moloney Murine Leukemia Virus-based retroviral plasmid LZRSpBMN-LacZ is used (Kinsella TM and Nolan GP (1996) .
  • Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum. Gene Ther. 7:1405- 13) .
  • the LacZ gene replaces the env-pol sequences.
  • the EBV EBNA-1 gene and EBV oriP origin of replication are present in the plasmid backbone. These allow episomal replication of the plasmid in the packaging cells. In this way, high titer supernatant can be generated after transient transfection of the packaging cells.
  • Transfected cells can be selected since a puromycine resistance gene, under control of the Phosphoglycerol Kinase-1 promoter, is also present in the plasmid backbone. Culturing of the transfected packaging cells in the presence of puromycine usually generates high titer supernatant.
  • the LZRSpBMN-LacZ vector is further modified by replacing the LacZ gene for an expression cassette.
  • This expression cassette contains an ubiquitously active promoter, in particular, a promoter recognized by RNA polymerase III (pol III promoter) including but not limited to U6 and let7 promoters.
  • the expression cassette can be cloned in either orientation at different positions within the viral backbone of the retroviral vector, as is well known to those skilled in the art (see for example, Medina MF, Joshi S. RNA-polymerase III- driven expression cassettes in human gene therapy. Curr Opin Mol Ther 1999 Oct; 1(5): 580-94.
  • the expression cassette further contains (a) unique restriction enzyme recognition sequence (s) (see example 10) to directionally ligate and clone the annealed F and R oligonucleotides that encode the sRNA against an endogenous mRN .
  • s unique restriction enzyme recognition sequence
  • Oligonucleotides are designed as described above. Specific pairs of forward and reverse oligonucleotides are annealed together forming a duplexed structure that is used for cloning into a modified LZRSpBMN-LacZ vector or equivalent.
  • the single stranded oligonucleotides components can be synthesized and annealed in 96 or 384 well plates to generate the double stranded oligonucleotides.
  • the arrayed library of retroviral plasmid-sRNA ligations is then, again in an arrayed format, transformed into host microorganisms, such as bacteria, preferably Escherichia coli
  • Transformed bacteria can be plated and grown on 6 well LB-ampicillin plates, after which a colony picker picks individual bacterial colonies and further inoculates 300 ⁇ l of liquid LB growth medium (+ 100 ⁇ g/ml ampicillin) in 96 well plates followed by plasmid DNA isolation.
  • the preferred method of this invention is to start the liquid cultures directly from the 96 well E. coli transformation plates without plating and picking individual colonies.
  • the resulting 96 well plates are incubated in a rotary shaker (New Brunswick Scientific, Innova, floor model or equivalent) at 37°C, 300 rpm.
  • a rotary shaker New Brunswick Scientific, Innova, floor model or equivalent
  • After culturing bacteria for about 12 to about 24 hours, about 100 ⁇ l of bacterial cultures are then mixed with 100 ⁇ l of 50% glycerol using a Multimek robot (Beckman Coulter) or equivalent and stored at -80 °C.
  • These plates are defined as ⁇ glycerol stock plates' . From these ⁇ glycerol stock plates', plasmid DNA can be prepared and quantified as described in Example 12.
  • a suitable packaging cell line is subsequently used to generate an arrayed retroviral library from the purified retroviral plasmid-sRNA constructs.
  • a suitable packaging cell line is provided by the Phoenix ( ⁇ NX) packaging cells (Nolan GP and Shatzman AR (1998), Expression vectors and delivery systems, Curr. Opin. Biotechnol. 9: 447-450), but other packaging cells might be equally suitable.
  • the Phoenix cells express the gag /pol and env proteins from two different constructs, thus minimizing the chance to generate replication competent retroviruses. Furthermore, the presence of a selection marker on each of these constructs allows the selection of cells that have retained them.
  • ⁇ NX-E Ecotrophic packaging cells
  • ⁇ NX-A amphotrophic packaging cells
  • Transfection of packaging cells is routinely performed using standard calcium phosphate co-precipitation, but other methods might be equally suited such as lipofectamine and PEI (also see WO 99/64582, US 6,340,595 and US 6,413,776).
  • the cell line is seeded in 96 well plates.
  • Virus production, propagation and titering may be accomplished with methods known in the art of retroviral vector technology. After production of retroviral-sRNA viruses in 96 well plates, the transfected cells can be aliquoted using a liquid handler into 384 well aliquot plates.
  • collection of the retrovirus- containing supernatant may start 24 hours after transfection by replacing the medium with fresh culture medium. A 24 hours collection period is usually sufficient for high titer supernatant.
  • the culture medium is gently withdrawn from the dish, centrifuged at 3000xg, and aliquoted. Aliquots can be stored at -80°C and are stable for at least six months.
  • the cells may be trypsinized to select for transfected cells and transferred to a fresh plate containing medium supplemented with 2.5 mg/ml of puromycin. Selection must be performed for a minimum period of 8 days. After this period, medium is replaced with normal medium without puromycin. 24 hours the retrovirus-containing supernatant is collected by replacing the medium with fresh culture medium. Supernatant is centrifuged at 3000xg and stored in aliquots at -80°C.
  • the arrayed retrovirus libraries described above can be used in disease relevant cellular assays to screen for knock-down induced phenotypes. Also these retroviral sRNA expression libraries can be used to generate collections of cell lines with individual or multiple genes that are stably knocked- down.
  • the individual knockdown retroviruses can be pooled to various degrees, that is in one large pool of retroviruses, or subsets of such retrovirus pool.
  • the sets and subsets of pools can then be used in disease relevant assays where the phenotype is a selectable phenotype such as a flow cytometric phenotype (e.g. induction or repression of marker) or growth advantage phenotype.
  • Non-limiting examples using sRNA to knock down expression of exogenous genes during adenovirus and retrovirus production are presented below.
  • nucleic acid sequences in the mRNA encoding the toxic protein can be used as target sequences for knock-down constructs.
  • Polynucleotide sequences of the invention targeted against these sequences or a vector encoding the polynucleotide sequences are co-transfected with the viral plasmid (s) into the packaging cells to suppress exogenous protein production.
  • the polynucleotide sequences of the invention, or a vector encoding the polynucleotide sequences can be stably integrated into the packaging cells. Production of retrovirus :
  • the retroviral vector containing the exogenous gene contains a packaging signal surrounded by two splice sites, the splice donor site and the splice acceptor site. Replication of the viral RNA requires the transcription of the full vector. However, the packaging signal is spliced out to produce mRNA before protein production. To allow replication of the viral RNA, but suppress expression of the exogenous gene, the sequences adjacent to the splice donor site and splice acceptor site are used as a target for the polynucleotide sequences of the invention.
  • the first sequence of said polynucleotide sequence consists of the complement of these two portions that are covalently linked and that form a unique sequence in the mRNA coding for the toxic protein.
  • the first portion is complementary to about 9 to 11 nucleotides of the sequence upstream of the splice donor sequence
  • the second portion is complementary to about 9 to 11 nucleotides of the sequence downstream of the splice acceptor sequence.
  • polynucleotide sequences as described above or a vector encoding the polynucleotide sequences are co- transfected with the viral plasmid (s) into the packaging cells to suppress exogenous protein production.
  • the polynucleotide sequences can be stably integrated into the packaging cells.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
  • Investigating Or Analysing Materials By Optical Means (AREA)
  • Peptides Or Proteins (AREA)
PCT/EP2002/009670 2001-09-01 2002-08-29 Sirna knockout assay method and constructs Ceased WO2003020931A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2002339458A AU2002339458A1 (en) 2001-09-01 2002-08-29 Sirna knockout assay method and constructs
DE60225586.4T DE60225586T3 (de) 2001-09-01 2002-08-29 Sirna knockout prüfverfahren und konstrukte
CA002457419A CA2457419A1 (en) 2001-09-01 2002-08-29 Sirna knockout assay method and constructs
EP02776950.4A EP1444346B2 (en) 2001-09-01 2002-08-29 Sirna knockout assay method and constructs
JP2003525634A JP2005501557A (ja) 2001-09-01 2002-08-29 siRNAノックアウトアッセイ法およびコンストラクト

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US31722901P 2001-09-01 2001-09-01
US60/317,229 2001-09-01
US38573302P 2002-06-04 2002-06-04
US60/385,733 2002-06-04

Publications (2)

Publication Number Publication Date
WO2003020931A2 true WO2003020931A2 (en) 2003-03-13
WO2003020931A3 WO2003020931A3 (en) 2003-11-20

Family

ID=26980845

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/009670 Ceased WO2003020931A2 (en) 2001-09-01 2002-08-29 Sirna knockout assay method and constructs

Country Status (8)

Country Link
US (2) US20030198627A1 (https=)
EP (1) EP1444346B2 (https=)
JP (1) JP2005501557A (https=)
AT (1) ATE389016T2 (https=)
AU (1) AU2002339458A1 (https=)
CA (1) CA2457419A1 (https=)
DE (1) DE60225586T3 (https=)
WO (1) WO2003020931A2 (https=)

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003056012A1 (en) * 2001-12-24 2003-07-10 Cancer Research Technology Limited A system for stable expression of sirnas in mammalian cells
WO2003095652A3 (de) * 2002-05-08 2004-02-26 Xantos Biomedicine Ag Expressionskonstrukte zur herstellung von doppelstrang (ds) rna und deren anwendung
WO2004094636A1 (en) * 2003-04-24 2004-11-04 Galapagos Genomics N.V. Effective sirna knock-down constructs
EP1546174A2 (en) 2002-01-22 2005-06-29 Cold Spring Harbor Laboratory Methods and compositions for rna interference
WO2004101788A3 (en) * 2003-05-09 2005-06-30 Univ Pittsburgh Small interfering rna libraries and methods of synthesis and use
WO2006006520A1 (ja) * 2004-07-09 2006-01-19 Genofunction, Inc. 新規創薬標的の探索方法
EP1546408A4 (en) * 2002-09-20 2007-10-10 Pharmacia & Upjohn Co Llc A METHOD FOR PRODUCING RANDOM RNAI LIBRARY, AND ITS APPLICATION TO CELLS BASED ON CELLS
WO2007000668A3 (en) * 2005-05-27 2007-12-21 San Raffaele Centro Fond Gene vector comprising mi-rna
JP2008000137A (ja) * 2007-07-17 2008-01-10 Aichi Prefecture 癌の遺伝子治療ベクター及び癌治療用医薬組成物
US7459547B2 (en) 2003-06-02 2008-12-02 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
WO2008155397A2 (en) 2007-06-20 2008-12-24 Galapagos N.V. Molecular targets and compounds, and methods to identify the same, useful in the treatment of bone and joint degenerative diseases
US7615626B2 (en) * 2004-04-27 2009-11-10 Galapagos N.V. Methods, agents, and compound screening assays for inducing differentiation of undifferentiatied mammalian cells into osteoblasts
EP2002037A4 (en) * 2006-03-07 2010-03-10 Univ Pennsylvania RNAI LIBRARIES, METHOD FOR CREATING THEM AND SCREENING METHODS THEREWITH
US7683036B2 (en) 2003-07-31 2010-03-23 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US7750144B2 (en) 2003-06-02 2010-07-06 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
EP1462525B1 (en) * 2001-11-28 2010-10-06 Toudai Tlo, Ltd. siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE KNOCKDOWN CELL OR THE LIKE USING THE SAME
WO2010115841A1 (en) 2009-04-01 2010-10-14 Galapagos Nv Methods and means for treatment of osteoarthritis
EP2256197A1 (en) 2004-06-14 2010-12-01 Galapagos N.V. Methods for identification, and compounds useful for the treatment of degenerative and inflammatory diseases
EP2281887A1 (en) * 2004-11-12 2011-02-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
WO2011015572A1 (en) 2009-08-03 2011-02-10 Galapagos Nv Molecular targets and compounds, and methods to identify the same, useful in the treatment of neurodegenerative diseases
WO2011015573A1 (en) 2009-08-03 2011-02-10 Galapagos Nv Molecular targets and compounds, and methods to identify the same, useful in the treatment of neurodegenerative diseases
US7892793B2 (en) 2002-11-04 2011-02-22 University Of Massachusetts Allele-specific RNA interference
US7893036B2 (en) 2001-07-12 2011-02-22 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
EP2292739A1 (fr) 2006-03-24 2011-03-09 Institut National De La Recherche Agronomique Procédé de préparation de cellules aviaires differenciées et gènes impliqués dans le maintien de la pluripotence
US7919583B2 (en) 2005-08-08 2011-04-05 Discovery Genomics, Inc. Integration-site directed vector systems
WO2011054922A1 (en) 2009-11-05 2011-05-12 Galapagos Nv Salts of fused pyrazine compounds, useful for the treatment of degenerative and inflammatory diseases.
WO2011095495A1 (en) * 2010-02-05 2011-08-11 F. Hoffmann-La Roche Ag Compositions and methods for inhibiting expression of ikk2 genes
EP2360478A1 (en) 2004-10-15 2011-08-24 Galapagos N.V. Molecular targets and compounds and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases
EP2360474A2 (en) 2004-06-21 2011-08-24 Galapagos N.V. Methods and means for treatment of osteoarthritis
US8153776B2 (en) 2000-03-16 2012-04-10 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US8309791B2 (en) 2008-07-16 2012-11-13 Recombinectics, Inc. Method for producing a transgenic pig using a hyper-methylated transposon
US8309704B2 (en) 2003-06-02 2012-11-13 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNAi
US8383599B2 (en) 2000-03-16 2013-02-26 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US8680063B2 (en) 2003-09-12 2014-03-25 University Of Massachusetts RNA interference for the treatment of gain-of-function disorders
US8809293B2 (en) 2011-06-30 2014-08-19 Arrowhead Madison Inc. Compositions and methods for inhibiting gene expression of hepatitis B virus
EP2561078A4 (en) * 2010-04-23 2014-10-15 Cold Spring Harbor Lab NEW STRUCTURAL DESIGNED SHRNAS
EP2816113A2 (en) 2008-09-11 2014-12-24 Galapagos N.V. Method for identifying compounds useful for increasing the functional activity and cell surface expression of CF-associated mutant cystic fibrosis transmembrane conductance regulator
US8946176B2 (en) 2010-10-18 2015-02-03 Arrowhead Research Corporation Compositions and methods for inhibiting expression of RRM2 genes
US9080215B2 (en) 2007-09-14 2015-07-14 Asuragen, Inc. MicroRNAs differentially expressed in cervical cancer and uses thereof
US9267145B2 (en) 2002-05-03 2016-02-23 Duke University Method of regulating gene expression
AU2014202015B2 (en) * 2006-03-07 2016-06-02 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
US9365852B2 (en) 2008-05-08 2016-06-14 Mirna Therapeutics, Inc. Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
US9879253B2 (en) 2003-12-22 2018-01-30 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US9914924B2 (en) 2005-08-18 2018-03-13 University Of Massachusetts Methods and compositions for treating neurological disease
US9988627B2 (en) 2013-10-04 2018-06-05 Novartis Ag Formats for organic compounds for use in RNA interference
US10047388B2 (en) 2004-05-28 2018-08-14 Asuragen, Inc. Methods and compositions involving MicroRNA
US10130651B2 (en) 2015-08-07 2018-11-20 Arrowhead Pharmaceuticals, Inc. RNAi Therapy for Hepatitis B Virus Infection
CN109456995A (zh) * 2018-11-08 2019-03-12 杜以军 基因敲除质粒、细胞系及制备方法和应用
US10227588B2 (en) 2013-10-04 2019-03-12 Novartis Ag 3′end caps for RNAi agents for use in RNA interference
US10519446B2 (en) 2013-10-04 2019-12-31 Novartis Ag Organic compounds to treat hepatitis B virus
US11517584B2 (en) 2016-08-04 2022-12-06 Arrowhead Pharmaceuticals, Inc. RNAi agents for Hepatitis B virus infection

Families Citing this family (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19956568A1 (de) 1999-01-30 2000-08-17 Roland Kreutzer Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens
GB9925459D0 (en) 1999-10-27 1999-12-29 Plant Bioscience Ltd Gene silencing
DE10100586C1 (de) * 2001-01-09 2002-04-11 Ribopharma Ag Verfahren zur Hemmung der Expression eines Ziegens
US7829693B2 (en) * 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7767802B2 (en) * 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7423142B2 (en) * 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US8546143B2 (en) 2001-01-09 2013-10-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
EP1281767A3 (en) 2001-07-31 2003-05-28 Aladar A. Szalay Light emitting microorganisms and cells for diagnosis and therapy of tumors
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
DE10163098B4 (de) * 2001-10-12 2005-06-02 Alnylam Europe Ag Verfahren zur Hemmung der Replikation von Viren
US20040121348A1 (en) * 2001-10-26 2004-06-24 Ribopharma Ag Compositions and methods for treating pancreatic cancer
DE10230997A1 (de) * 2001-10-26 2003-07-17 Ribopharma Ag Medikament zur Erhöhung der Wirksamkeit eines Rezeptor-vermittelt Apoptose in Tumorzellen auslösenden Arzneimittels
DE10202419A1 (de) 2002-01-22 2003-08-07 Ribopharma Ag Verfahren zur Hemmung der Expression eines durch eine Chromosomen-Aberration entstandenen Zielgens
US7820632B2 (en) 2002-02-14 2010-10-26 City Of Hope Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US20030228261A1 (en) * 2002-06-05 2003-12-11 Aladar Szalay Light emitting microorganisms and cells for diagnosis and therapy of diseases associated with wounded or inflamed tissue
EP1369491A1 (en) 2002-06-05 2003-12-10 Aladar A. Szalay Light emitting microorganisms and cells for diagnosis and therapy of diseases associated with wounded or inflamed tissue
EP1592412A1 (en) * 2003-01-31 2005-11-09 Novartis AG Down-regulation of target-gene with pei/single-stranded oligoribonucleotide complexes
ATE420160T1 (de) 2003-06-18 2009-01-15 Genelux Corp Modifizierte rekombinante vacciniaviren, verwendungen davon
WO2005063983A1 (en) * 2003-12-29 2005-07-14 Galapagos Genomics N.V. Modulators of bone homeostasis identified in a high-throughput screen
ES2425749T3 (es) 2004-03-31 2013-10-17 The General Hospital Corporation Método para determinar la respuesta del cáncer a tratamientos dirigidos al receptor del factor de crecimiento epidérmico
EP2270513A3 (en) 2004-04-20 2011-04-06 Galapagos N.V. Methods, compositions and compound assays for inhibiting amyloid-beta protein production
US8673268B2 (en) 2004-10-15 2014-03-18 Galapagos N.V. Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases
WO2007137220A2 (en) * 2006-05-22 2007-11-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of ikk-b gene
WO2007147067A2 (en) * 2006-06-14 2007-12-21 Rosetta Inpharmatics Llc Methods and compositions for regulating cell cycle progression
TW200819540A (en) 2006-07-11 2008-05-01 Genelux Corp Methods and compositions for detection of microorganisms and cells and treatment of diseases and disorders
JP2008086201A (ja) * 2006-09-29 2008-04-17 Gifu Prefecture Kenkyu Kaihatsu Zaidan マイクロrna生成の検出方法と癌の診断・治療およびマイクロrna生成調整剤
EP2097517B1 (en) 2006-10-16 2014-06-04 Genelux Corporation Recombinant Lister strain vaccinia virus encoding an anti-VEGF single chain antibody
US8114982B2 (en) * 2006-12-06 2012-02-14 Albert Einstein College Of Medicine Of Yeshiva University Multi-microRNA methods and compositions
CA2690627C (en) * 2007-06-15 2014-12-02 Genelux Corporation Microorganisms for imaging and/or treatment of tumors
US8841437B2 (en) * 2008-06-20 2014-09-23 The Board Of Trustees Of The Leland Stanford Junior University Precursor miRNA loop-modulated target regulation
WO2009054996A2 (en) * 2007-10-25 2009-04-30 Genelux Corporation Systems and methods for viral therapy
WO2009151591A2 (en) * 2008-06-10 2009-12-17 Sangamo Biosciences, Inc. Methods and compositions for generation of bax- and bak-deficient cell lines
US20120004160A1 (en) 2009-02-19 2012-01-05 Glaxo Group Ltd. Methods for identifying and compounds useful for the diagnosis and treatment of diseases involving inflammation
US20110306655A1 (en) 2009-02-19 2011-12-15 Richard Antonius Jozef Janssen Methods for identifying and compounds useful for the diagnosis and treatment of diseases involving inflammation
JP2012518181A (ja) 2009-02-19 2012-08-09 ガラパゴス・ナムローゼ・フェンノートシャップ 炎症を包含する疾患の診断及び治療に有用な同定方法及び化合物
WO2010112569A1 (en) 2009-03-31 2010-10-07 Robert Zimmermann Modulation of adipose triglyceride lipase for prevention and treatment of cachexia, loss of weight and muscle atrophy and methods of screening therefor
EP2414830A2 (en) 2009-03-31 2012-02-08 Robert Zimmermann Modulation of adipose triglyceride lipase for prevention and treatment of cachexia, loss of weight and muscle atrophy and methods of screening therefor
CA2780875A1 (en) 2009-11-13 2011-05-19 Pangaea Biotech, S.L. Molecular biomarkers for predicting response to tyrosine kinase inhibitors in lung cancer
US20130183326A9 (en) 2009-11-20 2013-07-18 St. Jude Children's Research Hospital Methods and compositions for modulating the activity of the interleukin-35 receptor complex
JP5794558B2 (ja) * 2010-03-24 2015-10-14 国立研究開発法人産業技術総合研究所 改変された致死遺伝子及び該遺伝子を含むベクター
US8383793B2 (en) 2010-04-15 2013-02-26 St. Jude Children's Research Hospital Methods and compositions for the diagnosis and treatment of cancer resistant to anaplastic lymphoma kinase (ALK) kinase inhibitors
EP2468883A1 (en) 2010-12-22 2012-06-27 Pangaea Biotech S.L. Molecular biomarkers for predicting response to tyrosine kinase inhibitors in lung cancer
EP2492688A1 (en) 2011-02-23 2012-08-29 Pangaea Biotech, S.A. Molecular biomarkers for predicting response to antitumor treatment in lung cancer
US20140157443A1 (en) 2011-04-14 2014-06-05 St. Jude Children's Research Hospital Methods and compositions for detecting and modulating a novel mtor complex
ES2733211T3 (es) 2011-04-15 2019-11-28 Genelux Corp Cepas clonales de virus vaccinia atenuados y métodos de uso de las mismas
US20140087362A1 (en) 2012-03-16 2014-03-27 Aladar A. Szalay Methods for assessing effectiveness and monitoring oncolytic virus treatment
WO2013158265A1 (en) 2012-04-20 2013-10-24 Genelux Corporation Imaging methods for oncolytic virus therapy
WO2013190089A1 (en) 2012-06-21 2013-12-27 Pangaea Biotech, S.L. Molecular biomarkers for predicting outcome in lung cancer
US20140140959A1 (en) 2012-10-05 2014-05-22 Aladar A. Szalay Energy Absorbing-Based Diagnostic and Therapeutic Methods Employing Nucleic Acid Molecules Encoding Chromophore-Producing Enzymes
ES2670590T3 (es) 2012-11-20 2018-05-31 Centro De Investigacíon Biomédica En Red De Enfermedades Neurodegenerativas Ciberned Neuronas motoras superiores corticoespinales, métodos y composiciones para diferenciar células madre neurales modulando la señalización del receptor de cannabinoides CB1 y usos de los mismos
WO2014139883A1 (en) 2013-03-14 2014-09-18 Galapagos Nv Molecular targets and compounds, and methods to identify the same, useful in the treatment of fibrotic diseases
EP2972381A2 (en) 2013-03-14 2016-01-20 Galapagos NV Molecular targets and compounds, and methods to identify the same, useful in the treatment of diseases associated with epithelial mesenchymal transition
WO2014139884A2 (en) 2013-03-14 2014-09-18 Galapagos Nv Molecular targets and compounds, and methods to identify the same, useful in the treatment of fibrosis
CN112301024A (zh) 2013-03-15 2021-02-02 通用医疗公司 使用RNA引导的FokI核酸酶(RFN)提高RNA引导的基因组编辑的特异性
US11332719B2 (en) * 2013-03-15 2022-05-17 The Broad Institute, Inc. Recombinant virus and preparations thereof
US10760064B2 (en) 2013-03-15 2020-09-01 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
EP2813571A1 (en) 2013-06-13 2014-12-17 Institut d'Investigació Biomèdica de Bellvitge (IDIBELL) Method for the treatment of lung cancer
CA2935032C (en) * 2013-12-26 2024-01-23 The General Hospital Corporation Multiplex guide rnas
WO2015134528A1 (en) * 2014-03-04 2015-09-11 Donald Danforth Plant Science Center New generation of artificial micrornas
CN107206088A (zh) 2014-12-05 2017-09-26 豪夫迈·罗氏有限公司 使用pd‑1轴拮抗剂和hpk1拮抗剂用于治疗癌症的方法和组合物
US9512446B1 (en) 2015-08-28 2016-12-06 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9926546B2 (en) 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
JP2022541197A (ja) 2019-07-16 2022-09-22 ユニヴェルシテ・コート・ダジュール 腫瘍溶解性ウイルスに対する対象の感受性又は抵抗性を評価する方法、組換えウイルス、その調製、及び使用

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US6060456A (en) * 1993-11-16 2000-05-09 Genta Incorporated Chimeric oligonucleoside compounds
US6146886A (en) * 1994-08-19 2000-11-14 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
WO1996029097A1 (en) * 1995-03-21 1996-09-26 Research Corporation Technologies, Inc. Stem-loop and circular oligonucleotides
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
CN1202246C (zh) 1998-04-08 2005-05-18 联邦科学和工业研究组织 获得修饰表型的方法和措施
US6413776B1 (en) * 1998-06-12 2002-07-02 Galapagos Geonomics N.V. High throughput screening of gene function using adenoviral libraries for functional genomics applications
EP1105470A4 (en) * 1998-08-20 2002-07-17 Cell Genesys Inc USE OF SUPPRESSOR TRNAS FOR REGULATING CYTOTOXICITY DURING THE PRODUCTION OF RECOMBINANT GENE PRODUCTS
WO2000049035A1 (en) * 1999-02-19 2000-08-24 The General Hospital Corporation Gene silencing
GB9904905D0 (en) * 1999-03-03 1999-04-28 Oxford Biomedica Ltd Cells
US6326193B1 (en) * 1999-11-05 2001-12-04 Cambria Biosciences, Llc Insect control agent
ES2336887T5 (es) * 2000-03-30 2019-03-06 Whitehead Inst Biomedical Res Mediadores de interferencia por ARN específicos de secuencias de ARN
US20020132788A1 (en) * 2000-11-06 2002-09-19 David Lewis Inhibition of gene expression by delivery of small interfering RNA to post-embryonic animal cells in vivo
CA2429814C (en) * 2000-12-01 2014-02-18 Thomas Tuschl Rna interference mediating small rna molecules
US6399378B1 (en) * 2001-03-01 2002-06-04 Isis Pharmaceuticals, Inc. Antisense modulation of RECQL2 expression
GB0118223D0 (en) * 2001-07-26 2001-09-19 Univ Sheffield Stem loop RNA
US20030148519A1 (en) * 2001-11-14 2003-08-07 Engelke David R. Intracellular expression and delivery of siRNAs in mammalian cells
US20040053876A1 (en) * 2002-03-26 2004-03-18 The Regents Of The University Of Michigan siRNAs and uses therof

Cited By (142)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8153776B2 (en) 2000-03-16 2012-04-10 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US8202846B2 (en) 2000-03-16 2012-06-19 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US8383599B2 (en) 2000-03-16 2013-02-26 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US9850487B2 (en) 2001-07-12 2017-12-26 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US8530438B2 (en) 2001-07-12 2013-09-10 University Of Massachusetts Vivo production of small interfering RNAs that mediate gene silencing
US8232260B2 (en) 2001-07-12 2012-07-31 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US9175287B2 (en) 2001-07-12 2015-11-03 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US8557785B2 (en) 2001-07-12 2013-10-15 University Of Massachusetts In vivo production of small interfering RNAS that mediate gene silencing
US7893036B2 (en) 2001-07-12 2011-02-22 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US10731155B2 (en) 2001-07-12 2020-08-04 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
EP1462525B1 (en) * 2001-11-28 2010-10-06 Toudai Tlo, Ltd. siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE KNOCKDOWN CELL OR THE LIKE USING THE SAME
WO2003056012A1 (en) * 2001-12-24 2003-07-10 Cancer Research Technology Limited A system for stable expression of sirnas in mammalian cells
US7241618B2 (en) 2001-12-24 2007-07-10 Cancer Research Technology Limited Expression system
GB2383330B (en) * 2001-12-24 2005-05-25 Cancer Res Ventures Ltd Expression system
US8829264B2 (en) 2002-01-22 2014-09-09 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
EP1546174B1 (en) * 2002-01-22 2011-06-22 Cold Spring Harbor Laboratory Methods and compositions for rna interference
EP1546174A2 (en) 2002-01-22 2005-06-29 Cold Spring Harbor Laboratory Methods and compositions for rna interference
US9856476B2 (en) 2002-05-03 2018-01-02 Duke University Method of regulating gene expression
US9267145B2 (en) 2002-05-03 2016-02-23 Duke University Method of regulating gene expression
US10233451B2 (en) 2002-05-03 2019-03-19 Duke University Method of regulating gene expression
US9850485B2 (en) 2002-05-03 2017-12-26 Duke University Method of regulating gene expression
WO2003095652A3 (de) * 2002-05-08 2004-02-26 Xantos Biomedicine Ag Expressionskonstrukte zur herstellung von doppelstrang (ds) rna und deren anwendung
EP1546408A4 (en) * 2002-09-20 2007-10-10 Pharmacia & Upjohn Co Llc A METHOD FOR PRODUCING RANDOM RNAI LIBRARY, AND ITS APPLICATION TO CELLS BASED ON CELLS
US7892793B2 (en) 2002-11-04 2011-02-22 University Of Massachusetts Allele-specific RNA interference
WO2004094636A1 (en) * 2003-04-24 2004-11-04 Galapagos Genomics N.V. Effective sirna knock-down constructs
WO2004101788A3 (en) * 2003-05-09 2005-06-30 Univ Pittsburgh Small interfering rna libraries and methods of synthesis and use
US7524653B2 (en) 2003-05-09 2009-04-28 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Small interfering RNA libraries and methods of synthesis and use
US10604754B2 (en) 2003-06-02 2020-03-31 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
US7732593B2 (en) 2003-06-02 2010-06-08 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US7459547B2 (en) 2003-06-02 2008-12-02 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US8329892B2 (en) 2003-06-02 2012-12-11 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
US10364429B2 (en) 2003-06-02 2019-07-30 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US8309705B2 (en) 2003-06-02 2012-11-13 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
US8309704B2 (en) 2003-06-02 2012-11-13 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNAi
US8304530B2 (en) 2003-06-02 2012-11-06 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
US11459562B2 (en) 2003-06-02 2022-10-04 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US7772203B2 (en) 2003-06-02 2010-08-10 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US9121018B2 (en) 2003-06-02 2015-09-01 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
US7750144B2 (en) 2003-06-02 2010-07-06 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
US7683036B2 (en) 2003-07-31 2010-03-23 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US9139832B2 (en) 2003-07-31 2015-09-22 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8110558B2 (en) 2003-07-31 2012-02-07 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAS
US8133876B2 (en) 2003-07-31 2012-03-13 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8697663B2 (en) 2003-07-31 2014-04-15 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8178506B2 (en) 2003-07-31 2012-05-15 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US9447412B2 (en) 2003-07-31 2016-09-20 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAS
US9447413B2 (en) 2003-07-31 2016-09-20 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US9528108B2 (en) 2003-07-31 2016-12-27 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAS
US9267138B2 (en) 2003-07-31 2016-02-23 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US9663787B2 (en) 2003-07-31 2017-05-30 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US9752146B2 (en) 2003-07-31 2017-09-05 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US10072265B2 (en) 2003-07-31 2018-09-11 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8106025B2 (en) 2003-07-31 2012-01-31 Regulus Therapeutics Inc. Method for inhibiting the activity of mir-155
US10093926B2 (en) 2003-07-31 2018-10-09 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US7759319B2 (en) 2003-07-31 2010-07-20 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of pri-mirnas
US8765701B2 (en) 2003-07-31 2014-07-01 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8946179B2 (en) 2003-07-31 2015-02-03 Regulus Therapeutics, Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8466120B2 (en) 2003-07-31 2013-06-18 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of pri-miRNAs
US8809294B2 (en) 2003-07-31 2014-08-19 Regulus Therapeutics Inc. Method of inhibiting miR-33 using a modified oligonucleotide
US8546350B2 (en) 2003-07-31 2013-10-01 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US10584336B2 (en) 2003-07-31 2020-03-10 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8859521B2 (en) 2003-07-31 2014-10-14 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US11299734B2 (en) 2003-09-12 2022-04-12 University Of Massachusetts RNA interference for the treatment of gain-of-function disorders
US10344277B2 (en) 2003-09-12 2019-07-09 University Of Massachusetts RNA interference for the treatment of gain-of-function disorders
US8680063B2 (en) 2003-09-12 2014-03-25 University Of Massachusetts RNA interference for the treatment of gain-of-function disorders
US9434943B2 (en) 2003-09-12 2016-09-06 University Of Massachusetts RNA interference for the treatment of gain-of-function disorders
US9879253B2 (en) 2003-12-22 2018-01-30 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US10385339B2 (en) 2003-12-22 2019-08-20 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US8318137B2 (en) 2004-04-27 2012-11-27 Galapagos N.V. Methods, agents, and compound screening assays for inducing differentiation of undifferentiated mammalian cells into osteoblasts
US7615626B2 (en) * 2004-04-27 2009-11-10 Galapagos N.V. Methods, agents, and compound screening assays for inducing differentiation of undifferentiatied mammalian cells into osteoblasts
US10047388B2 (en) 2004-05-28 2018-08-14 Asuragen, Inc. Methods and compositions involving MicroRNA
EP2256197A1 (en) 2004-06-14 2010-12-01 Galapagos N.V. Methods for identification, and compounds useful for the treatment of degenerative and inflammatory diseases
EP2270160A1 (en) 2004-06-14 2011-01-05 Galapagos N.V. Methods for identification, and compounds useful for the treatment of degenerative and inflammatory diseases
EP2256198A1 (en) 2004-06-14 2010-12-01 Galapagos N.V. Methods for identification, and compounds useful for the treatment of degenerative and inflammatory diseases
EP2386856A2 (en) 2004-06-21 2011-11-16 Galapagos N.V. Methods and means for treatment of osteoarthritis
EP2360474A2 (en) 2004-06-21 2011-08-24 Galapagos N.V. Methods and means for treatment of osteoarthritis
WO2006006520A1 (ja) * 2004-07-09 2006-01-19 Genofunction, Inc. 新規創薬標的の探索方法
EP2360478A1 (en) 2004-10-15 2011-08-24 Galapagos N.V. Molecular targets and compounds and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases
US9068219B2 (en) 2004-11-12 2015-06-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9506061B2 (en) 2004-11-12 2016-11-29 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9051571B2 (en) 2004-11-12 2015-06-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2281887A1 (en) * 2004-11-12 2011-02-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9447414B2 (en) 2004-11-12 2016-09-20 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9382537B2 (en) 2004-11-12 2016-07-05 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US10000757B2 (en) 2005-05-27 2018-06-19 Ospedale San Raffaele S.R.L. Gene vector
US11753643B2 (en) 2005-05-27 2023-09-12 Ospedale San Raffaele S.R.L. Gene vector
WO2007000668A3 (en) * 2005-05-27 2007-12-21 San Raffaele Centro Fond Gene vector comprising mi-rna
EP3002330A1 (en) 2005-05-27 2016-04-06 Ospedale San Raffaele S.r.l. Gene vector
CN101287834A (zh) * 2005-05-27 2008-10-15 圣拉斐尔德尔蒙特塔博基金中心 基因载体
US9556438B2 (en) 2005-05-27 2017-01-31 Fondazione Centro San Raffaele Del Monte Tabor Gene vector
US7919583B2 (en) 2005-08-08 2011-04-05 Discovery Genomics, Inc. Integration-site directed vector systems
US9914924B2 (en) 2005-08-18 2018-03-13 University Of Massachusetts Methods and compositions for treating neurological disease
US8309533B2 (en) 2005-09-30 2012-11-13 University Of Massachusetts Allele-specific RNA interference
EP2002037A4 (en) * 2006-03-07 2010-03-10 Univ Pennsylvania RNAI LIBRARIES, METHOD FOR CREATING THEM AND SCREENING METHODS THEREWITH
US9163231B2 (en) 2006-03-07 2015-10-20 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
US9982256B2 (en) 2006-03-07 2018-05-29 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
AU2007223980B2 (en) * 2006-03-07 2014-01-09 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
AU2014202015B2 (en) * 2006-03-07 2016-06-02 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
EP2543738A3 (en) * 2006-03-07 2013-04-24 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
EP2292739A1 (fr) 2006-03-24 2011-03-09 Institut National De La Recherche Agronomique Procédé de préparation de cellules aviaires differenciées et gènes impliqués dans le maintien de la pluripotence
US8637257B2 (en) 2007-06-20 2014-01-28 Galapagos Nv Molecular targets and compounds, and methods to identify the same, useful in the treatment of bone and joint degenerative diseases
WO2008155397A2 (en) 2007-06-20 2008-12-24 Galapagos N.V. Molecular targets and compounds, and methods to identify the same, useful in the treatment of bone and joint degenerative diseases
EP2565649A1 (en) 2007-06-20 2013-03-06 Galapagos N.V. Molecular targets and compounds, and methods to identify the same, useful in the treatment of bone and joint degenerative diseases
JP2008000137A (ja) * 2007-07-17 2008-01-10 Aichi Prefecture 癌の遺伝子治療ベクター及び癌治療用医薬組成物
US9080215B2 (en) 2007-09-14 2015-07-14 Asuragen, Inc. MicroRNAs differentially expressed in cervical cancer and uses thereof
US9365852B2 (en) 2008-05-08 2016-06-14 Mirna Therapeutics, Inc. Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US8309791B2 (en) 2008-07-16 2012-11-13 Recombinectics, Inc. Method for producing a transgenic pig using a hyper-methylated transposon
US8785718B2 (en) 2008-07-16 2014-07-22 Recombinetics, Inc. Methods for producing genetically modified animals using hypermethylated transposons
EP2816113A2 (en) 2008-09-11 2014-12-24 Galapagos N.V. Method for identifying compounds useful for increasing the functional activity and cell surface expression of CF-associated mutant cystic fibrosis transmembrane conductance regulator
WO2010115841A1 (en) 2009-04-01 2010-10-14 Galapagos Nv Methods and means for treatment of osteoarthritis
US9951337B2 (en) 2009-04-01 2018-04-24 Galapagos Nv Methods and means for treatment of osteoarthritis
US8663930B2 (en) 2009-04-01 2014-03-04 Galapagos Nv Methods and means for treatment of osteoarthritis
EP3043179A1 (en) 2009-04-01 2016-07-13 Galapagos N.V. Methods and means for treatment of osteoarthritis
WO2011015572A1 (en) 2009-08-03 2011-02-10 Galapagos Nv Molecular targets and compounds, and methods to identify the same, useful in the treatment of neurodegenerative diseases
WO2011015573A1 (en) 2009-08-03 2011-02-10 Galapagos Nv Molecular targets and compounds, and methods to identify the same, useful in the treatment of neurodegenerative diseases
WO2011054922A1 (en) 2009-11-05 2011-05-12 Galapagos Nv Salts of fused pyrazine compounds, useful for the treatment of degenerative and inflammatory diseases.
WO2011095495A1 (en) * 2010-02-05 2011-08-11 F. Hoffmann-La Roche Ag Compositions and methods for inhibiting expression of ikk2 genes
US9624494B2 (en) 2010-04-23 2017-04-18 Cold Spring Harbor Laboratory Structurally designed shRNAs
US12351802B2 (en) 2010-04-23 2025-07-08 Cold Spring Harbor Laboratory Structurally designed shRNAs
US10329562B2 (en) 2010-04-23 2019-06-25 Cold Spring Harbor Laboratory Structurally designed shRNAs
EP3502254A1 (en) * 2010-04-23 2019-06-26 Cold Spring Harbor Laboratory Novel structurally designed shrnas
US11753641B2 (en) 2010-04-23 2023-09-12 Cold Spring Harbor Laboratory Structurally designed shRNAs
US8993532B2 (en) 2010-04-23 2015-03-31 Cold Spring Harbor Laboratory Structurally designed shRNAs
EP2561078A4 (en) * 2010-04-23 2014-10-15 Cold Spring Harbor Lab NEW STRUCTURAL DESIGNED SHRNAS
US8946176B2 (en) 2010-10-18 2015-02-03 Arrowhead Research Corporation Compositions and methods for inhibiting expression of RRM2 genes
US9938531B2 (en) 2010-10-18 2018-04-10 Arrowhead Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of RRM2 genes
US11920134B2 (en) 2010-10-18 2024-03-05 Arrowhead Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of RRM2 genes
US10619160B2 (en) 2010-10-18 2020-04-14 Arrowhead Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of RRM2 genes
US8809293B2 (en) 2011-06-30 2014-08-19 Arrowhead Madison Inc. Compositions and methods for inhibiting gene expression of hepatitis B virus
USRE48345E1 (en) 2011-06-30 2020-12-08 Arrowhead Pharmaceuticals Inc. Compositions and methods for inhibiting gene expression of hepatitis B virus
US10655184B2 (en) 2011-09-13 2020-05-19 Interpace Diagnostics, Llc Methods and compositions involving miR-135b for distinguishing pancreatic cancer from benign pancreatic disease
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
US10227588B2 (en) 2013-10-04 2019-03-12 Novartis Ag 3′end caps for RNAi agents for use in RNA interference
US11008570B2 (en) 2013-10-04 2021-05-18 Novartis Ag 3′ end caps for RNAi agents for use in RNA interference
US10519446B2 (en) 2013-10-04 2019-12-31 Novartis Ag Organic compounds to treat hepatitis B virus
US9988627B2 (en) 2013-10-04 2018-06-05 Novartis Ag Formats for organic compounds for use in RNA interference
US10130651B2 (en) 2015-08-07 2018-11-20 Arrowhead Pharmaceuticals, Inc. RNAi Therapy for Hepatitis B Virus Infection
US11534453B2 (en) 2015-08-07 2022-12-27 Arrowhead Pharmaceuticals, Inc. RNAi therapy for hepatitis B virus infection
US10806750B2 (en) 2015-08-07 2020-10-20 Arrowhead Pharmaceuticals, Inc. RNAi therapy for hepatitis B virus infection
US11517584B2 (en) 2016-08-04 2022-12-06 Arrowhead Pharmaceuticals, Inc. RNAi agents for Hepatitis B virus infection
US11590156B2 (en) 2016-08-04 2023-02-28 Arrowhead Pharmaceuticals, Inc. RNAi agents for hepatitis B virus infection
CN109456995A (zh) * 2018-11-08 2019-03-12 杜以军 基因敲除质粒、细胞系及制备方法和应用

Also Published As

Publication number Publication date
DE60225586T2 (de) 2009-04-02
EP1444346B2 (en) 2015-06-24
EP1444346B1 (en) 2008-03-12
JP2005501557A (ja) 2005-01-20
ATE389016T2 (de) 2008-03-15
DE60225586T3 (de) 2015-12-03
AU2002339458A1 (en) 2003-03-18
WO2003020931A3 (en) 2003-11-20
DE60225586D1 (https=) 2008-04-24
CA2457419A1 (en) 2003-03-13
US20050214851A1 (en) 2005-09-29
EP1444346A2 (en) 2004-08-11
US20030198627A1 (en) 2003-10-23

Similar Documents

Publication Publication Date Title
EP1444346B1 (en) Sirna knockout assay method and constructs
US10233451B2 (en) Method of regulating gene expression
EP1462525B1 (en) siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE KNOCKDOWN CELL OR THE LIKE USING THE SAME
AU2003254151B2 (en) Novel siRNA libraries and their production and use
US20050197315A1 (en) siRNA expression system and method for producing functional gene knock-down cell using the system
US20100184207A1 (en) Methods for producing interfering rna molecules in mammalian cells and therapeutic uses for such molecules
CA2509636A1 (en) Rna interference
US7776569B2 (en) Virally-encoded RNAs as substrates, inhibitors and delivery vehicles for RNAi
US20070122798A1 (en) Methods and tools for screening active rna in cellulo
GB2448994A (en) shRNA sequences

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2457419

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003525634

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002776950

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002776950

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 2002776950

Country of ref document: EP