WO2003020220A2 - Mitochondrial biology expression arrays - Google Patents
Mitochondrial biology expression arrays Download PDFInfo
- Publication number
- WO2003020220A2 WO2003020220A2 PCT/US2002/027886 US0227886W WO03020220A2 WO 2003020220 A2 WO2003020220 A2 WO 2003020220A2 US 0227886 W US0227886 W US 0227886W WO 03020220 A2 WO03020220 A2 WO 03020220A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- array
- sample
- genes
- nucleic acid
- hybridization
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- Mitochondrial disorders are a complex and polygenic group of conditions with the patient's symptoms varying due to differences in energetic threshold effect of various tissues and the stochastic nature of mtDNA segregation. Consequently, most mitochondrial disorders are best classified by their genetic cause rather than a biochemical or phenotypic profile (Shoffher, J. M., and Wallace, D. C, (1995) "Oxidative phosphorylation diseases," In The Metabolic and Molecular Basis of Inherited Disease. C. R. Scriver, A. L. Beaudet, W. S. Sly and D. Valle, eds. (New York: McGraw-Hill), pp.1535-1609; Wallace, D.
- DNA microarray analysis has been used to study diffuse large B-cell lymphoma (DLBCL) where microarrays were used to expand the diagnosis of DLBCL (Alizadeh , A. A. et al., "Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling," [2000] Nature 403:503-11). While standard histological and morphological techniques had defined subsets of DLBCL, array analysis revealed two clinically distinct classes. These two newly discovered classes were indistinguishable by standard pathology, but expression analysis showed a differential expression of hundreds of genes.
- DLBCL diffuse large B-cell lymphoma
- Mitochondrial DNA sequences have been associated with pathologies as described in U.S. patent numbers 5,670,320, 5,296,349, 5,185,244, and 5,494,794. Publications on the subject of mitochondrial biology include: Scheffler I.E. (1999) Mitochondria, Wiley-Liss, NY; Lestienne, P., Ed. (1999) Mitochondrial Diseases: Models and Methods, Springer- Verlag, Berlin; Methods in Enzymology (2000) 322:Section V Mitochondria and Apoptosis, Academic Press, CA; Mitochondria and Cell Death (1999) Princeton University Press, NJ; Papa S, Ferruciio G, and Tager J Eds.
- Nucleic acid arrays have been described, e.g., in patent nos. U.S. 5,837,832, U.S. 5,807,522, U.S. 6,007,987, U.S. 6,110,426, WO 99/05324, 99/05591, WO 00/58516, WO 95/11995, WO 95/35505A1, WO 99/42813, JP10503841T2, GR3030430T3, ES2134481T3, EP804731B1, DE69509925C0, CA2192095AA, AU2862995A1, AU709276B2, AT180570, EP 1066506, and AU 2780499.
- Such arrays can be incorporated into computerized methods for analyzing hybridization results when the arrays are contacted with prepared sample nucleotides, e.g., as described in PCT Publication WO 99/05574, and U.S. Patents 5,754,524; 6228,575; 5,593,839; and 5,856,101.
- Methods for screening for disease markers are also known to the art, e.g., as described in U.S. Patents 6,228,586; 6,160,104; 6,083,698; 6,268,398; 6,228,578; and 6,265,174. All references cited herein are incorporated by reference in their entirety to the extent that they are not inconsistent with the disclosure herein. Citation of the above documents is not an admission that any of them are pertinent prior art.
- This invention provides a library of genes involved in mitochondrial biology, arrays containing probes for genes involved in mitochondrial biology, methods for making such arrays, and methods of using such arrays. Genes and probe sequences involved in mitochondrial biology in humans and mice are provided.
- the arrays of this invention are useful for deterarining mitochondrial biology gene expression profiles. Mitochondrial biology gene expression profiles are useful for determining expression profiles diagnostic of energy metabolism-related physiological conditions; diagnosing such physiological conditions; identifying biochemical pathways, genes, and mutations involved in such physiological conditions; identifying therapeutic agents useful for preventing and/or treating such physiological conditions; evaluating and/or monitoring the efficacy of such therapies; and creating and identifying animal models of human energy metabolism-related physiological conditions.
- Arrays containing probes for all genes known to be involved in mitochondrial biology are provided, as well as arrays containing subsets of such probes.
- the mitochondrial biology expression arrays of this invention contain probes of genes not previously recognized to participate in mitochondrial biology.
- FIG. 1 is a diagram of the mammalian mitochondrion showing mitochonrial energetics, and the relationship between energy production, reactive oxygen species (ROS) generation, and regulation of apoptosis.
- ROS reactive oxygen species
- FIG. 2 is a depiction of a hybridized mouse array of this invention.
- the picture of the hybridized array shows the image generated when the two channels representing the control or reference and experimental targets are overlaid. When viewed in color, the spots appear various shades of red, green and yellow. Red spots indicate a predominance of hybridization to control cDNAs, while green spots indicate the predominance of hybridization to the experimental target sample. Yellow spots indicate an equal hybridization of both samples. Spots that are yellow-green or orange when the array is shown in color are depicted as half yellow and green, or half red and yellow, respectively.
- FIG. 3 shows the pO LMEB4 cell line gene expression scatter plot. The scatter plot shows the distribution of gene expression ratio for the pO LMEB4 sample.
- the diagonal dotted line indicates a ratio of 1 between the two samples. Any spot above the dotted line is up-regulated or more abundant in the pO LMEB4 experimental sample compared to the LM(TK) - control. Any spot below the dotted line is down-regulated or less abundant in the experimental sample compared to the control.
- FIG. 4 shows NZB heart gene expression scatter plot.
- the scatter plot shows the distribution of gene expression ratio for the NZB heart tissue sample.
- the diagonal dotted line indicates a ratio of 1 between the two samples. Any spot above the dotted line is up- regulated or more abundant in the NZB-mtDNA heart experimental sample compared to the "common" mtDNA control heart. Any spot below the dotted line is down-regulated or less abundant in the experimental sample compared to the control.
- DNA microarrays provide a means to profile the expression patterns of up to thousands of genes simultaneously, and knowing where and when a gene is expressed often provides insight into its biological function. The pattern of gene expression in a particular tissue or cell type can also provide detailed information about its state or condition.
- DNA microarrays are the most efficient method to monitor correlative changes in gene expression and to investigate complex traits on a molecular level.
- Expression profiles assembled from multiple interrelated experiments are used to determine hierarchical connections between gene expression patterns underlying complex biological traits. These patterns are used to further define the molecular basis of complex disorders.
- the mitochondrion is assembled from approximately 1000 protein-coding nuclear DNA (nDNA) and mitochondrial DNA (mtDNA) genes. Thirteen protein-coding mitochondrial genes are known, as shown in Table 1.
- the codon usage table of the mtDNA is known. It differs slightly from the universal code. For example, UGA codes for tryptophan instead of termination, AUA codes for methionine instead of isoleucine, and AGA and AGG are terminators instead of coding for arginine.
- gene refers to a unigene cluster, an expressed sequence, or a sequence that is transcribed and translated into a protein. Another word used in the art for “gene” is “locus.”
- the National Institutes of Health (NIH) have instituted the term “unigene cluster” to refer to non-redundant sets of gene clusters.
- a stretch of DNA may be transcribed into several splice variants that share sequences, and these would be designated as belonging to one unigene cluster.
- splice variant refers to one version of several transcripts that are transcribed from one gene.
- housekeeping gene refers to a gene that is expressed at a similar level in almost all cell types.
- genes involved in mitochondrial biology refers to mitochondrial genes and nuclear genes involved in cellular structures and functions such as intermediary metabolism, OXPHOS, mitochondrial transport, cellular bioenergetics, cellular biogenesis, cell cycle control, DNA replication, energy, metabolism, heat shock, stress, cellular matrix, cellular structural proteins, protein synthesis and translational control, signal transduction, transcription and transcriptional regulation, chromatin structure, reactive bxygen species (ROS) biology, and apoptosis.
- ROS reactive bxygen species
- mtDNA means mitochondrial DNA.
- nDNA means nuclear DNA.
- mitochondrial biology expression profile refers to the expression patterns of genes involved in mitochondrial biology, such as is detected by probes derived from those genes, in a sample.
- the profile can be said to be of the sample or of the source from which the sample is derived.
- a profile may be measured independently, but a profile may also measured relative to a standard or control or other sample.
- a complete mitochondrial biology expression profile includes data on all genes known to be involved in mitochondrial biology for the species from which the sample is derived.
- the mitochondrial biology expression profile for a selected physiological condition is at least the expression pattern of genes determined to have altered expression diagnostic of that physiological condition, but the expression pattern of additional genes involved in mitochondrial biology may also be included.
- array refers to an ordered set of isolated nucleic acid molecules or spots consisting of pluralities of substantially identical isolated nucleic acid molecules. Preferably the molecules are attached to a substrate. The spots or molecules are ordered so that the location of each (on the substrate) is known and the identity of each is known. Arrays on a micro scale can be called microarrays. Microarrays on solid substrates, such as glass or other ceramic slides, can be called gene chips or chips.
- an "isolated nucleic acid” is a nucleic acid outside of the context in which it is found in nature.
- An isolated nucleic acid is a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid molecule.
- the term covers, for example: (a) a DNA which has the sequence of part of a naturally-occurring genomic DNA molecule but is not flanked by both of the coding or noncoding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally-occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein, or a modified gene having a sequence not found in nature.
- a DNA which has the sequence of part of a naturally-occurring genomic DNA molecule but is
- probe refers to an isolated nucleic acid that is suitable for hybridizing to other nucleic acids when placed on a solid substrate.
- Probes for arrays can be as short as 20-30 nucleotides and up to as long as several thousand nucleotides. Probes can be single-stranded or double stranded.
- a probe usually comprises at least a partially known sequence that is used to investigate or interrogate the presence, absence, and/or amount of a complementing sequence. On the arrays of this invention, a probe is of such a sequence and the hybridization conditions of such stringency that each probe hybridizes substantially to only one type of nucleic acid per target sample.
- target or “target sample” refers to the collection of nucleic acids, e.g., reverse transcribed and labeled cDNA used as a prepared sample for array analysis.
- the target is interrogated by the probes of the array.
- a “target” or “target sample” may be a mixture of several prepared samples that are combined.
- an experimental target sample may be combined with a differently labeled control sample and hybridized to an array, the combined samples being referred to as the "target” interrogated by the probes of the array.
- interrogated means tested. Probes, targets, and hybridization conditions are chosen such that the probes are capable of interrogating the target, i.e., of hybridizing to complementary sequences in the target sample.
- physiological condition refers to a healthy or unhealthy physiological state.
- optimal an array for diagnosis refers to selecting probes for an array such that only probes from genes necessary for diagnosis of one or more physiological conditions are included.
- printing refers to the process of applying probes to a solid substrate, e.g., or applying arrays of probes to a solid substrate to make a gene chip.
- glass slide refers to a small piece of glass of the same dimensions as a standard microscope slide.
- prepared substrate refers to a substrate that is prepared with a substance capable of serving as an attachment medium for attaching the probes to the substrate, such as poly Lysine.
- selective hybridization refers to hybridization at moderate to high stringency such that only sequences of an appropriate homology can remain bound. Selective hybridization is hybridization performed at stringency conditions such that probes only hybridize to target sample nucleic acids that they are intended to hybridize with. Depending on the sequences of the probes and the target, the hybridization conditions are chosen to be appropriately selective. For example, if human sequences are used as probes for interrogating a human sample, selective hybridization could be at high stringency because, allowing for neutral polymorphism in humans, the sequences would be about 99-100% identical. When applying a chimpanzee target prepared sample to an array containing human sequence probes, selective hybridization would be at a lower stringency.
- hybridizing a target to an array is performed at one chosen hybridization stringency, probes are chosen so that they can undergo selective hybridization with the appropriate target molecules at the same hybridization stringency.
- homology refers to nucleotide sequence identity to a sequence, a molecule, or its complement.
- mouse sample refers to a sample derived from a mouse or a cell line derived from a mouse.
- human sample refers to a sample derived from a human or a cell line derived from a human.
- Samples preferably contain total RNA or messenger RNA (mRNA).
- total RNA refers to a combination of several types of RNA, including mRNA, from a cell or a group of cell.
- mRNA refers to messenger RNA or RNA that has a 3' poly A tail.
- a "prepared sample” or a “target” refers to a sample that has been labeled in preparation for array hybridization.
- a "prepared sample” or “target” is reverse transcribed and fluorescently labeled.
- standard refers to a sample or a dataset that is commonly used for comparison to unknown samples so that the unknown samples or datasets can be standardized for comparison to each other.
- control sample and reference sample refer to samples that are used for comparison against an experimental sample.
- clone refers to an isolated nucleic acid molecule that may be stored in an organism such as E. coli.
- a clone is usually made of a vector and an insert.
- the insert usually contains a sequence of interest.
- mitochondrial diseases the accuracy of current biochemical and phenotypic techniques has proven quite limited in distinguishing and diagnosing the various disorders.
- Recent technical and analytical advancements make it practical to analyze and quantitate the expression patterns of thousands of genes at once using arrays such as DNA microarrays.
- This invention applies these array techniques to the study of mitochondrial gene expression, in the design of specialized microarrays containing genes involved in mitochondrial biology.
- the arrays of this invention contain probes for genes not previously recognized to participate in mitochondrial biology.
- Genes, or expressed sequences, involved in mitochondrial biology are involved in cellular structures and functions such as intermediary metabolism, OXPHOS, transport, cellular bioenergetics, cellular biogenesis, cell cycle control, DNA replication, energy, metabolism, heat shock, stress, cellular matrix, cellular structural proteins, protein synthesis and translational control, signal transduction, transcription and transcriptional regulation, chromatin structure, reactive oxygen species (ROS) biology and apoptosis. Alterations in mitochondrial functions are associated with a variety of physiological conditions including degenerative diseases. These functions are involved in many degenerative diseases. This invention provides a compilation of sequences involved in human and mouse mitochondrial biology.
- the genes in the arrays of this invention were identified by a variety of techniques including searching databanks for sequences related to genes involved in processes similar to mitochondrial biology such as homologues of prokaryotic genes, and screening mitochondrial mutant cell lines and animal lines for genes having altered expression patterns.
- a relevant gene was identified for one species, such as the mouse, the homologue for a second species, such as human, if known, was then included on the list of genes involved in mitochondrial biology for the second species.
- Mitochondrial mutant cell lines are cell lines that have at least one mutation in a gene involved in mitochondrial biology.
- the microarrays or gene chips of this invention comprise probes placed in known positions on a solid substrate.
- a useful solid substrate is a specialized glass microscope shde.
- the arrays of this invention include arrays containing probes that detect some or all expressed sequences involved in mitochondrial biology in a selected species.
- Arrays of this invention may contain control probes as well as probes for genes involved in mitochondrial biology.
- Controls that can be included on the arrays of this invention include hybridization controls and scanning controls. The controls can be positive or negative controls.
- One type of hybridization control is spotting the same probe for a gene involved in mitochondrial biology several times on one chip, each spot having different amounts of probe. This allows for the amount of probe of a given sequence to be optimized.
- Dimethyl sulfoxide can be used as a negative hybridization and scanning control.
- a spot of DMSO should give no signal. If there is any signal at a DMSO spot, the problem could be at hybridization or scanning steps.
- Plant sequences having sufficiently low homology with human and mouse sequences can be utilized as negative hybridization and scanning controls. Plant sequences should not give any signal.
- a signal at a plant spot could indicate a problem with hybridization, i.e. too low a hybridization stringency was used, or with scanning, i.e., the chip was inserted into the scanner at the incorrect orientation.
- Poly A can be used as a positive hybridization specificity/non specificity control.
- a poly A spot should always give intense hybridization. No signal at a poly A spot could be the result of use of too high a hybridization stringency.
- Cy3 or Cy5 incorporated into a PCR product can be a positive scanning control.
- a spot on an array of a PCR product, or any other nucleic acid, that includes fluorescent label, should always give a signal, and if this sequence has no homology with any other sequence in the target, there should only be a signal of the label included in the nucleic acid.
- Control probes and probes for genes involved in mitochondrial biology can be duplicated, triplicated, etc. on the chip as printing controls. Controls for arrays can be purchased from Stratagene (SpotReportTM, La Jolla, CA, USA).
- Standard targets and reference targets are also useful with the arrays of this invention, as is known in the art.
- the results of the test are measured, i.e. by scanning, and recorded. These results can be compared directly to other test results using a similar array. However, it is much more accurate to include a differently labeled standard target in the hybridization mix with the prepared sample target.
- the results of the experimental sample target are then standardized, so that they can be compared accurately to the results of hybridizations of other sample targets. If ten different prepared sample targets are hybridized to arrays of this invention, simultaneously with the same prepared standard target, then the results of the ten sample targets can be accurately compared to each other.
- a prepared reference or control target for comparison can also be particularly pertinent to the experiment being performed.
- a prepared reference target could be a target sample derived from the same cell type from an animal of the same sex, age, and nuclear background as the experimental target sample, except for one difference, such as a different phenotype or treatment. Comparing the results of the experimental target with the results of an appropriate reference target yields a profile associated with the one difference being tested.
- the comparison can occur while the hybridization results of the first sample are being measured and recorded, or afterwards, by comparing the measured and recorded hybridization results of the two samples.
- Probes on an array may be as short as about 20-30 nucleotides long or as long as the entire gene or clone from which they are derived, which may be up to several kilobases.
- a probe sequence may be identical (have 100% homology) to the portion of the gene it hybridizes to or it may be a mutated sequence. Mutated probes have less than 100% homology, such as about 98% homology, about 95% homology, about 90% homology, about 80% homology, or about 75% homology, or less, with the portions of the genes to which they hybridize.
- Arrays are designed such that all probes on an array can hybridize to their corresponding genes at about the same hybridization stringency.
- Probes for arrays used for interrogating samples usually do not contain sequences such as repetitive sequences that would hybridize substantially with nucleic acids derived from more than one gene, i.e., transcripts or cDNAs. Probes for arrays should be unique at the hybridization stringencies used. Statistically, to be unique in the total human genome, probes should be at least about fifteen nucleotides long. A unique probe is only able to hybridize with one type of nucleic acid per target. A probe is not unique if at the hybridization stringency used, it hybridizes with nucleic acids derived from two different genes, i.e. related genes. The homology of the sequence of the probe to the gene and the hybridization stringency used help determine whether a probe is unique when testing a selected sample.
- Probes also may not hybridize with different nucleic acids derived from the same gene, i.e., splice variants.
- the location in the gene of the sequence used for the probe also helps detera ⁇ ies whether a probe is unique when testing a selected sample. If the splice variants of a gene are known, ideally several different probes sequences are chosen from that gene for an array, such that each probe can only hybridize to nucleic acid derived from one of the splice variants. References for sequences of probes useful for arrays of this invention are compiled in Tables 3-5 and in the sequence listings. Other equivalent probes derived from the gene sequences from which the Tables 3-5 probes are derived, are also useful for the arrays of this invention.
- Arrays of this invention are used at hybridization conditions allowing for selective hybridization.
- probes hybridize with nucleic acid from only one gene.
- each probe may hybridize with a nucleic acid in each prepared sample or target.
- these two nucleic acids are from the same unigene cluster, the probe is said to hybridize with one gene, despite the fact that these nucleic acids may contain different labels.
- Sequences of genes involved in mitochondrial biology from other species can be used to make probes that are useful in the arrays of this invention as long as they hybridize at about the same hybridization stringency as other probes on an array. Sequences that are only able to hybridize at a substantially lower stringency, such as plant sequences, are useful as negative controls.
- the arrays of this invention can be utilized to determine profiles for related species by modifying the hybridization stringency appropriately. Sequence homology between organisms is known in the art. For example, human and chimpanzee sequences are about 98% identical. Consequently, human arrays are useful for profiling chimpanzees, with an appropriate lowering of the hybridization stringency.
- Hybridization stringency can be lowered by modifying hybridization components such as salt concentrations and hybridization and/or wash temperatures, as is known in the art.
- sequences useful for the arrays of this invention are useful for designing arrays for other species as well.
- the known sequences from the new organism including expressed sequence tags (ESTs)
- ESTs expressed sequence tags
- Sequence comparisons may be performed at the nucleic acid or polypeptide level.
- Homologous and analogous sequences from the new organism are thereby identified and selected for the new organism's mitochondrial array.
- the probes on the arrays of this invention are also useful as probes for identifying candidates for the new organism's array using molecular biology techniques that are standard in the art such as screening libraries. All sequences given herein are meant to encompass the complementary strand, as well as double-stranded polynucleotides comprising the given sequence.
- Microarrays of this invention can contain as few as two probes to as many as all the probes diagnostic of the selected physiological condition to be tested. Microarrays of this invention may also contain probes for all genes involved in mitochondrial biology.
- the arrays of this invention may contain probes for at least about five genes, at least about ten genes, at least about twenty-five genes, at least about fifty genes, at least about 100 genes, at least about 500 genes, or at least about 1000 genes.
- the mouse array may contain probes for at least about 950 genes and the human array may contain probes for at least about 600 genes.
- Arrays of this invention may comprise more than about five spots, more than about ten spots, more than about twenty-five spots, more than about one hundred spots, more than about 500 spots, or more than about 1000 spots.
- microarrays may require amplification of target sequences (generation of multiple copies of the same sequence) of sequences of interest, such as by PCR or reverse transcription.
- target sequences generation of multiple copies of the same sequence
- PCR or reverse transcription As the nucleic acid is copied, it is tagged with a fluorescent label that emits light like a light bulb.
- the labeled nucleic acid is introduced to the microarray and allowed to react for a period of time. This nucleic acid sticks to, or hybridizes, with the probes on the array when the probe is sufficiently complementary to the labeled, amplified, sample nucleic acid. The extra nucleic acid is washed off of the array, leaving behind only the nucleic acid that has bound to the probes.
- Arrays of this invention may be made by any array synthesis methods known in the art such as spotting technology or solid phase synthesis. Preferably the arrays of this invention are synthesized by solid phase synthesis using a combination of photolithography and combinatorial chemistry. Some of the key elements of probe selection and array design are common to the production of all arrays. Strategies to optimize probe hybridization, for example, are invariably included in the process of probe selection. Hybridization under particular pH, salt, and temperature conditions can be optimized by taking into account melting temperatures and by using empirical rules that correlate with desired hybridization behaviors. Computer models may be used for predicting the intensity and concentration- dependence of probe hybridization.
- Arrays also called DNA microarrays or DNA chips, are fabricated by high-speed robotics, generally on glass but sometimes on nylon substrates, for which probes (Phimister, B. (1999) Nature Genetics 2 Is: 1-60) with known identity are used to determine complementary binding.
- An experiment with a single DNA chip can provide researchers information on thousands of genes simultaneously.
- Many strategies have been investigated at each of these steps: 1) DNA types; 2) Chip fabrication; 3) Sample preparation; 4) Assay; 5) Readout; and 6) Software (informatics).
- Format I consists of probe cDNA (500 ⁇ 5,000 bases long) immobilized to a solid surface such as glass using robot spotting and exposed to a set of targets either separately or in a mixture. This method, "traditionally” called DNA microarray, is widely considered as having been developed at Stanford University. (R. Ekins and F.W. Chu "Microarrays: their origins and applications,” [1999] Trends in Biotechnology, 17:217-218).
- Format II consists of an array of oligonucleotide (20 ⁇ 80-mer oligos) or peptide nucleic acid (PNA) probes synthesized either in situ (on-chip) or by conventional synthesis followed by on-chip immobilization. The array is exposed to labeled sample DNA, hybridized, and the identity/abundance of complementary sequences is determined.
- This method "historically” called DNA chips, was developed at Affymetrix, Inc., which sells its photolithographically fabricated products under the GeneChip ® trademark. Many companies are manufacturing oligonucleotide-based chips using alternative in-situ synthesis or depositioning technologies.
- Probes on arrays can be hybridized with fluorescently-labeled target polynucleotides and the hybridized array can be scanned by means of scanning fluorescence microscopy.
- the fluorescence patterns are then analyzed by an algorithm that determines the extent of mismatch content, identifies polymorphisms, and provides some general sequencing information (M. Chee et al., [1996] Science 274:610). Selectivity is afforded in this system by low stringency washes to rinse away non-selectively adsorbed materials. Subsequent analysis of relative binding signals from array elements determines where base-pair mismatches may exist. This method then relies on conventional chemical methods to maximize stringency, and automated pattern recognition processing is used to discriminate between fully complementary and partially complementary binding.
- Devices such as standard nucleic acid microarrays or gene chips, require data processing algorithms and the use of sample redundancy (i.e., many of the same types of array elements for statistically significant data interpretation and avoidance of anomalies) to provide semi-quantitative analysis of polymorphisms or levels of mismatch between the target sequence and sequences immobilized on the device surface.
- sample redundancy i.e., many of the same types of array elements for statistically significant data interpretation and avoidance of anomalies
- Such algorithms and software useful for statistical analysis are known to the art.
- microarrays first requires amplification (generation of multiple copies of the same gene) of genes of interest, such as by reverse transcription.
- the nucleic acid is copied, it is tagged with a fluorescent label that emits light like a light bulb.
- the labeled nucleic acid is introduced to the microarray and allowed to react for a period of time. This nucleic acid sticks to, or hybridizes, with the probes on the array when the probe is sufficiently complementary to the nucleic acid in the prepared sample. The extra nucleic acid is washed off of the array, leaving behind only the nucleic acid that has bound to the probes.
- Detecting a particular polymorphism can be accomplished using two probes.
- One probe is designed to be perfectly complementary to a target sequence, and a partner probe is generated that is identical except for a single base mismatch in its center.
- these probe pairs are called the Perfect Match probe (PM) and the Mismatch probe (MM). They allow for the quantitation and subtraction of signals caused by non-specific cross-hybridization.
- the difference in hybridization signals between the partners, as well as their intensity ratios, serve as indicators of specific target abundance, and consequently of the sequence.
- Arrays can rely on multiple probes to interrogate individual nucleotides in a sequence.
- the identity of a target base can be deduced using four identical probes that vary only in the target position, each containing one of the four possible bases.
- the presence of a consensus sequence can be tested using one or two probes representing specific alleles.
- arrays with many probes can be created to provide redundant information, resulting in unequivocal genotyping.
- Probes fixed on solid substrates and targets are combined in a hybridization buffer solution and held at an appropriate temperature until annealing occurs. Thereafter, the substrate is washed free of extraneous materials, leaving the nucleic acids on the target bound to the fixed probe molecules allowing for detection and quantitation by methods known in the art such as by autoradiograph, liquid scintillation counting, and/or fluorescence. As improvements are made in hybridization and detection techniques, they can be readily applied by one of ordinary skill in the art.
- the probe molecules and target molecules hybridize by forming a strong non- covalent bond between the two molecules, it can be reasonably assumed that the probe and target nucleic acid are essentially identical, or almost completely complementary if the annealing and washing steps are carried out under conditions of high stringency.
- the detectable label provides a means for determining whether hybridization has occurred.
- the probes may be labeled.
- the target may instead be labeled by means known to the art.
- Target may be labeled with radioactive or non-radioactive labels.
- Targets preferably contain fluorescent labels.
- Moderate to high stringency conditions for hybridization are known to the art.
- An example of high stringency conditions for a blot are hybridizing at 68° C in 5X SSC/5X Denhardt's solution 0.1% SDS, and washing in 0.2X SSC/0.1% SDS at room temperature.
- An example of conditions of moderate stringency are hybridizing at 68° C in 5X SSC/5X Denhardt's solution 0.1% SDS and washing at 42° C in 3X SSC.
- the parameters of temperature and salt concentration can be varied to achieve the desired level of sequence identity between probe and target nucleic acid. See, e.g., Sambrook et al. (1989) vide infra or Ausubel et al. (1995) Current Protocols in Molecular Biology. John Wiley & Sons, NY, NY, for further guidance on hybridization conditions.
- the melting temperature is described by the following formula (Beltz, G.A. et al., [1983] Methods of Enzvmology. R. Wu, L. Grossman and K. Moldave [Eds.] Academic Press, New York 100:266-285).
- Tm 81.5o C + 16.6 LogrNa+]+0.41(+G+C)-0.61(%formamide)-600/length of duplex in base pairs.
- Washes can typically be carried out as follows: twice at room temperature for 15 minutes in IX SSPE, 0.1% SDS (low stringency wash), and once at TM-20o C for 15 minutes in 0.2X SSPE, 0.1% SDS (moderate stringency wash).
- Nucleic acid useful in this invention can be created by Polymerase Chain Reaction (PCR) amplification. PCR products can be confirmed by agarose gel electrophoresis. PCR is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al.
- PCR is used to enzymatically amplify a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence.
- the primers are oriented with the 3' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA template produced in the previous cycle.
- thermostable DNA polymerase such as the Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus
- the amplification process can be completely automated.
- Other enzymes that can be used are known to those skilled in the art.
- Polynucleotide sequences of the present invention can be truncated and/or mutated such that certain of the resulting fragments and/or mutants of the original full-length sequence can retain the desired characteristics of the full-length sequence.
- restriction enzymes that are suitable for generating fragments from larger nucleic acid molecules are well known.
- Bal31 exonuclease can be conveniently used for time-controlled limited digestion of DNA. See, for example, Maniatis (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, New York, pages 135-139, incorporated herein by reference. See also Wei et al. (1983) J. Biol. Chem. 258:13006-13512.
- Bal31 exonuclease commonly referred to as "erase-a- base” procedures
- the ordinarily skilled artisan can remove nucleotides from either or both ends of the subject nucleic acids to generate a wide spectrum of fragments that are functionally equivalent to the subject nucleotide sequences.
- One of ordinary skill in the art can, in this manner, generate hundreds of fragments of controlled, varying lengths from locations all along the original molecule.
- the ordinarily skilled artisan can routinely test or screen the generated fragments for their characteristics and determine the utility of the fragments as taught herein. It is also well known that the mutant sequences can be easily produced with site-directed mutagenesis. See, for example, Larionov, O.A.
- mutational, insertional, and deletional variants of the disclosed nucleotide sequences can be readily prepared by methods which are well known to those skilled in the art. These variants can be used in the same manner as the exemplified primer sequences so long as the variants have substantial sequence homology with the original sequence.
- substantial sequence homology refers to homology that is sufficient to enable the variant polynucleotide to function in the same capacity as the polynucleotide from which the probe was derived. Homology is greater than 80%, greater than 85%, greater than 90%, or greater than 95%. The degree of homology or identity needed for the variant to function in its intended capacity depends upon the intended use of the sequence. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations that are equivalent in function or are designed to improve the function of the sequence or otherwise provide a methodological advantage.
- Standard techniques for cloning, DNA isolation, ampUfication and purification, for enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like, and various separation techniques useful herein are those known and commonly employed by those skilled in the art.
- a number of standard techniques are described in Sambrook et al. (1989) Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory, Plainview, New York; Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor Laboratory, Plainview, New York; Wu (ed.) (1993) Meth. Enzymol. 218, Part I; Wu (ed.) (1979) Meth. Enzymol. 68; Wu et al.
- the arrays of this invention are useful for defining expression signatures or profiles for mitochondrial diseases, as well as distinguishing clinical disorders that result from OXPHOS dysfunction, oxidative stress, apoptosis, and aging.
- the microarrays of this invention are useful for providing profiles for whole classes of mitochondrial diseases that have common underlying pathophysiological mechanisms.
- the data obtained from using these arrays are useful in the identification of pathways involved in these diseases and in the design of efficient therapies for treating these diseases.
- the arrays of this invention are useful for determining mitochondrial biology expression profiles and for sample evaluation using those profiles.
- the arrays of this invention are useful for diagnosis, for identifying pathways, genes, and mutations involved in physiological conditions, for creating animal models of human physiological conditions, and for designing curative and preventative therapies and evaluating their effectiveness.
- the arrays of this invention are useful for determining mitochondrial biology expression profiles of organisms, such as humans, mice, and closely related species; tissues and organs of such organisms; cell types of such organisms; and cell lines derived from such organisms.
- An individual can be tested at any age, including as a fetus, neonate, infant, child, adolescent, mature adult, senior, and deceased.
- the arrays of this invention are useful for comparing mitochondrial biology profiles of different individuals or cells.
- the arrays of this invention are useful for determining the profile associated with a physiological condition such as an energy-metabolism-related physiological condition.
- Physiological conditions can be healthy conditions or pathological conditions. Examples of healthy conditions in humans are centenaria and physical fitness. An example of a pathological condition in humans is Leigh's syndrome (LS).
- LS Leigh's syndrome
- the mitochondrial biology profile representative and descriptive of the physiological condition can be determined, such as for humans in Examples 4-5.
- Profiles can similarly be determined for cells lines with phenotypes or genotypes associated with physiological conditions, such as in Examples 13-15. Profiles can also be determined for non-human animals, including mouse strains, with physiological conditions as in Examples 8-12, 16, and 19.
- the arrays of this invention are useful for deteimining the range of normal variation of expression of genes involved in mitochondrial biology, as in Example 20.
- prepared target samples or pooled prepared target samples, of individuals with and without the physiological condition, but otherwise similar are hybridized to an array of this invention.
- the hybridization of the prepared samples are measured and compared to, if possible, determine a profile associated with the physiological condition.
- the profile may be optimized by statistical analysis, as is known in the art, to only contain profile data on probes necessary for diagnosing the physiological condition.
- the profile associated with a physiological condition can then be used for diagnosis or evaluation using the arrays of this invention, such as in Example 7.
- the profile of the physiological condition can be analyzed and the analysis used to optimize an array for diagnosis of the physiological condition.
- An optimized array for diagnosis of a physiological condition minimally contains at least one probe for the one or more genes that have altered expression levels in the context of the physiological condition, and probes for enough genes to eliminate other likely diagnoses.
- Diagnosis involves collecting a sample from an individual who might have the physiological condition, and determining the profile of the prepared sample using an array of this invention, using an array containing probes for all genes involved in mitochondrial biology or fewer probes with at least as many probes as necessary for an array optimized for diagnosis of the physiological condition.
- the profile of the individual is then compared to the profile of the physiological condition, and the comparison is analyzed to determine the likelihood that the individual has the physiological condition.
- Arrays of this invention can also be used for screening individuals who are not suspected of having the particular physiological condition. A sample is collected from such an individual, prepared, and the mitochondrial biology profile of the individual is determined using an array of this invention, e.g., an array containing probes for all genes involved in mitochondrial biology. The profile of this individual is then compared to known mitochondrial biology profiles of one or more physiological conditions that the individual may have, to determine if the profile of the individual is indicative of a diagnosable physiological condition. As demonstrated in Example 16, the arrays of this invention are also useful for detecting profiles indicative of physiological conditions before the appearance of other symptoms.
- the profile of, or associated with, a physiological condition is also useful for identifying biochemical pathways affected by the physiological condition and genes involved in causation of the physiological condition. If a profile of a physiological condition demonstrates alteration in the expression of a gene, that gene is a candidate for sequencing to identify a mutation causing the physiological condition. If a profile demonstrates alteration of expression of several genes, then genes known to regulate those are candidates for sequencing to identify a mutation causing the physiological condition.
- Example 3 describes using the arrays of this invention for the identification of mutations associated with physiological conditions.
- the profile of a physiological condition is useful for creating and/or identifying animal models of human physiological conditions.
- the profile of a physiological condition may suggest types of mutations, such as knockouts, to create in order to mimic the physiological condition in an animal.
- the arrays of this invention are also useful for screening genetically engineered or other mutated populations to identify an individual animal having a similar profile, and thus associated with the physiological condition.
- the same individual can be profiled, using arrays of this invention, repeatedly over time or after exposure to various environmental conditions, thereby determining the effects of time or exposure.
- Equivalent individuals can also be profiled, using the arrays of this invention, at different ages or after exposure to different environmental conditions, thereby determining the effects of time or exposure.
- a control group of mice of a particular genotype and of a particular age can be compared, using the arrays of this invention, to a group of experimental mice of the same genotype and age, that has been exposed to a certain environmental hazard, to determine the effects of the environmental hazard.
- Cell lines, as well as organisms can be profiled after exposure to different environmental conditions, as in Example 15.
- Arrays of this invention are also useful for determining the effects of aging. Examples 8 and 19 demonstrate differences in profiles at different ages.
- Therapy is an environmental condition, the effects of which can be tested using the arrays of this invention. Identification of the pathways affected in a physiological condition allows identification of therapies useful to treat individuals having the physiological condition. For example, if profiles are determined for the effects of classes of therapeutic agents, as new physiological conditions are profiled, relevant therapeutic agents can be easily identified.
- the profile of a physiological condition is useful for testing candidate therapies for treating individuals with the physiological condition.
- An individual, with or without the physiological condition, an animal model of the physiological condition in humans, or a cell line representative of an individual with the physiological condition, can be treated with a candidate therapy.
- a sample for profiling is collected after treatment, prepared, the profile is determined using an array of this invention, and compared to the profile of the same individual before treatment or to equivalent individuals or cells without treatment to determine the effect of the treatment. Therapies reversing the effects of the physiological condition can thereby be identified. Preventative therapies and therapies causing desired physiological conditions can similarly be identified.
- the arrays of this invention are useful for monitoring the effectiveness of a therapy for a particular individual as well as for a population.
- the profile of a diagnosed individual can be determined, the individual given a therapy, and then the profile of the individual determined again, using the arrays of this invention.
- the therapy can be modified and the profile retested, until a satisfactory treated profile is obtained.
- Arrays containing probes hybridizing at moderate to high stringency with human genes involved in mitochondrial biology are used for assaying prepared samples from humans, human cell lines, and prepared samples from closely related species.
- Arrays containing probes hybridizing at moderate to high stringency with mouse genes involved in mitochondrial biology are used for assaying prepared samples from mice, mouse cell lines, and prepared samples from closely related species.
- the arrays of this invention are made using probes for genes involved in mitochondrial biology. Probes can be selected and generated from the lists of clones and sequences in Tables 3-5, or from sequences and clones representing genes involved in mitochondrial biology not listed in these tables. Probes can be generated in vitro by nucleic acid synthesis, PCR, cloning techniques or other techniques known in the art. Flanking or vector sequence may be minimized in the probe. Probes generated from Research Genetics clones (ResGen/Invitrogen, Carlsbad, CA) can be amplified by PCR as described in Example 22. Optionally, control probes are also selected for the arrays of this invention.
- control probes examples include clones and sequences for making control probes.
- Table 6 SEQ ID NOS:3041- 3044. If housekeeping genes are chosen as positive controls, usually they are derived from the same species as the non-control probes. Housekeeping gene probes are available from Stratagene (Spot ReportTM, La Jolla, CA, USA).
- Housekeeping genes generally have a consistent amount of expression in all cells. Using the arrays of this invention, the expression of the 25 housekeeping genes listed in Table 2 were compared in 4 cell lines, LMEB4, NZB, 501-1, and the LM(TK) - cell line grown in media supplemented with glucose, pyruvate, and uridine (GUP). Some variability was present between cell lines. Housekeeping genes were also tested in 6 different mouse tissue samples (brain, heart, liver, kidney, spleen and muscle) in two strains of mice, CAP R and NZB. Variation was again present, but slight. Table 2
- Arrays can be printed on solid substrates, e.g., glass microscope slides. Before printing, slides are prepared to provide a substrate for binding as in Example 23. Arrays can be printed using any printing techniques and machines known in the art. Printing involves placing the probes on the substrate, attaching the probes to the substrate, and blocking the substrate to prevent non-specific hybridization, as described in Example 24.
- RNA samples useful for analyses using the arrays of this invention include total RNA samples and mRNA samples.
- RNA samples can be prepared as described in Example 25.
- An RNA sample is reverse transcribed into cDNA and simultaneously labeled, i.e. with one member of a two-color fluorescent system, such as Cy3-dCTP/Cy5-dCTP as described in Example 26.
- the arrays are hybridized with the prepared sample and washed at appropriate stringencies accounting for the choices of sample and probes of the array.
- the hybridization stringency can be higher when the probe sequence has higher homology with the gene it interrogates and when the probe is larger.
- a reference target, standard target, or other sample target for direct comparison may be prepared and hybridized simultaneously to the same array.
- a prepared sample will not degrade during hybridization and is labeled.
- Prepared samples are reverse transcribed and fluorescently labeled.
- Hybridization results can be measured and analyzed using equipment and software available in the art as described in Example 27. Before finalizing data, preliminary results are preferably normalized by methods known in the art. An example of normalization appears in Example 29. Analysis includes determination of statistical significance. Measurement may include normalization and analysis, including statistical analysis. Resulting data are typically stored in computer files.
- Mitochondrial biology expression microarrays are useful for detecting alterations in gene expression caused by alterations in mitochondrial biology.
- commercially available total genome expression arrays from companies such as Incyte Pharmaceuticals or Affymetrix contain probes for ten to twenty times as many genes as the arrays of this invention, the commercially available arrays have limitations. Several genes and probes that have been included on the arrays of this invention are not available on the commercial arrays. The commercial arrays are also very expensive and the large data sets resulting from them can be rather cumbersome to analyze and manipulate. The smaller, more focused arrays of this invention allow the expression patterns of hundreds of mitochondrial genes to be monitored quickly and efficiently.
- Clones used to generate probes are listed in Tables 3-5. Clones range from about 1 kb to about 4 kb. The inserts of most clones have been sequenced on the 5' and 3' ends. Sequences of the 5' and 3' ends of the clones are usually about 200 nt to about 800 nt and are provided herein. Probes may be generated via several methods. For example, the clones listed in Tables 3-5 may be obtained commercially, the inserts purified and used as probes.
- a 5 ' or 3 ' sequence given in the sequence listings hereof may be used to design an oligonucleotide which may be synthesized and used to probe a library to identify a cDNA or genomic clone that is equivalent to the clone used to generate the original sequence. This newly identified cDNA or genomic equivalent clone may be used to generate a probe.
- a pair of sequences from the sequence listings, representing the 5 ' and 3 ' ends of one clone may be used to design PCR primers, which may be used to PCR amplify an isolated nucleic acid that is quivalent to the insert of the corresponding clone from which the 5' and 3 ' were derived. This isolated nucleic acid may be used as a probe. Probes should not contain a vector sequence that hybridizes with any sequence in a sample. Methods for designing PCR primers and designing oligonucleotides for screening libraries are known in the art.
- a human mitochondrial biology array is made from clones representing 650 expressed sequences involved in mitochondrial biology.
- the clones used to make probes that are placed on the array are shown in Table 3 which references SEQ ID NOS: 1-994 provided herein setting forth the 5' and 3' sequences from these clones.
- the clones identified in Table 3 are used to make a set of probes called Human Probe Set #1.
- Control sequences are also placed this array. Controls include, but are not limited to blanks, DMSO, probes derived from plant sequences, sequence(s) not involved in mitochondrial biology, and poly adenine (40-60 nucleotides long).
- a mouse mitochondrial biology array is made from clones representing expressed sequences.
- the clones placed on the array are shown in Table 4 which references sequence ID NOS:995-3040 provided herein setting forth the 5' and 3' sequences from these clones. See Tanaka, T.S. et al., (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using 15k mouse developmental cDNA microarray" Proc. Natl. Acad. Sci. USA 97:9127-9132.
- Equivalent clones useful as probes are listed in Table 5.
- the clones listed in Table 4 are preferable to the clones listed in Table 5.
- the clones identified in Table 4 are used to make a set of probes called Mouse Probe Set #2.
- mice Probe Set #3 The clones identified in Table 5 are used to make a set of probes called Mouse Probe Set #3. Control sequences are also placed this array. Controls include, but are not limited to blanks, DMSO, probes derived from plant sequences, sequence(s) not involved in mitochondrial biology, and poly adenine (40-60 nucleotides long). Sequences used to make probes for the mouse mitochondrial genes can also be found in GenBank Accession No. J01420, which provides the complete mouse mitochondrial genome. Preferably, the probes used for ATP8 and ATP6 do not cross- hybridize with each other. Table 4
- the mitochondrial respiratory complex I is assembled from seven mtDNA genes and thirty-six nDNA genes. Patients with complex I defects have phenotypes ranging from midlife-onset optic atrophy to lethal childhood Leigh's disease. Mitochondrial biology expression profiles were determined for patients with a variety of complex I defects. Samples are collected from a variety of patients with complex I defects. Each sample is reverse transcribed, labeled, and hybridized, together with standard target, to a human array comprising probes selected from Example 1. The hybridization measurements are analyzed, leading to the identification of several novel mtDNA mutations and dominant and recessive nDNA mutations.
- LS is a subacute neurodegenerative condition characterized by necrotic lesions in the brain stem, basal ganglia, thalamus and spinal cord. Death is usually within 2 years of onset of symptoms that may include motor and/or intellectual retardation, abnormal breathing rhythm, nystagmus, opthalmoparesis, optic atrophy, ataxia, and dystonia.
- the Leigh's syndrome patient had a typical complex IV cytochrome c oxidase deficiency associated with surfeit 1 (SURF-1) gene mutations.
- This patient was from a consanguineous marriage and was homozygous for a nonsense mutation in the SURF-1 gene.
- Expression profiling of muscle and cultured cell samples from this patient using a human array of Example 1 was performed, in comparison to a control reference standard.
- NDUFS8 expression was not significantly altered.
- many nuclear and mitochondrially encoded complex I genes were down-regulated, including mtDNA transcripts ND4, NDL4, and ND6.
- Nuclear genes SURF-1, SOD2, 70kD heat shock protein, voltage dependent anion channel (VDAC4), adenine nucleotide translocase 2 (ANT2), and glutathione peroxidase 3 were down-regulated.
- Mitochondrial biology expression profiles were determined for twelve complex I Leigh's syndrome patients (Procaccio, VF (2001) EuroMit5 Abstract). Sequencing of all 43 genes known to be part of complex I, of each patient, identified one patient as a compound heterozygote for two missense mutations in the 23 kD NADH dehydrogenase (NDUFS8) gene of complex I. This patient had a respiratory complex I defect apparent in skeletal muscle and cultured lymphoblastoid cells. Samples were collected from cultured lymphoblastoid cells from this patient and control reference lymphoblastoid cells. Samples were reverse transcribed and differentially labeled and hybridized to a human array comprising probes selected from Example 1.
- the expression profile was determined using a hierarchical clustering method. Mitochondrial biology expression profiles from the other patients were similarly determined using appropriate samples and controls. Expression profiles of all patients were characteristic of complex I deficiencies, including down- regulation of all mtDNA and some nDNA complex I genes and up-regulation of the adenine nucleotide translocator genes (ANT1 and ANT2).
- ANT1 and ANT2 adenine nucleotide translocator genes
- the mitochondrial biology expression profile for Leigh's syndrome SURF-1 nonsense mutations is used to diagnose patients. Samples are collected from patients and mitochondrial biology expression microarray-tested using a human array containing probes for at least SURF-1, ND4, NDL4, ND6, SOD2, 70kD heat shock protein, VDAC4, ANT2, and glutathione peroxidase 3.
- a mouse Mitochip was printed with probes for 452 genes. Some of these genes were represented by two or more probes, providing internal controls for the reproducibility of gene expression quantitation. An additional 37 control spots were included on the array. Of these, 25 were probes for housekeeping genes to allow normalization between samples. The remaining 12 spots were various controls for hybridization and positioning. Table 2 lists the functional categories and number for all of the housekeeping genes on this array.
- the cDNA clones that represent each gene were either from the I.M.A.G.E. consortium or cloned by The Center for Molecular Medicine and published in (Murdock et al., 1999). A complete annotation of each gene was compiled and GenBank accession numbers and Unigene cluster numbers were determined. Table 5 provides a list of the probes on this array.
- Oxidative stress has been implicated in aging and degenerative disease. Mitochondria are thought to be the main source of reactive oxygen species such as superoxide anion. Mitochondrial superoxide anion is normally detoxified by manganese superoxide dismustase (MnSOD, the Sod2 gene). However, when, free radical metabolism is perturbed, oxidative damage to protein, DNA, and lipids may occur. To demonstrate the effects of increased superoxide anion toxicity on mitochondrial physiology with age, the mitochondrial biology expression profiles of mice with a 50% reduction in MnSOD (Sod2 +/-) were determined at various ages.
- MnSOD manganese superoxide dismustase
- Samples were collected from young (5 months), middle-aged (10-14 months), and old (20-25 months) wild-type and Sod2 +/- mice. Samples were reverse transcribed and differentially labeled from the corresponding controls. The labeled mutant sample and the corresponding labeled control were hybridized with the mouse array of Example 2. Relative to the control mice, the old Sod2 +/- mice showed induction of antioxidant and apoptosis genes including glutathione peroxidase 3, apoptosis inhibitory factor 3, caspase 1, and the peripheral benzodiazepine receptor.
- Manganese superoxide dismutase (MnSOD, the Sod2 gene) is a gene expression product involved in mitochondrial biology. Sod2 -/- animals die soon after birth due to the superoxide inactivation of mitochondrial iron-sulfur center enzymes resulting in dilated cardiomyopathy. The mitochondrial biology expression profile of Sod2 -/- mice is determined using the mouse MitoChip of Example 2. RNA samples are collected from Sod2 -/- mice and Sod2 +/+ mice. The Sod2 -/- sample is reverse transcribed and labeled with Cy3 phosphoramidite. The Sod2 +/+ sample is reverse transcribed and labeled with Cy5 phosphoramidite. The labeled samples are incubated with a mouse array under conditions of high stringency hybridization. The hybridization of both samples is measured with a microarray reader. The hybridization measurements are recorded.
- MnSOD the Sod2 gene
- Glutathione peroxidase 1 is an expressed sequence involved in mitochondrial biology. GPxl -/- animals show mild growth inhibition and reduced OXPHOS efficiency.
- the mitochondrial biology expression profile of GPxl -/- mice is determined using a mouse array of Example 2. RNA samples are collected from GPxl -/- mice and GPxl +/+ mice. The GPxl -/- sample is reverse transcribed and labeled with Cy3 phosphoramidite. The GPxl +/+ sample is reverse transcribed and labeled with Cy5 phosphoramidite. The labeled samples are incubated with a mouse array under conditions of high stringency hybridization. The hybridization of both samples is measured with a microarray reader. The hybridization measurements are recorded.
- the mitochondrial biology expression profile of Sod2 -/+ plus GPxl -/- mice is determined using a mouse array of Example 2.
- RNA samples are collected from Sod2 -/+ plus GPxl -/- mice and Sod2 +/+ plus GPxl +/+ mice.
- the Sod2 -/+ plus GPxl -/- sample is reverse transcribed and labeled with Cy3 phosphoramidite.
- the Sod2 +/+ plus GPxl +/+ sample is reverse transcribed and labeled with Cy5 phosphoramidite.
- the labeled samples are incubated with a mouse array under conditions of high stringency hybridization. The hybridization of both samples is measured with a microarray reader. The hybridization measurements are recorded.
- the mitochondrial biology expression profiles are determined using a mouse array, for mice overexpressing MnSOD and for mice overexpressing MnSOD plus GPxl.
- Example 2 A mouse array of Example 2 was used to determine the mitochondrial biology expression profile of the mouse mutant cell line p°, the most extreme case of mitochondrial dysfunction.
- the LMEB4 (p°) cell line was profiled against its parental LM(TK) - cell line.
- the mouse mutant cell line p° lacks mitochondrial DNA.
- GUP media glucose, pyruvate, and uridine
- FIG. 3 A scatter plot of the gene expression ratios is shown in FIG. 3. Samples from the p° cell line and from the LM(TK) cell line were reverse transcribed and differentially labeled using a standard two-color fluorescent system, and hybridized to a mouse array of Example 2.
- Mitochondrial transport proteins such as the Glutamate-malate transporter were down-regulated as was the mitochondrial protein import subunit gene Timl7 and several amino acid metabolism genes.
- glycolytic genes such as pyruvate kinase, glucose phosphate isomerase and glucose-6- phosphate dehydrogenase were up-regulated 2 to 3-fold.
- Phosphofructokinase was up 1.6- fold.
- Anti-apoptotic genes such as apoptosis inhibitor 2 and 3 were up-regulated as was the pro-apoptotic Bcl-Xs binding protein BNIP3 and Caspase 2. The other Bel protein family members that are on the array were not changed significantly.
- the multi-function mitochondrial LON protease was up-regulated 2.1 -fold.
- Example 2 A mouse array of Example 2 was used to determine the mitochondrial biology expression profile of the mouse mutant cell line harboring a mutation for chloramphenicol resistance (CAP R ), and the CAP R 501-1 cell line having a mtDNA mutation in the 16S rRNA gene.
- the CAP R mutation in chimeric mice causes cataracts, reduced photoreceptor response, vacuoUzation of the retinal pigment epithelium, and hamartomatous outgrowths of the optic nerve head. Mice inheriting the CAP R mutation showed a marked increase in embryonic lethality, and those that were born died within two weeks with growth retardation, dilated cardiomyopathy, and mitochondrial abnormalities.
- CAP R 501-1 was compared to the CAP S LM(TK) - cell line.
- Mouse arrays of this invention were used to demonstrate how treatment changes, such as changing cell culture conditions, affect gene expression.
- the control cell line LM(TK) - grown in standard medium was profiled against a culture of LM(TK) - cells grown in media supplemented with glucose, pyruvate, and uridine (LM(TK) - (GUP)).
- Samples from the treated fibroblast cell line and from untreated fibroblast cells were reverse transcribed and differentially labeled with a standard two-color fluorescent system, and hybridized to a mouse array of Example 2. Treatment resulted in a down-regulation of the LON protease and HSP 84.
- HSP70 heat shock protein
- the 70 kDa heat shock protein (HSP70) was down-regulated 3.4-fold.
- HSP70 has been shown to be a chaperone protein involved in mitochondrial protein import that forms an ATP-dependent motor with the inner mitochondrial membrane translocase and the polypeptide in transit (Voos, W. et al., "Mechanisms of protein translocation into mitochondria,” [1999] Biochimica etBiophysica Ada 1422:235-54).
- the entire HSP70 control spot was of medium intensity, while the experimental spot was only medium intensity in the center.
- the LON protease was down- regulated 9.7 fold in LM(TK) - cells grown in GUP.
- the control LON protease spot was of medium high intensity over the entire spot and of low intensity in the experimental spot.
- the electron transfer flavoprotein (ETF) which shuttles electrons gathered during fatty acid metabolism to the electron transport chain, was down-regulated 3.8 fold.
- the E.T.F control spot was high intensity and the experimental spot very low intensity.
- Some of the nuclear encoded OXPHOS subunits as well as several proteins involved in amino acid metabolism were down-regulated 1.5 to 2-fold with mean ratio of 1.65. Since most of these genes fell below the +/- 1.7 ratio cutoff, further analysis was needed to determine if the expression pattern was significant. There were no differences in mtDNA transcript levels and no consistent pattern of up-regulation of glycolytic genes.
- Samples were collected from 8 day old Sod2 mice without MnTBAP treatment, 8 day old Sod2 mice with MnTBAP treatment, and 12 day old Sod2 mice with MnTBAP treatment. Samples were also collected from age-matched controls. About 20 genes were found to be differentially expressed in all three groups of Sod2 knockout mice compared to the corresponding age-matched controls. The about 20 genes included bioenergetic genes such as the mitochondrial creatine phosphokinase, antioxidant enzymes like the glutathione peroxidase 3, and apoptotic factors including caspase 1 and apoptosis inhibitor factor 3. The excitatory amino acid transporter 3, frataxin, and one EST of unknown function were also induced. Mitochondrial biology expression profiling demonstrated changes in expression before neuropathic changes were manifested.
- the NZB mouse line mtDNA and the "common haplotype" mtDNAs (129/Sv, C57B1/6J, C3H, BALB/c, and others which are thought to have arisen as the progeny of a single female (Ferris et al.,1982) differ by 108 nucleotides, and these polymorphic differences have been used to monitor the segregation of heteroplasmic populations of mtDNAs in mice created by embryo fusion techniques (Jenuth, J. P. et al., "Random genetic drift in the female germline explains the rapid segregation of mammalian mitochondrial DNA," [1996] Nat Genet 14:146-51; Jenuth, J. P.
- RNA was isolated from the brain, liver, spleen, kidney, heart, and skeletal muscle of a male mouse heteroplasmic for the NZB mtDNA and a male mouse that was 80% chimeric for ES cell-derived CAP R cells as defined by coat color. Due to the severity of the CAP R mutation it was not possible to analyze the mitochondrial gene expression changes in mice that were homoplasmic for the CAP R mtDNA. Control mRNA for each of the tissue samples was isolated from sex, age, and nuclear background-matched control mice. All of the tissue samples were genotyped to determine the levels of heteroplasmy for the NZB and CAP R mtDNA in each of the tissues.
- Equal levels of the NZB and "common" mtDNA were found in the six tissues analyzed from the NZB mtDNA-positive mice.
- the six tissues from the CAP R chimera had varying levels of CAP R mtDNA with the kidney and spleen having the highest amounts, 65% and 50% CAP R mtDNA, respectively.
- the heart contained approximately 20% CAP R mtDNA, while brain, liver, and muscle all contained between 5% and 10% CAP R mtDNA.
- Analysis of the NZB-mtDNA tissue samples did not reveal any differentially expressed genes in the heart, liver, brain, and kidney.
- a scatter plot from the NZB heart is shown in FIG 4.
- the scatter plots from the liver, brain, and kidney are virtually identical in that nearly every gene has an expression ratio of 1.
- Analysis of the NZB-mtDNA spleen and muscle showed several genes that were differentially expressed in the two tissues.
- the NZB-mtDNA muscle showed a 1.5 to 2.1-fold reduction in all mtDNA transcripts, pyruvate dehydrogenase was down 2.2-fold, and there was a general trend for nuclear-encoded OXPHOS subunits to be down-regulated 1.4 to 1.8-fold.
- the vesicular transport protein, pantophysin was down-regulated 4-fold and the glycogenolysis rate-limiting enzyme, glycogen phosphorylase, was down 3 -fold.
- the integral membrane protein SURF 4 was up 2-fold and the amino acid metabolism gene 2-amino-3- ketobutyrate CoA ligase was up 4.8-fold.
- Glycogen phosphorylase down 3-fold in the muscle, was up 4.8 fold in the spleen.
- the muscle and spleen results suggest that the polymorphisms between the NZB and "common" mtDNA may have a functional consequence in some tissues but not others.
- Analysis of the CAP R tissue samples did not show any genes to be differentially expressed in the kidney, heart, muscle, liver, or spleen.
- the two outliers on the kidney scatter plot that appear to be down- regulated can be explained by hybridization artifacts causing a high background in the control sample.
- the CAP R brain sample was the only tissue that had any differentially expressed genes. Skd 3 was up-regulated 2.2-fold, glutathione peroxidase was up 2.4-fold and apoptosis-inbibitor 3 was up 2.4-fold. Although no genes were down-regulated in the brain more than 1.8-fold, closer analysis of the brain samples did reveal a trend that was not observed in any of the other tissues.
- Several nuclear-encoded OXPHOS subunits were down- regulated between 1.3 and 1.6-fold.
- mice mutant in mitochondrial biology were used to identify genes involved in mitochondrial biology.
- Mice deficient in the heart/muscle isoform of the adenine nucleotide translocator (ANTl) exhibit many hallmarks of human oxidative phosphorylation (OXPHOS) disease, including dramatic proliferation of skeletal mitochondria.
- Samples were collected from the gastrocnemius muscle of ANTl and wild-type mice, reverse transcribed and differentially labeled, and hybridized with a mouse microarray chip (Mouse Unigene 1, Incyte Genomics Inc., Palo Alto, California) containing over 8000 sequence-verified cDNAs. Analysis of the hybridization results identified more than 150 differentially expressed genes.
- Gene sequences that were not previously recognized as being involved in mitochondrial biology were used to generate probes that were placed on the mouse array of Example 2.
- Homologous human gene sequences were used to generate probes that were placed on the human array of Example 1.
- Age-related changes in the mitochondrial biology expression profile in chimpanzees are determined using a human array of Example 1. Samples from young adult chimpanzee muscle and samples from most-mortem tissues of older chimps are reverse-transcribed, differentially labeled, and hybridized with a human array of Example 1.
- the NZB cell line was profiled to examine the changes in mitochondrial gene expression resulting from a more neutral set of mtDNA polymorphisms.
- the NZB mtDNA contains 108 sequence differences compared to the "common" mouse mtDNA genotype found in LM(TK). While these differences were reported to be neutrally polymorphic (Jenuth et al., [1996] Nature Genetics 14:146-151; Meirelles and Smith [1997] Genetics 145:445-451), the only evidence to support that hypothesis is that transgenic mice containing a high percentage of NZB mitochondria have no overt phenotypes (Levy, S.
- NZB cybrid cell line was profiled on a mouse mitochondrial array.
- the scatter plot of gene expression ratios between the NZB cell line and the parental LM(TK) - (without GUP supplementation) shows that both probes of the fatty acid metabolism gene Acyl-CoA dehydrogenase (medium-chain) detected up-regulation 3.6-fold.
- Procollagen III and VI were up-regulated 6.2 and 6.8-fold, respectively.
- Two independent probes of the coproporphyrinogen oxidase in gene that is involved in heme biosynthesis detected down regulation 2.6 and 2.3-fold.
- Also down- regulated was the peripheral-type benzodiazepine receptor.
- This receptor has been implicated in a variety of mitochondrial functions including the regulation of mitochondrial protein import under conditions of oxidative stress, calcium homeostasis, and steroidogenesis (Culty, M. et al., "In vitro studies on the role of the peripheral-type benzodiazepine receptor in steroidogenesis," [1999] J.
- NZB and "common" mtDNAs are not entirely neutral and cause changes in mitochondrial function when combined with the LM(TK) - nucleus.
- the NZB mtDNA does not appear to be completely interchangeable with the "common” mtDNA genome.
- An interesting group of genes that were up-regulated in the NZB cell line were the pro-inflammatory genes Caspase 1 and platelet activating factor (PAF) acetylhydrolase, the mitochondrial RNA polymerase, and glutathione peroxidase 3.
- PCA Principal component analysis
- hierarchical clustering were performed on the cell line data (Examples 13-15 and 20) to group genes based on similarities in their expression patterns over all the samples.
- PCA analysis was used to reduce the dimensionality of the data by calculating three principal axes that encompass as much of the variability in all of the samples as possible. Each of the samples was then plotted on those axes in three- dimensional space.
- the PCA results revealed that the NZB cell line clustered away from the other cell lines, consistent with it having fewer differentially expressed genes in common with the other samples.
- Group 3 genes are diverse clusters of genes that change in expression coordinately across the 5 samples. It includes some nuclear-encoded OXPHOS subunits, a few antioxidant and transport proteins as well as pyruvate kinase and a GTP- binding protein.
- Group 4 is a small, diverse cluster of genes mainly up-regulated in the CAP R 501-1 cell line. This group includes several of the same genes found to be up-regulated in the Antl(-/-) mouse by differential display analysis (Murdock et al., 1999). Also in this group are two NADP-transhydrogenases, carbonate dehydratase and cytochrome b5 reductase. Group 5 is almost exclusively nuclear-encoded OXPHOS subunits.
- VDAC voltage-dependent anion channel
- Group 6 is composed almost entirely of mtDNA-encoded transcripts.
- Group 7 is the heterogeneous group of genes that were up-regulated in each of the samples analyzed and included Caspase 1, PAF acetylhydrolase, the mitochondrial RNA polymerase, and glutathione peroxidase 3.
- Hierarchical clustering packages are available in the art, i.e. Expression Profiler (http://ep.ebi.ac.uk/EP/ from the European Bioinformatics Institute, Cambridge, UK). PCA is described in Bioinformatics 2001, volume 17, number 9, pages 763-774.
- PCR amplifications were performed with standard PCR techniques. Probes were made my amplifying clones using a universal primer set (Forward primer 5'- CTGCAAGGCG ATTAAGTTGGGTAAC-3' Reverse primer 5'- GTGAGCGGATAACAATTTCAC ACAGGAAACAGC-3') in a 100 ⁇ l PCR reaction containing PCR buffer (10 mM Tris, 1.5 mM MgC12, 50 mM KC1, pH8.3), 0.2 mM dNTPs, 0.2 mM each primer, 1.25 U Taq (Sigma, St Louis, MO).
- PCR buffer 10 mM Tris, 1.5 mM MgC12, 50 mM KC1, pH8.3
- 0.2 mM dNTPs 0.2 mM each primer
- PCR reaction 0.5-1 ⁇ l of bacterial culture was added to each PCR reaction and thermal cycling was done as follows: 4 minutes at 94 C followed by 35 cycles of 15 seconds at 94 C, 30 seconds at 66 C and 1 minute 30 seconds at 72 C. Following cycling, reactions were held at 72 C for 4 minutes to complete all extension reactions. All PCR products were confirmed by agarose gel electrophoresis through a 1.5% gel. After satisfactory amplification, products were quantitated by UV 260/280 ratio and desiccated in a Savant Speed- Vac (Holbrook, NY). Dried products were then resuspended in 3xSSC (450 mM NaCl, 40 mM sodium citrate) at a concentration of 400-600 ng/ ⁇ l for arraying.
- 3xSSC 450 mM NaCl, 40 mM sodium citrate
- the glass microscope slides for the arrays were coated with poly-Lysine to provide a substrate for DNA binding.
- Standard glass microscope slides Gold Seal, Beckton-Dickson, Franklin Lakes, NJ
- slides were cleaned in a solution of 2.5 M NaOH, 60% ethanol for two hours. After cleaning, slides were rinsed five times in fresh water.
- the slides were then soaked in a solution of 0.01% poly-L-lysine, .lx PBS for 1 hour followed by rinsing in fresh water. After rinsing, the slides were dried in a vacuum oven at 45°C for 15 minutes.
- Arrays were printed onto poly-L-lysine coated glass slides using the GMS 417 Arrayer (Affymetrix/Genetic Microsystems, Woburn, MA).
- the arrays were printed using a 4-pin print head with a spot size of 150 ⁇ m (approximately 33 pL of volume per spot) and a center-to-center spot spacing of 375 ⁇ m.
- a humidity level of 65-70% was maintained during the printing of the arrays by a custom humidifier system.
- the arrays were allowed to dry for 1 hour at room temperature.
- the arrays were then processed by rehydrating over a warm solution of lx SSC for 5 minutes followed by rapid drying on a 95°C heat block.
- the DNA was crosslinked to the slide by exposing the arrays to 65 mJ of ultraviolet energy (Stratalinker, Stratagene, La Jolla, CA).
- the slides were then treated with a solution of 60 mM succinic anhydride and 40 mM sodium borate in l-methyl-2-pyrrolidinone for 15 minutes at room temperature.
- the arrays were then denatured in 95°C water for 2 minutes and dehydrated by rapid immersion in 95% ethanol.
- the arrays were then dried by centrifugation at 20xg for 5 minutes.
- RNA preparations were performed using the TRIzol reagent (Life Technologies, Gaithersburg, MD) as per the manufacture's directions. For cell culture samples, a 90% confluent 225ml flask was lysed directly in the flask with 18 ml of TRIzol. At least three flasks were pooled for each cell line to reduce any variability caused by culture conditions. For each mouse tissue, RNA was isolated from approximately 500 mg of tissue that was mechanically homogenized in 6ml of TRIzol. Following the isolation of total RNA, poly-A+ mRNA was isolated using Qiagen Oligotex (Valencia, CA) as per the manufacture's directions.
- Qiagen Oligotex Valencia, CA
- poly- A+ RNA was labeled with fluorescent nucleotides by reverse transcription.
- the poly-A+ RNA was mixed with 3 mg of anchored oligo-dT and incubated at 70°C for 10 minutes followed by 10 minutes on ice.
- reaction buffer 50 mM Tris-HCl, 75 mM KC1, 3 mM MgC12 pH 8.3
- 10 mM dithio-threatol 500 ⁇ M dATP,dGTP,dTTP, 300 ⁇ M dCTP, 20 U Superscript reverse transcriptase (Life Technologies, Gaithersburg, MD) and 100 ⁇ M of either Cy5-dCTP
- the final sample volume was adjusted to 12 ⁇ l and 525 mM NaCl, 52.5 mM sodium citrate, 0.25% SDS.
- the sample was denatured at 100°C for 2 minutes and added to the array.
- the sample and the array were hybridized under high stringency hybridization conditions.
- the sample and array were covered by a 22 mm x 22 mm coverslip and placed in a humidified hybridization chamber (Corning, Acton, MA) and incubated at 65°C for 12-16 hours. Following hybridization, the arrays were washed with successive 5-minute washes in 2xSSC, 0.1%SDS; lxSSC; and O.lxSSC. After the final wash, the arrays were dried by centrifugation at 20xg and scanned using the GMS 418 Array Scanner (Affymetrix/Genetic Microsystems, Woburn, MA).
- the data is transformed because of the non-Gaussian distribution of the expression ratio values. Because the ratios are bounded on the lower limit by zero, a non-Gaussian distribution is normally observed. To allow for additional statistical manipulations, the data was transformed for a more uniform distribution.
- the Z-score normalization method involved subtracting the mean from every observation and dividing by its standard deviation, effectively normalizing each spot to all other spots on the array.
- Control cDNA samples were prepared from mRNA isolated from the LM(TK) - cell line and labeled with the Cy5 dye. Each experimental mRNA sample was labeled with the Cy3 dye, combined with the Cy5 control sample and the mixture used to hybridize the array. A representative image of a hybridized array is shown in FIG 2. Any spot on an array that appeared red was due to hybridization of a large proportion of the Cy5-labeled control LM(TK) - sample and any sample that was green was due to the hybridization of a large proportion of the Cy3 -labeled experimental sample. Any spot that is yellow is an about equal co-hybridization of the two targets. The fluorescence ratio was quantitated for each spot, permitting calculation of the relative abundance of each gene's mRNA in the two samples.
- the two fluorescent dyes that were used to label the cDNA produced during the reverse transcription of the mRNA have different structures and different emission maxima. Therefore, the two images that represent the hybridization of each of the fluorescently labeled samples were normalized to each other to account for the differences in dye behavior prior to calculating the expression ratios between the two images.
- One image was normalized to the other by averaging all of the spots in each image to derive a constant that was then applied to each spot.
- a predetermined set of genes that were expressed equally in the two samples under all conditions could have been used. The expression ratios of these genes were used to calculate a constant that was then applied to all spots on the array.
- a set of 25 housekeeping genes in Table 2 was included on a mouse array for normalization and both of these methods were used in the analysis of the mouse cell line and tissue samples.
- Housekeeping gene expression in the cultured cells was much more variable than in the tissue samples. Because of the variability in the housekeeping gene expression patterns in the cell line samples, normalization was done using all of the spots on the array. The expression of the housekeeping genes was much more consistent in the tissue samples and normalization using either the housekeeping genes or the average of all of the genes gave similar results.
- Clones useful for making control probes for the arrays of this invention are listed in Table 6. Sequences of the genes useful for making the control probes are provided in the sequence listings hereof.
- Tables 3-5 list sequence information on the clones that are useful for making probes for practicing the methods of this invention. Clone identification numbers are usually from NLA (National Institutes of Aging, National Institutes of Health, Bethesda, MD, USA), ResGen Invitrogen (Carlsband, CA, USA) or IMAGE Consortium, LLNL (Livermore, CA, USA). Gene names and descriptions are provided for the gene interrogated by a probe made from the corresponding clone. GenBank Accession Number and Unigene Cluster ID are provided where available. The functions of certain genes are included in Table 4. Sequences of the 5' and 3' ends of the clones listed in Tables 3-4 are provided when available.
- GenBank Accession No. may be larger than the sequence of the clone.
- the instant invention may be practiced without the sequence information provided herein using the clones or GenBank listings.
- Other sequences derived from the genes interrogated by probes generated from clones listed in Tables 3-5 are useful for making equivalent probes using information known in the art, i.e., unique segments of such genes may be used.
- the IMAGE Clone ID No. which is often the same as the ResGen Clone ID No., and information in parentheses identifying the sequence as 5 ' or 3 ' of the clone; the length of the insert of the clone; the source of the clone; the type of clone, such as cDNA; and the nucleic acid sequence.
- Sequence listings for control probes are provided as SEQ ID NOS: 3041-3044.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2003524534A JP2005515757A (ja) | 2001-08-30 | 2002-08-30 | ミトコンドリア生物学発現アレイ |
| US10/488,619 US20060099578A1 (en) | 2001-08-30 | 2002-08-30 | Mitochondrial biology expression arrays |
| CA002459061A CA2459061A1 (en) | 2001-08-30 | 2002-08-30 | Mitochondrial biology expression arrays |
| EP02768777A EP1432823A4 (en) | 2001-08-30 | 2002-08-30 | MITOCHONDRIAL BIOLOGICAL EXPRESSION ARRAYS |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US31632301P | 2001-08-30 | 2001-08-30 | |
| US60/316,323 | 2001-08-30 | ||
| CA002356540A CA2356540A1 (en) | 2001-08-30 | 2001-08-31 | Expressed dna sequences involved in mitochondrial functions |
| CA2,356,540 | 2001-08-31 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003020220A2 true WO2003020220A2 (en) | 2003-03-13 |
| WO2003020220A3 WO2003020220A3 (en) | 2003-12-24 |
Family
ID=25682709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/027886 Ceased WO2003020220A2 (en) | 2001-08-30 | 2002-08-30 | Mitochondrial biology expression arrays |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP1432823A4 (https=) |
| JP (1) | JP2005515757A (https=) |
| WO (1) | WO2003020220A2 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005040831A1 (en) * | 2003-10-17 | 2005-05-06 | DKFZ Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Use of adam 12 for diagnosis and therapy of preeclampsia |
| WO2004108960A3 (en) * | 2003-06-09 | 2005-07-14 | Decode Genetics Ehf | Methods for predicting drug efficacy in patients afflicted with hypertension |
| WO2005058142A3 (en) * | 2003-12-16 | 2006-03-02 | Univ Emory | Diabetes diagnostic |
| EP1625142A4 (en) * | 2003-05-21 | 2007-04-04 | Bios Chile I G S A | MARKERS FOR PRECANCEROUS AND CANCER CELLS AND METHOD OF DISRUPTING CELL PROLIFERATION |
| CN114990160A (zh) * | 2022-06-13 | 2022-09-02 | 昆明医科大学 | 一种Navβ2-ICD低表达转基因鼠模型的构建方法及其应用 |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1027456B1 (en) * | 1997-10-31 | 2005-03-16 | Affymetrix, Inc. (a Delaware Corporation) | Expression profiles in adult and fetal organs |
| JP2002512954A (ja) * | 1998-04-24 | 2002-05-08 | マイトコー | ミトコンドリア関連疾患を処置するための化合物および方法 |
| US6218117B1 (en) * | 1998-06-15 | 2001-04-17 | Mitokor | Compositions and methods for identifying agents that quantitatively alter detectable extramitochondrial DNA:mitochondrial DNA ratios |
| EP1161534A1 (en) * | 1999-03-16 | 2001-12-12 | Mitokor | Differential expression of organellar gene products |
-
2002
- 2002-08-30 JP JP2003524534A patent/JP2005515757A/ja active Pending
- 2002-08-30 WO PCT/US2002/027886 patent/WO2003020220A2/en not_active Ceased
- 2002-08-30 EP EP02768777A patent/EP1432823A4/en not_active Withdrawn
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9359648B2 (en) | 2003-05-21 | 2016-06-07 | Andes Biotechnoogies S.A. | Markers for pre-cancer and cancer cells and the method to interfere with cell proliferation therein |
| US8895719B2 (en) | 2003-05-21 | 2014-11-25 | Andes Biotechnologies S.A. | Markers for pre-cancer and cancer cells and the method to interfere with cell proliferation therein |
| US8318686B2 (en) | 2003-05-21 | 2012-11-27 | Andes Biotechnologies S.A. | Markers for pre-cancer and cancer cells and the method to interfere with cell proliferation therein |
| EP1625142A4 (en) * | 2003-05-21 | 2007-04-04 | Bios Chile I G S A | MARKERS FOR PRECANCEROUS AND CANCER CELLS AND METHOD OF DISRUPTING CELL PROLIFERATION |
| US10876166B2 (en) | 2003-05-21 | 2020-12-29 | Andes Biotechnologies Global, Inc. | Markers for pre-cancer and cancer cells and the method to interfere with cell proliferation therein |
| US9903000B2 (en) | 2003-05-21 | 2018-02-27 | Andes Biotechnologies Global, Inc. | Markers for pre-cancer and cancer cells and the method to interfere with cell proliferation therein |
| AU2004245762B2 (en) * | 2003-06-09 | 2008-02-28 | Decode Genetics Ehf. | Methods for predicting drug efficacy in patients afflicted with hypertension |
| WO2004108960A3 (en) * | 2003-06-09 | 2005-07-14 | Decode Genetics Ehf | Methods for predicting drug efficacy in patients afflicted with hypertension |
| AU2004245762B9 (en) * | 2003-06-09 | 2008-04-24 | Decode Genetics Ehf. | Methods for predicting drug efficacy in patients afflicted with hypertension |
| WO2005040831A1 (en) * | 2003-10-17 | 2005-05-06 | DKFZ Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Use of adam 12 for diagnosis and therapy of preeclampsia |
| US7842464B2 (en) | 2003-10-17 | 2010-11-30 | Dkfz Deutsches Krebsforschungszentrum | Use of ADAM 12 for diagnosis and therapy of preeclampsia |
| WO2005058142A3 (en) * | 2003-12-16 | 2006-03-02 | Univ Emory | Diabetes diagnostic |
| CN114990160A (zh) * | 2022-06-13 | 2022-09-02 | 昆明医科大学 | 一种Navβ2-ICD低表达转基因鼠模型的构建方法及其应用 |
| CN114990160B (zh) * | 2022-06-13 | 2024-02-02 | 昆明医科大学 | 一种Navβ2-ICD低表达转基因鼠模型的构建方法及其应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2003020220A3 (en) | 2003-12-24 |
| EP1432823A2 (en) | 2004-06-30 |
| EP1432823A4 (en) | 2005-03-02 |
| JP2005515757A (ja) | 2005-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20060099578A1 (en) | Mitochondrial biology expression arrays | |
| EP1836322B1 (en) | Methods and products for in vitro genotyping | |
| Russell et al. | Microarray technology in practice | |
| Mandal et al. | Sequencing arrays for screening multiple genes associated with early-onset human retinal degenerations on a high-throughput platform | |
| US20040005584A1 (en) | Biallelic markers for use in constructing a high density disequilibrium map of the human genome | |
| JP2002525127A (ja) | 遺伝子型決定およびdna分析に関する、方法および生成物 | |
| US20040023237A1 (en) | Methods for genomic analysis | |
| CA2324866A1 (en) | Biallelic markers for use in constructing a high density disequilibrium map of the human genome | |
| AU2018296673B2 (en) | Target-enriched multiplexed parallel analysis for assessment of risk for genetic conditions | |
| EP1432823A2 (en) | Mitochondrial biology expression arrays | |
| US20120183958A1 (en) | Methods for predicting fat and lean phenotypes in chickens | |
| JP2005515757A5 (https=) | ||
| EP1432831A2 (en) | Human mitochondrial dna polymorphisms, haplogroups, associations with physiological conditions, and genotyping arrays | |
| AU2002331789A1 (en) | Mitochondrial biology expression arrays | |
| US20060234221A1 (en) | Biallelic markers of d-amino acid oxidase and uses thereof | |
| EP1829979B1 (en) | Method of identifying gene with variable expression | |
| US20150247195A1 (en) | Detecting a brachyspina mutation | |
| US20080026367A9 (en) | Methods for genomic analysis | |
| CA2459061A1 (en) | Mitochondrial biology expression arrays | |
| JP2004215647A (ja) | 2型糖尿病関連遺伝子 | |
| Lin | Candidate gene expression and SNP analyses of toxin-induced dilated cardiomyopathy in the turkey (Meleagris gallopavo) | |
| Lozynskyi et al. | The study of the mechanisms of the different phenotypical manifestations in patients with reciprocal translocations | |
| HK40030209B (en) | Target-enriched multiplexed parallel analysis for assessment of risk for genetic conditions | |
| HK40030209A (en) | Target-enriched multiplexed parallel analysis for assessment of risk for genetic conditions | |
| JP2004537310A (ja) | インスリン遺伝子の5’隣接領域のアリル異型に基づく肥満の危険性を評価する方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2003524534 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2459061 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002331789 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002768777 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002768777 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2006099578 Country of ref document: US Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10488619 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 10488619 Country of ref document: US |