WO2002066686A1

WO2002066686A1 - Feline infectious peritonitis viruses (fipv) diagnosis

Info

Publication number: WO2002066686A1
Application number: PCT/NL2002/000109
Authority: WO
Inventors: Hermanus Fransiscus Egberink; Fermin Adrianus Simons
Original assignee: Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V.
Priority date: 2001-02-19
Filing date: 2002-02-19
Publication date: 2002-08-29
Also published as: WO2002066686A8

Abstract

The invention relates to a method to differentiate feline infectious peritonitis viruses (FIPV) from feline enteric coronaviruses (FECV). The invention provides a method allowing for antemortem diagnosis for distinguishing a feline infectious peritonitis virus (FIPV) infection from a feline enteric coronavirus (FECV) infection comprising detecting coronavirus in non-enteric cells in a sample obtained from a cat suspected of being infected with FIPV and/or FECV. Provided are methods for the detection of a replicating FIPV in order to distinguish a FIPV coronavirus infection from a FECV infection, including diagnostic kits and a cat or cat population diagnosed with such kits.

Description

Title: Feline Infectious Peritonitis Viruses (FIPV) diagnosis

The invention relates to a method to differentiate feline infectious peritonitis viruses

(FIPV) from feline enteric coronaviruses (FECV)

Coronaviruses (genus Coronavirus, family Coronaviridae, order Nidovirales) are enveloped RNA viruses with an unsegmented genome 27- 32Kb in size. The 5' two-thirds of the viral genome are taken up by the POL gene encoding the POL1A and the POLlb polyproteins from which the viral polymerase is derived by proteolytic cleavage. During replication, a 3' co-terminal nested set of mRNAs that codes for the structural proteins S (spike protein), E (envelope protein), M (triple spanning membrane protein), N (nucleocaspid protein), and for a number of persumptative structural proteins is produced [Rottier, P.J.M (1999). Veterinary Microbiology 69: 117-125].

Although generally associated with acute, self limiting enteric and respiratory infections, coronaviruses can establish persistent infections both in-viυo and in-vitro. Feline coronaviruses (FCoVs) [designated 'feline enteric coronaviruses' (FECV)] generally cause mild enteric infections, but also a rare fatal immune mediated disease called feline infectious peritonitis (FIP. There is apoptosis of activated T-cells mediated by an unknown soluble factor, whilst the T-cells are not replicating the virus. Once infected with FIPV the prognosis for the cat is bad. CHnical signs of FIPV in infected cats include fever, malaise, dyspnea, anorexia, abdominal or pleural effusion, neurophilia and lymphopenia, neurologic abnormalities, especially anterior uveitis, and/or palable abdominal lesions.

Genetic evidence shows that the avirulent 'enteric' FCoVs and the disease causing FIP viruses are not separate species, but are genetically very closely related, merely avirulent and virulent strains of the same FCoV species. The latter arising spontaneously in FCoV infected hosts. The disease occurs worldwide in domestic cats and numerous wild feline species [Arnold et al., (1995): Virology: 212: 622-631; Herrewegh et al, (1997). Virology 234: 349-363],

FIPV isolates from FIP outbreaks have 98% homology with the enzootic FECN suggesting that in most cases FIP results from mutations that form from enzootic FECV Mutations leading to phenotypically different coronaviruses strains involve point mutations, recombination's and deletions [Poland et al, (1996). Journal of Clinical Microbiology: 3180-3184]. FECV and FIPV are closely related antigenically to other coronaviruses, including transmissible gastroenteritis virus (TGEV) of pigs, canine coronavirus (CCV) and human bronchitis virus 229-E [Vennema et al, (1992): Virology. 191, 134-140].

Feline coronaviruses can be allocated into two serotypes on the basis of their in-vitro neutralisation. In the field type 1 strains (70-95 %) predominate. The type 2 strains appear to have originated from RNA recombination events during which the spike gene of canine coronaviruses was incorporated into the FCoV type 1 genomes. In Europe and in the US type 2 strains are rarely found, however, in Japan they contribute to 10-20% of the virus.

Epidemiological studies suggest that feline coronaviruses are transmitted by the oro-faecal route. It is known that seropositivity is highest amongst cats in crowded situations (90%). However, many cats in single cat households are also seropositive (10-50%). Recent studies demonstrate that feline coronaviruses can establish asymptomatic chronic infections, the virus persisting in their natural host's, in the lower intestinal tract where it continues to replicate at low levels.

It would appear that the virulent FIP -inducing viruses, that can cause systemic infections are an infrequent manifestation of a common, in-apparent infection. It occurs in only 1-5% of the infected animals, predominantly in kittens and animals older than 8 years. All cats are however susceptible to FIP and recent work suggests that susceptibility to FIP is partly genetically predisposed.

Clinical disease caused by FlP-inducing strains of FCoV are manifested in two primary forms, effusive (wet form) and noneffusive (dry form). Current diagnosis is based on clinical symptoms, blood and physical examinations. These however, result only in a probability diagnosis that the FIP disease is present. The 'dry' form of the disease can last several months. An early diagnosis of the disease is thus desired on account of the bad prognosis and the misery the disease inflicts on the cat, and hence the need to carry out a humane killing of the cat on compassionate grounds. This would further avoid the need for futile quarantine, although it seems that FIPV is not so contagious. The two most common serologic tests used to detect FCoV antibodies are immunofluorescent assay (IF A) and the enzyme linked immunoasorbent assay (ELISA). Positive results for serologic tests for FCoV can only mean exposure to one of the three antigenetically related viruses: TGEV, CCV or FCoV. To date, no current available serological test can distinguish FECV and FIPV from each other, nor can determine if and when the cat has become infected with the virus. The main dilemma is that FIPV is considered morphologically, serologically and antigenically identical to FECV [Poland et al, (1996). Journal of Clinical Microbiology: 3180-3184]. Also FCoV antibody titres do not appear to correlate with the diagnosis of FIP as false positives results often occur as a result of recent vaccinations or due to the close antigenic relationship between FIPV and FeCV. In addition no test can indicate whether the animal is immune or susceptible to clinical disease. Nucleic acid probes have been previously developed to detect strands of RNA of coronaviruses in feline body fluids [Arnold et al, (1995); Vennema et al, (1992): Virology. 191, 134-140]. However, to date none have been successful in distinguishing virulent strains from avirulent strains of FCoVs. Partly because FCoVs were assumed to be localised to the gastrointestinal system, and partly due to the fact that the genome of enteritis inducing strains is almost identical to that of FIP inducing strains when viruses from the same feline population were compared. Veterinary researchers are currently looking for a single test to confirm the antemortem diagnosis of FIP [Mc Reynolds and Macy (1997). 19(9): 1007-1015].

The invention now provides a method allowing for antemortem diagnosis for distinguishing a feline infectious peritonitis virus (FIPV) infection from a feline enteric coronavirus (FECV) infection comprising detecting coronavirus in non-enteric cells in a sample obtained from a cat suspected of being infected with FIPV and /or FECV. One embodiment of the invention is a method which allows one to effectively identify the early manifestation of an FIPV infection in a cat which may or may not have been previously infected with a coronavirus. The definition 'enteric cells' herein refers to gastro-epithelial cells, parietal cells, zymogenic cells and other cells exclusively associated with the gastrointestinal tract. In a further embodiment the invention provides for a method to distinguish FCoV biotypes, including allowing for antemortem diagnosis of a FIPV coronavirus infection in a sample obtained from a cat. The invention also provides a method wherein said cells comprise white blood cells. This invention makes use of the observation herein that the FCoV biotypes are present and can be detected in white blood cells. More importantly the FIPV virus can be detected. In addition the invention also provides a method allowing for antemortem diagnosis for distinguishing a FIPV infection from a FECV infection comprising detecting a replicating coronavirus. The replication strategy of coronoviruses, synthesis of nucleic acid and viral protein is known. The evidence of a replicating coronavirus is the synthesis of viral nucleic acid and protein in the host cell. The invention makes use of the observation as disclosed herein that the FIPV virus is predominantly present and capable of replicating for long periods in non- enteric cells, distinct from other FCoV biotypes which essentially do not, or only little replicate in those cells, in particular FECV, thus providing an efficient method for distinguishing avirulent FCoV strains from virulent strains, the subject of the invention. The invention also provides a method allowing for antemortem diagnosis for distinguishing FIPV infection from a FECV infection comprising detecting nucleic acid from a coronavirus genome. The invention further provides a method allowing for antemortem diagnosis for distinguishing FIPV infection from a FECV infection comprising detecting cellular coronavirus mRNA derived from a coronavirus genome. It is an object of the present invention to provide for hybridisation or polymerase chain reaction (PCR) probes/primers, which are capable of detecting polynucleotide sequences, including genomic sequence(s),' encoding the FIPV polypeptides, or closely related molecules. Nucleic acid sequence as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represents the sense or antisense strand. The invention also provides for degenerate primers. The method for producing degenerate primers are well known in the art. The definition 'antisense' RNA is an RNA sequence which is complementary to a sequence of bases in the corresponding mRNA: complementary in the sense that each base (or majority of bases) in the antisense strand (read in the 5' to 3' sense) is capable of pairing with the corresponding base (G with C, A with TJ), in the mRNA sequence read in the 5' to 3' sense. The definition 'sense' RNA is an RNA sequence which is substantially homologous to at least part of the corresponding mRNA sequence. The definition 'substantially homologous' means that a particular subject sequence, for example a mutant sequence, varies from the reference sequence by one or more substitutions, deletions, or additions, the net effect of which does not result in an adverse functional dissimilarity between the reference and the subject sequence.

The probes and primers provided herein may be used in other hybridisation and amplification assays, Southern or Northern analysis, dot/slot blot or other membrane based technologies; such as PCR technologies such as DNA Chip, Taqman® , NASBA, SDA, TMA and -situ-hybridisation technologies, and other molecular biology technologies well known in the art and under development providing the new techniques rely on properties of nucleic acid sequences that are currently known. Other means for producing specific hybridisation probes include the cloning of nucleic acid into suitable vectors for the production of mRNA probes for in- situ hybridisation. Such vectors are known in the art and are commercially available and may be used to synthesise RNA probes in-υitro by means of the addition of the appropriate RNA polymerase such as T7, T3, or SP6 polymerase and the appropriately radioactively labeled nucleotides. A number of companies such as Pharmacia Biotech (Piscataway NJ), Promega (Madisson WI), and US Biochemical Corp (Cleveland OH) supply commercial kits and protocols for these procedures. Suitable reporter molecules or labels include fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like.

Probes/primers may also be used for the detection of related sequences and preferably contain at least 50% of any of the nucleotides from a selected sequence [e.g nucleic acid from a coronavirus genome, more specifically FCoV genome]. The hybridisation probes may be derived from the nucleotide sequence, or from genomic sequence including enhancer element and introns. Hybridisation probes may be labelled by a variety of reporter groups, including radionuclides such as ³²P or ³⁵S, or enzymatic labels such as alkahne phosphatase coupled to the probe via avidin/biotin coupling systems, and the like. The specificity of the probe, whether it is made from a highly specific region (eg the M region, N region etc.), and the stringency of the hybri- disation or amplification (maximal, high, intermediate, low) will determine whether the probe identifies only naturally occurring sequence(s) encoding the polypeptide, allele's or related sequences. 'Stringency' typically occurs in the range from about 5°C below the Tm of the probe to about 20°C to 25°C below the Tm. As will be understood by those skilled in the art, a stringent hybridisation can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences. The term 'hybridisation' as used herein shall include 'any process' by which a strand of nucleic acid joins with a complementary strand through base pairing (Coombs J, (1994) Directory of biotechnology, Stockton press, New York NY).

The invention further provides a method for distinguishing a FIPV infection from a FECV infection wherein said nucleic acid is derived from the M and or N region [wherein M refers to a gene encoding a triple spanning membrane protein, and N refers to a gene encoding a nucleocaspid protein]of a coronavirus genome. Suitable primers, including degenerate primers, may be generated by methods known in the art [an appropriate primer set by way of illustration is provided in example 1]. It may be advantageous to produce nucleotide sequences, the subject of the invention or derivatives thereof possessing a substantially different codon usage. It is known by those skilled in the art that as a result of degeneracy of the genetic code, a multitude of gene sequences, some bearing minimal homology to the nucleotide sequences of any known and any naturally occurring genes may be produced. The invention contemplates each and every possible variation of the nucleotide sequences that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of naturally occurring gene sequences, and all such variations are to be considered as being specifically disclosed. In addition the nucleotide sequences of the invention may be used in molecular biology techniques that have not been developed, providing the new techniques rely on properties of nucleotide sequences that are currently known, including but are not limited to such properties such as the triplet genetic code and specific base pair interactions. Altered nucleic acid sequences of this invention include deletions, insertions, substitutions of different nucleotides resulting in the polynucleotides that encode the same or are functionally equivalent.

Included in the scope of the invention are methods allowing for antemortem diagnosis for distinguishing FIPV infection from a FECV infection comprising detecting amino acid from a repHcating coronavirus. 'Amino acid' herein refers to peptide or protein sequence. Included in the scope of the present invention are alleles of the polypeptide encoded by nucleic acid sequences of this invention. As used herein; an 'allele' or 'allelic sequence' is an alternative form of the polypeptides described above. Alleles result from a mutation [eg. a change in the nucleic acid sequence, and generally produce altered mRNA or polypeptide whose structure or function may or may not be altered]. Any given polypeptide may have none, or more allelic forms. Common allelic changes that give rise to alleles are generally ascribed to natural deletions, additions or substitutions of amino acids. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence. Deliberate amino acid substitution may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, and/or the amphipathetic nature of the residues as long as the biological activity of the polypeptide is retained.

A 'deletion' is defined as a change in either nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent. An 'insertion' or 'addition' is that change in nucleotide or amino acid sequence which has resulted in the addition of one or more nucleotides or amino acid residues, respectively, as compared to the naturally occurring polypeptide(s). A 'substitution' results from the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids, respectively. A 'variant' of a polypeptide is defined as an amino acid sequence that is different by one or more amino acid 'substitutions'. A variant may have 'conservative' changes, wherein a substituted amino acid has similar structural or chemical properties eg replacement of leucine with isoleucine. More rarely a variant may have 'non-conservative' changes (eg replacement of a glycine with a tryptophan). Similar minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted, without abolishing biological or immunological activity may be found using computer programs well known in the art, for example, DNAStar software. The term 'biologically active' refers to a polypeptide, having structural, regulatory, or biochemical function of their naturally occurring counterparts. Likewise, 'immunologically active' defines the capability of the natural, recombinant or synthetic polypeptide, or any oligopeptide thereof, to induce a specific immune response in an appropriate animal or cells and to bind with specific antibodies.

The invention provides a method comprising detecting said nucleic acid with a nucleic acid based amplification assay. The invention provides a diagnostic test for FCoV-viral biotypes or variants, using a nucleic acid amplification based assay. The nucleic acid of the coronavirus FCoV genome provides the basis for an assay, that can distinguish FCoV biotypes, in particular to distinguish FECV and FIPV, but not limited to. The diagnostic assay is useful to distinguish between absence, presence and excess expression of FlP-viral proteins and to monitor expression levels during FIP development and to determine when an animal has become infected with an FCoV virus. Nucleic acid amplification based assays involve the use of oligonucleo- tides or oligomers complementary to or substantially homologous to selected regions of coronavirus genome, to detect samples containing DNA or RNA encoding the coronavirus polypeptides. As used herein 'oligonueleotides' or 'oligomers' refer to nucleic acid sequence of at least 10 nucleotides and as many as about 60 nucleotides, preferably about 15-30 nucleotides, and more preferably about 20-25 nucleotides which can be used as a probe or amplimer. PCR provides a practical method for the diagnosis of coronavirus infection. Oligonueleotides based on the coronavirus genome sequences may be chemically synthesised, or enzymatically generated, or produced from a recombinant source. Oligomers generally comprise two nucleotide sequences, one with sense orientation (5'-3') and one with antisense (3'-5'), employed under less stringent conditions for detection and /or quantitation of closely related DNA or RNA sequences. For example, nucleic acid sequences (e.g the M region, N region etc.) encoding coronavirus polypeptides may be used in the PCR assay of feline samples, more specifically non-enteric cells, more specifically isolated white blood cells wherein the FIPV virus replicates the most as compared to the innocuous variety, to detect coronavirus replication present. The invention further provides a kit comprising a means for executing a method for antemortem diagnosis for distinguishing a FIPV infection from a FECV infection. A variety of methods for detecting coronavirus nucleic acid or 'amino acid' are known to those skilled in the art. These procedures include, but are not limited to DNA-DNA, DNA-RNA hybridisation. The form of such quantitative methods may include, Southern or Northern analysis, dot/slot blot or other membrane based technologies; PCR technologies such as DNA Chip, Taqman®, NASBA, SDA, light-cycler PCR, TMA, ire-sito-hybridisation, protein bioassay or immunoassay techniques ELISA, IFA and proteomic Technologies. All of these technologies are well known in the art and are the basis of many commercially available diagnostic kits. The invention further provides a diagnostic assay using antibodies raised to polypeptides encoded by FCoV- viral genes of the present invention, with or without modification. Diagnostic assays for structural polypeptides include methods utilising the antibody and a label to detect the structural protein in samples. A variety of protocols for measuring the polypeptide, using either polyclonal or monoclonal antibodies specific for the respective protein are known in the art. Frequently the polypeptides and antibodies are labelled by joining them, either covalently or non covalently, with a reporter molecule. A variety of reporter molecules, labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and 'amino acid' assays. Other methods known in the art may be used to detect replicating FIP -viral particles, known to have high titres, in non-enteric samples, in order to ascertain a FCoV viral infection. These may include electron microscopy, and may take advantage of properties pertaining to the virus [e.g etc making use of variations in the genetic make up of feline coronavirus] but are not limited to. Other evolving technologies such as 'metabolomics' can be employed to look at changes in metabolic profiles in FIPV infected tissues compared with FECV infected tissues, and can be considered as being useful to diagnose an FIPV viral infection. In addition the nucleic acid and derived 'amino acid' of the invention may be used in molecular biology techniques including detection techniques, that have not been developed, providing the new techniques rely on properties of nucleic acid sequences and 'amino acid' that are currently known. The invention also provides for a kit allowing for antemortem diagnosis of coronavirus. The invention provides a kit for both the ante- and post- mortem diagnosis of a FCoN coronavirus infection. One advantage of such a kit is that an early diagnosis of a potentially virulent FCoN coronavirus infection in the feHne host can be made. Furthermore the invention provides for a cat population diagnosed with a kit. A further embodiment is a feHne population which is devoid of the FCoV coronavirus, for breeding purposes.

The foUowing example is offered by way of iUustration and not by Hmitation

Example 1. Nucleic acid amplification based assay for distinguishing FECV from FIPV.

Isolation of total RNA was performed as follows:

Total RNA was isolated from 0.5-1.0 ml of EDTA-treated blood with the Total Quick RNA Blood kit (Talent), according to the protocol provided by the manufacturer. RNA was eluted in a volume of 40-70μl of RNase-free H2O and stored at -20°C.

Reverse transcription was performed as follows:

2.0μl of reverse primer 212 (5mM) and lO.Oμl of RNA sample was heated for 2' at 95°C. After cooling on ice a mixture consisting of 4.0μl of 5x RT buffer, 2.0μl of 0.1 M DTT, O.δμl of M-MLV reverse transcriptase (aU Gibco BRL), l.Oμl of 25μM dNTP's and O.δμl of RNAguard dNTP's (both Amersham Pharmacia Biotech), was added. The mixture was incubated at 37°C for 1 hour, followed by a 5' heat treatment at 95°C. The cDNA was then stored at -20°C.

Polymerase chain reaction (PCR) was performed as follows: 3.0 μl of cDNA is ampHfied in a PCR reaction mix that consists of 3.0μl of lOxPCR buffer (Perkin Elmer), 2.5μl of 50 mM MgCl(Gibco BRL), 0.6μl of 25μlM dNTP's

(Amersham Pharmacia Biotech), 1.2μl of each primer (212 and 1179, Gibco BRL),

18.25μl of ddH₂O and 0.25μl Taq polymerase (Perkin Elmer).

Programme: 10' 94°C; 50" 94°C, 45" 55°C, 45" 72°C, 40 times repeated; 10' 72°C. Primers (sequence 5' to 3'):

212 : TAATGCCATACACGAACCAGCT antisense

1179 : GTGCTAGATTTGTCTTCGGACACC sense

Detection of product

12μl of the ampHfied product was separated on a 1.5% agarose/TAE gel. The ampHfied product should be approximately 300 bp long.

Claims

1. A method aUowing for antemortem diagnosis for distinguishing a feHne infectious peritonitis virus (FIPV) infection from a feHne enteric coronavirus (FECV) infection comprising detecting coronavirus in non-enteric ceUs in a sample obtained from a cat suspected of being infected with FIPV and /or FECV.

2. A method according to claim 1 wherein said cells comprise white blood ceUs.

3. A method according to claims 1 and 2 comprising detecting repHcating coronavirus.

4. A method according to claims 1-3 comprising detecting nucleic acid from a coronavirus genome.

5. A method according to claim 4 wherein said nucleic acid comprises mRNA.

6. A method according to claims 4-5 wherein said nucleic acid is derived from the M region of a coronavirus genome.

7. A method according to claims 4-6 comprising detecting said nucleic acid with a nucleic acid based ampHfication assay.

8. A kit comprising means for performing a method according to claims 1-7

9. A kit according to claim 8 allowing for antemortem diagnosis of coronavirus.

10. A cat or cat population diagnosed with a kit according to claim 9.