WO2002097099A1 - Expression regulee de somatostatine - Google Patents

Expression regulee de somatostatine Download PDF

Info

Publication number
WO2002097099A1
WO2002097099A1 PCT/US2001/017573 US0117573W WO02097099A1 WO 2002097099 A1 WO2002097099 A1 WO 2002097099A1 US 0117573 W US0117573 W US 0117573W WO 02097099 A1 WO02097099 A1 WO 02097099A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression system
ghrh
inducible
ligand
seq
Prior art date
Application number
PCT/US2001/017573
Other languages
English (en)
Inventor
Jeffrey L. Nordstrom
Ruxandra Draghia-Akli
Original Assignee
Valentis, Inc.
Baylor College Of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Valentis, Inc., Baylor College Of Medicine filed Critical Valentis, Inc.
Publication of WO2002097099A1 publication Critical patent/WO2002097099A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/60—Growth hormone-releasing factor [GH-RF], i.e. somatoliberin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a regulated gene expression system for growth hormone releasing hormone ("GHRH”) characterized by low basal expression and high specific inducibility, and to the use of regulated gene expression for control of GHRH expression in gene therapy.
  • GHRH growth hormone releasing hormone
  • Gene-based drug delivery offers a number of advantages over administration of recombinant proteins. These advantages include: conservation of native protein structure; improved biological activity; prolonged exposure to protein in the therapeutic range; prolonged availability of protein from each administration; avoidance of systemic toxicities; and avoidance of infectious and toxic impurities. Gene therapy is particularly relevant to the provision of hormones such as Growth Hormone Releasing Hormone ("GHRH”) in which an extremely short in vivo half-life renders administration of recombinant proteins impracticable.
  • GHRH Growth Hormone Releasing Hormone
  • GH Growth Hormone
  • IGF-I Insulin-like Growth Factor-I
  • Effective and regulated expression of the GH and IGF-I pathway is essential for optimal linear growth, homeostasis of carbohydrate, protein, and fat metabolism, provides a positive nitrogen balance.
  • GH and IGF-I also have beneficial effects on immune function (LeRoith, D. et al., Endocrinology 137:10711079 (1996); Kotzmann, H. et al., Neuroendocrinology 60:618-625 (1994)).
  • GHRH growth hormone releasing hormone
  • Muller, E. E., et al. (1999) Physiol Rev. 79, 511-607 growth hormone releasing hormone
  • the GHRH-GH-IGF-I axis undergoes dramatic changes during the aging process and in the elderly (Iranmanesh et al., (1991), J. Clin. Endocrin. & Metab. 73:1081-1088; D'Costa A.P. et al., (1993), J. Reproduction & Fertility Suppl.
  • GHRH-GH-IGF-I axis including those of GHRH receptor (Cao et al. (1995) Pediatr. Res. 38:962-966), GH gene (Cogan et al. (1993) J. Clin. Endocrin. & Metab. 76:1224-1228; Vnencak- Jones et al. (1988) Proc. Natl. Acad. Sci. 85:5615-5619), GH receptor (Amselem et al. (1993) Human Molec. Gen. 2:355359; Amselem et al.
  • GH must be administered subcutaneously or intramuscularly once a day to three times a week for month, or usually years; insulin resistance and impaired glucose tolerance often result (Angelopoulos, T. J., et al. (1998) Gerontology 44, 228-231); in pediatric patients, there is accelerated bone epiphysis growth and closure or slipping of the capital femoral epiphysis (Blethen, S. L. and Rundle, A. C. (1996) Horm.Res. 46, 113-116; Blethen, S. L. and MacGillivray, M. H.
  • GH secretagogues such as GHRH allow for normal homeostasis of the GH-IGF-I axis by stimulating the pulsatile release of endogenous GH and retaining feedback control of endogenous GH and IGF-I thus avoiding imbalances of and between GH and IGF-I levels.
  • GHRH therapy is expected to be more physiological than GH therapy.
  • GHRH administration permits a degree of feed- back, which is totally abolished in the GH therapies.
  • GHRH would be expected to have therapeutic utility in the treatment of cachexia in chronic diseases such as cancer, diabetes, due to growth hormone production abnormalities, enhancement of burn and wound healing, bone healing, retardation of the aging process and osteoporosis.
  • Recombinant GHRH is being tested in human clinical trials in the elderly for indications including congestive heart failure, osteoporosis, and improvements in body composition and function in the frail elderly.
  • Recombinant GHRH has been found to boost the nighttime secretion of growth hormone with concomitant increase in blood IGF-I levels and reduction in body fat.
  • current limitations of recombinant GHRH therapy are the high cost of recombinant proteins and the short half-life of the peptides in vivo resulting in a requirement for frequent (one to three times a day) intravenous, subcutaneous or intranasal (requiring 300-fold higher dose) administrations (Evans, W. S., et al.
  • gene therapy provides delivery of genes to somatic tissue in a manner that can provide correction of inborn or acquired deficiencies and imbalances.
  • Gene-based drug delivery offers a number of advantages over administration of recombinant proteins. These advantages include: conservation of native protein structure; improved biological activity; prolonged exposure to protein in the therapeutic range; prolonged availability of protein from each administration; avoidance of systemic toxi cities; and avoidance of infectious and toxic impurities.
  • Using a GHRH injectable DNA plasmid based vector can enhance endogenous GH secretion in vertebrate animals with GH deficiencies in a manner more closely mimicking the natural process and in a less expensive manner than classical therapies.
  • a gene therapy approach will overcome this primary limitation to GHRH use and is preferable, as a single injection into the patient's skeletal muscle may permit physiologic GHRH expression for more then 1 year.
  • Intramuscular injection of DNA vector encoding GHRH can persist for several months to produce sustained levels of GHRH and has been shown by the present inventors to result in enhanced growth. (Draghia-Akli R, et al.
  • GHRH functions as an autocrine growth factor in some tumors.
  • GHRH functions as an autocrine growth factor in some tumors.
  • regulated expression of GHRH is desirable for use in animals under some circumstances and may be required to provide an acceptable safety margin for use in humans.
  • What is needed for expression of proteins such as GHRH is the ability to closely regulate expression of the introduced gene across a range of administration dosages.
  • a regulated gene expression system having extremely low levels of basal expression of GHRH while retaining high inducibility.
  • the present invention provides an improved molecular-switch, inducible- expression system for regulating the expression of a nucleic acid sequence in gene therapy under conditions in which tight control of expression is of particular importance.
  • a system is provided wherein expression of the gene to be induced is characterized by low or undetectable expression or biological effect in the absence of the inducer, but in the presence of the inducer, is characterized by efficient induction of expression or biological effect.
  • a method is provided that induces a measure of tolerance to transgenic proteins, thus making long-term administration of the protein by gene therapy or recombinant protein possible and effective.
  • Additional embodiments of the present invention include: (1) a method for treating growth hormone-related deficiencies associated with the growth hormone pathway; (2) a method for treating growth hormone-related deficiencies associated with genetic disease; a (3) a method of treating wasting symptoms associated with burn, trauma, AIDS, or other consumption diseases, including conversion to anabolism from a catabolic state associated with wasting associated with cancer, AIDS, burns, or post-surgery; and (4) a method to prevent or treat bone loss, as in elderly, or post-fracture. All of these methods include the step of introducing a regulated expression vector system into an animal, wherein said expression system can be activated and controlled by administration of an exogenously supplied ligand.
  • said vector is selected from the group consisting of a plasmid or a viral vector.
  • the vector may be administered in a simple physiologic solution such as a saline or sugar solution or may be formulated with a liposome, cationic lipid, or a cationic, non-ionic or anionic polymer.
  • said vector is introduced into myogenic cells or muscle tissue.
  • said animal is a human, a pet animal, a work animal, or a food animal.
  • the inducible-expression system comprises two nucleic acid or expression cassettes.
  • the first expression cassette includes a promoter driving the expression of a molecular switch protein.
  • the molecular switch is a chimeric or fusion protein.
  • the fusion protein may be comprised of a mutated GAL-4 DNA binding domain characterized by an inability to autodimerize in the absence of an inducer.
  • the fusion protein may further comprise a transactivation domain and a mutated ligand-binding domain of a steroid-hormone receptor capable of being activated by a non-natural ligand inducer such as mifepristone.
  • the promoter is a tissue-specific promoter such as ⁇ -actin promoter specific for muscle tissues.
  • the first expression cassette may also include 5' untranslated regions, synthetic introns, and poly (A) signals that increase the fidelity of expression of the gene to be induced.
  • the second expression cassette may include a gene controlled by an inducible promoter comprising a GAL-4 DNA-binding site.
  • the inducible expression system is applied in vivo to effect expression of a transgene for gene therapy purposes.
  • the inducible expression system administered to an animal or human in conjunction with electroporation.
  • the inducible system may be formulated with transfection enhancing or nucleic acid protective compounds and administered with or without electroporation.
  • a method is provided to minimize potential immune responses of the animal to the transgene or any other introduced nucleic acid and proteins. After administration of the expression system, the induction of the expression system may occur after the animal's initial immune reaction to the injection and electroporation has subsided.
  • a lag time between the administration of the expression system and the inducer may be at least 12 days, more preferably, at least 20 days, or most preferably, greater than 50 days.
  • the method may also include the administration of the inducer using a pulsatile program that further enhances the immunotolerance of the animal.
  • the inducible expression system as introduced in an animal may be characterized by the ability to repetitively effect a biological response using administration of an inducer of the expression system.
  • the biological response to the inducer is maintained over a period of at least one year using only a single administration of the expression system.
  • Figure 1 is a schematic representation of the nucleic acid structures of an improved expression-regulated system comprising a GENESWITCH® regulator plasmid and an inducible GHRH plasmid according to one embodiment of the present invention.
  • Figure 1 also depicts the interaction between the gene product (i.e. regulator protein) of the GENESWITCH® plasmid and an inducer (e.g. anti-progestin) to induce the expression of GHRH encoded by the inducible GHRH plasmid.
  • an inducer e.g. anti-progestin
  • Figure 2 depicts the feedback loops of the GHRH-GH-IGF-I Axis.
  • Figure 3 depicts the amino acid sequence and structure of the GAL-4 DNA binding domain, amino acid residues 1-93. SEQ. ID. NO. 10.
  • Figure 4 depicts the consensus intron structure SEQ. ID. NO. 6 and the sequence of a synthetic intron SEQ. ID. NO. 5 according to one embodiment of the present invention.
  • Figure 5 depicts the sequence of a particular synthetic intron, IVS8 SEQ. ID. NO.
  • Figure 6A depicts a schematic representation of relevant regions of an inducible promoter with unique restriction sites indicated.
  • Figure 6B depicts the nucleic acid sequence of the 6X GAL-4/TATA promoter region SEQ. ID. NO. 18, and
  • Figure 6C depicts the nucleic acid sequence of the TATA box, initiation ("inr") region and the UT12 transcription factor binding site, SEQ. ID .NO. 19.
  • Figure 7 depicts the coding sequences of the molecular switch plasmid pGLV65 (SEQ. ID. NO. 12) and pGS1633 v.4.0 (SEQ. ID. NO. 13), wherein SEQ. ID. NO. 13 has a truncated GAL-4 DNA-binding domain.
  • Figure 8 depicts the amino acid sequences of the GENESWITCH® regulator proteins (SEQ. ID. NOS. 14 & 15) encoded by the coding sequences depicted in Figure 7. SEQ. NOS. 12 & 13 respectively.
  • Figure 9 depicts the plasmid map of pGS1633, GENESWITCH® Plasmid Version 4.0 having a chicken skeletal ⁇ -actin ("SK") promoter according to one embodiment of the present invention.
  • SK skeletal ⁇ -actin
  • Figure 10 depicts the plasmid map of phGHRH1674, an inducible human GHRH encoding plasmid according to one embodiment of the present invention.
  • Figure 11 depicts the complete nucleic acid sequence of pGS1633, SEQ. ID. NO. 28.
  • Figure 12 depicts the complete nucleic acid sequence of pGHRH1674, SEQ. ID. NO. 29.
  • Figure 13 depicts the sequence and components of exemplary synthetic muscle specific promoters, SEQ. ID.NO. 21 and 22.
  • Figure 14 depicts the in vivo activity of an early version of a regulated GHRH expression system.
  • Figure 15 depicts the in vitro activity of a tightly regulated GHRH/GeneSwitch system is active according to one embodiment of the present invention.
  • Myoblasts were transfected with a mixture of GHRH/GeneSwitch in the presence (+MFP) or absence (- MFP) of the inducible drug.
  • the construct coding for E.coli beta-galactosidase, ⁇ gal is used as a negative control.
  • As a positive control cells were transfected with a constitutively active pSP-GHRH construct.
  • Ten micrograms of total RNA were separated, transferred onto a nylon membrane and hybridized with a hGHRH cDNA probe.
  • Figure 16 depicts the in vivo activity of a tightly regulated GHRH/GeneSwitch system is active according to one embodiment of the present invention.
  • a single injection of GHRH/GeneSwitch increases IGF-I serum levels upon activation of the system with
  • Figure 17 depicts weight and pituitary organ change upon chronic MFP induction.
  • Figure 17A depicts average weight increase in injected mice upon chronic activation of the GHRH/GeneSwitch system, * p ⁇ 0.027.
  • Figure 17 B depicts pituitary weight / total body weight in +MFP injected animals, * p ⁇ 0.035.
  • Figure 18 depicts body composition changes in chronically induced GHRH/GeneSwitch mice.
  • Figure 18A depicts the significant increase in lean non-bone mass, * p ⁇ 0.022.
  • Figure 18B depicts the significant decrease in fat body mass/ total weight in induced animals, * p ⁇ 0.05.
  • Figure 19 depicts body composition changes in chronically induced GHRH/GeneSwitch mice.
  • Figure 19A depicts that bone area is increased by PLXImus, *p ⁇ 0.0006.
  • Figure 19B depicts that bone mineral content is increased in induced animals, * p ⁇ 0.002.
  • Figure 20 depicts GHRH sequences.
  • Figure 20A depict one embodiment of a codon optimized human 1-40 aa GHRH.
  • Figure 20B depicts the amino acid sequences of several alternate GHRH species.
  • GH Growth Hormone
  • GHRH-GH-IGF-I axis Growth Hormone Releasing Hormone - Growth Hormone - Insulin Growth Factor I axis
  • GH synthesis and secretion from the anterior pituitary is stimulated by GHRH and inhibited by somatostatin, both hypothalamic hormones.
  • GH increases production of IGF-I, primarily in the liver, and possibly other target organs.
  • IGF- I and GH in turn, feedback on the hypothalamus and pituitary to inhibit GHRH and GH release.
  • Effective and regulated expression of GH and IGF-I is essential for optimal linear growth, homeostasis of carbohydrate, protein, and fat metabolism, provides a positive nitrogen balance, and has beneficial effects on immune function.
  • GHRH it is meant a protein having GHRH activity that is able to regulate the GH synthesis and release.
  • GHRH analog proteins U.S. Pat. Nos. 5,847,066; 5,846,936; 5,792,747; 5,776,901; 5,696,089; 5,486,505; 5,137,872; 5,084,442; 5,036,045; 5,023,322; 4,839,344; 4,410,512; RE33.699
  • synthetic or naturally occurring peptide fragments of GHRH U.S. Pat. Nos.
  • the GHRH of the subject invention can be any animal GHRH or GHRH analoque having GHRH activity such as for example the GHRH species of SEQ.ID. 31 (human 44 aa GHRH), 32 (humans 40 aa GHRH), 33 (porcine 40 aa wild type), and including protease resistant variants such as for example the GHRH species of SEQ.ID. 34 (super- porcine HV as disclosed in WO 01/06988).
  • the sequence encoding GHRH can be a native sequence or can be codon optimized such as for example the human 1-40 aa codon optimized sequence of SEQ.ID .NO. 30.
  • control of GHRH expression via a "molecular switch” should allow specificity, selectivity, precise timing and level of expression, safety, and rapid clearance of the triggering compound.
  • a system for regulating gene expression is generally depicted in Figure 1 using the GHRH gene as an example.
  • a non-viral GHRH gene therapy for the regulation of growth and body composition was developed using a mifepristone ("MFP") dependent GeneSwitchTM technology.
  • MFP mifepristone
  • the system consisted of two plasmids, one encoding for a chimeric GeneSwitchTM transactivator, and the other for an inducible growth hormone releasing hormone (GHRH).
  • GHRH growth hormone releasing hormone
  • the administration of the GHRH gene was in conjunction with electroporation.
  • IGF levels following administration of both GeneSwitchTM and GHRH plasmid followed by MFP were 1797.28 ⁇ 164.96 ng/ml, versus 1100.86 ⁇ 33.67 ng ml pre MFP levels in the same group of animals, p ⁇ 0.0006, 1086.78 ⁇ 65.34 ng/ml in control (beta-galactosidase) injected animals, p ⁇ 0.0007, 1171.79 ⁇ 42 ng/ml in animals injected with the two plasmids, but without MFP, p ⁇ 0.002, and animals injected with the constitutively active construct 1374.22 ⁇ 83.8 ng/ml, p ⁇ 0.03).
  • IGF-I levels returned to baseline 7 days after MFP was withdrawn.
  • Four rounds of induction were performed to 115 days after injection with similar results. Starting with day 125, the animals were induced with MFP for 24 days and then analyzed by DEXA and for analysis of body composition. Total body weight of chronically MFP induced animals was increased (p ⁇ 0.027). The weight gain was restricted to lean body mass, while fat was significantly decreased (p ⁇ 0.05). Pituitary weight was significantly increased, with pituitary weight/ total body weight 7.35xl0 "5 ⁇ 3.1xl0 "6 in MFP induced animals, versus 6.2xl0 "5 ⁇ 4.6x10 " * in ⁇ -gal controls, p ⁇ 0.035.
  • Bone mineral area, content and density were significantly increased in treated animals compared with controls. This data supports the use of regulated GHRH to efficiently to deliver growth hormone releasing hormone as adjuvant to enhance or support an anabolic state, as in the treatment of burn, sepsis, large surgery or AIDS, or in the elderly.
  • the "molecular switch” expression system is generally comprised of two nucleic acid or expression cassettes: (1) a molecular switch or otherwise called a GENESWITCH® plasmid, and (2) an inducible gene plasmid (e.g., Inducible GHRH plasmid).
  • a molecular switch or otherwise called a GENESWITCH® plasmid e.g., GENESWITCH® plasmid
  • an inducible gene plasmid e.g., Inducible GHRH plasmid
  • Figure 2 suggests that the two nucleic acid cassettes are carried on two different plasmid vectors, the two nucleic acid cassettes may also be combined in a single plasmid vector or a single viral vector having both nucleic acid cassettes.
  • molecular switch plasmids refers to plasmids encoding chimeric transcriptional regulator or "molecular switch” molecules or proteins having, but not limited to: 1) a sequence specific DNA binding domain (DBD) such as for example the GAL-4 DBD; 2) a mutated steroid receptor ligand binding domain such as for example a human progesterone receptor ligand binding domain having a C-terminal deletion of about 19-66 amino acids wherein the mutant may be activated in the presence of an antagonist for the naturally occurring or wild-type progesterone receptor; and 3) a transactivation domain, such as for example the herpes virus VP-16 or NFKB p65 transactivation domain.
  • the transactivation domains may also be selected from a number of other transactivation domains known to those of skill in the art, such as for example, TAF-1, TAF-2, TAU-1, and TAU-2.
  • GENESWITCH® is a registered trademark of Valentis, Inc. and is used to identify “molecular switch plasmids,” “molecule switch” proteins or molecules, and expression systems generated by Valentis, Inc.
  • pGS is abbreviation identifying GENESWITCH® plasmids.
  • Figure 1 generally depicts the interaction of the molecular-switch plasmid and proteins with the inducible gene plasmid.
  • the first expression cassette contained in the GENESWITCH® plasmid may comprise a promoter driving the expression of a fusion or chimeric protein.
  • the promoter may be any promoter such as a CMV promoter or a tissue-specific promoter for expression in an animal cell.
  • a preferred promoter for use with one aspect of the invention is a muscle-specific promoter with advantages as will be discussed below.
  • the fusion or chimeric protein expressed from the fusion or chimeric gene generally comprises three structural domains represented by GAL- 4, hPR LBD, and p65 in the GENESWITCH® plasmid in Figure 1. These three domains also correlate to the functional domains of the fusion protein.
  • GAL-4 represents nucleic acid sequence correlating to the GAL-4 DNA-binding domain responsible for the interaction or binding of the fusion protein to the 6X GAL-4 promoter in a second nucleic acid cassette, depicted as the inducible EPO plasmid.
  • p65 represents nucleic acid sequence correlating to the transcription regulatory domain of the NFi b p65 protein.
  • the hPR LBD correlates to the ligand-binding domain of the fusion protein, which is responsible for the interaction of the fusion protein with a ligand represented by an oral anti-progestin in Figure 1.
  • the ligand-binding domain is derived from the amino acid sequence correlating to the ligand-binding domain of human progesterone receptor (hPR), a receptor in the steroid-receptor family.
  • the amino acid sequence in the LBD of hPR may be mutated to result in a mutated hPR LBD (or, more generally, a mutated steroid-receptor LBD) that selectively binds to the anti-progestin instead of progestin, the natural ligand/agonist of the progesterone receptor.
  • a mutated hPR LBD the fusion protein may, thus, be selectively activated by an anti-progestin, instead of the naturally occurring progestin.
  • the fusion protein when the anti-progestin binds to the fusion protein expressed from the GENESWITCH® plasmid, the fusion protein is activated and forms a dimer complex.
  • the dimer/anti-progestin complex in turn, binds to the promoter of the inducible plasmid and transactivates the transcription of the gene.
  • the specific nucleic acid structures depicted in the two nucleic acid cassettes in Figure 1 are provided as examples, and various modifications can be made to achieve a similarly tightly regulated expression system.
  • the transregulatory domain represented by p65 may be substituted with various other transregulatory domains such as VP-16, TAF-1, TAF-2, TAU-1, TAU- 2 and any other nucleic acid/amino acid sequence having a transcription regulatory function.
  • the DNA-binding domain and the corresponding 6x GAL-4 binding site in the inducible gene plasmid should not be seen as being limited to the GAL-4 DNA-binding domain.
  • DNA binding domains may also be used such as known DNA binding domains of the steroid-receptor family (e.g., glucocorticoid receptor, progesterone receptor, retinoic acid receptor, thyroid receptor, androgen receptor, ecdysone receptor) or other cellular DNA binding proteins such as the cAMP Response Element Binding protein
  • the GAL-4 DNA-binding domain is preferred because it allows for greater control and selectivity of gene activation using this expression system in mammalian cells.
  • the steroid-receptor family of gene regulatory proteins is also ideal for the construction of molecular switches.
  • Steroid receptors are ligand activated transcription factors whose ligands can range from steroids to retinoids, fatty acids, vitamins, thyroid hormones, and other presently unidentified small molecules. These compounds bind to receptors and either up-regulate or down-regulate the expression of steroid-regulated genes. The compounds are usually cleared from the body by existing mechanisms and are usually non-toxic.
  • LBD ligand-binding domain
  • steroid-hormone receptor refers to steroid-hormone receptors in the superfamily of steroid receptors, some of which are known steroid receptors whose primary sequence suggests that they are related to each other.
  • Representative examples of the steroid-hormone receptors include the estrogen, progesterone, glucocorticoid- ⁇ , glucocorticoid- ⁇ , mineralocorticoid, androgen, retinoic acid, retinoid X, Vitamin D, COUP-TF, ecdysone, Nurr-1 and orphan receptors.
  • the receptors for hormones in the steroid/thyroid/retinoid supergene family are transcription factors that bind to target sequences in the regulatory regions of hormone- sensitive genes to enhance or suppress their transcription. These receptors have evolutionarily conserved similarities in a series of discrete structural domains, including a ligand-binding domain (LBD), a DNA binding domain (DBD), a dimerization domain, and one or more trans-activation domain(s).
  • LBD ligand-binding domain
  • DBD DNA binding domain
  • dimerization domain a dimerization domain
  • trans-activation domain(s) one or more trans-activation domain(s).
  • mutated steroid receptor a steroid receptor or steroid-hormone receptor that has been mutated in its amino acid sequences such that the mutated form is capable of preferentially binding to a non-natural or non-native ligand rather than binding to the wild type, or naturally occurring, hormone receptor ligand.
  • mutated steroid-receptor LBD a mutated steroid receptor has the property to activate transcription of a desired gene (such as a gene encoding erythropoeitin) in the presence of .an antagonist for a wild type steroid hormone receptor protein.
  • a non-natural or non-native ligand may act as an antagonist or may have an antagonist effects to a wild-type steroid receptor or steroid-hormone receptor.
  • Antagonist as used herein is a compound that interacts with or binds to a native steroid hormone receptor and blocks the activity of the agonist of the native steroid hormone receptor.
  • Ant as used herein is a compound that interacts with the wild type steroid hormone receptor to promote a transcriptional response.
  • progesterone or progestin is an agonist for the progesterone receptor because progesterone normally binds to the progesterone receptor to activate the tr.anscription of progesterone-regulated genes. Compounds, which mimic progesterone, would also be defined as progesterone receptor agonists.
  • Mifepristone (MFP) or otherwise known as RU486 is a non-natural ligand that also binds to the progesterone receptor and competes with progesterone for binding.
  • MFP may slightly activate certain progesterone-regulated genes through the progesterone receptor, the 4amount of activation is minimal when compared to the major activity of MFP, which is to block the activation of the progesterone receptor by progesterone.
  • MFP exerts an antagonistic effect on the progesterone receptor because it blocks the normal activation of the receptor by progesterone.
  • the progesterone receptor may be mutated, e.g. in the ligand-binding domain of the progesterone receptor, such that it only binds to MFP and not to progesterone.
  • the mutation of the ligand-binding domain of progesterone receptor may be such that binding of the MFP may actually activate the progesterone receptor under typical cellular conditions.
  • a mutated PR LBD or more generally any other mutated steroid- receptor LBD, is combined as a fusion protein with a particular DNA-binding domain such as the GAL-4 DNA binding domain, binding of MFP selectively activates the fusion protein to transactivate gene expression driven by a promoter recognized by the DNA- binding domain.
  • the mutated steroid receptor of the subject invention is not activated in the presence of agonists for the native receptor, but instead the mutated steroid receptors may be activated in the presence of "non-natural ligands.”
  • non-natural ligands or “non-native ligands” refers to compounds that are normally not found in animals or humans and that bind to the ligand-binding domain of a receptor.
  • non-natural ligands and non-native ligands are anti-hormones that may include without limitation the following: l l ⁇ -(4-dimethylaminophenyl)-17 ⁇ -hydroxy-17 ⁇ -propinyl-4, 9-estradiene-3-one (RU38486 or Mifepristone);
  • a mutant, mutated or modified steroid-hormone receptor protein as used in this disclosure can be a mutant of any member of the steroid-hormone receptor superfamily.
  • a steroid receptor can be mutated by addition of amino acid(s), substitution of amino acid(s) or deletion of amino acid(s). Preferably, the deletion of the amino acids occur on the carboxy terminal end of the protein.
  • a deletion of from about 1 to about 120 amino acids from the carboxy terminal end of the protein provides a mutant useful in the present invention.
  • a person having ordinary skill in this art will recognize, however, that a shorter deletion of carboxy terminal amino acids will be necessary to create useful mutants of certain steroid hormone receptor proteins.
  • a mutant of the progesterone receptor protein will contain a carboxy terminal amino acid deletion of from about 1 to about 60 amino acids.
  • 19 carboxy terminal amino acids are deleted from the progesterone receptor protein.
  • a mutated steroid-hormone receptor LBD may be selected based on the ability of an antagonist for the wild-type steroid-hormone receptor to activate the mutant receptor even in the presence of an agonist for the wild-type receptor.
  • progesterone is the normal ligand and functions as a strong agonist for the receptor.
  • the anti-progestin, mifepristone (RU486) is a non-natural or non-native ligand for the progesterone receptor.
  • MFP Mifepristone
  • MFP is considered an "anti-progestin” because, although it is able to exert a slight agonist effect on the wild-type progesterone receptor, MFP inhibits the strong agonistic effects of progesterone.
  • MFP may be considered an "antagonist" for the wild-type progesterone receptor when in the presence of the normal agonist, i.e. when both MFP and progesterone are together in the presence of the wild-type progesterone receptor.
  • the mutated progesterone receptor is not activated by progesterone (agonist for the wild type receptor) but is activated in the presence of MFP ("antagonist" for the wild type receptor).
  • progesterone is not able to block the activation of the mutated steroid-hormone receptor by MFP.
  • the mutated receptor may be characterized as activated when bound to an antagonist (MFP) for the wild-type receptor even in the presence of an agonist (progesterone) for the wild-type progesterone receptor.
  • mutated and modified steroid-hormone receptor for used with the current invention are described in, for example: (1) "Adenoviral Vector-Mediated Delivery of Modified Steroid Hormone Receptors and Related Products and Methods" International Patent Publication No. WO0031286 (PCT/US99/26802); (2) “Modified Glucocorticoid Receptors, Glucocorticoid Receptor/ Progesterone Receptor Hybrids" International Patent Publication No. WO9818925 (PCT/US97/ 19607); (3) "Modified Steroid Hormones for Gene Therapy and Methods for Their Use” International Patent Publication No.
  • WO9640911 (PCT/US96/0432); (4) "Mutated Steroid Hormone Receptors, Methods for Their Use and Molecular Switch for Gene Therapy” International Patent Publication No. WO 9323431 (PCT/US93/0439); (5) "Progesterone Receptors Having C-Terminal Hormone Binding Domain Truncations", U.S. Patent No. 5,364,791; (6) "Modified Steroid Hormone Receptors, Methods for Their Use and Molecular Switch for Gene Therapy” U.S. Patent No. 5,874,534; (7) “Modified Steroid Hormone Receptors, Methods for Their Use and Molecular Switch for Gene Therapy” U.S. Patent No. 5,935,934, (8) "Improved System for Regulation of Transgene Expression", U.S. Patent Application No. 60/278,281 all of which are incorporated herein by reference in their entirety, including any drawings.
  • viral-based versions of a mutated steroid hormone receptor system may also be used to regulate gene expression in vitro or in vivo.
  • early versions of inducible transcriptional regulator system in viral vectors For example: (1) the positive and negative regulation of gene expression in eukaryotic cells with an inducible transcriptional regulator is described in Wang, et al., Gene Therapy, 4: 432- 441,1997; and (2) drug inducible transgene expression in brain using a herpes simplex virus vector is described in Oligino, et al., Gene Therapy, 5: 491-496,1998. These above examples may be applied to provide for viral-based regulated gene-expression systems according to the present invention. To improve the tightness of regulated expression, several aspects of the
  • GENESWITCH® expression cassette and the inducible therapeutic molecule expression cassette were modified.
  • the transcribed portion of the GENESWITCH® expression cassette was modified to include post-transcriptional elements (5' UTR, synthetic intron and poly(A) signal) that improve the level and fidelity of transgene expression.
  • the structure of the GENESWITCH® regulatory protein was modified. The regulator protein appears to have a propensity, in the absence of ligand, to form dimers that could bind GAL-4 sites in the inducible promoter and thereby partially activate transcription.
  • truncated or mutation on the GAL-4 domain of the regulator protein may be made such as deleting from the C-terminal portion of the GAL-4 DBD, about 20 residues, thereby reducing the length of a coiled-coil structure that contributes to GAL-4 homodimer formation.
  • GENESWITCH® regulator protein v.4.0 embodies this modification.
  • the promoter of the GENESWITCH® expression cassette may be replaced with a tissue-specific promoter such as avian skeletal ⁇ -actin promoter, which is muscle-specific.
  • the inducible therapeutic molecule expression plasmid may be also that modified in the core region of the inducible promoter. It has been determined that a deletion in the transcription initiation region of the inducible plasmid can reduce the intrinsic activity of the promoter by approximately 10-fold without impairing its ability to be induced. It should be noted that the modifications described above may be employed independently or in combination with each other depending on the desired effect.
  • a molecular switch protein comprising a chimeric receptor having a mutated progesterone-receptor ligand-binding domain, a truncated GAL-4 DNA binding domain, and a VP16 or p65 transregulatory domain.
  • the p65 transregulatory domain is part of the activation domain of the human p65 protein, a component of the NFKB complex.
  • this chimeric regulator binds to a target nucleic acid sequence containing a 17mer GAL-4 binding site, and results in an efficient ligand-inducible transactivation of the target gene downstre.am of the GAL-4 binding site.
  • the modified steroid-hormone ligand-binding domain of the receptor protein may also be modified by deletion of carboxy terminal amino acids, preferably, from about one to one hundred-twenty carboxy terminal amino acids. The extent of deletion desired can be modulated according to conventional molecular biological techniques to achieve both selectivity for the desired ligand and high inducibility when the ligand is administered.
  • the mutated steroid hormone receptor LBD is mutated by deletion of about one to about sixty carboxy terminal amino acids. In another embodiment forty-two carboxy terminal amino acids are deleted. In yet another embodiment, having both high selectively and high inducibility, nineteen carboxy terminal amino acids are deleted.
  • GAL-4 DBD refers to amino acids 1 - 93 of the N-terminal DNA binding domain of GAL-4 as shown in Fig. 5 SEQ. ID. NO. 10.
  • a "modified GAL-4 DBD” or mutated GAL-4 DBD refers to a GAL-4 DBD that has a mutation in the primary amino acid structure, or to a amino acid sequence derived from the GAL-4 DBD, that retains the ability to bind to the canonical 17-mer binding site, CGGAAGACTCTCCTCCG, (SEQ.ID.NO. 9), but no longer has ability to form a helical tertiary structure needed for autodimerization.
  • a deletion of a region represented by amino acids 75 to 93 of the native GAL-4 DBD as depicted in Figure 5 provides for a modified or mutated GAL-4 DBD that when combined with the GENESWITCH® regulator protein decreases the basal expression of GHRH from an inducible expression plasmid.
  • Other mutations, including substitutions (changes in the amino acid sequence) or deletions may also be made to the region spanning amino acid sequence 54-74 of the GAL-4 DBD as shown in Figure 5.
  • a deletion of amino 54-64, or 65-75 may be made such that autodimerization through the coiled coil region is minimized.
  • an optimized transgene regulation system is disclosed below that meets desired criteria for a robust system.
  • an improved regulated muscle- specific GHRH GENESWITCH® system disclosed in one embodiment herein provides undetectable biological effect from a pharmacological dose of the introduced GHRH transgene in the absence of inducer.
  • biological effect it is meant that, although it may be possible to detect the production of messenger RNA by ultra sensitive assays such by Polymerase Chain Reaction ("PCR"), no physiologic effect, such as for example in the case of GHRH, no rise in the level of IGF-I, is observed.
  • the improved system responded to doses of MFP as low as 0.01 mg Kg. Responsiveness to low doses of MFP is highly favorable; especially since chronically administered 25 mg doses (0.25-0.5 mg/Kg) are well tolerated in humans.
  • the improved system may also have several optional components that permit advantages over existing systems.
  • the present improved GENESWITCH® regulator protein is mostly humanized (86%) (amino acid sequences derived from human proteins except for the GAL-4 DNA-binding domain); thus reducing the potential for long-term responsiveness of the system in immune-competent recipients.
  • exogenous control of expression in the present system having undetectable baseline expression may also permit a lag time prior to first induction by MFP or other inducer.
  • the length of the lag period between plasmid delivery and the first induction of transgene expression permits reduction in the potential for developing immune responses to the expressed transgene.
  • Delivery of plasmids with electroporation may be associated with transient inflammation and cellular infiltration that are able to activate dendritic cell maturation.
  • Foreign transgene expression that is induced after inflammation at the muscle site has subsided avoids transgene expression in a hyperinflammatory environment.
  • use of a muscle-specific promoter may also provide low level GENESWITCH® protein production and may minimize expression in non-muscle cells.
  • expression cassette or "nucleic acid cassette,” as used herein refers to the combination of nucleic acid sequences involved in expression of a particular functional product.
  • This functional product is typically a protein although it could also be a nucleic acid such as for example, an RNA molecule such as a ribozyme or antisense RNA.
  • the expression cassette may also be comprised of a number of non-coding elements in addition to sequences encoding a product such as a protein. Non-coding elements are nucleic acid sequences bounded or defined by consensus sequences or having a contextual location identifiable or recognized by those of skill in the art.
  • a “5 1 untr.anslated region” or “5' UTR” refers to a sequence located 3' to promotor region and 5' of the downstream coding region.
  • the 5' end of the 5' UTR is typically defined as the trmscription start site.
  • the start of transcription may not be precisely known, it is often estimated to be approximately 30 base pairs 3' of the end of the TATA box.
  • the 3' end of the 5'UTR would be defined as the base immediately 5' to the start codon (ATG).
  • ATG start codon
  • Such a 5 1 UTR may also have an intron within it.
  • the expression cassette includes: promoter sequences, transcription start sequences, 5' untr.anslated (“5' UTR”) sequences, coding sequences from a start codon through a stop codon, and 3 1 untranslated sequences ("3' UTR") including polyadenylation sequences.
  • the 5' UTR may include one or more functional non-coding elements able to increase the level and fidelity of expression.
  • the 5 1 UTR may include intron sequences that are transcribed but spliced out of the mature messenger RNA ("mRNA").
  • the expression cassette may positionally and sequentially oriented in a vector with other necessary elements such that the nucleic acid in the cassette can be transcribed and, when necessary, translated in eukaryotic cells.
  • the term "intron” as used herein refers to a sequence encoded in a DNA sequence that is transcribed into an RNA molecule by RNA polymerase but is spliced from the mature messenger RNA.
  • a "synthetic intron” refers to a sequence that is not initially replicated from a naturally occurring intron sequence and generally will not have a naturally occurring sequence, but will be removed from an RNA transcript during normal post-transcriptional processing.
  • both the molecular switch expression cassette and the therapeutic gene expression cassette include a synthetic intron.
  • the synthetic intron includes consensus sequences for the 5' splice site, 3' splice site, .and branch point. When incorporated into eukaryotic vectors designed to express therapeutic genes, the synthetic intron will direct the splicing of RNA transcripts in a highly efficient and accurate manner, thereby minimizing cryptic splicing and maximizing production of the desired gene product.
  • a “therapeutic molecule” or “therapeutic gene” is one that has a pharmacologic activity when administered appropriately to a mammal suffering from a disease or condition. Such a pharmacological property is one that is expected to relate to a beneficial effect on the course or a symptom of the disease or condition.
  • therapeutic protein refers to the native, full-length secreted form of a therapeutic protein, as well as to analogs or derivatives thereof comprising single or multiple amino acid substitutions, deletions or additions that retain native therapeutic protein function or activity. Sequences encoding therapeutic proteins may include codon-optimized versions of native sequences.
  • Optimal codon usage in humans is indicated by codon usage frequencies for highly expressed human genes and may be determined from the program "Human High.codN” from the Wisconsin Sequence Analysis Package, Version 8.1, Genetics Computer Group, Madison, WI.
  • the codons that are most frequently used in highly expressed human genes are presumptively the optimal codons for expression in human host cells, and thus form the basis for constructing a synthetic coding sequence.
  • Plasmid refers to a construction comprised of extrachromosomal genetic material, usually of a circular duplex of DNA that can replicate independently of chromosomal DNA. Plasmids may be used in gene transfer as vectors.
  • vector refers to a construction comprised of genetic material designed to direct transformation of a targeted cell.
  • a vector may contain multiple genetic elements positionally and sequentially oriented with other necessary elements such that an included nucleic acid cassette can be transcribed and when necessary translated in the transfected cells.
  • expression vector refers to a DNA plasmid that contains all of the information necessary to produce a recombinant protein in a heterologous cell.
  • pharmacological dose refers to a dose of vector and level of gene expression resulting from the action of the promoter on the nucleic acid cassette when introduced into the appropriate cell type that will produce sufficient protein, polypeptide, or antisense RNA to either (1) increase the level of protein production, (2) decrease or stop the production of a protein, (3) inhibit the action of a protein, (4) inhibit proliferation or accumulation of specific cell types, or (5) induce proliferation or accumulation of specific cell types.
  • the dose will depend on the protein being expressed, the promoter, uptake and action of the protein or RNA.
  • pharmacological dose refers to a dose of ligand sufficient to cause either up-regulation or down-regulation of the nucleic acid cassette. Thus, there will be a sufficient level of ligand such that it will bind with the receptor in the appropriate cells in order to regulate expression from the nucleic acid cassette.
  • the specific dose of any ligand will depend on the characteristics of the ligand entering the cell, binding to the receptor and then binding to the DNA and the amount of protein being expressed and the amount of up-regulation or down-regulation needed.
  • a non-viral gene medicine may also be composed of a synthetic gene delivery system in addition to the nucleic acid encoding a gene product (e.g., a therapeutic protein).
  • the non-viral gene medicine products are generally intended to have low toxicity due to the use of synthetic components for gene delivery (minimizing for instance the risks of immunogenicity generally associated with viral vectors) and non-integrating plasmids for gene expression. Since no integration of plasmid sequences into host chromosomes has been reported in vivo to date, they should neither activate oncogenes nor inactivate tumor suppressor genes. This built-in safety with non- viral systems contrasts with the risks associated with the use of most viral vectors.
  • nucleic acid As episomal systems residing outside the chromosomes, plasmids have defined pharmacokinetics and elimination profiles, leading to a finite duration of gene expression in target tissues.
  • Formulating the nucleic acid with non-ionic and anionic polymers may be desirable where the polymers enhance transfection and expression of the nucleic acid or protect the nucleic acid from degradation, and are biodegradable.
  • formulating the nucleic acid may result in more efficient transfection, lower amounts of DNA may be used.
  • biodegradable it is meant that the polymers can be metabolized or cleared by the organism in vivo without any or minimal toxic effects or side effects.
  • anionic polymers means polymers having a repeating subunit that includes, for example, an ionized carboxyl, phosphate or sulfate group having a net negative charge at neutral pH.
  • anionic polymers include poly-amino acids (such as poly- glutamic acid, poly-aspartic acid and combinations thereof), poly nucleic acids, poly acrylic acid, poly galacturonic acid, and poly vinyl sulfate.
  • polymeric acids the polymer will typically be utilized as the salt form.
  • other polymers include PVP, PVA, chitosan, etc.
  • Efforts have been made to enhance the delivery of plasmid DNA to cells by physical means including electroporation, sonoporation and pressure. Injection by electroporation involves the application of a pulsed electric field to create transient pores in the cellular membrane without causing permanent damage to the cell and thereby allows for the introduction of exogenous molecules. By adjusting the electrical pulse generated by an electroporetic system, nucleic acid molecules can find their way through passageways or pores in the cell that are created during the procedure.
  • U. S. Patent No. 5,704,908 describes an electroporation apparatus for delivering molecules to cells at a selected location within a cavity in the body of a patient.
  • pulse voltage device or "pulse voltage injection device” as used herein relates to an apparatus that is capable of causing or causes uptake of nucleic acid molecules into the cells of an organism by emitting a localized pulse of electricity to the cells, thereby causing the cell membrane to destabilize and result in the formation of passageways or pores in the cell membrane. It is understood that conventional devices of this type are calibrated to allow one of ordinary skill in the art to select and/or adjust the desired voltage amplitude and/or the duration of pulsed voltage and therefore it is expected that future devices that perform this function will also be calibrated in the same manner.
  • the type of injection device is not considered a limiting aspect of the present invention.
  • the pulse voltage injection device can include, for example, an electroporetic apparatus as described in U.S. Patent 5,439,440, U.S. Patent 5,704,908 or U.S. Patent 5,702,384 or as published in PCT WO 96/12520, PCT WO 96/12006, PCT WO 95/19805, and PCT WO 97/07826, all of which are incorporated herein by reference in their entirety.
  • an early-regulated expression system was tested for GHRH expression.
  • the inducer plasmid was pGLV65, which codes for an early version of the regulator protein, and contains a synthetic muscle specific promoter SPc5-12 promoter driving expression of an early version chimeric regulator protein comprised of a GAL-4 l-94aa DNA binding domain, a modified progesterone receptor ligand binding domain and a NF ⁇ Bp65 transactivator domain (SEQ.ID.NO. 12) followed by a SV40 poly(A) signal.
  • the early regulated plasmid, pl450HV-GHRH (encoding protease resistant super-porcine GHRH), was similar to the present improved regulated plasmid with the exception that it includes the INR region downstream of the TATA that was deleted in the improved inducible plasmid, pGHRH1674.
  • the inducible system was co-delivered by intra-muscular injection to SCID mice in a total quantity of 30 micrograms. At ten days post-injection, RU486, was injected i.p. at a dose of 250 micrograms/kg for 3 days. On the fourth day, the animals were bled and serum was used to measure IGF-I levels.
  • the tightness of regulated expression was improved by modifying certain aspects of the GENESWITCH® and inducible plasmids. Modifications, as will be discussed in succeeding examples included: modifications to the transcribed but untranslated portions of the GENESWITCH® plasmid and truncation of the GAL-4 DNA binding domain. Modification of the core promoter on the inducible therapeutic gene plasmid was also undertaken in the improved system to reduce basal expression while retaining high inducability. It should be noted that these modifications may be applied independently or in combination with the improved GENESWITCH® protein modifications.
  • both the molecular switch expression cassette and the therapeutic gene expression cassette include a synthetic intron.
  • Cryptic splicing in transcripts from eukaryotic expression vectors is obviously undesirable.
  • suboptimal introns can be replaced by a strong intron.
  • a synthetic intron with consensus splicing sequences should be optimal for this purpose.
  • the synthetic intron of the present embodiment includes consensus sequences for the 5 1 splice site, 3' splice site and branch point. When incorporated into eukaryotic vectors designed to express therapeutic genes, the synthetic intron will direct the splicing of RNA transcripts in a highly efficient and accurate manner, thereby minimizing cryptic splicing and maximizing production of the desired gene product.
  • the first and sixth position of the 5* splice site consensus sequence are partially ambiguous.
  • the 5' splice site pairs with Ul snRNA.
  • the chosen sequence minimizes the free energy of helix formation between Ul RNA and the synthetic 5' splice site.
  • the branch point sequence is very ambiguous.
  • the jranch point sequence except for a single bulged A residue, pairs with U2 snRNA.
  • the chosen sequence minimizes the free energy of helix formation between U2 RNA and the synthetic branch point sequence. It also matches the branch point sequence that is obligatory for yeast pre-mRNA splicing.
  • the branch point is typically located 18-38 nts upstream of the 3' splice site.
  • the branch point of the synthetic intron is located 24 nts upstream from the 3' splice site.
  • the polypyrimidine tract of the consensus sequence for 3' splice sites is not exactly defined. At least 5 consecutive uracil residues are needed for optimal 3' splice site function. This concept is incorporated into the polypyrimidine tract of the synthetic intron, which has 7 consecutive uracil residues.
  • Splicing in vitro is optimal when introns are >80 nts in length. Although many introns may be thousands of bases in length, most naturally occurring introns are 90-200 nt in length.
  • the elemental structure of a synthetic intron according to the present invention (SEQ.ID.NO:5) is shown in Figure 3 compared with italicized consensus sequences (SEQ.ID. NO:6).
  • IVS8 the length of the synthetic intron is 118 nucleotides.
  • the sequence of IVS8, (SEQ.ID .NO:7), is shown in Figure 4. Exonic sequences are in boldface. N any base. Consensus splicing signals are double-underlined. Restriction enzyme recognition sites are over-lined. The restriction enzyme Bbsl may be used to cleave the DNA precisely at the 5' splice site, and Earl may be used to cleave the DNA precisely at the 3' splice site. The two restriction sites, Bbsl and Earl, located within the synthetic intron, permit the intron to be easily and precisely deleted. The Pstl and Nhel sites are included to facilitate the verification of cloning procedures. Double-stranded DNA with this sequence may be prepared using mutually priming long oligonucleotides.
  • the synthetic intron may be inserted into the gene of interest at multiple locations. When multiple introns are inserted, however, care must be taken to ensure that the lengths of resultant internal exons are less than 300 nucleotides. If internal exons are greater than 300 nucleotides in length, exon skipping may occur.
  • the expression cassette was further modified to introduce a CMV 5' UTR, termed UT12 (SEQ. ID. NO:8) in addition to the synthetic intron, IVS8 (SEQ.ID.NO:7), within the 5' UTR.
  • UT12 SEQ. ID. NO:8
  • IVS8 SEQ.ID.NO:7
  • the SV40 polyadenylation signal was replaced with a human growth hormone ("hGH") poly (A) signal.
  • the GAL-4 DNA binding domain binds as a dimer to the palindromic 17-mer GAL-4 DNA binding site (CGGAAGACTCTCCTCCG, SEQ.ID.NO.9).
  • the Kd for binding of GAL-4, residues 1-100, is 3 nM (Reece and Ptashne (1993) Science 261: 909- 911).
  • a GENESWITCH® regulatory protein having a GAL-4 DNA binding domain is required to form a homodimer.
  • binding of MFP to the mutated hPR LBD may trigger a conformational change in the protein so as to initiate dimerization.
  • the first seven residues of the GAL-4 DNA binding domain are disordered and are not known to contribute any function, while residues 8-40 form the Zn binding domain or the DNA recognition unit.
  • This unit has two alpha helical domains that form a compact globular structure and in the presence of Zn resulting in a structure that is a binuclear metal ion cluster rather than a zinc finger, i.e., the cysteine-rich amino-acid sequence (Cys u -Xaa 2 -Cys 14 -Xaa 6 -Cys 21 -Xaa 6 -Cys 28 -Xaa 2 -Cys 31 -Xaa 6 -Cys 38 , SEQ.ID.NO.il) binds two Zn(II) ions (Pan and Coleman (1990) PNAS 87: 2077-81).
  • the Zn cluster is responsible for making contact with the major groove of the 3 bp at extreme ends of the 17-mer binding site.
  • a proline at 26 (cis proline) forms the loop that joins the two alpha- helical domains of the zinc cluster domain and is also critical for this function.
  • Residues 41-49 exist as a disordered linker that joins the DNA recognition unit and the dimerization elements (54-74 and 86-94). Once dimerized, residues 47-51 of dimerized subunits also interact with phosphates of the DNA target. Residues 50-64 are contemplated to be involved in weak dimerization.
  • residues 65-94 are contemplated to form a strong dimerization domain.
  • the structure of residues 65-71 has not been fully determined, but it is most likely a continuation of the coiled-coil structure for one heptad repeat.
  • Residues 72-78 contain a proline and therefore disrupt the amphipathic helix. Residues 79-99, however, contain three more potentially alpha-helical heptad sequences (Marmorstein et al (1992) Nature 356: 408-414). There are a number of possible modifications that can be made to the regions of the GAL-4 domain as discussed above. Modifications in these regions may result in lower basal expression but still retain sequence-specific DNA binding. For example, the length of the region that contains the interacting coiled-coil sequences (residues 54-74 and residues 86-93) could be shortened by deletion such as deleting amino acid sequence 54- 64, 65-74, 54-74, or 86-93.
  • GAL-4 mutants with only one coiled-coil region could be constructed by deleting one of the coiled-coil region.
  • mutant or artificial sequences may also be used to replace the fragment GAL-4 domain with unique restriction sites positioned at key spots, for example at the junctions of each of the alpha- helical heptad sequences.
  • modified versions of the GAL-4 protein domain could be produced that have progressively reduced alpha-helical heptad sequences.
  • the GAL-4 domain was truncated by deletion of amino acids 75-93. This was achieved through the use of a convenient restriction endonuclease sites (Hinc II and Xho I) although other truncations may be produced according to molecular biology techniques known to those of skill in the art.
  • Hinc II and Xho I restriction endonuclease sites
  • GENESWITCH® v.4.0 embodied in the pGS1633, was generated, which has a 19 amino acid truncation at the C-terminal portion of the GAL-4 DNA-binding domain (the deletion corresponding to amino acid sequence 75-93 of SEQ. ID. NO. 10 of in Figure 5).
  • Figure 7 shows the nucleic acid sequences of the coding region of both early version, pGLV65, SEQ. ID. NO. 12, and an improved GENESWITCH®v.4.0, embodied in pGS1633, SEQ. ID. NO. 13, while Figure 8 shows the respective amino acid sequences of the same, SEQ. ID. NOS. 14 & 15.
  • Molecular modeling indicates that deletion of residues 75-93 removed the C-terminal helical portion without affecting the helical and coiled structure of the upstream amino acid sequences.
  • the N-terminal methionine of the native GAL- 4 sequence has been removed and a further eight amino acids have been added to the N- terminal end of the GENESWITCH® protein.
  • the improved molecular switch protein may have the amino acid sequence: MXJ [yGAL-4 2- ] / X n / [hPR 6 4 0 - 9 14] / X n / [hP65 285 - 55 i] as exemplified by SEQ.ID.NO:16 wherein X n represents a series of amino acid sequences.
  • X can be any amino acid and n can be any number but preferably between 1-10.
  • the improved molecular switch protein encoded for example in GS v4.0 has the amino acid sequence MDSQQPDL / [yGAL-4 2 -74] / DQ / [hPR 6 ⁇ Ml4 ] I GST / [hP65 285-551] as exemplified by (SEQ.ID.NO: 17). Amino acids for the N-terminus and linker regions are indicated by single letter abbreviations, individual protein components are bracketed and the amino acid residues are specified in subscript.
  • yGAL-4 is the N-terminal DNA binding domain of the yeast GAL-4 protein (GenBank accession no. AAA34626).
  • hPR is a C-terminal truncated portion of the ligand binding domain of the human progesterone receptor (GenBank accession no. AAA60081), where I1PR640-933 is the full-length version of the hPR-LBD.
  • hP65 is the activation domain of the p65 subunit of human NF- ⁇ B (GenBank accession no. AAA46408).
  • the human components of the GENESWITCH® regulator protein comprise 86% of its sequence.
  • FIG. 10 A map of an exemplary regulated GHRH plasmid, pGHRH1674 is shown in Figure 10 with the corresponding sequence, SEQ.ID .NO:29, on Figure 12 (GHRH sequence indicated).
  • the core region of the inducible promoter in the regulated GHRH plasmid was also modified to reduce the basal expression of GHRH without reducing the inducibility of GHRH expression. This was desirable because, as shown in Figure 14 increases in IGF-I levels were ultimately observed in the absence of MFP when the original inducer and inducible GHRH plasmids were delivered (in the absence of GENESWITCH® plasmid) to mice. Studies conducted with an analogous inducible plasmid showed that a certain level of basal expression was obtained in the absence of the regulator plasmid indicating a certain level of basal expression from the single inducible plasmid in the absence of the regulator protein.
  • the promoter of an inducible GHRH plasmid contains 6X GAL-4 sites linked to a TATA box.
  • Figure 6B depicts the nucleotide sequence of an inducible 6X GAL-4/TATA promoter (SEQ.ID.NO. 18).
  • the six GAL-4 elements (17 bp in length) are boxed, the TATA box (- 29 to -24) is double-underlined, and the predicted transcription initiation site (+1) is marked by the arrow.
  • the sequence from -33 to -22, which contains the TATA box, is from the Elb region of Adenovirus type 2 (residues 1665-1677 of NCBI accession no. J01917).
  • FIG. 6A indicates schematically the unique restriction endonuclease sites used to delete the TATA box (Sal I EcoR V), inr (EcoR V/BsmB I) and part of the UT12 (Sac II/Pac I).
  • Figure 6C depicts the sequence of the inducible promoter, SEQ. ID. NO. 19, with relevant regions and unique restriction enzyme sites boxed. BsmBI enzyme cleavage sites are indicated with arrows.
  • TF refers to transcription factor binding site
  • inr refers to initiator.
  • an "inr” region as depicted in encompassed in a 30 bp BsmBI-EcoRV fragment (13-42 bp downstre.am from the TATATAAT box) was deleted as shown in Figure 6C. It was found that resultant inducible plasmids having a deletion in the inr region, the level of tr.ansgene expression was 7 - 10X lower than with inducible promoter having the inr in the absence of a GENESWITCH® plasmid.
  • the inducibility of expression was increased in some cases from 5X inducibility to 7X inducibility.
  • a deletion in the transcription initiation region (inr) of the inducible plasmid significantly reduces the intrinsic activity of the promoter without impairing, and may even enhance, its ability to be induced.
  • tissue specific promoters may be replaced with tissue specific promoters.
  • tissue specific promoters For example, if the target tissue for gene expression is muscle, an actin promoter may be employed.
  • tissue-specific promoters may be expected to decrease the potential for occult gene expression in non-ta get tissues.
  • tissue-specific promoters may provide the advantage of reduced expression in dendritic and other antigen presenting cells, thus avoiding immune rerponses to the expressed proteins.
  • a low level of regulator plasmid expression may also be desirable.
  • it is also preferable to regulate the level of transgene expression by inherent properties of the plasmid delivered rather than by attempting to variably titrate the dose of plasmid delivered.
  • the ⁇ .omoter of the GENESWITCH® plasmid was a muscle- specific promoter, avian skeletal ⁇ -actin promoter (SK promoter) (SEQ. ID. NO. 20) to reduce the level of regulator protein produced.
  • SK promoter avian skeletal ⁇ -actin promoter
  • the avian skeletal ⁇ -actin promoter is described in US Patent No. 5,298,422, incorporated herein by reference in its entirety.
  • the muscle specific promoter is a synthetic muscle specific promoter comprised of a series of muscle specific transcriptional regulatory regions having a novel configuration relative to those found in nature as described in WO9902737, incorporated herein by reference in its entirety.
  • a unique synthetic promoter is utilized, termed SPc5-12 (Li et al., (1999), Nature Biotechnology), which contains a proximal serum response element (SRE) from skeletal ⁇ -actin, multiple MEF-2 sites, MEF-1 sites, and TEF-1 binding sites, and exceeds the transcriptional potencies of natural myogenic promoters.
  • synthetic muscle specific promoters include SPc 5-12, SEQ.ID.NO.
  • SEQ.ID.NO. 21 comprising various synthetic orientations and combinations of muscle specific transcriptional regulatory regions including SRE, MEF-1, MEF-2, TEF-1 and SP-1, the sequences of which are set out below with the critical sequences underlined.
  • SRE 5' GACACCCAAATATGGCGACGG — 3' 21 mer
  • the muscle-specific avian skeletal ⁇ -actin promoter was combined with an optimized arrangement of post-transcriptional elements (5' untranslated region (UT12), synthetic intron (ivs 8) and poly(A) signal (hGH pA)).
  • post-transcriptional elements 5' untranslated region (UT12), synthetic intron (ivs 8) and poly(A) signal (hGH pA)
  • UT12 untranslated region
  • ivs 8 synthetic intron
  • hGH pA poly(A) signal
  • GENESWITCH® regulator protein v.4.0 constructed by deleting about 20 C-terminal residues of the GAL-4 region (indicated by the inverted triangle in Figure 1) together with a muscle-specific promoter.
  • EXAMPLE 7 Expression of GHRH in a Tightly Regulated Expression System In Vitro Minimal Essential Medium (MEM), heat-inactivated horse serum (HIHS), gentamycin, Hanks Balanced Salt Solution (HBSS), and lipofectamine were obtained from Gibco BRL (Grand Island, NY). Primary chicken myoblast cultures were obtained and transfected as described in Bergsma, D. J., et al. (1986) Molecular & Cellular Biology 6, 2462-2475 and Draghia-Akli, R., et al. (1997) Nature biotechnology 15, 1285-1289. A 228-bp fragment of super-porcine GHRH, HV-GHRH (Draghia-Akli, R., et al.
  • RNA and cells were harvested 72 hours post- differentiation. Non-induced controls were transfected, but MFP was not added to the media.
  • For Northern analysis of extracted total RNA 20 micrograms of total RNA was DNase I treated (Gibco BRL), size separated in 1.5% agarose-formaldehyde gel and transferred to Gene Screen nylon membrane (DuPont Research Products, Boston, MA). The membranes were hybridized with a GHRH cDNA probe 32 P-labeled by random priming (Ready-to-Go DNA labeling kit, Pharmacia Biotech, Piscataway, NJ).
  • Hybridization was carried out at 45°C in a solution which contained 50% formamide, 5xSSPE, 5xDenhardt's, 1% SDS, 200 microliters/ml sheared salmon sperm DNA.
  • Membranes were washed twice for 10 minutes in 2xSSPE/l%SDS at room temperature and twice for 30 minutes in 0.2xSSPE/l%SDS at 68°C. Blots were subsequently exposed to X-ray film (Kodak X-Omat AR; Eastman Kodak, Rochester, NY) at -80°C with intensifying screens.
  • the IS activity was compared with that of a positive control, a constitutively active construct (SP-GHRH).
  • SP-GHRH constitutively active construct
  • EXAMPLE 8 Expression of GHRH in a Tightly Regulated Expression System In vivo Intramuscular injection of plasmid DNA in adult mice. Severe combined immunodeficient (SCID) male mice (Taconic Laboratories, Germantown, NY) were housed and cared for in the animal facility of Baylor College of Medicine (Houston,TX). Animals were maintained under environmental conditions of lOh light/14h darkness, in accordance with NIH Guide, USDA and Animal Welfare Act guidelines, and a protocol approved by the Institutional Animal Care and Use Committee.
  • SCID Severe combined immunodeficient mice
  • Houston,TX Baylor College of Medicine
  • IS inducible system
  • MFP at 250 micrograms/kg was injecting i.p. for 3 days.
  • the animals On the fourth day, the animals were bled and serum was used to measure IGF- I levels.
  • Repeated administration of MFP to the animals using the same protocol three days induction, bleed the fourth day, allow recovery to background 7 days was performed four times over 115 days. In between day 124 and 149, MFP was administered daily.
  • body composition was performed in vivo, using a dual x-ray absorbimetry technique, PLXImus, and than post-mortem. Blood was collected, centrifuged immediately at 0°C, and stored at -80°C prior to analysis. Organs, carcass, fat from injected animals and controls were removed, weighed and snap frozen in liquid nitrogen.
  • Body composition data Body composition measurements were performed either under anesthesia, at day 149 post-injection (PLXImus) or post-mortem (organ, carcass, body fat, direct dissection followed by neutron activation analysis of the body).
  • Statistics Values shown in the figures are the mean ⁇ s.e.m. Specific p values were obtained by comparison using Students t-test or ANOVA analysis. A p ⁇ 0.05 was set as the level of statistical significance.
  • Plasmid pGS1633 encoding improved GeneSwitch regulator protein having a truncated GAL-4 DNA binding domain under the control of a muscle specific skeletal alpha- actin promoter, was used together with an improved regulated plasmid, pGHRH1674, encoding a mutated GHRH cDNAs obtained by site-directed mutagenesis of human GHRH cDNA (Altered Sites II in vitro Mutagenesis System, Promega, Madison, WI). The GHRH cDNA is followed by the 3 1 untranslated region of human GH hormone.
  • mice On day 0, the animals were weighed and then, the left tibialis anterior muscle of mice was injected with 10 micrograms of the inducible system (IS) (1:10 transactivator to target gene), in 25 microliters PBS. The injection was followed by caliper electroporation. At twenty-one days post-injection, MFP was injected i.p., 250 micrograms/kg for 3 days. On the fourth day, the animals were bled and serum was used to measure IGF-I levels.
  • IS inducible system
  • body composition was analyzed in vivo, by DEXA, using a high resolution PLXImus scanner, and subsequently post-mortem.
  • Organs lungs, heart, liver, kidney, stomach, intestine, adrenals, gonads, brain
  • No organomegaly or associated pathology was observed in the injected animals.
  • Pituitary glands were dissected within the first minutes post-mortem, and weighted.
  • Body composition in activated GHRH GeneSwitch animals Body composition studies by dual-energy x-ray absorptiometry, PIXImus (total body fat, non-bone lean tissue mass and bone mineral area, content and density) showed significant changes in chronically MFP induced animals injected with the GHRH/GeneSwitch system. Lean, non-bone body mass (Figure 18 A) increased by 2.5% in GHRH/GeneSwitch animals + MFP (87.44 ⁇ 0.65%, versus ⁇ -gal 84.94 ⁇ 0.6%, and no MFP animals 84.88 ⁇ 0.3%), p ⁇ 0.022.
  • Treated animals did not experience any side effects from the therapy, had normal biochemical profiles, and with no associated pathology or organomegaly.
  • the profound increases in IGF-I levels, enhancement in growth and changes in body composition, upon chronic induction of the GHRH/Gene Switch system indicate that ectopic expression of myogenic GHRH vectors has the potential to replace classical GH therapy regimens and may stimulate the GH axis in a more physiologically appropriate manner.
  • GHRH Growth hormone is released in a pulsatile or episodic fashion and observes a diurnal pattern of increased noctural release. Growth hormone is released within 20 minutes of infusion of recombinant GHRH.
  • GHRH has a very short half-life. In i.v. studies in children, GHRH 1-40, 1 micrograms/kg, demonstrated a distribution half life (tl/2) of 3.9 (SD 0.9) min and an elimination tl/2 of 53.1 (SD 3.2) min.
  • tl/2 distribution half life of 3.9 (SD 0.9) min and an elimination tl/2 of 53.1 (SD 3.2) min.
  • Smith PJ et al. (1987) Clin Endocrinol (Oxf) Oct;27(4):501-7. Peak growth hormone release following continuous GHRH infusion has been reported to be similar to that of maximally effective bolus doses.
  • the present invention provides a method of pulsatile exposure to GHRH after a single administration of DNA encoding GHRH in which GHRH is produced in vivo following pulsatile administration of mifepristone resulting in activation of the GeneSwitch protein followed by expression of GHRH.
  • the present invention provides a method of diurnal exposure to GHRH after a single administration of DNA encoding GHRH in which GHRH is produced in vivo following diumal administration of mifepristone resulting in activation of the GeneSwitch protein followed by expression of GHRH.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Endocrinology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un système d'expression génétique régulé destiné à une somatostatine ('GHRH') caractérisée par une basse expression basale et une haute inductibilité spécifique. Le système d'expression inductible comporte deux cassettes d'expression. La première cassette d'expression comprend un agent promoteur entraînant l'expression d'une protéine de fusion de séquence activatrice comprenant un domaine se liant à l'ADN, un domaine de transactivation et un domaine de liaison aux ligands. La protéine de fusion est caractérisée par une incapacité de s'autodimériser en l'absence d'un inducteur. La seconde cassette d'expression comprend le codage génétique de somatostatine contrôlé par un promoteur d'inductabilité qui est activé par la protéine de fusion se dimérisant en présence de l'inducteur et se liant au promoteur. L'invention décrit des procédés thérapeutiques permettant de traiter des déficiences liées à l'hormone de croissance associées à la voie de l'hormone de croissance; des déficiences liées à l'hormone de croissance associées à des maladies génétiques; des symptômes cachectiques associés à des brûlures, à un traumatisme, à un cancer, au SIDA, et à une perte osseuse, comme chez des personnes âgées, ou suite à une fracture. Le système d'expression génétique peut être activé et contrôlé par administration exogène d'un inducteur.
PCT/US2001/017573 2001-05-29 2001-05-30 Expression regulee de somatostatine WO2002097099A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US29431601P 2001-05-29 2001-05-29
US60/294,316 2001-05-29

Publications (1)

Publication Number Publication Date
WO2002097099A1 true WO2002097099A1 (fr) 2002-12-05

Family

ID=23132869

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/017573 WO2002097099A1 (fr) 2001-05-29 2001-05-30 Expression regulee de somatostatine

Country Status (1)

Country Link
WO (1) WO2002097099A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005073371A3 (fr) * 2004-01-20 2005-10-27 Advisys Inc Secretion/retention ameliorees de somatostatine par des cellules musculaires au moyen de peptides signal specifiques de l'espece
IL248229A (en) * 2014-04-10 2016-11-30 Seattle Childrens Hospital Dba Seattle Childrens Res Inst A drug associated with the trans expression of a gene
WO2017134137A1 (fr) * 2016-02-05 2017-08-10 Polygene Ag Système de régulation de gènes à base de glucocorticoïdes
US11123369B2 (en) 2015-08-07 2021-09-21 Seattle Children's Hospital Bispecific CAR T-cells for solid tumor targeting
US11408005B2 (en) 2016-12-12 2022-08-09 Seattle Children's Hospital Chimeric transcription factor variants with augmented sensitivity to drug ligand induction of transgene expression in mammalian cells

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988010307A1 (fr) * 1987-06-24 1988-12-29 Genentech, Inc. Systeme eqilibre de transcription constitutive par induction
WO1993009236A1 (fr) * 1991-11-06 1993-05-13 Baylor College Of Medicine Systemes de vecteurs myogenes
WO1995018380A1 (fr) * 1993-12-30 1995-07-06 The Salk Institute For Biological Studies Nouvelles utilisations de produits de recombinaison de recepteurs de gal4

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988010307A1 (fr) * 1987-06-24 1988-12-29 Genentech, Inc. Systeme eqilibre de transcription constitutive par induction
WO1993009236A1 (fr) * 1991-11-06 1993-05-13 Baylor College Of Medicine Systemes de vecteurs myogenes
WO1995018380A1 (fr) * 1993-12-30 1995-07-06 The Salk Institute For Biological Studies Nouvelles utilisations de produits de recombinaison de recepteurs de gal4

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005073371A3 (fr) * 2004-01-20 2005-10-27 Advisys Inc Secretion/retention ameliorees de somatostatine par des cellules musculaires au moyen de peptides signal specifiques de l'espece
US11414486B2 (en) 2014-04-10 2022-08-16 Seattle Children's Hospital Transgene genetic tags and methods of use
US10266592B2 (en) 2014-04-10 2019-04-23 Seattle Children's Hospital Drug regulated transgene expression
US11155616B2 (en) 2014-04-10 2021-10-26 Seattle Children's Hospital Drug regulated transgene expression
EP3129399A4 (fr) * 2014-04-10 2017-11-08 Seattle Children's Hospital, dba Seattle Children's Research Institute Expression transgénique liée à un médicament
EP3943507A1 (fr) * 2014-04-10 2022-01-26 Seattle Children's Hospital, dba Seattle Children's Research Institute Expression transgénique liée un médicament
US10611837B2 (en) 2014-04-10 2020-04-07 Seattle Children's Hospital Transgene genetic tags and methods of use
US10865242B2 (en) 2014-04-10 2020-12-15 Seattle Children's Hospital Method and compositions for cellular immunotherapy
KR102618955B1 (ko) 2014-04-10 2023-12-27 시애틀 칠드런즈 호스피탈 디/비/에이 시애틀 칠드런즈 리서치 인스티튜트 약물 관련 트랜스진 발현
IL248229B2 (en) * 2014-04-10 2023-05-01 Seattle Childrens Hospital Dba Seattle Childrens Res Inst A drug associated with the trans expression of a gene
KR20160143762A (ko) * 2014-04-10 2016-12-14 시애틀 칠드런즈 호스피탈 디/비/에이 시애틀 칠드런즈 리서치 인스티튜트 약물 관련 트랜스진 발현
KR20220153100A (ko) * 2014-04-10 2022-11-17 시애틀 칠드런즈 호스피탈 디/비/에이 시애틀 칠드런즈 리서치 인스티튜트 약물 관련 트랜스진 발현
IL248229A (en) * 2014-04-10 2016-11-30 Seattle Childrens Hospital Dba Seattle Childrens Res Inst A drug associated with the trans expression of a gene
KR102463529B1 (ko) 2014-04-10 2022-11-07 시애틀 칠드런즈 호스피탈 디/비/에이 시애틀 칠드런즈 리서치 인스티튜트 약물 관련 트랜스진 발현
US11458167B2 (en) 2015-08-07 2022-10-04 Seattle Children's Hospital Bispecific CAR T-cells for solid tumor targeting
US11123369B2 (en) 2015-08-07 2021-09-21 Seattle Children's Hospital Bispecific CAR T-cells for solid tumor targeting
WO2017134137A1 (fr) * 2016-02-05 2017-08-10 Polygene Ag Système de régulation de gènes à base de glucocorticoïdes
US11408005B2 (en) 2016-12-12 2022-08-09 Seattle Children's Hospital Chimeric transcription factor variants with augmented sensitivity to drug ligand induction of transgene expression in mammalian cells

Similar Documents

Publication Publication Date Title
US7579326B2 (en) Gene switch systems employing regulators with decreased dimerization
US8178504B2 (en) Gene therapy expression of GHRH for increasing RBC count in subjects
US20090292107A1 (en) Composition and method to alter lean body mass and bone properties in a subject
AU2002348417A1 (en) A composition and method to alter lean body mass and bone properties in a subject
EP1499731B1 (fr) Developpement modifie de l'hypophyse chez la progeniture de femelles animales portantes traitees par la therapie hormonale de liberation de l'hormone de croissance
WO2002097099A1 (fr) Expression regulee de somatostatine
EP1573046B1 (fr) Hormone de liberation de l'hormone de croissance ti resistant aux proteases
CA2563312C (fr) Apport complementaire du ghrh induit par plasmide pour l'insuffisance renale
Xie et al. Ghrelin and truncated ghrelin variant plasmid vectors administration into skeletal muscle augments long-term growth in rats
US20080221034A1 (en) Canine specific growth hormone releasing hormone
CA2557737A1 (fr) Suplementation d'igf-i avec mediation par plasmide pour applications therapeutiques
MC et al. GHRH ZUR VERWENDUNG BEI DER BEHANDLUNG VON CHRONISCHER NIERENINSUFFIZIENZ GHRH POUR LE TRAITEMENT DES INSUFFISANCES RENALES CHRONIQUES
Lewis The role of VGF and its derived peptides in the regulation of energy homeostasis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP