WO2003002761A1 - Procede de multimerisation et de mutagenese dirigee - Google Patents

Procede de multimerisation et de mutagenese dirigee Download PDF

Info

Publication number
WO2003002761A1
WO2003002761A1 PCT/DK2002/000458 DK0200458W WO03002761A1 WO 2003002761 A1 WO2003002761 A1 WO 2003002761A1 DK 0200458 W DK0200458 W DK 0200458W WO 03002761 A1 WO03002761 A1 WO 03002761A1
Authority
WO
WIPO (PCT)
Prior art keywords
complementary
primers
primer
bacillus
region
Prior art date
Application number
PCT/DK2002/000458
Other languages
English (en)
Inventor
Thomas Aage Thisted
Original Assignee
Novozymes A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes A/S filed Critical Novozymes A/S
Publication of WO2003002761A1 publication Critical patent/WO2003002761A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids

Definitions

  • the present invention relates to a method for generating a multimerized polynucleotide and at the same time introducing at least one mutation in each of the resulting multimers. This is achieved by the use of a polymerase chain reaction polynucleotide amplification, employing at least one pair of primers comprising the desired mutation.
  • the present invention also relates to a multimerized polynucleotide and the use of a multimerized polynucleotide generated by the method according to the present invention for identifying a polypeptide of interest.
  • Bacillus subtilis is an important host organism for the production of enzymes and other proteins due to its capacity to secrete gene products into the growth medium.
  • cloning and mutagenesis of desirable genes is more complicated than similar processes in e.g. Esche chia coli.
  • Several plasmids that can be stably maintained in B. subtilis have been identified (Bron, 1990, In C.R. Harwood and S.M. Cutting (Eds.), Molecular Biolgical Methods for Bacillus. John Wiley & Sons, Chichester, pp. 75-94).
  • the plasmids need to be in multimeric form (Canosi et al., 1978, Mol. Gen. Genet. 166:259-267).
  • a PCR based method for the generation of plasmid multimers that can be directly transformed into Bacillus subtilis is disclosed in WO 97/16546.
  • the region of interest e.g. a cloned gene
  • the plasmid containing the region of interest has been linearized using a restriction endonuclease site within the region of interest, to form a polymerase chain reaction mixture.
  • multimers will start to form.
  • the PCR fragment is gel-purified and cloned into a suitable vector and used in a multimerization reaction as described in WO 97/16546.
  • a need still exists for a faster and more convenient method of introducing a mutation by e.g. site-directed mutagenesis into a region of interest and transforming a suitable host organism, like a Bacillus species transformable with a multimer, with the multimerized product.
  • the present invention concerns a new, simplified protocol for the simultaneous introduction of a mutation by site-directed mutagenesis in a DNA template in a region of interest and the formation of multimers for subsequent transformation in Bacillus.
  • the invention in a first aspect relates to a method for generating a multimerized polynucleotide comprising at least one mutation, the method comprising: a) contacting a polynucleotide template with at least one pair of primers in a mixture, wherein one primer of said pair comprises a region which is at least 80% complementary to a region of the second primer of said pair, wherein the 3'-end-sequences of said primers are at least 80% complementary to a region of the template, and wherein at least one primer comprises one or more mutation(s); and b) performing at least 3 cycles of a polymerase chain reaction amplification on said mixture.
  • the invention in a second aspect relates to a method for generating a multimerized polynucleotide comprising at least one mutation, the method comprising: a) contacting a polynucleotide template with at least one pair of primers in a mixture, wherein one primer of said pair comprises a region which is at least 80% complementary to a region of the second primer of said pair, wherein the 3'-end-sequence of at least one of said primers is at least 80% complementary to the template and the 3'-end-sequence of the other primer is at least 80% complementary to a complementary template sequence, and wherein at least one of said primers comprises one or more mutation(s); and b) performing at leeast 4 cycles of a polymerase chain reaction amplification on said mixture.
  • the invention relates to a multimerized polynucleotide obtainable by any of the above methods.
  • the invention relates to a method for using a multimerized polynucleotide generated by any of the above methods for identifying a polypeptide of interest, wherein the multimers are transformed into a suitable host cell, the gene encoding the polypeptide of interest is expressed into the corresponding polypeptides, and said polypeptide is screened in a suitable assay.
  • the invention relates to a recombinant host cell comprising a multimerized product as obtainable by the method the first aspect, preferably generated by the method of the first aspect.
  • Fig. 1 shows an outline of one embodiment of the present invention where some of the products of the PCR reaction is shown.
  • the method can optionally be split in two reactions; a primary PCR reaction (2-99 cycles) followed by a multimerization PCR reaction.
  • the template is a double-stranded circular plasmid, and the pair of primers have complementary 5'-end sequences (regions 1A and 1B).
  • One of the primers (1A2A) comprises a mutation shown by an asterisk (*) in the 3'-end-sequence.
  • Fig. 2 shows an outline of another embodiment, wherein the mutation to be introduce into the multimers generated by the method of the invention is a deletion comprising the region 2.
  • Primer used herein especially in connection with a PCR reaction is an oligonucleotide (especially a “PCR-primer”) defined and constructed according to general standard specifications known in the art ("PCR A Practical Approach” IRL Press, (1991)).
  • a primer directed to a sequence means that the primer (preferably to be used in a PCR reaction) is designed to exhibit a high level of sequence identity, such as at least 80% degree of sequence identity to the sequence fragment of interest, more preferably at least 90% degree of sequence identity to the sequence fragment of interest, which said primer consequently is "directed to”.
  • the primer is designed to specifically anneal at the sequence fragment (or region of the template) it is directed towards at a given temperature. Especially a high level of identity at the 3' end of the primer is essential.
  • “Homology of DNA sequences or polynucleotides” In the present context the degree of DNA sequence homology is determined as the identity percentage between two sequences indicating a derivation of the first sequence from the second.
  • the identity percentage may suitably be determined by means of computer programs known in the art, such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 )(Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453).
  • homologous means that one single-stranded nucleic acid sequence from a first sequence may hybridize to a complementary single-stranded nucleic acid sequence from a second sequence. The degree of hybridization may depend on a number of factors including the identity percentage between the sequences, the length of the sequences, and the hybridization conditions such as temperature and salt concentration.
  • Polypeptide Polymers of amino acids sometimes referred to as proteins. The sequence of amino acids determines the folded conformation that the polypeptide assumes, and this in turn determines biological properties and activity. Some polypeptides consist of a single polypeptide chain (monomeric), whereas other comprise several associated polypeptides (multimeric). All enzymes and antibodies are polypeptides.
  • Enzyme A protein capable of catalysing chemical reactions. Specific types of enzymes to be mentioned are e.g. amylases, proteases, carbohydrases, lipases, cellulases, oxidoreductases, esterases, etc. "Mutation”: Any change in a DNA-sequence which was not present in the parent template. could be a substitution, a deletion or an insertion.
  • Multimerization The formation of multimers, which in the present context is repeated units (at least two) of a DNA-sequence, e.g. a plasmid.
  • Site-directed mutagenesis An in vitro technique whereby a mutation is introduced at a specific predetermined site in the DNA, usually employing PCR wherein the desired mutation is introduced into at least one of the primers.
  • Polymerase chain reaction The polymerase chain reaction (PCR) is a primer- mediated enzymatic amplification of specifically cloned or genomic DNA sequences.
  • the template DNA contains the target sequence.
  • a thermostable DNA polymerase catalyzes a buffered reaction in which an excess of an oligonucleotide primer pair directed to the ends of the template and four deoxynucleotide triphosphates (dNTPs) are used to make millions of copies of the target sequence.
  • dNTPs deoxynucleotide triphosphates
  • the PCR process requires a repetitive series of the three fundamental steps that define one PCR cycle: double-strand DNA template denaturation, annealing of two oligonucleotide primers to the single-stranded template, and enzymatic extension of the primers to produce copies that can serve as templates in subsequent cycles.
  • the PCR process can be reduced to two cycles: double-strand DNA template denaturation, and combined annealing and extension.
  • DNA consists of nucleotides linked together by phosphodiester bonds between the 5'- and 3'- hydroxyl groups of the sugar backbone.
  • a single-stranded DNA polynucleotide like e.g. a primer thus has an orientation with a free 5'-phosphate at one end and a 3'-hydroxyl at the other end.
  • the "5'-end - sequence” therefore means the end-sequence comprising the free ⁇ '-phosphate group
  • the "3'-end-sequence” therefore means the end-sequence comprising the free 3'-hydroxyl group.
  • Hybridization Suitable experimental conditions for determining if two or more DNA sequences of interest do hybridize to each other or not are generally those used in PCR reactions, including low stringency conditions such as annealing at 50°C-55°C in high salt (1- 5x SSC) to high stringency conditions such as annealing at 68°C-70°C in low salt (0.1-0.5x SSC); in the present context the term “promote hybridization” refers to hybridization at low stringency conditions.
  • T m DNA duplexes, such as primer-template complexes, have a stability that depends on the sequence of the duplex, the concentrations of the two components, and the salt concentration of the buffer. Heat can be used to disrupt this duplex.
  • the temperature at which half the molecules are single-stranded and half are double stranded is called the T m of the complex.
  • Annealing temperature, T A The specificity of the PCR process depends on the successful primer binding events at each amplicon end, and the annealing temperature is selected based on the consensus of melting temperatures (within ⁇ 2-4°C) of the two primers. Usually the annealing temperature is chosen to be a few degrees below the consensus T m of the primers.
  • a double- stranded polynucleotide comprised in a liquid solution may be denatured by heating the solution to at least the melting-point or melting-temperature of the double-stranded polynucleotide and keeping the solution at that temperature until the double-stranded polynucleotide has denatured, separated, or "melted” into two complementary single- stranded polynucleotides.
  • Annealing as used herein means that conditions such as temperature and salt- concentrations in a liquid solution are so that a single-stranded polynucleotide comprised in the solution will anneal preferentially to another single-stranded homologous polynucleotide comprised in the solution, in other words polynucleotides that are not homologous will not anneal to any significant extent.
  • a gene denotes herein a gene (a polynucleotide) which is capable of being expressed into a polypeptide within a living cell or by an appropriate expression system. Accordingly, said gene is defined as an open reading frame starting from a start codon (normally “ATG”, “GTG”, or “TTG”) and ending at a stop codon (normally "TAA”, TAG” or “TGA”).
  • start codon normally "ATG”, "GTG”, or “TTG”
  • TAA start codon
  • TAG stop codon
  • TGA stop codon
  • Control sequence is defined herein to comprise all components that are necessary or advantageous for the expression of a polynucleotide.
  • Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide.
  • Such control sequences include, but are not limited to, a leader sequence, polyadenylation sequence, propeptide sequence, promoter sequence, signal peptide sequence, and transcription terminator sequence.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
  • Operaably linked is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the polynucleotide.
  • Coding sequence is intended to cover a polynucleotide sequence, which directly specifies the amino acid sequence of its protein product.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon.
  • the coding sequence typically includes DNA, cDNA, and recombinant nucleotide sequences.
  • expression includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • expression vector covers a polynucleotide molecule, linear or circular, that comprises a polynucleotide segment encoding a polypeptide of interest, and which is operably linked to additional segments that provide for the expression.
  • the polynucleotide sequence may be obtained by standard cloning procedures used in genetic engineering to relocate the polynucleotide sequence from its natural location to a different site where it will be reproduced.
  • the cloning procedures may involve excision and isolation of a desired polynucleotide fragment comprising the polynucleotide sequence of interest, insertion of the fragment into a vector molecule, and incorporation of the resulting recombinant vector into a host cell where multiple copies or clones of the polynucleotide sequence will be replicated.
  • the polynucleotide sequence may be of genomic, cDNA, RNA, semi synthetic, synthetic origin, or any combinations thereof.
  • a template polynucleotide may encode an enzymatic polypeptide e.g. an aminopeptidase, an amylase, a carbohydrase, a carboxypeptidase, a catalase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an esterase, an alpha-galactosidase, a beta-galactosidase, a glucoamylase, an alpha-glucosidase, a beta-glucosidase, a haloperoxidase, an invertase, a laccase, a lipase, a mannosidase, an oxidase, a pectinolytic enzyme, a peroxidase, a phytase, a polyphenoloxida
  • the starting polynucleotide template of the invention may comprise a coding sequence operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • a polynucleotide sequence to be used as a template in the present invention may be manipulated in a variety of ways to provide e.g. for expression of an encoded polypeptide.
  • Manipulation of the nucleotide sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector.
  • the techniques for modifying nucleotide sequences utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of the nucleotide sequence.
  • the promoter sequence contains transcriptional control sequences, which mediate the expression of the polypeptide.
  • the promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • Suitable promoters for directing the transcription of the nucleic acid constructs of the present invention are the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene ⁇ dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983
  • yeast host useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP), and Saccharomyces cerevisiae 3-phosphoglycerate kinase.
  • ENO-1 Saccharomyces cerevisiae enolase
  • GAL1 Saccharomyces cerevisiae galactokinase
  • ADH2/GAP Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
  • Saccharomyces cerevisiae 3-phosphoglycerate kinase Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8:
  • promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei asparilc proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha- amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (WO 96/00787), as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for
  • the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3'-terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin- like protease.
  • the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3'-terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
  • the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell.
  • the leader sequence 5 is operably linked to the 5'-terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the nucleotide sequence and which, when transcribed, is 0 recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
  • control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded s polypeptide into the cell's secretory pathway.
  • the control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to a mature active polypeptide by o catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836).
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) 5 which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleotide sequence.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vectors may be linear or closed circular plasmids.
  • the vector may be an autonomously replicating vector, i.e., a vector which exists as o an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • a vector which exists as o an extrachromosomal entity the replication of which is independent of chromosomal replication
  • a plasmid e.g., an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one which, when introduced into the host cell, is integrated into the genome 5 and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vector may rely on the nucleotide sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination.
  • the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell.
  • the additional nucleotide sequences enable the vector to be integrated into the host cell genome at (a) precise location(s) in the chromosome(s).
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • origins of replication are the origins of replication of plasmids pUB110, pE194, pTA1060, and pAM ⁇ l permitting replication in Bacillus.
  • the origin of replication may be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75: 1433).
  • the vectors used in the method according to the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophy, and the like.
  • bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance.
  • the present invention also relates to a recombinant host cell comprising the polynucleotide(s) or nucleic acid construct(s) of the invention, which are advantageously used in the screening assays described herein.
  • a vector comprising a nucleotide sequence of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier.
  • the host cell may be a unicellular microorganism, e.g., a prokaryote, or a non- unicellular microorganism, e.g., a eukaryote.
  • Useful unicellular cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces cell, e.g., Streptomyces lividans or Streptomyces murinus, or gram negative bacteria such as E. coli and Pse
  • the introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81 : 823-829, or Dubnau and Davidoff-Abelson, 1971 , Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).
  • protoplast transformation see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115
  • competent cells see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81 : 823-8
  • the host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.
  • the host cell is a fungal cell.
  • "Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).
  • the fungal host cell is a yeast cell.
  • yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, FA, Passmore, S.M., and Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
  • the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
  • the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell.
  • the yeast host cell is a Kluyveromyces lactis cell.
  • the yeast host cell is a Yarrowia lipolytica cell.
  • the fungal host cell is a filamentous fungal cell.
  • "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as
  • Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal host cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.
  • the filamentous fungal host cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell.
  • the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell.
  • the filamentous fungal parent cell is a Fusarium venenatum (Nirenberg sp. nov.) cell.
  • the filamentous fungal host cell is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81 : 1470- 1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N.
  • the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus subtilis cell.
  • the Bacillus cell is an alkalophilic Bacillus.
  • the introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81 : 823-829, or Dubnau and Davidoff-Abelson, 197 ' 1 , Journal of Molecular Biology 56: 209-221 ), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thome, 1987, Journal of Bacteriology 169: 5771-5278).
  • protoplast transformation see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115
  • competent cells see, e.g., Young and Spizizin, 1961 , Journal of Bacteriology 81
  • the present invention relates to a PCR based method that makes possible the simultaneous introduction of mutations in e.g. a plasmid, in a region of interest by e.g. site- directed mutagenesis and at the same time formation of multimers suitable for efficient introduction into a host organism like Bacillus.
  • the DNA multimers resulting from the method according to the invention can be efficiently taken up by competent B. subtilis, and subsequent intramolecular recombination leads to a recircularization of the polynucleotide template, e.g. a plasmid within the cell.
  • the template DNA is a circular double-stranded DNA template, like a plasmid containing a region of interest, which could be a region comprised in a gene within the coding sequence, or it could be a region comprised in a control sequence like e.g. a promoter.
  • the pair of primers are designed in such a way that the 5'-end-sequences of the primers are complementary to each other and complementary to a region on the plasmid as shown in Fig. 1.
  • the 3'-ends of the primers are not complementary to each other but complementary to the template.
  • complementarity should be at least 80% within the 3'-end-sequence, which in this embodiment is the part of the primers that will not be able to anneal to the other primer of the pair (region 2A and 3B in Fig. 1).
  • the 5'-end-sequences of the primers which are the parts of the said primers that will be able to anneal to each other ( region 1A and 1B in Fig.
  • the region of complementarity between the two primers should be sufficiently complementary and of sufficient length to facilitate hybridization of one primer to the other primer under conditions suitable for performing a polymerase chain reaction.
  • at least one of the primers should comprise at least one mutation. The said mutation, in case it is in the 3'-end-sequence of the primer (e.g. region 2A in Fig. 1 ) should not prevent priming from occurring.
  • the first primer, 1A2A comprises the sequence complementary to region 1 B2B
  • the second primer, 3B1 B comprises the sequence complementary to region 3A1A.
  • the resulting product will be a double-stranded DNA fragment comprising the regions 1 and 2 at one end and the regions 3 and 1 at the other end.
  • the ends of the double- stranded fragment as shown in Fig. 1 are now identical. This makes possible, under the proper conditions, the annealing of region 1 A, adjacent to region 3A, to its complementary sequence, region 1 B, adjacent to region 2B during the multimerization PCR reaction.
  • the product of the third PCR cycle will be a linear multimer comprising region 1 at the ends and in the middle.
  • the pair of primers are designed to be complementary to each other only in their 5'-end-sequences, which makes it possible to control which polynucleotides will be able to anneal to each other (primers to template or primer to primer), by controlling the annealing temperature in the PCR-reaction and the length of the 5'-end-sequence complementarity between the primers.
  • the inventive method according to the present invention will, however, also work with primers that are complementary to each other only in their 3'-end-sequences (e.g. 3A1 A and 2B1 B as primers), or alternatively a set of primers that are perfectly complementary sequences except for at least one mutation in at least one of the primers (e.g. 3A1A and 1 B3B as primers).
  • the present invention therefore relates to a method for generating a multimerized polynucleotide comprising at least one mutation, the method comprising: a) contacting a polynucleotide template with at least one pair of primers in a mixture, wherein one primer of the pair comprises a region which is at least 80% complementary to a region of the other primer of the pair, wherein the 3'-end-sequences of the primers are at least 80% complementary to a region of the template, and wherein at least one primer comprises one or more mutation(s); and b) performing at least 3 cycles of a polymerase chain reaction amplification on said mixture.
  • the 5'-end-sequences of said primers are at least 80% complementary to each other, and in another embodiment the 5'-end-sequences of the said primers are also complementary to a region of the template.
  • the 3'-end-sequences of the said primers are at least 80% complementary to each other.
  • the primers are at least 80% complementary to each other, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% complementary to each other.
  • the consensus annealing temperature of the complementary end-sequences 1A and 1B to each other as shown in Fig. 1 is lower than the consensus annealing temperature of the primers 1 A2A and 1 B3B to their complementary sequences 1 B2B and 1A3A, and since presence of the primers will compete for annealing of region 1A, adjacent to region 3A, to its complementary sequence, region 1B, adjacent to region 2B.
  • the primers will be designed in such a way that the melting temperature of the complementary regions of the pair of primers hybridized to each other is comprised in the range from 35-65°C, preferably in the range from 40-60°C, more preferably in the range from 45-55°C, and most preferably from 48-52°C.
  • the primary PCR reaction will be performed using an annealing temperature in the range from 55-65°C and a number of cycles between 2-99. After the primary PCR reaction has been completed most of the primers will have been used and the following multimerization PCR reaction will be performed using an annealing temperature between 40- 50°C.
  • the first step, the primary PCR reaction comprises contacting the first and second primers, wherein at least one of said primers comprises a desired mutation, and the double- stranded DNA template to form a PCR reaction mixture.
  • the mixture is placed in a PCR thermocycler in a suitable tube.
  • the thermocycler is heated to a temperature of 90-100°C for a period of time (typically 1-10 min) in order to denature the DNA templates (typically 90-100°C for 0-5 minutes). Then the temperature is lowered (typically between 55°C and 65°C for 0-5 minutes) to allow annealing of the primer to the single-stranded template. The temperature is then raised to allow extension of the primers along the template (typically 5-180 seconds at 66-76°C). After extension the temperature is raised to 90-100°C for a period of time (typically 1-10 min) thereby denaturing the extended primers and the template.
  • the resulting product as shown in Fig. 1 , will be a double-stranded DNA fragment comprising the regions 1 and 2 at one end and the regions 3 and 1 at the other end and the desired mutation on both strands.
  • the product can be purified before proceeding to the second step, the multimerization step.
  • the product of the primary PCR reaction is used in the subsequent multimerization PCR reaction in which no primers are added, and a lower annealing temperature is applied, typically between 40-50°C.
  • a DNA polymerase suitable for long template elongation such as PWO polymerase (Roche) or the polymerase of the ExpandTM Long Template PCR System (Roche), is preferred.
  • the mixture is placed in a PCR thermocycler in a suitable tube.
  • the thermocycler is heated to a temperature of 90-100°C for a period of time (typically 1-10 min) in order to denature the DNA templates (typically 90-100°C for 0-5 minutes). Then the temperature is lowered (typically between 40°C and 50°C for 0-5 minutes) to allow annealing of the complementary 5'-end-sequences, 1 A and 1 B. The temperature is then raised to allow extension of the primers along the template (typically 1-5 minutes at 66-76°C). After extension the temperature is raised to 90-100°C for a period of time (typically 1-10 min) thereby denaturing the extended primers and the template. This cycle of denaturation, annealing, and extension can be repeated, typically about 10 times, followed by 10-20 more cycles in which the elongation time is increased to 5-10 minutes.
  • the desired mutation is comprised in at least one of the two primers used in the primary PCR reaction.
  • the one or more mutation(s) could be inside a region that is complementary to the template, and in another embodiment the one or more mutation(s) could be outside a region that is complementary to the template.
  • the mutation could optionally be present in both primers (e.g. in region 1A and 1 B shown in Fig. 1).
  • the primer should be designed in a way that will place the mutation as close as possible to the overlapping region of the complementary 5'-end-sequences (e.g. in 2A but as close as possible to 1 A as shown in Fig. 1). This will ensure optimal priming at the 3'-end of the primer necessary for polymerization to be efficient.
  • the said mutation comprises insertions, deletions, and substitutions.
  • Fig. 2 is shown an outline of the PCR reaction products in an example of a deletion of a whole region 2.
  • the first primer, 1 A4A comprises the sequence complementary to region 1 B4B
  • the second primer, 3B1 B comprises the sequence complementary to region 3A1 A.
  • the first primer, 1 A4A will anneal to the sequence 4B on the product of the first cycle and the second primer, 1B3B, will anneal to the sequence 1A3A on the other product of the first cycle.
  • the resulting product will be a double-stranded DNA fragment comprising the regions 1 and 4 at one end and the regions 3 and 1 at the other end.
  • Region 2 has been deleted, and the ends of the fragment as shown in figure 2 are now identical. This makes possible under the proper conditions the annealing of region 1 A, adjacent to region 3A, to its complementary sequence, region 1 B, adjacent to region 4B.
  • the product of the third PCR cycle will be a linear multimer comprising region 1 at the ends and in the middle.
  • the method according to the invention can be applied to a starting linear double-stranded DNA template.
  • the template polynucleotide is linear and comprises two end-sequences, wherein each of the end-sequences is at least 80% complementary to the 3'-end-sequences of each of the primers; or wherein each of the end-sequences is sufficiently complementary to the 3-end-sequences of each of the primers to facilitate hybridization of the primers to the end-sequences under conditions suitable for performing primer extension by a polymerase chain reaction.
  • the polynucleotide template from which to generate a multimerized polynucleotide comprising at least one mutation can be single stranded. In that case an extra cycle of PCR amplification is needed before a multimer can be formed, since in the first cycle of the PCR amplification there will only be one template strand. Primers are designed in the same way as previously described, and after the first PCR cycle which will result in the formation of the complementary template strand, the following cycles will be equivalent to that shown in Fig. 1.
  • Another embodiment of the present invention therefore relates to a method for generating a multimerized polynucleotide and introducing at least one mutation in said polynucleotide, the method comprising: a) contacting a polynucleotide template with at least one pair of primers to form a polymerase chain reaction mixture, wherein one primer of the pair comprises a region which is at least 80% complementary to a region of the other primer of the pair, wherein the 3'-end-sequence of at least one of said primers is at least 80% complementary to the template and the 3'-end- sequence of the other primer is at least 80% complementary to a complementary template sequence, and wherein at least one of the primers comprises one or more mutation(s); and b) performing at least 4 cycles of a polymerase chain reaction amplification on said mixture.
  • the polynucleotide template from which to generate a multimerized polynucleotide using the inventive method according to the present invention is preferably a plasmid or a vector.
  • the said plasmid or vector could comprise a region of interest like a gene or a control sequence in which region it is desirable to introduce a specific mutation by site directed mutagenesis.
  • the said plasmid or vector is stably maintained in a host cell transformable with plasmid multimers, which in the present context means a vector or plasmid capable of autonomous replication or integration into the host genome.
  • the plasmid comprises a selectable marker, an origin of replication and a gene encoding a polypeptide of interest.
  • the said polypeptide of interest could be an enzyme, preferably a hydrolase, a lyase, a ligase, a transferase, an isomerase or an oxidoreductase. Also, the polypeptide of interest could be a peptide having antimicrobial activity.
  • the polypeptide of interest is a polypeptide having biological activity.
  • the polypeptide is insulin, pro-insulin, pre-pro-insulin, glucagon, somatostatin, somatotropin, thymosin, parathyroid hormone, pituitary hormones, somatomedin, erythropoietin, luteinizing hormone, chorionic gonadotropin, hypothalamic releasing factor, antidiuretic hormone, blood coagulant factor, thyroid stimulating hormone, relaxin, interferon, thrombopoeitin (TPO) or prolactin.
  • TPO thrombopoeitin
  • the method according to the present invention is particular useful for generating multimerized polynucleotides comprising at least one mutation for transformation into a host organism transformable with plasmid multimers.
  • the said host organism comprises Bacillus species, Vibrio species, Penicillium species, Streptococcus species, or Haemophilus species.
  • Bacillus species comprises: B. subtilis, B. licheniformis, B. clausii, B. amylolichefaciens, or B. agaradhaerens.
  • the present invention relates to a multimerized polynucleotide obtainable by any of the methods of the present invention.
  • the invention in a third aspect relates to a method of use of a multimer generated by any of the above methods for multimerization and site-directed mutagenesis, for identifying a polypeptide of interest exhibiting improved properties in comparison to naturally occurring or other known polypeptides of similar activity, whereby the multimers are transformed into a suitable host cell, the gene of interest is expressed into the corresponding polypeptides, and said polypeptide is screened in a suitable assay.
  • the suitable host cell comprises Bacillus species, Vibrio species, Penicillium species, Streptococcus species, or Haemophilus species.
  • Bacillus species comprises: B. subtilis, B. licheniformis, B. clausii, B. amylolichefaciens, or B. agaradhaerens.
  • the invention in a final aspect relates to a recombinant host cell comprising a multimerized product as obtainable by the method the first aspect, preferably generated by the method of the first aspect.
  • the host cell is a Bacillus cell, preferably a Bacillus subtilis, Bacillus licheniformis, Bacillus clausii, Bacillus amylolichefaciens, or Bacillus agaradhaerens cell.
  • S301T (SEQ ID NO:1): 5' ccttcattataatctttataacgcgactaatagtggaggcaactatgacatggca S301 overlap (SEQ ID NO:2): 5' cgcgttataaagattataatgaagggggacatcaaagacag
  • the primers are designed so that the mutant primer, S301T (SEQ ID NO:1), would have a high T A (approx. 65°C) calculated for the 3'-end of the primer, from the end to the position of the mutation, and a lower T A (approx. 55°C) for the 5'-end of the primer.
  • the overlap primer, S301 overlap (SEQ ID NO:2), has a high T A to template, and is designed with a short 5'-end-sequence complementary to the 5'-end of the mutant primer. This ensures that the two primers do not hybridize under conditions where efficient template annealing is possible. Also, the complementarity between the primers is in the 5'-ends of the primers, which should minimize primer-dimer problems.
  • the primary PCR reaction was performed with the two primers, S301T and S301overlap, and an annealing temperature of 65°C. This annealing temperature ensured that the primers preferably annealed to the template and not to each other. PCR was performed using PCR Beads from Pharmacia, and 0.1 units PWO polymerase (Roche).
  • PCR cycling was as follows: 94°C, 2min; 25 cycles of (94°C, 30 sec; 65°C, 30 sec; 72°C, 2 min); 72°C, 5 minutes; 4°C hold.
  • DNA was purified on a PCR-purification column (Qiagen), and eluted into 100 ⁇ l 10mM Tris-HCl, pH 7.5, or alternatively the PCR product was gel purified using the Pharmacia GFXTM purification kit.
  • PCR program - Multi I 94°C, 1 min; 10 x (94°C, 15 sec; 48°C, 30 sec; 68°C, 5 min); 10 x (94°C, 15 sec; 48°C, 30 sec; 68°C, 10 min).

Landscapes

  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Molecular Biology (AREA)

Abstract

L'invention concerne un procédé de production d'un polynucléotide soumis à une multimérisation comprenant au moins une mutation. Le procédé consiste à mettre en contact une matrice polynucléotidique avec au moins une paire d'amorces dans un mélange et est caractérisé en ce qu'une amorce de cette paire comprend une région étant à au moins 80 % complémentaire d'une région de la seconde amorce de ladite paire, en ce que les séquences d'extrémité 3' des amorces sont à au moins 80 % complémentaires d'une région de la matrice, et en ce qu'au moins une amorce comprend au moins une mutation; le procédé consiste ensuite à effectuer au moins 3 cycles d'une amplification de réaction en chaîne par polymérase sur ledit mélange.
PCT/DK2002/000458 2001-06-29 2002-07-01 Procede de multimerisation et de mutagenese dirigee WO2003002761A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DKPA200101025 2001-06-29
DKPA200101025 2001-06-29

Publications (1)

Publication Number Publication Date
WO2003002761A1 true WO2003002761A1 (fr) 2003-01-09

Family

ID=8160597

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2002/000458 WO2003002761A1 (fr) 2001-06-29 2002-07-01 Procede de multimerisation et de mutagenese dirigee

Country Status (1)

Country Link
WO (1) WO2003002761A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2068251A2 (fr) 2007-10-25 2009-06-10 Deutsche Telekom AG Procédé d'adaptation de contenu pour affichages électroniques
WO2011099015A1 (fr) 2010-02-15 2011-08-18 Yeda Research And Development Co. Ltd. Complexes multienzymatiques biologiquement modifiés comprenant des xylanases et utilisations associées
WO2011154943A1 (fr) 2010-06-07 2011-12-15 Yeda Research And Development Co. Ltd. Cellulases modifiées à thermostabilité améliorée
WO2013114362A1 (fr) 2012-01-30 2013-08-08 Yeda Research And Development Co. Ltd. Protéines de fusion comprenant des modules cohésines de type ii, complexes multienzymatiques comprenant celles-ci et leurs utilisations
WO2013132477A1 (fr) 2012-03-06 2013-09-12 Cellect Biotechnology Ltd Dispositifs et procédés de sélection de cellules résistantes à la signalisation de l'apoptose, et utilisations associées
US8962253B2 (en) 2009-04-13 2015-02-24 Somagenics Inc. Methods and compositions for detection of small RNAs
US9816130B2 (en) 2011-12-22 2017-11-14 Somagenics, Inc. Methods of constructing small RNA libraries and their use for expression profiling of target RNAs
US11014957B2 (en) 2015-12-21 2021-05-25 Realseq Biosciences, Inc. Methods of library construction for polynucleotide sequencing

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991007506A1 (fr) * 1989-11-08 1991-05-30 The United States Of America, Represented By The Secretary, United States Department Of Commerce Procede de synthese de molecules d'adn bicatenaire
WO1997016546A1 (fr) * 1995-11-02 1997-05-09 Genencor International, Inc. Clonage moleculaire par multimerisation de plasmides
WO1997020948A1 (fr) * 1995-12-05 1997-06-12 Koch Joern Erland Reaction d'amplification en cascade d'acide nucleique
EP0812911A2 (fr) * 1996-06-10 1997-12-17 Japan Science and Technology Corporation Procédé pour la formation de polymère microgène macromoléculaire
US5789166A (en) * 1995-12-08 1998-08-04 Stratagene Circular site-directed mutagenesis
WO1999009183A1 (fr) * 1997-08-19 1999-02-25 Genencor International, Inc. ALPHA-AMYLASE MUTANTE COMPRENANT UNE MODIFICATION AU NIVEAU DES RESIDUS CORRESPONDANT A A210, H405 ET/OU T412 CHEZ LES $i(BACILLUS LICHENIFORMIS)
US5928905A (en) * 1995-04-18 1999-07-27 Glaxo Group Limited End-complementary polymerase reaction
US6194179B1 (en) * 1999-07-20 2001-02-27 The Rockefeller University Method for preparing polynucleotide sequences and uses thereof

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991007506A1 (fr) * 1989-11-08 1991-05-30 The United States Of America, Represented By The Secretary, United States Department Of Commerce Procede de synthese de molecules d'adn bicatenaire
US5928905A (en) * 1995-04-18 1999-07-27 Glaxo Group Limited End-complementary polymerase reaction
WO1997016546A1 (fr) * 1995-11-02 1997-05-09 Genencor International, Inc. Clonage moleculaire par multimerisation de plasmides
WO1997020948A1 (fr) * 1995-12-05 1997-06-12 Koch Joern Erland Reaction d'amplification en cascade d'acide nucleique
US5789166A (en) * 1995-12-08 1998-08-04 Stratagene Circular site-directed mutagenesis
EP0812911A2 (fr) * 1996-06-10 1997-12-17 Japan Science and Technology Corporation Procédé pour la formation de polymère microgène macromoléculaire
WO1999009183A1 (fr) * 1997-08-19 1999-02-25 Genencor International, Inc. ALPHA-AMYLASE MUTANTE COMPRENANT UNE MODIFICATION AU NIVEAU DES RESIDUS CORRESPONDANT A A210, H405 ET/OU T412 CHEZ LES $i(BACILLUS LICHENIFORMIS)
US6194179B1 (en) * 1999-07-20 2001-02-27 The Rockefeller University Method for preparing polynucleotide sequences and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HIROKO KADOWAKI ET AL: "Use of polymerase chain reaction catalyzed by TAQ DNA polymerase for site-specific mutagenesis.", GENE, vol. 76, 1989, pages 161 - 166, XP002902759 *
SHAFIKHANI ET AL: "Generation of large libraries of random mutants in Bacillus subtilis by PCR-based plasmid multimerization", BIOTECHNIQUES, EATON PUBLISHING, NATICK, US, vol. 23, no. 2, 1997, pages 304 - 310, XP002094373, ISSN: 0736-6205 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2068251A2 (fr) 2007-10-25 2009-06-10 Deutsche Telekom AG Procédé d'adaptation de contenu pour affichages électroniques
US10041107B2 (en) 2009-04-13 2018-08-07 Somagenics, Inc. Methods and compositions for detection of small RNAs
US8962253B2 (en) 2009-04-13 2015-02-24 Somagenics Inc. Methods and compositions for detection of small RNAs
US9416402B2 (en) 2009-04-13 2016-08-16 Somagenics, Inc. Methods and compositions for detection of small RNAs
US9493818B2 (en) 2009-04-13 2016-11-15 Somagenics, Inc. Methods and compositions for detection of small RNAS
WO2011099015A1 (fr) 2010-02-15 2011-08-18 Yeda Research And Development Co. Ltd. Complexes multienzymatiques biologiquement modifiés comprenant des xylanases et utilisations associées
US9034609B2 (en) 2010-02-15 2015-05-19 Yeda Research And Development Co. Ltd. Bio-engineered multi-enzyme complexes comprising xylanases and uses thereof
WO2011154943A1 (fr) 2010-06-07 2011-12-15 Yeda Research And Development Co. Ltd. Cellulases modifiées à thermostabilité améliorée
US11072819B2 (en) 2011-12-22 2021-07-27 Realseq Biosciences, Inc. Methods of constructing small RNA libraries and their use for expression profiling of target RNAs
US9816130B2 (en) 2011-12-22 2017-11-14 Somagenics, Inc. Methods of constructing small RNA libraries and their use for expression profiling of target RNAs
WO2013114362A1 (fr) 2012-01-30 2013-08-08 Yeda Research And Development Co. Ltd. Protéines de fusion comprenant des modules cohésines de type ii, complexes multienzymatiques comprenant celles-ci et leurs utilisations
WO2013132477A1 (fr) 2012-03-06 2013-09-12 Cellect Biotechnology Ltd Dispositifs et procédés de sélection de cellules résistantes à la signalisation de l'apoptose, et utilisations associées
EP3486315A1 (fr) 2012-03-06 2019-05-22 Cellect Biotherapeutics Ltd. Dispositifs et procédés de sélection de cellules résistantes à la signalisation de l'apoptose et utilisations associées
US9783778B2 (en) 2012-03-06 2017-10-10 Cellect Biotherapeutics Ltd. Devices and methods for selecting apoptosis-signaling resistant cells, and uses thereof
US11014957B2 (en) 2015-12-21 2021-05-25 Realseq Biosciences, Inc. Methods of library construction for polynucleotide sequencing
US11964997B2 (en) 2015-12-21 2024-04-23 Realseq Biosciences, Inc. Methods of library construction for polynucleotide sequencing

Similar Documents

Publication Publication Date Title
EP0973940B1 (fr) Methode de production in vitro d'une bibliotheque d'adn
US20240101988A1 (en) Temperature-sensitive cas9 protein
US11174487B2 (en) Stable genomic integration of multiple polynucleotide copies
US6159687A (en) Methods for generating recombined polynucleotides
WO2018009520A1 (fr) Amélioration d'un micro-organisme par inhibition de crispr
WO2008065200A1 (fr) Expression d'une dnase dans des cellules hôtes recombinées
EP2221366B1 (fr) Polypeptides dotés d'activité alpha-glucuronidase et polynucléotides les codant
EP3969576A1 (fr) Endonucléase guidée par arn sensible à la température
Wäneskog et al. Multi-fragment site-directed mutagenic overlap extension polymerase chain reaction as a competitive alternative to the enzymatic assembly method
WO2003002761A1 (fr) Procede de multimerisation et de mutagenese dirigee
EP1157100B1 (fr) Cellules fongiques hotes deficitaires en hydrolase d'oxaloacetate
CN114717209A (zh) 具有增加的耐盐性的t4 dna连接酶变体
US6783941B2 (en) Method for producing a polynucleotide library in vitro by mismatch repair of heteroduplexes
US20040152094A1 (en) Method for producing recombined polynucleotides
US20180073017A1 (en) Methods for selecting enzymes having enhanced activity
KR101503726B1 (ko) Ｄｎａ 제한효소에 의해 활성 조절이 가능한 프라이머 및 이를 이용한 유전자 증폭방법 그리고 이러한 프라이머의 설계방법
EP3728583B1 (fr) Contre-sélection par inhibition de gènes essentiels de manière conditionnelle
CN114854699A (zh) 具有提高的热稳定性的t4 dna连接酶变体
WO2002046396A1 (fr) Methode pour la production d'une bibliotheque de polynucleotides
WO2020260061A1 (fr) Contre-sélection par inhibition de gènes essentiels conditionnellement
WO2008077881A1 (fr) Sélection de gènes synthétiques bien exprimés
US20080153128A1 (en) Cell-Free Protein Synthesis
US20060014149A1 (en) Methods for rolling circle amplification and signal trapping of libraries
MXPA99008619A (en) An in vitro

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2004111974

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)