WO2002090551A2 - Self-containing lactococcus strain - Google Patents

Self-containing lactococcus strain Download PDF

Info

Publication number
WO2002090551A2
WO2002090551A2 PCT/EP2002/004942 EP0204942W WO02090551A2 WO 2002090551 A2 WO2002090551 A2 WO 2002090551A2 EP 0204942 W EP0204942 W EP 0204942W WO 02090551 A2 WO02090551 A2 WO 02090551A2
Authority
WO
WIPO (PCT)
Prior art keywords
lactococcus
strain
gene
thya
lactis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2002/004942
Other languages
English (en)
French (fr)
Other versions
WO2002090551A3 (en
Inventor
Lothar Steidler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vlaams Instituut voor Biotechnologie VIB
Original Assignee
Vlaams Instituut voor Biotechnologie VIB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vlaams Instituut voor Biotechnologie VIB filed Critical Vlaams Instituut voor Biotechnologie VIB
Priority to CA2446776A priority Critical patent/CA2446776C/en
Priority to EP02740565A priority patent/EP1383897B1/en
Priority to AU2002314040A priority patent/AU2002314040B2/en
Priority to DE60212825T priority patent/DE60212825T2/de
Priority to JP2002587611A priority patent/JP4347575B2/ja
Publication of WO2002090551A2 publication Critical patent/WO2002090551A2/en
Publication of WO2002090551A3 publication Critical patent/WO2002090551A3/en
Priority to US10/687,996 priority patent/US7780961B2/en
Anticipated expiration legal-status Critical
Priority to US12/803,333 priority patent/US20100316611A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007Methyltransferases (general) (2.1.1.)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y201/00Transferases transferring one-carbon groups (2.1)
    • C12Y201/01Methyltransferases (2.1.1)
    • C12Y201/01045Thymidylate synthase (2.1.1.45)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K2035/11Medicinal preparations comprising living procariotic cells

Definitions

  • the invention relates to a recombinant Lactococcus strain, with environmentally limited growth and viability. More particularly, it relates to a recombinant Lactococcus that can only survive in a medium, where well-defined medium compounds are present.
  • a preferred embodiment is a Lactococcus that may only survive in a host organism, where said medium compounds are present, but cannot survive outside the host organism in absence of said medium compounds.
  • said Lactococcus can be transformed with prophylactic and/or therapeutic molecules and can, as such, be used to treat diseases such as inflammatory bowel diseases.
  • Lactic acid bacteria have long time been used in a wide variety of industrial fermentation processes. They have generally-regarded-as-safe status, making them potentially useful organisms for the production of commercially important proteins. Indeed, several heterologous proteins, such as lnterleukin-2, have been successfully produced in Lactococcus spp (Steidler et al., 1995). It is, however, unwanted that such genetically modified micro organisms are surviving and spreading in the environment. To avoid unintentional release of genetically modified microorganisms, special guidelines for safe handling and technical requirements for physical containment are used.
  • Biological containment is extremely important in cases where physical containment is difficult or even not applicable. This is, amongst others, the case in applications where genetically modified microorganisms are used as live vaccines or as vehicle for delivery of therapeutic compounds. Such applications have been described e.g. in WO 97/14806, which discloses the delivery of biologically active peptides, such as cytokines, to a subject, by recombinant non-invasive or non- pathogenic bacteria.
  • WO 96/11277 describes the delivery of therapeutic compounds to an animal - including humans - by administration of a recombinant bacterium, encoding the therapeutic protein.
  • Steidler et al. (2000) describe the treatment of colitis by administration of a recombinant Lactococcus lactis, secreting interleukin-10.
  • Such a delivery may indeed be extremely useful to treat a disease in an affected human or animal, but the recombinant bacterium may act as a harmful and pathogenic micro organism when it enters a non-affected subject, and an efficient biological containment that avoids such unintentional spreading of the micro organism is needed.
  • Biological containment systems for host organisms may be passive, based on a strict requirement of the host for specific growth factor or a nutrient, that is not present or present in low concentrations in the outside environment, or active, based on so-called suicidal genetic elements in the host, whereby the host is killed in the outside environment by a cell killing function, encoded by a gene that is under control of a promoter only being expressed under specific environmental conditions.
  • E. coli strains are disclosed e.g. in US4100495.
  • WO 95/1061 discloses lactic acid bacterial suppressor mutants and their use as means of containment in lactic acid bacteria, but in that case, the containment is on the level of the plasmid, rather than on the level of the host strain and it stabilizes the plasmid in the host strain, but doesn't provide containment for the genetically modified host strain itself.
  • WO 95/10614 discloses the use of a cytoplasmatically active truncated and/or mutated Staphylococcus aureus nuclease as lethal gene.
  • WO 96/40947 discloses a recombinant bacterial system with environmentally limited viability, based on the expression of either an essential gene, expressed when the cell is in the permissive environment and is not expressed or temporarily expressed when the cell is in the non-permissive environment and/or a lethal gene, wherein expression of the gene is lethal to the cell and the lethal gene is expressed when the cell is in the non-permissive environment but not when the cell is in the permissive environment.
  • WO 99/58652 describes a biological containment system based on the relE cytotoxin.
  • FIG. 2 Schematic representation of the different expression modules as present on pOThy plasmids ands genomic integrants of hlL-10. Black parts represent original L. lactis MG1363 genetic information, white parts represent recombinant genetic information.
  • Figure 3 PCR identification of Thy11 (Thy11 1.1 and Thy11 7.1 represent individually obtained, identical clones). Standard PCR reactions were performed by using aliquots of saturated cultures of the indicated strains as a source of DNA template. Panel A shows an agarose gel of the products of the indicated PCR reactions. Panel B shows the positions at which primers attach in the thyA (1), upstream (2) or downstream (3) PCR's.
  • Oligonucleotide primers used (1): ATgACTTACgCAgATCAAgTTTTT and TTAAATTgCTAAATCAAATTTCAATTg (2): TCTgATTgAgTACCTTgACC and gCAATCATAATTggTTTTATTg (3): CTTACATgACTATgAAAATCCg and cTTTTTTATTATTAgggAAAgCA.
  • Figure 4 PCR identification of Thy11, Thy12, Thy15 and Thy16. Standard PCR reactions were performed by using three days old colonies of the indicated strains as a source of DNA template.
  • Panel A shows the positions at which primers attach in the upstream (1), downstream (2) or thyA (3), PCR's.
  • Panel B shows an agarose gel of the products of the indicated PCR reactions.
  • Figure 5 Southern blot analysis of the indicated strains. Chromosomal DNA was extracted and digested with the indicated restriction enzymes. Following agarose gel electrophoresis the DNA was transferred to a membrane and the chromosome structure around the thyA locus was revealed by use of DIG labelled thyA or hlL-10 DNA fragments (panel A).
  • Panel B shows a schematic overview of the predicted structure of the thyA locus in both MG1363 and Thy11.
  • Figure 6 Panel A shows a schematic overview of part of the predicted structure of the L lactis chromosome at the thyA locus in MG1363, Thy11 , Thy12, Thy15 and Thy16. Numbers indicate base pairs
  • Panel B Southern blot analysis of the indicated strains. Chromosomal DNA was extracted and digested with ⁇ /cfel and Spel restriction enzymes. Following agarose gel electrophoresis the DNA was transferred to a membrane and the chromosome structure around the thyA locus was revealed by use of DIG labelled thyA or hlL-10 DNA fragments.
  • Figure 7 Production of hlL-10. Panel A shows a western blot revealed with anti-hlL-10 antiserum of culture supernatant and cell associated proteins of the indicated strains. Panel B shows quantification (by ELISA) of hlL-10 present in the culture supernatant.
  • Figure 8 Production of hlL-10.
  • Panel A shows quantification (by ELISA) of hlL-10 present in the culture supernatant of the indicated strains.
  • Panel B shows a western blot revealed with anti-hlL-10 antiserum of culture supernatant proteins of the indicated strains.
  • Figure 9 Production of hlL-10 by the L. lactis strains LL108 carrying either pOThy11 , pOThy12, or pOThy16. Quantification (by ELISA) of hlL-10 present in the culture supernatant of the indicated strains.
  • the N-terminal protein sequence of the recombinant hlL-10 was determined by Edman degradation and was shown identical to the structure as predicted for the mature, recombinant hlL-10. The protein showed full biological activity.
  • Figure 10 Growth rate of the indicated strains in GM17 containing 100 ⁇ g/ml (T100) 50 ⁇ g/ml (T50) 25 ⁇ g/ml (T25) or no (TO) extra thymidine and possibly supplemented with 5 ⁇ g/ml of erythromycin (E). Saturated overnight cultures (prepared in T50) were diluted 1 :100 in the indicated culture media. Panel A shows the kinetics of absorbance accumulation. Panel B shows the kinetics of the number of colony forming units (cfu) per ml of culture.
  • TFM thymidine free medium
  • MG1363 and Thy12 bacteria were collected from an overnight culture in GM17 or GM17+50 ⁇ g/ml of thymidine respectively and washed in M9 buffer (6 g/l Na 2 HPO 4 , 3 g/l KH 2 PO 4 , 1 g/l NH CI, 0,5 g/l NaCI in water).
  • M9 buffer 6 g/l Na 2 HPO 4 , 3 g/l KH 2 PO 4 , 1 g/l NH CI, 0,5 g/l NaCI in water.
  • TFM TFM supplemented with 50 ⁇ g/ml of thymidine (T50).
  • Figure 12 Intestinal passage and viability: L.
  • lactis MG1363 was transformed with the plasmid pLET2N which carries a chioramphenicol (Cm) resistance marker.
  • L. lactis Thy12 was transformed with the plasmid pT1 NX which carries an erythromycin (Em) resistance marker.
  • Em erythromycin
  • Faeces were collected of the time intervals -1 to 0, 0 to 1 , 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10 and 10 to overnight. All samples were resuspended in isotonic buffer and appropriate dilutions were plated on GM17 (M17 medium, Difco, St.Louis supplemented with 0,5% glucose) plates containing either Cm, Em or Em+ 50 ⁇ g/ml thymidine. Colony forming units for the different plates are represented in the graph.
  • a first aspect of the invention is an isolated strain of Lactococcus sp. comprising a defective thymidylate synthase gene.
  • said defective thymidylate synthase gene is inactivated by gene disruption.
  • said Lactococcus sp. is Lactococcus lactis.
  • a special embodiment is a Lactococcus sp.
  • strain preferably Lactococcus lactis, more preferably a Lactococcus lactis MG1363 derivative, whereby the thymidylate synthase gene has been disrupted and replaced by an interleukin-10 expression unit.
  • Said interleukin-10 expression unit is preferably, but not limited to, a human interleukin-10 expression unit or gene encoding for human interleukin-10.
  • Another aspect of the invention is the use of a strain according to the invention as host strain for transformation, whereby the transforming plasmid does not comprise an intact thymidylate synthase gene.
  • Still another aspect of the invention is a transformed strain of Lactococcus sp.
  • the present invention also relates to the usage of a transformed strain of Lactococcus sp. to deliver prophylactic and/or therapeutic molecules, and as such, to treat diseases.
  • Methods to deliver said molecules and methods to treat diseases such as inflammatory bowel diseases are explained in detail in WO 97/14806 and WO 00/23471 to Steidler et al. and in Steidler et al. (Science 2000, 289:1352) that are hereby incorporated by reference.
  • Another aspect of the invention is a medical preparation, comprising a transformed strain of Lactococcus sp., according to the invention.
  • Lactococcus lactis subsp. lactis thymidylate synthase gene has been cloned by Ross et al. (1990a); it sequence is comprised in SEQ ID N° 3 and SEQ ID N° 5.
  • EP0406003 discloses a vector devoid of antibiotic resistance and bearing a thymidylate synthase gene as a selection marker; the same vector has been described by Ross et al. (1990b). However, this vector could not be used in a Lactococcus lactis strain due to the lack of a suitable thyA mutant that had never been described.
  • the present invention discloses how to construct such mutant by gene disruption, using homologous recombination in Lactococcus.
  • the thyA gene is disrupted by a functional human interleukin-10 expression cassette.
  • any construct can be used for gene disruption, as long as it results in an inactivation of the thyA gene or in an inactive thymidylate synthase.
  • the homologous recombination may result in a deletion of the gene, in one or more amino acid substitutions that lead to an inactive form of the thymidylate synthase, or to a frameshift mutation resulting in a truncated form of the protein.
  • Such a Lactococcus sp Such a Lactococcus sp.
  • thyA mutant is very useful as a host strain for transformation, in situations where more severe containment than purely physical containment is needed. Indeed, thyA mutants cannot survive in an environment without, or with only a limited concentration of thymidine and/or thymine. When such a strain is transformed with a plasmid that doesn't comprise an intact thyA gene and cannot complement the mutation, the transformed strain will become suicidal in a thymidine/thymine poor environment. Such a strain can be used in a fermentor, as an additional protection for the physical containment. Moreover, the present invention discloses that such a strain is especially useful in cases where the strain is used as a delivery vehicle in an animal body.
  • the present invention further demonstrates that the transformed strains surprisingly pass the gut at the same speed as the control strains and shows that their loss of viability is indeed not different from that of the control strains.
  • the transforming plasmid can be any plasmid, as long as it cannot complement the thyA mutation.
  • It may be a selfreplicating plasmid that preferably carries one or more genes of interest and one or more resistance markers, or it may be an integrative plasmid.
  • the integrative plasmid itself may be used to create the mutation, by causing integration at the thyA site, whereby the thyA gene is inactivated.
  • the active thyA gene is replaced by double homologous recombination by a cassette comprising the gene or genes of interest, flanked by targeting sequences that target the insertion to the thyA target site. It is of extreme importance that these sequences are sufficiently long and sufficiently homologous to obtain to integrate the sequence into the target site.
  • said targeting sequences consist of at least 100 contiguous nucleotides of SEQ ID N°1 at one side of the gene of interest, and at least 100 contiguous nucleotides of SEQ ID N°2 at the other side; more preferably, said targeting sequences consists of at least 500 contiguous nucleotides of SEQ ID N°1 at one side of the gene of interest, and at least 500 contiguous nucleotides of the SEQ ID N° 2 at the other side; most preferably, said targeting sequences consists of SEQ ID N°1 at one side of the gene of interest and SEQ ID N°2 at the other side, or said targeting sequences consist of at least 100 nucleotides that are at least 80% identical, preferably 90% identical to a region of SEQ ID N° 1 at one side of the gene of interest, and of at least 100 nucleotides that are at least 80% identical, preferably 90% identical to a region of SEQ ID N° 2 at the other side of the gene of interest, preferably said targeting
  • SEQ ID N° 7 A preferred example of a sequence, homologous to SEQ ID N°1 is given in SEQ ID N° 7.
  • SEQ ID N° 1 and SEQ ID N° 7 are interchangeable.
  • Lactococcus Transformation methods of Lactococcus are known to the person skilled in the art, and include, but are not limited to protoplast transformation and electroporation.
  • a transformed Lactococcus sp. strain according to the invention is useful for the delivery of prophylactic and/or therapeutical molecules and can be used in a pharmaceutical composition. The delivery of such molecules has been disclosed, as a non-limiting example, in WO 97/14806 and in WO 98/31786.
  • Prophylactic and/or therapeutical molecules include, but are not limited to polypetides such as insuline, growth hormone, prolactine, calcitonin, group 1 cytokines, group 2 cytokines and group 3 cytokines and polysaccharides such as polysaccharide antigens from pathogenic bacteria.
  • a preferred embodiment is the use of a Lactococcus sp. strain according to the invention to deliver human interleukin-10. This strain can be used in the manufacture of a medicament to treat Crohn's disease as indicated above
  • sequence of the whole locus is shown in SEQ ID N°3; a mutant version of this sequence is shown in SEQ ID N°5.
  • Both the 5' and 3' sequences are different from the sequence at genbank AE006385 describing the L lactis IL1403 sequence (Bolotin, in press) or at AF336368 describing the L. lactis subsp. lactis CHCC373 sequence. From the literature it is obvious that homologous recombination by use of the published sequences adjacent to thyA (Ross et al., 1990a) (86 bp at the 5'end and 31 bp at the 3'end) is virtually impossible due to the shortness of the sequences. Indeed, Biswas et al.
  • the thyA replacement is performed by making suitable replacements in a plasmid borne version of the thyA target, as described below.
  • the carrier plasmid is a derivative of pORI19 (Law et al., 1995) a replication defective plasmid, which only transfers the erythromycin resistance to a given strain when a first homologous recombination, at either the 5' 1000bp or at the 3'1000bp of the thyA target.
  • a second homologous recombination at the 3' 1000bp or at the 5' 1000bp of the thyA target yields the desired strain.
  • the thyA gene is replaced by a synthetic gene encoding a protein which has the L.
  • lactis Usp45 secretion leader (van Asseldonk et al., 1990) fused to a protein of identical amino acid sequence than: (a) the mature part of human-interleukin 10 (hlL- 10) or (b) the mature part of hlL-10 in which proline at position 2 had been replaced with alanine or (c) the mature part of hlL-10 in which the first two amino acids had been deleted; (a), (b) and (c) are called hlL-10 analogs, the fusion products are called Usp45-hlL-10.
  • the thyA gene is replaced by an expression unit comprising the lactococcal P1 promotor (Waterfield et al., 1995), the E. coli bacteriophageT7 expression signals: putative RNA stabilising sequence and modified gene10 ribosomal binding site (Wells and Schofield, 1996).
  • the insertion is performed in such way that the ATG of thyA is fused to the P1-T7Usp45-hlL-10 expression unit.
  • the insertion is performed in such way that the thyA ATG is not included: 5' agataggaaatttcacttacgcagatcaagttttt ... thyA wild type gattaagtcatcttacctctt... Pl-T7-usp45-hIL10 5' agataggaaaatttcgattaagtcatcttacctctt ... thyA " , Pl-T7-usp45-hIL10 Alternatively, at the 5' end the insertion is performed in such way that the thyA promotor [Ross, 1990 a] is not included:
  • an ACTAGT Spel restriction site was engineered immediately adjacent to the TAA stop codon of the usp45-hlL-10 sequence. This was ligated in a TCTAGA Xha ⁇ restriction site, which was engineered immediately following the thyA stop codon
  • the resulting strains are thyA deficient, a mutant not yet described for L. lactis. It is strictly dependent upon the addition of thymine or thymidine for growth.
  • the map of the deletion, as well as the PCR analysis of all the isolates/mutants of the present invention are shown in figures 3 and 4.
  • the presence of the thymidylate synthase and the interleukin 10 gene in the wild type strain and in the independent isolates/mutant was analyzed by Southern analysis as shown in figures 5 and 6.
  • the region around the inserted hlL-10 gene was isolated by PCR and the DNA sequence was verified. The structure is identical to the predicted sequence.
  • Figure 9 shows the production of hlL-10 by the L. lactis strains LL108 carrying either pOThy11 , pOThy12, or pOThy16. Quantification (by ELISA) of hlL-10 present in the culture supernatant of the indicated strains.
  • the N-terminal protein sequence of the recombinant hlL-10 was determined by Edman degradation and was shown identical to the structure as predicted for the mature, recombinant hlL-10. The protein showed full biological activity.
  • LL108 is a L.
  • lactis strain carrying a genomic integration of the repA gene, required for replication of pORH9 derived plasmids such as pOThy11 , pOThy12, pOThy15 or pOThy16.
  • This strain was kindly donated by dr. Jan Kok, University of Groningen.
  • the plasmids pOThy11, pOThy12, pOThy15 and pOThy16 carry the synthetic human IL-10 gene in different promotor configurations (see Fig. 2), flanked by approximately 1kB of genomic DNA derived from the thyA locus, upstream and downstream from thyA. These plasmids were used for the construction of the genomic integration as described.
  • Thy12 passes the intestine of the mice at the same speed as MG1363. Loss of viability does not appear different between Thy12 and MG1363. Thy12 appear fully dependent on thymidine for growth, indicating that no Thy12 bacteria had taken up a foreign thyA gene.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Compounds Of Unknown Constitution (AREA)
  • Food Preservation Except Freezing, Refrigeration, And Drying (AREA)
PCT/EP2002/004942 2001-05-03 2002-05-03 Self-containing lactococcus strain Ceased WO2002090551A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CA2446776A CA2446776C (en) 2001-05-03 2002-05-03 Self-containing lactococcus strain
EP02740565A EP1383897B1 (en) 2001-05-03 2002-05-03 Self-containing lactococcus strain
AU2002314040A AU2002314040B2 (en) 2001-05-03 2002-05-03 Self-containing lactococcus strain
DE60212825T DE60212825T2 (de) 2001-05-03 2002-05-03 Selbsterhaltender lactococcus stamm
JP2002587611A JP4347575B2 (ja) 2001-05-03 2002-05-03 自己自制ラクトコッカス(Loctococcus)株
US10/687,996 US7780961B2 (en) 2001-05-03 2003-10-17 Self-containing Lactococcus strain
US12/803,333 US20100316611A1 (en) 2001-05-03 2010-06-23 Self-containing lactococcus strain

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP01201631.7 2001-05-03
EP01201631 2001-05-03
EP01204785.8 2001-12-07
EP01204785 2001-12-07

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/687,996 Continuation US7780961B2 (en) 2001-05-03 2003-10-17 Self-containing Lactococcus strain

Publications (2)

Publication Number Publication Date
WO2002090551A2 true WO2002090551A2 (en) 2002-11-14
WO2002090551A3 WO2002090551A3 (en) 2003-03-27

Family

ID=26076897

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/004942 Ceased WO2002090551A2 (en) 2001-05-03 2002-05-03 Self-containing lactococcus strain

Country Status (9)

Country Link
EP (1) EP1383897B1 (cg-RX-API-DMAC7.html)
JP (2) JP4347575B2 (cg-RX-API-DMAC7.html)
AT (1) ATE331789T1 (cg-RX-API-DMAC7.html)
AU (1) AU2002314040B2 (cg-RX-API-DMAC7.html)
CA (1) CA2446776C (cg-RX-API-DMAC7.html)
DE (1) DE60212825T2 (cg-RX-API-DMAC7.html)
DK (1) DK1383897T3 (cg-RX-API-DMAC7.html)
ES (1) ES2266515T3 (cg-RX-API-DMAC7.html)
WO (1) WO2002090551A2 (cg-RX-API-DMAC7.html)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004056850A3 (en) * 2002-12-19 2004-09-30 Vib Vzw Mutant proteins showing increased secretion
EP1538198A3 (en) * 2003-11-28 2005-06-15 National Institute of Agrobiological Sciences Lactic acid bacteria and their cellular components inducing immunoregulatory function, and method of obtaining the same
WO2006018446A3 (en) * 2004-08-20 2006-05-18 Vib Vzw Method to improve lactococcus preservation
WO2007063075A1 (en) * 2005-11-29 2007-06-07 Actogenix Nv Induction of mucosal tolerance to antigens
WO2008071751A1 (en) * 2006-12-14 2008-06-19 Actogenix N.V. Delivery of binding molecules to induce immunomodulation
WO2008084115A3 (en) * 2007-01-12 2009-04-09 Actogenix Nv Lactococcus promoters and uses thereof
US7601799B2 (en) 2002-06-19 2009-10-13 Actogenix N.V. Methods and means to promote gut absorption
WO2010034844A1 (en) * 2008-09-29 2010-04-01 Actogenix N.V. Reduced colonization of microbes at the mucosa
US7780961B2 (en) 2001-05-03 2010-08-24 Actogenix N.V. Self-containing Lactococcus strain
WO2013041672A1 (en) 2011-09-23 2013-03-28 Actogenix Nv Modified gram positive bacteria and uses thereof
WO2013041673A1 (en) 2011-09-23 2013-03-28 Actogenix Nv Modified gram positive bacteria and uses thereof
US8524246B2 (en) 2007-01-25 2013-09-03 Actogenix N.V. Treatment of immune disease by mucosal delivery of antigents using genetically modified Lactobacillus
WO2017122180A1 (en) 2016-01-14 2017-07-20 Intrexon Actobiotics N.V. Compositions and methods for the treatment of type 1 diabetes
WO2018042390A1 (en) 2016-09-02 2018-03-08 Intrexon Actobiotics N.V. Genetically modified bacteria stably expressing il-10 and insulin
WO2018051223A1 (en) 2016-09-13 2018-03-22 Intrexon Actobiotics N.V. Mucoadhesive microorganism
EP3260531A4 (en) * 2015-03-26 2018-04-18 Nanjing Sinogen Biotech & Pharmaceutical Inc. Transformant used for losing weight and reducing fat, construction method for transformant, and application of transformant
WO2020075171A1 (en) 2018-10-11 2020-04-16 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Bacteria expressing single chain antibodies against toll-like receptors
WO2021059240A1 (en) 2019-09-27 2021-04-01 Intrexon Actobiotics Nv D/B/A Precigen Actobio Treatment of celiac disease
US10988770B2 (en) 2011-06-01 2021-04-27 Intrexon Actobiotics Nv Polycistronic expression system for bacteria

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9688967B2 (en) 2014-12-05 2017-06-27 Synlogic, Inc. Bacteria engineered to treat diseases associated with hyperammonemia
US20160206666A1 (en) 2014-12-22 2016-07-21 Synlogic, Inc. Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tighten gut mucosal barrier
BR112017018656B1 (pt) * 2015-03-02 2021-11-30 Synlogic, Inc Bactéria geneticamente modificada, composição farmaceuticamente aceitável compreendendo a dita bactéria e uso da dita composição para tratar ou prevenir uma doença ou condição associada à inflamação intestinal e/ou função da barreira intestinal comprometida
EP3294760B1 (en) 2015-05-13 2021-03-24 Synlogic Operating Company, Inc. Bacteria engineered to reduce hyperphenylalaninemia
US11685925B2 (en) 2015-10-30 2023-06-27 Synlogic Operating Company, Inc. Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier
EP3377518B1 (en) 2015-11-16 2022-04-13 Synlogic Operating Company, Inc. Bacteria engineered to reduce hyperphenylalaninemia
AU2021240078A1 (en) 2020-03-20 2022-09-01 Synlogic Operating Company, Inc. Microorganisms engineered to reduce hyperphenylalaninemia

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4231764A1 (de) * 1992-09-23 1994-03-24 Inst Pflanzengenetik & Kultur Verfahren zur chromosomalen Integration eines Produkt-Gens

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7780961B2 (en) 2001-05-03 2010-08-24 Actogenix N.V. Self-containing Lactococcus strain
US7601799B2 (en) 2002-06-19 2009-10-13 Actogenix N.V. Methods and means to promote gut absorption
WO2004056850A3 (en) * 2002-12-19 2004-09-30 Vib Vzw Mutant proteins showing increased secretion
EP1538198A3 (en) * 2003-11-28 2005-06-15 National Institute of Agrobiological Sciences Lactic acid bacteria and their cellular components inducing immunoregulatory function, and method of obtaining the same
US7642081B2 (en) 2003-11-28 2010-01-05 National Institute Of Agrobiological Sciences Lactic acid bacteria and their cellular components inducing immunoregulatory function, and method of obtaining the same
WO2006018446A3 (en) * 2004-08-20 2006-05-18 Vib Vzw Method to improve lactococcus preservation
US9200249B2 (en) 2004-08-20 2015-12-01 Actogenix N.V. Method to improve Lactococcus preservation
US10385351B2 (en) 2004-08-20 2019-08-20 Intrexon Actobiotics Nv Method to improve Lactococcus preservation
US9790510B2 (en) 2004-08-20 2017-10-17 Intrexon Actobiotics Nv Method to improve Lactococcus preservation
US8398995B2 (en) 2005-11-29 2013-03-19 Actogenix Nv Method of inducing immune tolerance to type I diabetes
EP2119450A3 (en) * 2005-11-29 2010-06-30 Actogenix N.V. Induction of mucosal tolerance to antigens
US10195269B2 (en) 2005-11-29 2019-02-05 Intrexon Actobiotics Nv Induction of mucosal tolerance to antigens
WO2007063075A1 (en) * 2005-11-29 2007-06-07 Actogenix Nv Induction of mucosal tolerance to antigens
US9539291B2 (en) 2005-11-29 2017-01-10 Intrexon Actobiotics Nv Induction of mucosal tolerance to antigens
US9526750B2 (en) 2005-11-29 2016-12-27 Intrexon Actobiotics Nv Induction of mucosal tolerance to antigens
EP3097924A1 (en) * 2005-11-29 2016-11-30 Intrexon Actobiotics NV Induction of mucosal tolerance to antigens
US8748126B2 (en) 2005-11-29 2014-06-10 Actogenix N.V. Induction of mucosal tolerance to antigens
WO2008071751A1 (en) * 2006-12-14 2008-06-19 Actogenix N.V. Delivery of binding molecules to induce immunomodulation
RU2495129C2 (ru) * 2007-01-12 2013-10-10 Актогеникс Н.В. ПРОМОТОРЫ Lactococcus И ИХ ПРИМЕНЕНИЕ:
AU2008204442B2 (en) * 2007-01-12 2013-03-14 Intrexon Actobiotics Nv Lactococcus promoters and uses thereof
US8759088B2 (en) 2007-01-12 2014-06-24 Actogenix N.V. Lactococcus promoters and uses thereof
EP3124614A2 (en) 2007-01-12 2017-02-01 Intrexon Actobiotics NV Lactococcus promoters and uses thereof
EP3124614A3 (en) * 2007-01-12 2017-04-05 Intrexon Actobiotics NV Lactococcus promoters and uses thereof
WO2008084115A3 (en) * 2007-01-12 2009-04-09 Actogenix Nv Lactococcus promoters and uses thereof
US10143729B2 (en) 2007-01-25 2018-12-04 Intrexon Actobiotics Nv Treatment of immune disease by mucosal delivery of antigens using genetically modified Lactococcus
US10668136B2 (en) 2007-01-25 2020-06-02 Intrexon Actobiotics Nv Treatment of immune disease by mucosal delivery of antigens using genetically modified Lactococcus
EP3351268A1 (en) 2007-01-25 2018-07-25 Intrexon Actobiotics NV Treatment of immune disease by mucosal delivery of antigens
US8524246B2 (en) 2007-01-25 2013-09-03 Actogenix N.V. Treatment of immune disease by mucosal delivery of antigents using genetically modified Lactobacillus
EP2774621A2 (en) 2007-01-25 2014-09-10 Actogenix N.V. Treatment of immune disease by mucosal delivery of antigens
EP3933029A3 (en) * 2008-09-29 2022-03-23 Intrexon Actobiotics NV Reduced colonization of microbes at the mucosa
WO2010034844A1 (en) * 2008-09-29 2010-04-01 Actogenix N.V. Reduced colonization of microbes at the mucosa
EP3181682A1 (en) * 2008-09-29 2017-06-21 Intrexon Actobiotics NV Reduced colonization of microbes at the mucosa
US10988770B2 (en) 2011-06-01 2021-04-27 Intrexon Actobiotics Nv Polycistronic expression system for bacteria
WO2013041672A1 (en) 2011-09-23 2013-03-28 Actogenix Nv Modified gram positive bacteria and uses thereof
US10519418B2 (en) 2011-09-23 2019-12-31 Intrexon Actobiotics Nv Modified gram positive bacteria and uses thereof
US10030234B2 (en) 2011-09-23 2018-07-24 Intrexon Actobiotics Nv Modified gram positive bacteria and uses thereof
US9982228B2 (en) 2011-09-23 2018-05-29 Intrexon Actobiotics Nv Modified gram positive bacteria and uses thereof
US9347036B2 (en) 2011-09-23 2016-05-24 Intrexon Actobiotics Nv Modified gram positive bacteria and uses thereof
US10793825B2 (en) 2011-09-23 2020-10-06 Intrexon Actobiotics Nv Modified gram positive bacteria and uses thereof
US9458467B2 (en) 2011-09-23 2016-10-04 Intrexon Actobiotics Nv Modified gram positive bacteria and uses thereof
WO2013041673A1 (en) 2011-09-23 2013-03-28 Actogenix Nv Modified gram positive bacteria and uses thereof
AU2016235674B2 (en) * 2015-03-26 2018-11-22 Guangzhou Sinogen Pharmaceutical Co., Ltd Transformant used for losing weight and reducing fat, construction method for transformant, and application of transformant
EP3260531A4 (en) * 2015-03-26 2018-04-18 Nanjing Sinogen Biotech & Pharmaceutical Inc. Transformant used for losing weight and reducing fat, construction method for transformant, and application of transformant
WO2017122180A1 (en) 2016-01-14 2017-07-20 Intrexon Actobiotics N.V. Compositions and methods for the treatment of type 1 diabetes
US11786567B2 (en) 2016-01-14 2023-10-17 Intrexon Actobiotics N.V. Compositions and methods for the treatment of type 1 diabetes
US12246046B2 (en) 2016-01-14 2025-03-11 Intrexon Actobiotics N.V. Compositions and methods for the treatment of type 1 diabetes
EP3919065A1 (en) 2016-01-14 2021-12-08 Intrexon Actobiotics NV Compositions and methods for the treatment of type 1 diabetes
US10905727B2 (en) 2016-01-14 2021-02-02 Intrexon Actobiotics N.V. Compositions and methods for the treatment of type 1 diabetes
US10858663B2 (en) 2016-09-02 2020-12-08 Intrexon Actobiotics N.V. Genetically modified bacteria stably expressing IL-10 and insulin
US11549118B2 (en) 2016-09-02 2023-01-10 Intrexon Actobiotics Nv Genetically modified bacteria stably expressing IL-10 and insulin
WO2018042390A1 (en) 2016-09-02 2018-03-08 Intrexon Actobiotics N.V. Genetically modified bacteria stably expressing il-10 and insulin
US12359210B2 (en) 2016-09-02 2025-07-15 Intrexon Actobiotics N.V. Genetically modified bacteria stably expressing IL-10 and insulin
US10808014B2 (en) 2016-09-13 2020-10-20 Intrexon Actobiotics N.V. Mucoadhesive microorganism
US11384123B2 (en) 2016-09-13 2022-07-12 Intrexon Actobiotics N.V. Mucoadhesive microorganism
WO2018051223A1 (en) 2016-09-13 2018-03-22 Intrexon Actobiotics N.V. Mucoadhesive microorganism
US12252516B2 (en) 2016-09-13 2025-03-18 Intrexon Actobiotics N.V. Mucoadhesive microorganism
WO2020075171A1 (en) 2018-10-11 2020-04-16 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Bacteria expressing single chain antibodies against toll-like receptors
WO2021059240A1 (en) 2019-09-27 2021-04-01 Intrexon Actobiotics Nv D/B/A Precigen Actobio Treatment of celiac disease

Also Published As

Publication number Publication date
DK1383897T3 (da) 2006-10-30
WO2002090551A3 (en) 2003-03-27
JP2009060913A (ja) 2009-03-26
JP4347575B2 (ja) 2009-10-21
AU2002314040B2 (en) 2007-06-28
ES2266515T3 (es) 2007-03-01
EP1383897A2 (en) 2004-01-28
CA2446776C (en) 2011-07-12
DE60212825T2 (de) 2007-01-11
DE60212825D1 (de) 2006-08-10
ATE331789T1 (de) 2006-07-15
JP2004533246A (ja) 2004-11-04
CA2446776A1 (en) 2002-11-14
EP1383897B1 (en) 2006-06-28

Similar Documents

Publication Publication Date Title
EP1383897B1 (en) Self-containing lactococcus strain
US20100316611A1 (en) Self-containing lactococcus strain
AU2002314040A1 (en) Self-containing lactococcus strain
CA2738781C (en) Reduced colonization of microbes at the mucosa
US20050276788A1 (en) Self-containing lactobacillus strain
US8759088B2 (en) Lactococcus promoters and uses thereof
AU2013327059B2 (en) Immunomodulatory minicells and methods of use
CA2342040C (en) Anaerobic bacterium as a drug for cancer gene therapy
Li et al. Food-grade expression of nattokinase in Lactobacillus delbrueckii subsp. bulgaricus and its thrombolytic activity in vitro
US20080253990A1 (en) Self-Containing Lactobacillus Strain
US12491236B2 (en) Genetically engineered live bacteria and methods of constructing the same
HK1236565A1 (en) Reduced colonization of microbes at the mucosa

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2002314040

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2002740565

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10687996

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2002587611

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2446776

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 2002740565

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 2002740565

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 2002314040

Country of ref document: AU