CN116042538A

CN116042538A - Cat coronavirus strain and application thereof

Info

Publication number: CN116042538A
Application number: CN202211482889.2A
Authority: CN
Inventors: 彭贵青; 胡小帅; 沈洲; 陈奕熹; 焦哲
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-11-24
Filing date: 2022-11-24
Publication date: 2023-05-02

Abstract

The invention discloses a feline coronavirus, which is classified and named as feline coronavirus (Feline Coronavirus) FCoV/WH/2022-1, and is preserved in China center for type culture collection, with the preservation number: CCTCCNO: V202297. The virus belongs to the I type of the cat infectious peritonitis virus, can cause animals to generate typical FIP symptoms and pathological changes, and can be further used for constructing a virus attack model and researching anti-FIPV related drugs or vaccines. The invention solves the problem that the existing strain can not construct the FIPV animal model I, and provides stable and reliable guarantee for the research and development of related medicines and biological products.

Description

Cat coronavirus strain and application thereof

Technical Field

The invention belongs to the field of biology, and relates to a feline coronavirus (Feline Coronavirus, FCoV) and application thereof.

Background

Cat infectious peritonitis (Feline Infectious Peritonitis, FIP) is a progressive, fatal infectious disease of cats, primarily in cats under 2 years of age and in multiple cat environments. In addition to infection of domestic cats, FIP is also seen in wild felines such as mink, tiger, cheetah, lion, and the like. Common clinical symptoms of diseased cats include somnolence, anorexia, weight loss, fever, jaundice, abdominal enlargement, shortness of breath, lymphadenectasis, pallor, uveitis, ataxia, seizures, etc. Viral presence was detected in blood, exudates, cerebrospinal fluid, aqueous humor, tissues (liver, spleen, kidney, mesenteric lymph) of the affected cats. The pathogen of FIP is feline coronavirus (Feline Coronavirus, FCoV).

Feline coronavirus is a enveloped, single-stranded positive-strand RNA virus belonging to the family coronaviridae, genus coronaviridae, family nimodiaceae. The surface of the virus particles has spike-shaped fiber, and the size of the virus genome is about 30Kb. Depending on the pathogenicity, feline coronaviruses are in turn classified into two biotypes, feline enterocoronavirus (Feline Enteric Coronavirus, FECV) and feline infectious peritonitis virus (Feline Infectious Peritonitis Virus, FIPV), FECV infection causes only mild, self-limiting enteritis, and FECV tissue tropism changes mutating it to FIPV, which in turn causes fatal FIP. Cat coronaviruses can be classified into two serotypes, type i and type ii, based on the difference in viral S proteins. Type II FCoV can be isolated and cultured by using a common cat cell line, and is a main material for developing FCoV research. The higher prevalence (> 90%) of feline coronaviruses type i, limited by the appropriate cell lines and unknown viral receptors, are difficult to isolate and culture and therefore lack a natural FIPV type i animal model.

Molecular epidemiological investigation of FIPV is not uncommon, but FIPV challenge models are lacking due to difficulty in isolation and culture. Evaluation of anti-feline coronavirus drugs at the animal level can only rely on extensive collection of clinical cases, greatly affecting animal experiment accuracy and precision. Wang et al established an FIP oral infection model by replacing the extracellular domain of FIPV type II S protein with that of FIPV type I through a reverse genetics system, and rescuing a recombinant FIPV strain (Wang et al 2021). However, the recombinant virus is essentially type II FIPV and does not fully reflect the vast majority (> 90%) of FIP cases of type I.

Through data query and information verification, there is no FIPV animal model I at present, mainly because of the lack of strains which can be used for attacking toxin and producing clinical symptoms. Therefore, a stable, reliable and near-naturally occurring FIP animal model I is needed to be applied to the research and development of FIPV related vaccines and medicaments, which has great scientific significance and application value for solving the problems existing in the prior art.

Disclosure of Invention

The invention aims to provide a cat infectious peritonitis virus type I strain which can cause animals to generate typical FIP symptoms and pathological changes, can be used for constructing a toxicity attack model and researching anti-FIPV related drugs or vaccines, and aims to solve the problem that the existing strain cannot construct a type I FIPV animal model.

To achieve the above object, the applicant has screened a feline coronavirus from FIP cats in a certain animal hospital in the flood mountain area of martial arts, and has found that the virus has the highest similarity with the currently reported FCoV type I by sequencing and aligning structural genes of the virus, thereby identifying that the virus belongs to serotype I feline infectious peritonitis virus. The virus was delivered to China center for type culture Collection (China) for 10:11 at 2022 with a accession number: CCTCC NO: V202297, classified and named as cat coronavirus (Feline Coronavirus) FCoV/WH/2022-1, preservation address: chinese armed chinese.

The applicant can perform intraperitoneal injection on ascites containing viruses to healthy experimental cats, find that animals generate obvious FIP symptoms and pathological changes, and can perform peritoneal fluid regression on more than 30 FCoV nucleic acid positive FIP cases which are collected to the experimental cats but cannot cause FIP to realize virus rejuvenation, so that the screened strains are initially proved to have different performances from the existing most strains in terms of causing the FIP symptoms. Next, the applicant aligned the strain S protein with the previously reported FCoV of multiple strains I, found that the highest similarity of the S protein sequence was only 92.70%, and that mutation occurred at multiple amino acid sites such as Phe5, arg13, glu33, gly65, lys79, arg128, tyr234, gln237, etc., which may be one of the causes of the above phenotypic differences.

The applicant prepares 5.275 copies/1 uL tissue virus liquid, and the experimental cat is subjected to intraperitoneal injection for virus attack after dilution by the doubling ratio to obtain half Lethal Dose (LD) of the virus strain ₅₀ ) 0.5275copies. The body temperature of the experimental cat after the toxicity attack is increased, the body weight is reduced, the blood lymphocyte is reduced, the serum amyloid level is increased to an obvious inflammatory level, the typical FIP symptoms are seen in the split inspection, a large amount of yellowish viscous effusion in the abdominal cavity, huang Baise nodules on the surface of the liver, uneven surface of the spleen, nodules on the mesentery and the intestinal wall are generated, and the FCoV N protein positive signals are detected in the pathological tissues and organs of the cat after the toxicity attack by immunohistochemical diagnosis. Thus far, the virus is used for successfully constructing a type I FIPV animal model, and symptoms and pathological features are the same as those of clinical FIP.

Finally, the applicant carries out drug screening experiments by using the constructed animal model, further verifies the reliability of the model, and can be used for evaluating the anti-cat coronavirus drugs.

The beneficial effects of the invention are as follows:

type I FCoV has poor resistance to external environment, is difficult to separate and subculture in vitro, and meanwhile, the receptor binding domain of the type I FCoV is easy to mutate and has unstable infectivity, so that the type I FCoV is difficult to infect animals to generate the same symptoms and pathological characteristics as clinical FIP. Aiming at the lack of a type I FIPV animal model and a strain for constructing the model in the prior art, the invention obtains a strain which can cause animals to generate typical FIP symptoms and pathological changes and can stably construct the type I FIPV animal model through a large number of test screening, and the strain has great scientific significance and application value in the research and development of FIPV related vaccines and medicaments.

Drawings

FIG. 1 is a diagram of the electrophoresis of specific bands for PCR detection of FCoV in ascites disease samples, wherein 1: negative control, 2:FCoV/WH/2022-1,M:2000bp DNAMarker;

FIG. 2 shows an S protein sequence alignment of FCoV/WH/2022-1 with 4 strain type I FCoV, the left side encoding as strain sequence accession number.

FIG. 3 is a plot of survival of experimental cats following challenge with different dilutions of FCoV/WH/2022-1 tissue toxin; 10 ⁰ 、10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 The virus copy number of the corresponding dilutions is 5275copies/mL, 527.5copies/mL, 52.75copies/mL, 5.275copies/mL, 0.5275copies/mL, 0.05275copies/mL, each dilution being injected intraperitoneally at 1mL for virus challenge. The Blank group was challenged with an equivalent amount of FCoV negative cat liver tissue homogenate supernatant.

FIG. 4 shows the body weight change of experimental cats following challenge with different dilutions of FCoV/WH/2022-1 tissue toxin relative to day 0.

FIG. 5 shows the body temperature change of experimental cats following challenge with different dilutions of FCoV/WH/2022-1 tissue toxin. The normothermic range for cats is 38.5 ℃ to 39.5 ℃.

FIG. 6 shows the change in blood lymphocyte numbers of cats with onset and asymptomatic cats before and after toxin challenge by FCoV/WH/2022-1 tissue, and the significant decrease in blood lymphocytes after toxin challenge. The normal range of the number of lymphocytes in cat blood is 1.50X10A 9/L to 7.00X10A 9/L.

FIG. 7 shows serum amyloid concentration changes in diseased cats and asymptomatic cats before and after FCoV/WH/2022-1 tissue toxin challenge, with serum amyloid concentration increase to significant inflammatory levels (> 40 mg/L) in cats after toxin challenge.

Fig. 8 is a photograph of a tissue toxicity attack experiment showing the pathological changes of peritoneal effusion, multi-organ nodules, and the like.

FIG. 9 shows HE sections of liver, spleen, mesenteric lymph nodes of cats dying of tissue toxin challenge experiments and the immunohistochemical antibody anti-FCoV-N Mab.

Fig. 10 is a change in body weight for drug evaluation using the present animal model, and the vertical dashed line indicates the start time of continuous administration, i.e., 2 days after the appearance of FIP symptoms.

Fig. 11 is a change in body temperature for drug evaluation using the present animal model, and the vertical dashed line indicates the start time of continuous administration, i.e., 2 days after the appearance of FIP symptoms.

FIG. 12 is a graph showing changes in serum amyloid concentration in cats assessed with the present animal model for drug administration, and experimental serum amyloid concentration levels in cats following isoquercitrin treatment were between the GS-441524 treated group and the Mock group; the serum amyloid concentration of cats decreased significantly after GS-441524 treatment, indicating a decrease in inflammatory levels (< 8 mg/L).

FIG. 13 is a graph showing the change in the number of lymphocytes in cat blood assessed with the present animal model for an experimental cat blood lymphocyte number after isoquercitrin treatment higher than that of the Mock group; the blood lymphocyte numbers of the experimental cats after the GS-441524 treatment were raised back to the normal level.

Detailed Description

The present invention will be described in detail with reference to specific examples.

Example 1FCoV/WH/2022-1 screening and identification

1. Experimental method

1. Collecting clinical wet FIP ascites of cat, centrifuging at 4deg.C and 8000rpm for 10min, sucking supernatant, filtering with 0.22 μm filter, sterilizing, and freezing in-80deg.C refrigerator.

2. Taking a small amount of ascites for RT-PCR detection of the cat coronavirus N gene, wherein the specific primer is N-F: TCTAACTCTCGTGGYCGG, N-R: CTCATCAATCATCTCAACCTGTG. If FCoV-N is detected, the key gene S is amplified continuously and sent to a biological company for sequencing.

2. Experimental results

1. A cat suspected of FIP disease was received at an animal hospital in the mountain area of Tongshan in Wuhan, the abdomen of the cat was obviously distended, about 100mL of ascites was withdrawn, and the nucleic acid of the cat coronavirus was detected in the ascites, and as a result, as shown in FIG. 1, a bright band was found at 1062bp, which was the same size as expected. This strain was designated FCoV/WH/2022-1.

2. The structural gene S sequence of FCoV/WH/2022-1 is shown as SEQ ID NO: 1. Through NCBI search comparison, the similarity with the type I FCoV reported at present is highest, namely FCoV/WH/2022-1 belongs to serotype I FCoV.

Example 2 rejuvenation of FCoV/WH/2022-1

1. Experimental method

1.5 mL of ascites in example 1 was thawed on ice, warmed to room temperature, and the abdominal cavity injection was returned to healthy 6 months old experimental cats, and after the common symptoms of FIP had died, the cats were examined for gross lesions.

2. Experimental results

1. In more than 30 FCoV nucleic acid positive FIP case ascites collected in the middle China, the animals return to the experimental animal cats and cannot cause FIP to realize virus rejuvenation. However, within days of the experimental cat entering FCoV/WH/2022-1 ascites, common FIP symptoms such as fever, weight loss, jaundice, abdominal distension and the like appear, and after-death section inspection also shows a large amount of yellowish viscous effusion of the abdominal cavity, huang Baise nodules on the liver surface, uneven spleen surface and nodules on the mesentery and intestinal walls.

2. The receptor binding domain of coronavirus is usually present in the S protein, and the highest similarity of the S protein sequence is only 92.70% when the S protein of FCoV/WH/2022-1 is compared with that of the previously reported multiple strain type I FCoV, and mutation occurs at a plurality of amino acid sites such as Phe5, arg13, glu33, gly65, lys79, arg128, tyr234, gln237 and the like, and the amino acid consistency of the region from Trp157 to Gly175 is lower, which is probably one of the reasons for the failure of the ascites in most FIP cases to rejuvenate as shown in FIG. 2.

Example 3 preparation of FCoV/WH/2022-1 tissue toxin

1. Experimental method

1. Taking out pathological tissues with stronger FCoV nucleic acid positive signals such as livers, spleens and the like through aseptic operation, adding aseptic PBS (phosphate buffer solution) in proportion for homogenization treatment, putting the homogenized tissues into a refrigerator at the temperature of-80 ℃, repeatedly freezing and thawing for 3 times, centrifuging at the temperature of 4 ℃ and at the speed of 8000rpm for 10min, taking a supernatant fluid of 0.22 mu M, filtering and sterilizing, split charging and storing in the refrigerator at the temperature of-80 ℃ to obtain FCoV/WH/2022-1 tissue toxic seed viruses.

2. Fluorescent quantitative PCR primers for FCoV/WH/2022-1S genes are designed to quantify the virus copy number of tissue virus stock. An upstream primer: CTGAAGATGCACCTCACGGT, downstream primer: CACGTGTATCCCATACGCCAT.

2. Experimental results

1. A total of 300mL of sterile, pathogen-free tissue virus stock was prepared in a ratio of 0.25g of diseased tissue to 1mL PBS.

2. Fluorescent quantitative PCR showed 5.275 FCoV/WH/2022-1 viral copies per 1uL of virus liquid. Delivering the virus liquid to China center for preservation with the preservation number: CCTCC No. V202297, date of preservation: 2022, 11 and 10.

Example 4 construction of FCoV/WH/2022-1 challenge model

1. Experimental method

1. Setting 6 groups of experimental animals, and carrying out next experiment after vein blood collection and detection of common FIP indexes (lymphocyte number and serum amyloid concentration of cat) before experiments on 4 experimental cats within 6 months of age.

2. Taking out a stock solution of tissue toxin in example 3, thawing on ice, diluting with 10 times of sterile PBS to obtain 10 ⁰ 、10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 Each dilution was challenged by intraperitoneal injection in an amount of 1mL, and the challenged dose was 5275copies, 527.5copies, 52.75copies, 5.275copies, 0.5275copies, 0.05275copies according to example 3. Another 4 cats were used as controls and 1mL FCoV negative cat liver tissue homogenate was tapped in the same manner. The body temperature and weight changes of each cat are monitored daily, and FIP common indexes are detected by blood sampling every week.

3. For cats with morbidity and mortality, pathological changes were observed by section examination, heart, liver, spleen, lung, kidney, mesenteric lymph nodes, brain, cerebellum were removed, and fixed in 4% paraformaldehyde solution for HE sectioning and immunohistochemical detection.

2. Experimental results

1、10 ⁰ 、10 ^-1 、10 ^-2 、10 ^-3 All the experimental animals with toxicity attack at dilution die, 10 ^-4 Half of the experimental animals with toxin-expelling dilution die, 10 ^-5 The experimental animals of the dilution challenge and control group do not have any symptoms, the survival curve is shown in figure 3, and the half-Lethal Dose (LD) of the tissue toxin is calculated ₅₀ ) 1mL 10 ^-4 Tissue toxin stock solution.

2. The body temperature of the ill experimental cat rises to above 39.5 ℃, the body weight is obviously reduced, and the body weight and the body temperature change of the experimental cat after different dilutions of toxin attack are shown in fig. 4 and 5. Blood lymphocytes of the diseased cats fall below the detection line, serum amyloid levels of the cats rise to obvious inflammatory levels, and FIP indexes before and after toxicity attack are shown in fig. 6 and 7.

3. The section inspection shows that the cat dying of illness can see typical FIP symptoms, a large amount of yellowish viscous effusion of abdominal cavity, huang Baise nodules on the surface of liver, uneven surface of spleen, nodules on mesentery and intestinal wall, and the section inspection picture is shown in figure 8.

4. Immunohistochemistry is the gold standard for FIP diagnosis. FCoV N protein positive signals were detected in diseased tissue organs of cats dying of disease, and pathological sections of diseased liver, spleen, mesenteric lymph nodes were as shown in fig. 9 and immunohistochemistry.

EXAMPLE 5FCoV/WH/2022-1 challenge model evaluation of drug efficacy

1. Experimental method

Isoquercitin (CAS: 21637-25-2) is a traditional Chinese medicine monomer compound with anti-inflammatory and enzyme-reducing effects, and a pre-drug screening test shows that the Isoquercitrin can relieve cytopathic effect (CPE) of FIPV 79-1146 on CRFK cat kidney cell lines, has anti-FCoV potential, and further uses the animal model to evaluate the effectiveness of the drug. GS-441524 is a known effective anti-feline coronavirus drug for the positive control of the test of this example. 100% minimum lethal dose (10 ^-3 Dilution), 4 groups of experimental animals were set, 4 per group. Isoquercitrin treatment group: treatment with isoquercitrin 2 days after onset of apparent symptoms at lethal doses (2.5 mg/kg/d, i.h.); GS-441524 treatment group: treatment with GS-441524 (2.5 mg/kg/d, i.h.) 2 days after onset of the apparent symptoms at the lethal dose; the Mock group did not undergo any treatment after the lethal dose was tapped; the Blank group challenged FCoV-negative cat liver tissue homogenate supernatants. FIP indexes such as fSAA concentration, lymphocyte number and the like before and after the experiment and body temperature and body weight changes are detected.

2. Experimental results

The GS-441524 treatment group had fever symptoms disappeared one day after administration, the body temperature was lowered to the normal range, the administration was continued for about 3 days, the body weight began to rise back as shown in fig. 10 and 11, and the fSAA concentration and lymphocyte number returned to the normal range after administration for 7 days as shown in fig. 12 and 13. The isoquercitrin-treated group had elevated body temperature but lower body weight loss rate than the Mock group, and the fSAA concentration was lower after 7 days of administration than the Mock group. Animals in Mock and Blank were similar to example 4, but the level of inflammation following administration of isoquercitrin was slightly lower in the isoquercitrin-treated group than in the Mock group. The results show that the toxicity attack model can be used for evaluating anti-cat coronavirus medicines, and isoquercitrin can relieve FIP related symptoms and has a certain curative effect on FIP on animal level.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. Cat coronavirus, classified and named as Cat coronavirus (Feline Coronavirus) FCoV/WH/2022-1, is deposited in China center for type culture Collection, and has the deposit number: CCTCC NO. V202297, which is a serotype I feline infectious peritonitis virus (Feline Infectious Peritonitis Virus).

2. The feline coronavirus of claim 1 having an S gene nucleotide sequence set forth in SEQ ID NO: 1.

3. Use of the virus of claim 1 for the preparation of a feline coronavirus drug screening model.

4. The preparation method of the cat coronavirus drug screening model is characterized by comprising the following steps:

(1) Preparing a tissue virus stock comprising the virus of claim 1;

(2) Diluting the tissue poison stock solution, and carrying out poison attack on the experimental cats by using 100% of the minimum lethal dose;

(3) Observing the weight and body temperature change of the experimental cat; detecting blood lymphocytes and serum amyloid; the pathology and immunohistochemical analysis were performed by section examination.

5. The method for preparing the feline coronavirus drug screening model according to claim 4, wherein: the 100% minimum lethal dose is 5.275copies.

6. The method for preparing the feline coronavirus drug screening model according to claim 4, wherein: the toxicity counteracting method is intraperitoneal injection.

7. The method for preparing the feline coronavirus drug screening model according to claim 4, wherein: the experimental cats were 6 months of age.

8. Application of isoquercitrin in preparing medicines for resisting cat coronavirus is provided.