WO2002066682A2

WO2002066682A2 - Rat toxicologically relevant genes and uses thereof

Info

Publication number: WO2002066682A2
Application number: PCT/US2002/002935
Authority: WO
Inventors: Georgia Farris; Samuel H. Hicken; Spencer B. Farr
Original assignee: Phase-1 Molecular Toxicology, Inc.
Priority date: 2001-01-29
Filing date: 2002-01-29
Publication date: 2002-08-29
Also published as: CA2440008A1; AU2002258387A1; JP2004535776A; WO2002066682A3; EP1368499A2

Abstract

The invention provides a set of toxicologically relevant rat genes which useful for determining toxicological responses.

Description

RAT TOXICOLOGICALLY RELEVANT GENES AND USES THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to provisional U.S. Serial No. 60/264,933 and 60/308,161, filed January 29, 2001 and July 26, 2001, respectively, both of which are hereby incorporated by reference herein.

TECHNICAL FIELD This invention is in the field of toxicology. More specifically, the invention provides a set of rat genes useful for determining toxicological responses to various agents.

BACKGROUND OF THE INVENTION Every year, many new drugs and chemical compounds are discovered, produced, and introduced into the public domain. Guidelines set forth by the U.S.

Food and Drug Administration (FDA) require toxicity studies to be conducted before a new drug or compound can be approved for human consumption or use. Toxicological studies are an important part of drug development but toxicity studies traditionally have required long periods of clinical trials, using both animal models and humans, and are quite often very expensive to conduct. A two year toxicity study in rats can cost approximately $800,000. See, for example, Casarett and Doull's Toxicology, 4th Edition, M.O. Amdur et al., eds. Pergamon Press, New York, N.Y. p. 37 (1991). Further, traditional toxicology studies are no longer sufficient to assess toxicity of a drug or compound because there are too many compounds derived from high throughput screening of combinatorial chemical libraries. In addition, traditional toxicological methods have offered little insight into molecular mechanisms of toxicity, which makes extrapolation of toxicity results from animal models to humans difficult.

Furthermore, traditional toxicity methods often result in numerous failures in subsequent stages of development and post-launching of the drug.

In recent years, a new field of toxicogenetics has emerged whereby toxicological responses to drugs or compound are studied at a molecular level, e.g., differential gene expression. One major focus of toxicogenetics is the study of differential gene expression induced as an response to chemical or environmental stress. One major goal of most applied toxicology studies is to identify the organ or organs, system, or systems that are damaged by exposure to a drug or other environmental agent. Examples of some major toxic target organs include but are not limited to the liver, kidney, pancreas, heart, lung, brain, fhymus, and hypothalamus. Examples of major toxic target systems include but are not limited to the immune, nervous, digestive and circulatory systems. By studying patterns of gene expression, toxicologists can learn a great deal about the fundamental mechanisms of chemical toxicity. Further, measurement of gene expression may allow us to identify threshold concentrations, below which, there is little health risk. Some methods and kits for determining toxicity have been reported. See, for example, WO 00/47761, U.S. Patent Nos. 5,585,232; 5,589,337; and 5,811,231; and pending U.S. provisional patent applications 60/220,057 and 60/254,232. However, toxicogenetics allows for a better understanding of mechanisms of organ and system toxicity and facilitate prediction of deleterious outcomes prior to their detection by more laborious and time-consuming means. If toxicity manifested at the organism level is preceded by altered expression of related genes, then detection of altered gene expression may serve as an early warning for subsequent deleterious outcomes. Altered gene expression may precede organ or system outcomes by weeks, months or even years. To the extent that a causal relationship can be demonstrated between early alterations in gene expression and delayed manifestations of toxicity, measuring the alterations in gene expression may reduce reliance on the observing delayed manifestations of toxicity. Better understanding of molecular mechanisms through toxicogenetics may also improve the predictive accuracy of animal models to humans, and in vitro systems to in vivo settings. A molecular approach to toxicology could save time, money and animal resources.

With the advent of molecular and recombinant technology, genetic and molecular analysis provides another method by which toxicity may be measured. Differential gene expression technology involves detecting the change in gene expression of cells exposed to various stimuli. The stimulus can be in the form of growth factors, receptor-ligand binding, transcription factors, or exogenous factors such as drugs, chemicals, or pharmaceutical compounds.

Several methods have been reported for detecting differential gene expression. One method is to use an array of polynucleotides which includes, for example, genes for which full-length cDNAs have been accurately sequenced and genes which may be defined by high-throughput, single-pass sequencing of random cDNA clones to generate expressed sequence tags (ESTs). Researchers focused on detecting changes in expression of individual mRNAs can use different methods to detect changes in gene expression, e.g., microarray, gel electrophoresis, etc. Other methods have focused on using the polymerase chain reaction (PCR) and/or reverse transcriptase polymerase chain reaction (RT-PCR) to define tags and to attempt to detect differentially expressed genes. Many groups have used PCR methods to establish databases of mRNA sequence tags which could conceivably be used to compare gene expression among different tissues (Williams, J. G. K., Nucl. Acids Res. 18:6531, 1990; Welsh, J., et al. Nucl. Acids Res., 18:7213, 1990; Woodward, S. R., Mamm. Genome, 3:73, 1992; Nadeau, J. H.,

Mamm. Genome 3:55, 1992). This method has also been adapted to compare mRNA populations in a process called mRNA differential display.

The process of isolating mRNA from cells or tissues exposed to a stimulus, e.g., drugs or chemicals, and analyzing the expression with gel electrophoresis can be laborious and tedious. To that end, microarray technology provides a faster and more efficient method of detecting differential gene expression. Differential gene expression analysis by microarrays involves nucleotides immobilized on a substrate whereby nucleotides from cells which have been exposed to a stimulus can be contacted with the immobilized nucleotides to generate a hybridization pattern. This microarray technology has been used for detecting secretion and membrane-associated gene products, collecting pharmacological information about cancer, stage specific gene expression in Plasmodium falciparum malaria, translation products in eukaryotes, and a number of other scientific inquiries. See, for example, Diehn M, et al. Nat Genet. 25(1): 58-62 (1993); Scherf, U., et al. Nat Genet. 24(3): 236-44 (1993); Hayward R.E., et al. MolMicrobiol 35(1): 6-14 (1993); Johannes G., et al. Proc Natl Acad Sci USA 96(23): 13118-23 (1993). Microarray technology has also been used in exploring drug- induced alterations in gene expression in Mycobacterium tuberculosis. See, for example, Wilson M., et al. Proc Natl Acad Sci. 96(22): 12833-8 (1999).

There exists a need for methods that are fast, efficient, cost-effective, capable of generating large amounts of toxicology data, and could spare many animals from being the subjects of laboratory tests. There also exist a need for a method of effectively selecting genes which are toxicologically relevant to agents being tested and can predict toxicity on a cellular, organ, or system level. There also exists a need for a toxicological database of information whereby one can obtain information about one or more agents being tested and how that agent(s) affects a particular organ or system and algorithms which may be used to identify toxicologically relevant genes and correlate toxicity between agents and target genes. Molecular toxicology analysis or toxicogenetics can provide a vast amount of information in the form of a database from a collection of toxicological response data that would be useful in toxicological analysis. The invention and its embodiments provided herein fulfill the aforementioned needs. The disclosure of all patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety.

SUMMARY OF THE INVENTION The invention provides toxic response genes and uses thereof. In one aspect, the invention provides a method of evaluating the toxicity of an agent by (a) exposing a test animal to the agent; (b) measuring the expression of one or more toxic response genes selected from the genes corresponding to the partial gene sequences in Tables 6, 7, 8, 9, and 10 in the test animal in response to the agent, thereby generating a test expression profile; and (c) comparing the test expression profile with a reference expression profile indicative of toxicity, wherein toxicity of the agent is evaluated by determining whether a significant correlation exists between the test expression profile and the reference expression profile. In one embodiment, the group of genes corresponding to the partial gene sequences is responsive in kidney, liver, spleen, heart, lung, testis, or brain. In other embodiments, the test animal is a rat, dog, non-human primate, or a human. In other embodiments, the agent is administered at various dosages or for various lengths of time. In another aspect, the invention provides a method of evaluating the toxicity of an agent by (a) exposing a test animal to the agent; (b) measuring the expression of one or more toxic response genes selected from the genes corresponding to the partial gene sequences in Tables 6, 7, and 8 in the test animal in response to the agent, thereby generating a test expression profile; and (c) comparing the test expression profile with a reference expression profile indicative of toxicity, wherein toxicity of the agent is evaluated by determining whether a significant correlation exists between the test expression profile and the reference expression profile. In one embodiment, the group of genes corresponding to the partial gene sequences is responsive in kidney, liver, spleen, heart, lung, testis, or brain. In other embodiments, the test animal is a rat, dog, non-human primate, or a human. In other embodiments, the agent is administered at various dosages or for various lengths of time.

In another aspect, the invention provides a method of evaluating the toxicity of a agent by (a) exposing a test animal to the agent; (b) measuring the expression of one or more toxic response genes selected from the genes corresponding to the partial gene sequences in Table 4 in the test animal in response to the agent, thereby generating a test expression profile; and (c) comparing the test expression profile with a reference expression profile indicative of toxicity, wherein toxicity of the agent is evaluated by determining whether a significant correlation exists between the test expression profile and the reference expression profile. In one embodiment, the set of toxicologically relevant genes consists of at least 25 genes. In another embodiment, the set of toxicologically relevant genes consists of at least 50 genes. In another embodiment, the set of toxicologically relevant genes consists of at least 100 genes.

In another aspect, the invention provides an array which includes one or more polynucleotides selected from the genes corresponding to the partial gene sequences in Tables 6, 7, 8, 9, and 10 or fragments of at least 20 nucleotides thereof. In one embodiment, the group of genes corresponding to the partial gene sequences is responsive in kidney, liver, spleen, heart, lung, testis, or brain.

In another aspect, the invention provides an array which includes one or more polynucleotides selected from the genes corresponding to the partial gene sequences in Tables 6, 7, and 8 or fragments of at least 20 nucleotides thereof. In one embodiment, the group of genes corresponding to the partial gene sequences is responsive in kidney, liver, spleen, heart, lung, testis, or brain.

In another aspect, the invention provides an array which includes one or more polynucleotides selected from the group consisting of the genes corresponding to the partial gene sequences in Table 4 or fragments of at least 20 nucleotides thereof. In one embodiment, the set of toxic response genes consists of at least 25 genes. In another embodiment, the set of toxic response genes consists of at least 50 genes. In another embodiment, the set of toxic response genes consists of at least 100 genes.

In another aspect, the invention provides an array which includes a set of polynucleotides of at least 20 nucleotides in length substantially homologous to a set of toxic response genes selected from the genes corresponding to the partial gene sequences in Tables 6, 7, and 8.

In another aspect, the invention provides an array which includes one or more polynucleotides which are homologous to the polynucleotides contained in the array which includes one or more polynucleotides selected from the genes corresponding to the partial gene sequences in Tables 6, 7, and 8 or fragments of at least 20 nucleotides thereof. In one embodiment, the polynucleotides correspond to human, murine, non- human primate, or canine genes.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 depicts the consistency of differential gene response in two microarrays spotted with 700 rat genes listed in Table 4. The slides were hybridized with cDNA preparations from the liver of a rat exposed to aflatoxin at 1 mg/kg for 72 hours as a differential expression compared with cDNA preparations from appropriate control rats hybridized on the slide at the same time. For each of the 9 genes shown one bar is from one microarray and the second bar is data from a second microarray.

Figure 2 depicts the similar differential gene expression response in two different organs from two rats given the same treatment of lipopolysaccharide (LPS)- treated rats at 6 hours post-exposure. The data shown is liver data from two rats (the first and second bars for each gene) and kidney data from two rats (the third and forth bar for each gene). For two of the five genes shown, the differential expression was increased in the kidney more than in the liver and for three of the genes shown the differential expression was increased in the liver more than at in the kidney. Figure 3 depicts the progression of toxicity-induced differential gene expression in rat liver over time. Rats were treated with lipopolysaccharide (8 mg/kg) by a single intraperitoneal injection. The data shown is from two rats sacrificed at 6 hours (the first and second bars for each gene), 2 rats at 24 hours (the third and forth bar for each gene), and 2 rats at 72 hours (the fifth and sixth bar for each gene). For the five genes shown, the differential expression was greater at- 6 hours than at 24 hours in the liver and there is very little differential expression by 72 hours. Figure 4 depicts the progression of toxicity-induced differential gene expression in rat heart over time. Rats were treated with lipopolysaccharide (8 mg/kg) by a single intraperitoneal injection. The data shown is from 2 rats sacrificed at 6 hours (the first and second bars for each gene), 2 rats at 24 hours (the third and forth bar for each gene), and 2 rats at 72 hours (the fifth and sixth bar for each gene). For the thirteen genes shown, the differential expression was greater at 6 hours than at 24 hours in the heart and there is very little differential expression by 72 hours.

Figure 5 depicts a correlation of erythromycin estolate-treated liver with tetracycline-treated liver in rats treated in vivo with these agents. The white squares delineate the area with the most correlation between experiments. There was high correlation between the experiments where the rats were dosed with erythromycin estolate (white squares) and high correlation between the experiments where the rats were dosed with tetracyclin. The correlation of the experiments of one compound with the other compound was not very high (dark gray and boxes) showing that the 700 genes expressed in the liver of rats exposed to these two toxins were different. This is expected since erythromycin and tetracycline have different mechanisms of liver toxicity.

Figure 6 depicts a correlation matrix of four mechanistic classes of toxic compounds. The gene expression data from a rat CT array tested in rat liver was identified by successive pairwise gene identification. The areas of white boxes signify higher correlations. The abbreviations are as follows: PAH: Polyaromatic Hydrocarbons, TCDD, Benzo(a)pyrene, Dimethylbenzanthracene; PP: Peroxisome Proliferators, Gemfibrozil, Diethylhexyl phthalate, Wy 14,643; CS: Corticosteroids, Prednisone, Triamcinolone; NM: Nitrogen Mustards, Mechlorethamine, Cyclophosphamide, Melphalan, Chlorambucil. > Figure 7 depicts the very similar response of the gene cytochrome P450 1 A2 using the microarray platform (O symbols and dashed line) and the the TacMan real time PCR platform (□ symbols and solid lines).

Figure 8 depicts the very similar response of the gene fatty acid synthase using the microarray platform (O symbols and dashed line) and the TacMan real time PCR 0 platform (D symbols and solid lines).

Figure 9 depicts the very similar response of the gene multidrug resistant protein- 1 using the microarray platform (O symbols and dashed line) and the the TacMan real time PCR platform (D symbols and solid lines).

5 BRIEF DESCRIPTION OF THE TABLES

Table 1 is a list of pharmaceutical agents which can potentially cause greatly heightened toxic responses in some individuals.

Table 2 is a list of industrial agents which can potentially cause greatly heightened toxic responses in some individuals. !0 Table 3 is a list of the drugs and chemicals used to generate the data shown in tables 7, 8, 9, and 10. These compounds were selected for their ability to induce the following pathologies: liver degeneration/necrosis, hepatocyte hypertrophy, hepatocyte vacuoles, renal tubular degeneration/necrosis, renal glomerular necrosis, myocardial degeneration, myocardial inflammation, splenic lymphoid depletion / apoptosis, splenic lymphoid hyperplasia, neurotoxicity, skeletal muscle degeneration and inflammation, multiple tissue necrosis and inflammation, repair, including proliferation.

Table 4 is a list of the 700 rat genes and/or gene sequences that have been determined to be toxic response genes.

The table is split into three sections. The first section lists the genes discovered using empirical data from the 17,241 gene set which matched a known complete rat gene when the genes were searched in the GenBank database. The second section lists the genes discovered using empirical data from the 17,241 gene set which did not match a known complete rat gene when the genes were searched in the NCBI GenBank database. These genes are listed in numerical order by Phase- 1 RCT number. The clones for the genes in the first and second section use the pT7T3D-PAC vector. The gene sequences in this table may include a small portion of vector in the sequence.

Portions of the following vector sequence are what may be included in the sequence listed in Table 4 and should not be included when referring the gene or gene sequence itself. Sequences using Ml 3 reverse primer include: TAATACGACTCACTATAGGGAATTTGGCCCTCGAGGCCAAGAATTC (SEQ ID NO: 701) which can be followed by an insert which can also be followed by

GCGGCCGCAAGCTTATTCCCTTTAGTGAGGGTTAAT (SEQ ID NO: 702). The sequences of the reverse complement are as follows:

ATTAACCCTCACTAAAGGGAATAAGCTTGCGGCCGC (SEQ ID NO: 703) which can be followed by an insert which can also be followed by

GAATTCTTGGCCTCGAGGGCCAAATTCCCTATAGTGAGTCGTATTA (SEQ ID NO: 704).

The third set of genes in this table refer to the genes chosen on the basis of their possible role in critical cellular pathways and empirical data toxicity responsiveness.

The clones for this third set of genes used the pCRII-TOPO vector. The gene sequences in this Table 4 may include a small portion of vector in the sequence. Portions of the following vector sequence are what may be included in the sequence listed in Table 4 and should not be included when referring to the gene or gene sequence itself.

Sequences using T7 promoter as primer include: ATATCTGCAGAATTCGCCCTT

(SEQ ID NO: 705) followed by an insert which can then be followed by

AAGGGCGAATTCCAGCACACT (SEQ ID NO: 706). The sequences of the reverse complements include: AGTGTGCTGGAATTCGCCCTT (SEQ ID NO: 707) which can be followed by an insert which can also be followed by

AAGGGCGAATTCTGCAGATAT (SEQ ID NO: 708). The genes designated "Phase-

1 RCT" are further detailed in Table 5.

Table 5 is a list of the Phase- 1 RCT genes and their homology with known genes (rat, mouse, human) identified by a BLAST search in NCBI GenBank. The phrase 'no significant homology found to a known complete gene' indicates that the BLAST search did not reveal significant (>97%) homology to any known complete gene.

Table 6 is a list of the genes discovered by testing of 17,241 genes on a 17,241 gene microarray and the response data that provided the basis for choosing each gene. These 400 genes were selected after a first filtering of all gene data for acceptable fold induction values (>2), coefficient of variance (CON, <30), and fluorescent value (fluor, >400) then ranking the genes that met these criteria by the number of experiments in which the gene responded, COV between duplicate slides, and fold induction. The name of the gene is followed by the list of compounds that induced an acceptable response (passed the filters) and the specifics of the tissue evaluated, the dose of the drug or chemical, and the timepoint that the animal was sacrificed after intraperitoneal injection of the compound.

Table 7 is a list which shows the tissue specific response of the toxicology genes chosen empirically from the 17,241 gene set. The data evaluated for. this tissue response was obtained by dosing rats with the compounds listed in Table 3 and then determining the differential gene expression to compile a database with approximately 2500 experiments (i.e., data from one microarray). The tissue response is greater than 2 fold in 1% of the experiments for the specific tissue for liver and kidney and greater than 2 fold in 2% of the experiments for the specific tissue for heart, lung, spleen, testis, and brain. This table is organized by data for each gene. Table 8 is a list which shows tissue specific response of the toxicology genes in Table 7 with organization by tissue.

Table 9 is a list which shows the tissue specific response of the toxicology genes chosen by description of their role in critical cellular pathways. The data evaluated for this tissue response was obtained by dosing rats with the compounds listed in Table 3 and determining the differential gene expression to compile a database with approximately 2500 experiments. The tissue response is greater than 2 fold in 1% of the experiments for the specific tissue for liver and kidney and greater than 2 fold in 2% of the experiments for the specific tissue for heart, lung, spleen, testis, and brain. This table is organized by data for each gene.

Table 10 is a list which shows tissue specific response of the toxicology genes in Table 9 with organization by tissue.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a set of toxicologically relevant rat genes which can be used to evaluate a toxic response to drugs, chemicals, and/or compounds.

I. General Techniques

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al, 1989) and Molecular Cloning: A Laboratory Manual, third edition (Sambrook and Russel, 2001), (jointly refeπed to herein as "Sambrook"); Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987, including supplements through 2001); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, and Harlow and Lane (1999) Using Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (jointly referred to herein as "Harlow and Lane"), Beaucage et al. eds., Current Protocols in Nucleic

Acid Chemistry John Wiley & Sons, Inc., New York, 2000).

II. Definitions

"Toxicity", as used herein, refers to the exaggerated microscopic or macroscopic responses of cells, tissues, organs or systems to low or average doses of an agent.

These responses may lead to observable symptoms such as dizziness or nausea and can also result in toxic outcomes. Toxicity often results in toxic side effects that are different, in either degree or kind, from the response of the majority of individuals at the recommended dose. "Frank toxicity" refers to toxicity in which macroscopic responses can be observed. Examples of frank toxicity responses include but are not limited to clinical observations, serum chemistry values, hematology values, urinalysis values, histopathology results, or gross appearance of the tissues and organs at necropsy.

A "toxicological response" refers to a cellular, tissue, organ or system level response to exposure to an agent and includes, but is not limited to, the differential expression of genes and/or proteins encompassing both the up- and down-regulation of such genes; the up- or down-regulation of genes which encode proteins associated with the repair or regulation of cell damage; or the regulation of genes which respond to the presence of an agent.

The terms "toxicity gene(s)", "toxicologically relevant gene(s)", and "toxic response gene(s)" as used herein are interchangeable. These terms can be defined as a gene whose message or protein level is altered by adverse stimuli. The specific set of genes that cells induce is dependent upon, inter alia, the type of damage or toxic threat caused by the agent and which organs are the most threatened.

"Gene expression indicative of toxicological response" as used herein refers to the relative levels of expression of a toxicity gene or toxic response gene. Profiles of gene expression profiles may be measured in a sample, such as samples comprising a variety of cell types, different tissues, different organs, or fluids (e.g., blood, urine, spinal fluid or serum). These profiles can include "test expression profile" and "reference expression profile". "Substantially homologous" or "substantially identical" refers to sequence homology wherein at least 70%, preferably at least 80%, preferably at least 85%, and more preferably at least 90% nucleotide or amino acid residue identity, when compared

and aligned for maximum correspondence, as measured using one of the following

sequence comparison algorithms or by visual inspection. Two sequences (amino acid

or nucleotide) can be compared over their full-length (e.g., the length of the shorter of

the two, if they are of substantially different lengths). For sequence comparison,

typically one sequence acts as a reference sequence, to which test sequences are

compared. When using a sequence comparison algorithm, test and reference sequences

are input into a computer, subsequence coordinates are designated, if necessary, and

sequence algorithm program parameters are designated. The sequence comparison

algorithm then calculates the percent sequence identity for the test sequence(s) relative

to the reference sequence, based on the designated program parameters. Optimal

alignment of sequences for comparison can be conducted, e.g., by the local homology

algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology

alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the

search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444

(1988), by computerized implementations of these algorithms (GAP, BESTFIT,

FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics

Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally

Ausubel et al., Current Protocols In Molecular Biology, Greene Publishing and Wiley-

Interscience, New York, supra). When using any of the aforementioned algorithms, the

default parameters for Window length, gap penalty, etc., are used. A further indication that two nucleic acid sequences or polypeptides are substantially identical is that the first polypeptide (e.g., a polypeptide encoded by the first nucleic acid) is immunologically cross reactive with the second polypeptide (e.g., a polypeptide encoded by the second nucleic acid). Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.

As used herein, the term "gene" refers to polynucleotide sequences which encode protein products and encompass RNA, mRNA, cDNA, single stranded DNA, double stranded DNA, complement strands, and fragments thereof. Genes can include introns and exons.

The term "gene sequence(s)" refers to gene(s), full-length genes or any portion thereof.

As used herein, "array" and "microarray" are interchangeable and refer to an arrangement of a collection of nucleotide sequences in a centralized location. Arrays can be on a solid substrate, such as a glass slide, or on a semi-solid substrate, such as nitrocellulose membrane. The nucleotide sequences can be DNA, RNA, any permutations thereof, and include nucleotide analogs. The nucleotide sequences can also be partial sequences from a gene, primers, whole gene sequences, non-coding sequences, coding sequences, published sequences, known sequences, or novel sequences. An "agent" to which an individual can exhibit a toxicological response can include, for example, drugs, pharmaceutical compounds, household chemicals, industrial chemicals, environmental chemicals, and other chemicals and compounds to which individuals may be exposed. Exposure to an agent can constitute physical contact as well as secondary contact, such as inhalation and environmental exposure.

"Differential expression" as used herein refers to the change in expression levels of genes, and/or proteins encoded by said genes, in cells, tissues, organs or systems upon exposure to an agent. As used herein, differential gene expression includes differential transcription and translation, as well as message stabilization. Differential gene expression encompasses both up- and down-regulation of gene expression.

The term "rat" refers to a mammal from the Rattus genus which can include any one of numerous rodents (Rattus and related genera) differing from related mice by considerably larger size and by structural details (e.g., size of teeth). Rats strains which may be used include but are not limited to Sprague-Dawley, Wistar, and Fisher. The term "sample" as used herein refers to substances supplied by an individual.

The samples may comprise cells, tissue, parts of tissues, organs, parts of organs, or fluids (e.g., blood, urine or serum). Samples are characterized in a preferred embodiment by comprising at least two different genes and may also include genes from multiple cell types. Samples include, but are not limited to, those of eukaryotic, mammalian or human origin. The terms "protein", "polypeptide", and "peptide" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non- amino acids. It also may be modified naturally or by intervention; for example, disulfide bond formation, glycosylation, myristylation, acetylation, alkylation, phosphorylation or dephosphorylation. Also included within the definition are polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids) as well as other modifications known in the art.

As used herein, the term "significant correlation" has the normal meaning in the art and means that the probability of the observed difference (or in the case of "similar" measurements, the probability of a observed absence of difference) occurring by chance (the p-value) is less than some predetermined level, i.e., a p-value that is <0.05, preferably <0.01 and more preferably <0.001. A variety of suitable statistical methods are well known to those of skill can be used to measure statistical significance (e.g., standard statistical methods such as Student t-tests {for comparing two samples},

ANOVA {analysis of variance}, and confidence interval analysis; software such as the SAS System Version 8 (SAS Institute Inc., Gary, NC, USA) can be used for analysis).

An "individual" is a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, sport animals, pets, primates, mice and rats. III. Identifying a set of toxicologically relevant genes

Identification of a set of toxicologically relevant genes can be achieved by several methods. One method which can be used is to clone genes previously described to be potentially relevant in toxicology. Using published sequences, for example in literature or from GenBank, primers can be made and then used to PCR amplify from a relevant library to obtain the candidate toxicologically relevant gene of interest which can then be cloned into a plasmid or an expression vector, depending on the use desired. The gene sequence (full or partial) can be placed amongst other toxicologically relevant genes in a microarray for high-throughput testing, as disclosed infra. Alternatively, for replication to high copy numbers, a plasmid may be used to grow high copies of the candidate toxicologically relevant gene of interest which can then be purified by any commercially available kit (e.g., from Qiagen or Promega). The purified candidate toxicologically relevant gene may be used for "spotting" in a microarray or alternatively, the purified nucleic acid can then be inserted into an expression vector, transfected into mammalian cells, e.g., rat cells, and then the cells can be exposed to a compound and observed for toxicological responses. Frank toxicity may be ascertained by_, observing changes in cell morphology or re-arrangement of cytoskeleton, which can be determined by examination under a microscope, or alternatively, cell apoptosis or necrosis. In another alternative, "transcriptome profiling", described in greater detail below, may be used whereby nucleic acid can be isolated from both the exposed and unexposed cells and examined to determine which level of the compound causes the up-regulation or down-regulation of the toxicologically relevant gene of interest.

Another method which can be used to identify a set of toxicologically relevant genes is to test available rat genes, of which there are approximately 17,421 known rat genes, for the genes' response using tissues from rat toxicity studies and select those with differential expression. Differential expression may be assessed by any number of methods. One method which may be used is by microarray analysis. Provided herein are methods of using microarray analysis to determine differential gene expression. Another method of determining differential gene expression is by reverse transcriptase- polymerase chain reaction (RT-PCR), e.g., Taqman® technology. Provided herein are methods of using Taqman® technology. Yet another method which could be used to detect differential gene expression is Invader® technology, commercially available from Third Wave. Yet another method which may be used to determine differential expression is Northern blot analysis. Other methods which may be used include AFLP and SAGE (Klein, P.E., et al. Genome Res. 10(6):789-807 (2000); Wang, X. and

Feuerstein, G.Z., Cardiovasc Re5.35(3):414-21 (1997)) Feuerstein, G.Z. and Wang X. Can J. Physiol Pharmacol. 75(6):731-4 (1997); Hough, CD. et al., Cancer Res. 60(22):6281-7 (2000); Ye, S.Q., et al., Anal Biochem. 287(l):144-52 (2000)).

One method which can be used to identify a set of toxicologically relevant genes is to use an "open system" to compare gene expression profiles from control rats and rats treated with an agent to select responsive genes. Alternatively, comparisons between gene expression profiles from control rat cells (or rat cell lines) and rat cells (or rat cell lines) treated with an agent can be used to select responsive genes. This is referred to herein as "transcriptome profiling". This method empirically determines which genes are toxicologically relevant by analyzing differential gene expression. In one embodiment, experimental rats are divided into two groups. One group is exposed to one or more agent(s) at different concentrations for different lengths of time. Another group of rats is not exposed to any agent and serves as the control group. Rats are then sacrificed and organs such as liver, spleen, kidney, testes, heart, lung, and thymus are harvested for cells to perform molecular analysis of gene expression. In addition, analysis of serum proteins in the circulating blood can provide another measure to compare with unexposed rats.

Once the experimental group is exposed to at least one agent, then RNA of both groups is isolated and reverse transcribed in PCR reactions to generate cDNA which in turn is amplified to generate double stranded DNA. The PCR is performed in the presence of a radioactive DNA substrate that is incorporated into the double stranded

DNA. On a polyacrylamide gel, the DNA derived from the treated cells is separated by length next to the DNA derived from untreated population. The intensity of the resulting band or bands is compared between the treated and untreated groups of cells. Bands that show different radioactive intensity are excised from the gel, amplified by PCR, cloned, and sequenced. The sequences are compared with known gene sequences in the public databases such as GenBank. In this manner, novel rat genes, in addition to known rat genes with varying degrees of similarity, which are toxicologically relevant are discovered and identified. The examples disclosed herein illustrates how this aspect of the invention may be practiced by the skilled artisan.

If a partial sequence of a rat gene which has no match to any publicly available gene sequence databases is discovered, the technology, texts (see Sambrook et al. infra), and resources available to a skilled artisan would enable the sequencing of the of remainder of the gene and obtain a full-length gene without undue experimentation. In one embodiment, a full-length gene is obtained by using the portion of the rat gene sequence which is known to make primers and then use the primers in combination with random primers in PCR reactions with a rat cDNA library. The PCR reaction are run on a standard agarose gel and amplified bands are identified, excised from the gel, and sequenced.

Each of these methods is disclosed in greater detail below. Other factors to consider in identifying toxicologically relevant genes include, but are not limited to, selection of one or more agent(s), the dosage amount to administer, and routes of administration.

IV. Selection of agent(s)

The agent to be tested can selected on the basis of different criteria. In one aspect, the basis of a compound to test is damage observed in specific organs. In one embodiment, cisplatin, amphotericin B and gentamicin are selected because they have been observed to cause kidney tubular epithelial cell damage. In another embodiment, clofibrate, gemfibrozil, and WY 14643 are selected because liver peroxisome proliferation has been observed to be affected by clofibrate, gemfibrozil, and WY 14643. h another aspect, a basis for selection is function. For example, cisplatin causes apoptosis and reactive oxygen species, amphotericin B causes increased permeability of cell membranes to ions and renal vasoconstriction, and gentamicin causes phospholipid accumulation in lysosomes.

Other toxicants affect an organ in general, for example, some kidney toxicants include but are not limited to cisplatin, gentamicin, puromycin, and amphotericin B. Liver toxicant include but are not limited to chlorpromazine, clofibrate, diflunisal, tetracycline, erythromycin, and ethanol. Immunotoxicants include but are not limited to cyclosporin A, lipopolysaccharide (LPS), hydroxyurea, phenylhydrazine, dexamethasone, estradiol, and tamoxifen. Heart toxicant includes but is not limited to doxorubicin. Multiorgan toxicants include but are not limited to methotrexate and cadmium chloride.

Other criteria for selecting an agent to tested is to select those agents to which an individual might be exposed to on a regular basis, either in the environment, by prescription or over-the-counter drug. Another criteria by which an agents is to be tested are those agents which are required to tested for toxicity for FDA-approval or alternatively for other toxicity requirements, for example in pre-clinical or clinical trials. Tables 1 and 2 list some agents which may be selected given the criteria above. V. Determination of dosage

Dosages of agents to use in rat experiments can be determined using several methods. In one aspect, reported dosages are used as a starting point and dose incrementally above and below the reported dosage. Increments can be at least about

±1%, 5%, 10%, 25%, 35%, 45%, 50%, 60%, 70%, 80%, 90%, or 95%. Upregulation or downregulation of markers in the blood including but not limited to: serum chemistry

values and hematology values can be used to determine if toxicity has been reached. In another aspect, examining the histopathology of organs, in particular, organs which are the specific targets of the compound of interest, may be used to determine if a

pathological change has occurred in response to administration of the compound. In

one embodiment, pathological changes include liver degeneration/necrosis, hepatocyte hypertrophy, hepatocyte vacuoles, renal tubular degeneration/necrosis, renal glomerular necrosis, myocardial degeneration, myocardial inflammation, splenic lymphoid depletion / apoptosis, splenic lymphoid hyperplasia, neurotoxicity, skeletal muscle degeneration and inflammation, multiple tissue necrosis and inflammation, repair, including proliferation. In one embodiment, In another aspect, the molecular changes in response to administration of different doses of one or more agents is determined by

analyzing the gene expression associated with exposure to such agents. Determination of the dosage experimentally using cell cultures is affected by many factors: the nature of the agent, its potency, mechanism of action, type of cell which is the target of the agent, and number of cells, To determine the dosage required experimentally, a low dosage level of the agent is added and then in a step-wise manner, the dosage is increased as well as length of time exposed to the agent. If the agent is lipophilic and easily crosses the lipid bilayer of cells, a lower initial concentration may be used and/or shorter length of time exposed to the agent. If the agent possesses the nature that would not cross the cell barrier easily and would need to be actively or passively transported across cell membranes, then a slighter higher initial concentration may be used and/or longer length of time exposed to the agent. Increasing dosage step- wise while monitoring toxicological response and morphology of the cells, rate of death of the cells, and growth patterns allows the skilled artisan to determine the dosage at which a toxicological response occurs. However, it should be noted that toxicological responses may occur which are visible changes, including but not limited to, physical structure and integrity of the cells (e.g., morphology, growth pattern, etc.). Monitoring for cellular toxic responses as well as molecular toxic responses, e.g., differential gene expression increases the likelihood of finding preferable dosages.

Changes in gene expression are toxicologically significant at that dosage at which removal or diminishment of the treatment no longer results in a return to normalcy, i.e., the state of a cell, organ, or system that existed prior to the treatment with the compound. Treatments beyond a certain dosages or time period may commit the cell to a toxicologically-relevant fate. This toxic dosage is reflected by an identifiable gene expression pattern, which is distinct from the pattern observed below the toxic dosage. Methods of analyzing gene expression and how to correlate gene expression data are described herein.

VI. Administration of an agent Administration of the agent of interest to rats may be achieved by various routes.

It will be readily appreciated by those skilled in the art that the route can vary, and can be intraperitoneal, intravenous, subcutaneous, transcutaneously, intramuscular, enterally, transdermally, transmucously, sustained release polymer compositions (e.g., a lactide polymer or co-polymer microparticle or implant), perfusion, pulmonary (e.g., inhalation), nasal, oral, etc. Injectables can be prepared in conventional forms, either as liquid solutions or suspension, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. The agents can be administered in a pharmaceutically acceptable form, for example, with an excipient. Suitable excipients include, for example, water, saline, aqueous dextrose, glycerol, ethanol or the like. Formulations for parenteral and nonparenteral delivery of one or more agents are known in the art and described in greater detail in Remington: The Science and Practice of Pharmacy, Mack Publishing (2000).

If a carrier is used to administer the agent, the carrier must be acceptable in the sense of being compatible with the agent to be tested and not deleterious (i.e., harmful) to the rat to be treated. For solid compositions, conventional non-toxic carriers include, for example mannitol, lactose, starch, magnesium stearate, magnesium carbonate, sodium saccharin, talcum, cellulose, glucose, sucrose, pectin, dextrin, tragacanth,

methyl cellulose, sodium carboxymethyl cellulose, a low-melting wax, cocoa butter,

and the like may be used. The active compound as defined above may be formulated as suppositories using, for example, polyalkylene glycols, for example, propylene glycol

as a carrier.

In one aspect, the agent to be administered will preferably contain a quantity of the agent in an amount sufficient to effect some sort of toxicological response in the rat,

either on a molecular level or on a physiological level.

NIL Method of identifying toxicologically relevant genes using known rat genes

In one aspect, rat genes which are candidate toxicologically relevant genes have

been described, either in the art or in a publicly available database, e.g., GenBank. Using the candidate toxicologically relevant rat sequences, primers are designed and used in PCR reaction to amplify the rat gene from a cDΝA library. The cDΝA library can be made from different rat cells, obtained ex vivo or from a commercial source, for example, American Type Culture Collection (ATCC). The generation of a cDΝA involves reverse transcribing isolated RΝA and is well-known in the art (see for

example, Sambrook et al. supra). The rat gene fragments, amplified by PCR, are cloned into any standard plasmid expression vector which can be obtained from numerous commercial sources (e.g., Promega, InVitrogen, New England BioLabs, etc.) and sequenced. The resulting sequence information is then compared to the GenBank database to confirm that the cloned DNA is the specific rat gene for which the primers were designed. Upon positive confirmation of the sequence, the amplified gene is then added to the panel of genes to be included in the array.

In another aspect, sequences of non-rat (e.g., human) genes which are candidate toxicologically relevant genes have been described. Primers to these toxicologically relevant non-rat genes are designed, synthesized, and are subsequently used in PCR reaction with rat cDNA libraries to amplify the homologous rat gene. The homologous rat gene may or may not be the exact sequence as the non-rat gene with which the primers were designed. Amplified rat gene is then added to the panel of genes to be included in the array.

In yet another aspect, rat genes or gene sequences which are toxicologically relevant or are candidate toxicologically relevant genes are used to determine toxicologically relevant genes in other rodents, e.g., mice. The high homology between rat and mouse gene sequences, which is believed to be about 97%, allows for reliable identification of non-rat toxicologically relevant without undue experimentation.

In yet another aspect, target sequences for inclusion in a rat aπay are obtained by de novo synthesis of nucleotides which are immobilized on a substrate, e.g., a glass slide. The target sequences are from genes which can indicate one or more toxicological responses. VII. (A) Differential Display

Several methods of differential display can be used to identify genes of interest. Differential gene expression can be observed by using techniques involving gel electrophoresis and polynucleotide microarrays or commercially available technologies, e.g., Invader® or Taqman®.

In one aspect, the results of PCR synthesis of mRNA (converted to cDNA before PCR) isolated from tissues of treated and control rats or cell lines are subjected to gel electrophoresis, and the bands produced by these mRNA populations are compared. Bands present on an image of one gel from one mRNA population, and not present on another, correspond to the presence of a particular mRNA in one population and not in the other, and thus indicate a gene that is likely to be differentially expressed. Messenger RNA derived from control and treated rat or cell lines can be compared by using arbitrary oligonucleotide sequences often nucleotides (random 10-mers) as a 5' primer and a set of 12 oligonucleotides complimentary to the poly A tail as a 3' fluorescent labeled "anchor primer". These primers are then used to amplify partial sequences of mRNAs with the addition of deoxyribonucleotides. These amplified sequences are then resolved on a sequencing gel such that each sequencing gel has a sequence of 50-100 mRNAs. The sequencing gels are then compared to each other to determine which amplified segments are expressed differentially (Liang, P. et al. Science 257:967, 1992; Welsh, J. et al., Nucl. Acid Res. 20:4965, 1992; Liang, P., et al.,

Nucleic Acids Res. 21(14): 3269-75 (1993)). VII (B Transcriptome profiling

An open system may be used whereby rat cells are exposed to drugs and/or chemicals at different concentration and then harvested at different time points. Rat cells can be obtained from various sources including, but are not limited to, tissue samples, organs, blood, skin, biological fluids (e.g., urine, spinal fluid, semen, etc.), and cell lines. Transcriptome profiling may also be obtained in rats dosed in vivo. Immortalized cell lines are obtained from commercial sources, e.g., Gibco BRL Life Sciences, or from other sources, e.g., American Type Culture Collection (ATCC). Other methods of obtaining rat cells include isolating cells obtained from tissue biopsies, blood, skin, or biological fluids, for example from rats dosed in vivo. As is well known to one of skill in the art, isolating cells from tissue samples can be achieved using any variety of techniques.

Sources from which cells are obtained can be any number of organs, including but not limited to liver, lung, heart, testis, kidney, spleen, thymus, and brain. In one embodiment, liver cells may be used for toxicity studies where the agent to be administered is known or thought to induce liver malfunctions or liver toxicity. In other embodiments, when the target of the action delivered by the agent is known, the use of cells deriving from the target organ may yield more beneficial information regarding toxicological responses than if a tissue were selected at random. In another embodiment where the agent to be tested has unknown effects, a panel of cells isolated from different sources may be used. In the alternative, liver cells may be used in the absence of knowledge of the agent's target of action because the liver is known to process many toxins. Although the toxicological responses may not be the most ideal compared to the results that one of skill in the art would obtain if the target tissue of the agent's action had been used, the benefits of using liver cells would be that toxicologically relevant genes may be identified and then subsequently tested on other organs to determine toxicity in the other organs or alternatively, to identify which organ(s) is the target for the agent. Time would be saved testing cells from one tissue source (liver in this situation) instead of isolating cells from many tissue sources. Rat cells obtained ex vivo or from a commercial or non-commercial source can be used fresh from a necropsy or frozen for storage and then cultured in media at time of experimentation. A wide variety of basal cell-sustaining media that can be used to keep the pH of the liquid in a range that promotes survival of rat cells. Non-limiting examples include F12/DMEM, Ham's F10 (Sigma), CMRL-1066, Minimal essential medium (MEM, Sigma), RPMI-1640 (Sigma), Dulbecco's Modified Eagle's Medium

(DMEM, Sigma), and Iscove's Modified Eagle's Medium (IMEM). In addition, any of the basal nutrient media described in Ham and Wallace Meth. Enz., 58:44 (1979), Barnes and Sato Anal. Biochem., 102:255 (1980). Cells can be grown in plates or in flasks. Cells are grown and expanded to a level desired and needed for DNA or RNA isolation. Cells are removed from the plate or flask to isolate DNA or RNA. If the cells are adherent, trypsin or another equivalent may be used to release the cells from the plate or flask. Preferably at least about lxlO² cells, more preferably at least about lxlO³ cells, more preferably at least about lxlO⁴ cells, more preferably at least about 1x10° cells, more preferably at least about lxlO⁶ cells, and even more preferably at least about lxlO⁷ cells are used as sources for DNA and RNA. In one embodiment, rats are dosed, tissues harvested (and nucleic acids isolated) after exposure to toxic doses of drugs/chemicals in vivo. This embodiment is further described in the Examples.

The isolated nucleic acid is then amplified to generate a product which can be attached to a substrate. In a preferred embodiment, the substrate is a solid substrate (e.g. , glass slide). The amplification process involves using primers which have a reactive group (e.g., amine group or derivative thereof) on one end of the primer, which is incorporated into the amplification product. One example of reactive primers that can be used is Amine Primers from Synthegen. The gene fragments which are attached to the glass slide can vary in length. The more nucleotides of a gene that are in the array, the tighter the binding and the greater the specificity in binding can occur. However, it is important to consider that longer fragments are more difficult to amplify and may contain point mutations or other errors associated with amplification. Therefore, the desired length of a gene or a fragment thereof that is to be included in the array should take into consideration the balance between a high specificity of binding obtained with a long (e.g., >1 kb) gene sequence with the high mutational rate associated with a longer fragment. The gene fragments attached to the glass slide are at least about 25 base pairs

(bp) in length, at least about 50 bp in length, more preferably at least about 100 bp in length, more preferably at least about 200 bp, even more preferably at least about 300 bp, even more preferably at least about 400 bp, even more preferably at least about 500 bp in length. In a preferred embodiment, the gene fragments are about 500 bp in length. The region of a gene that is used to attach to a solid substrate to generate an array can be any portion of the gene, coding, non-coding, 5' end, 3' end, etc. In a preferred embodiment, about 500 base pairs of the 3' end of rat gene related to toxicological responses are selected to be included in an array.

VII (C) Preparation of Microarray

Several techniques are well-known to a skilled artisan for attaching a gene or a fragment thereof to a solid substrate such as a glass slide. One method is to attach an amine group, a derivative of an amine group, another group with a positive charge or another group which is reactive to one end of a primer that is used to amplify a gene or a gene fragment to be included in the array. Subsequent amplification of a PCR product will then incorporate this reactive group onto one end of the product. The amplified product is then contacted with a solid substrate, such as a glass slide, which is coated with an aldehyde or another reactive group which will form a covalent link with the reactive group that is on the amplified PCR product and become covalently attached to the glass slide. Other methods using amino propryl silicane surface chemistry and other methods of preparation of microaπays have been disclosed. See, for example, Nuwaysir, E.F., et al. Molecular Carcinogenesis, 24:153-159 (1999); Kane, M.D., et al. Nucleic Acids Res. 28(22):4552-7 (2000); MacBeath G. and Schreiber, S.L., Science 289(5485):1760-1763 (2000); Lockhart, D. J. and Winzeler, E. A., Nature

405(6788):827-836 (2000); Cortese, J.D., The Scientist 14(17):25 (2000); and Cortese, J.D., The Scientist 14(11):26, (2000). Other embodiments of the invention are described further in the Examples.

Other methods using arrays are known, for example, arrays of polymers, such as nucleic acids, immobilized on a solid substrate, are disclosed, for example, in U.S. Pat.

Nos. 5,744,305; 5,510,270; 5,677,195; 5,624,711; 5,599,695; 5,451,683; 5,424,186; 5,412,087; 5,384,261; 5,252,743; and 5,143,854; as well as PCT WO 92/10092; PCT WO 93/09668; and PCT WO 97/10365. Photolithographic and fabrication techniques to allow each probe sequence to occupy a very small site on the support, for example, a few microns, are described in U.S. Pat. No. 5,631,734. Substrates having a surface to which arrays of polynucleotides are attached include silicon or glass. Substrates that are transparent to light and optical detection can be used, as described, for example, in U.S. Pat. No. 5,545,531.

NHL Algorithms for analysis and evaluation of toxicologically relevant genes A multi-step approach can be used in ranking candidate genes from rat genes, for example, a' set of 17,421 rat genes, known herein as "17K array", for possible inclusion on a comprehensive toxicity (CT) array. First, three cutoff criteria can be specified for individual gene values from whatever experiments result from using the 17K array: 1) Fold Induction/Repression level, 2) Average Fluorescence level of the replicate spots (reflection of the expression level) and 3) Coefficient of Variation of the replicate spots. The initial screening to make the "cut" may be based on expression level and measurement quality.

Second, gene values that would made the cut were aggregated into overall scores, and ranked for each gene, may be based on six ranking criteria: 1) Number of slides on which that gene met the cutoff criteria (NC), 2) Percent of consistency between slides (% of time the gene value made the cutoff criteria on the replicate slide for that initial slide) (CC), 3) Average magnitude (absolute value) of fold induction for all occurrences where that gene made the cutoff criteria (FI), 4) Coefficient of Variation of those fold induction scores (unlike all the other ranking criteria, lower is deemed better) (CV), 5) Average fluorescence value of all replicate spots of occurrences where that gene made the cutoff criteria (FL), and 6) Tissue consistency (what percent of cutoff-meeting occurrences of the gene were in the same tissue) (CT).

Each gene was assigned a score between 0 and 100 for each ranking criterion. Each ranking criterion score was computed as follows: The range of values for all genes was computed for the criterion by subtracting the lowest value present among all scores from the highest. The score for each gene was then calculated by subtracting the lowest value present from the value for that gene, then dividing by the range and multiplying by 100. In other words, the score for each gene is the percent above the minimum present toward the maximum. For example, if a gene's score was three-fourths of the way between the minimum present and the maximum for that criterion, its score would be 75%. Since for the CV factor (coefficient of variation of fold inductions) lower was deemed better, the score thus computed was subtracted from 100 to invert the percentage.

The final ranking score for each gene can be computed via a weighted combination of its score on the six ranking criteria. If a score could not be computed for a particular criterion, the entire value of that criterion would be removed from the equation, and ranking was based solely on the remaining factors. IX. Methods of using toxicologically relevant genes

In one aspect, the invention provides methods of determining toxicity to a particular agent by exposing a test animal (e.g., rat) to an agent and measuring the expression of one or more toxicologically relevant genes in the test animal. This generates a test expression profile which can then be compared to a reference expression profile to determine the toxicity of the agent. This can be accomplished, for example, by determining a significant correlation, for example, by routine statistical analysis between the test expression profile and the reference expression profile. In one embodiment, the agent is selected from Table 1 or 2. In another embodiment, the agent is a drug, drug candidate, or pharmaceutical compound. The toxicity dosages and time of exposure which is required to reach a toxic dose are determined by using the methods described herein. In another embodiment, the test expression profile includes genes or gene sequences from Tables 4, 6, 7, 8, 9, or 10. In another embodiment, the reference profile includes one or more expression profiles which have been empirically derived, for example, from Table 4, 6, 7, 8, 9, or 10. In another embodiment, the test gene expression profile may be compared with a reference gene expression profile stored in a database, for example, a comprehensive toxicity (CT) database. In another embodiment, the gene expression profiles are associated with responsiveness in a particular organ, for example, kidney, liver, spleen, heart, lung, testis, or brain. In another aspect, rat toxicologically relevant genes are used to obtain an array comprising polynucleotides which are selected from genes corresponding to partial gene sequences of toxicologically relevant genes. In one embodiment, the array includes genes or partial gene sequences of at least 20 nucleotides each. In another embodiment, the array includes genes or partial gene sequences of at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, or at least 500 nucleotides each. In another embodiment, the array comprises toxicologically relevant genes corresponding to the partial gene sequences in Table 4. In other embodiments, the array comprises toxicologically relevant genes corresponding to partial gene sequences in Table 6, 7, 8, 9, or 10. In yet another embodiment, the array comprises toxicologically relevant genes corresponding to partial gene sequences associated with responsiveness in a particular organ, for example, kidney, liver, spleen, heart, lung, testis, or brain.

In another aspect, toxicologically relevant gene sequences from non-rat animals (e.g., humans, dogs, non-human primates) can be obtained by using the arrays described herein to select for sequences which are substantially homologous. As known to one of skill in the art, homology may be determined by using computerized sequence alignment, as described above, or by hybridization techniques. Nucleic acids will hybridize will depend upon factors such as their degree of complementarity as well as the stringency of the hybridization reaction conditions. Stringent conditions can be used to identify nucleic acid duplexes with a high degree of complementarity. Means for adjusting the stringency of a hybridization reaction are well-known to those of skill in the art. See, for example, Sambrook, et al, "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989; Ausubel, et al, "Current Protocols In Molecular Biology," John Wiley & Sons, 1996 and periodic updates; and Hames et al, "Nucleic Acid Hybridization: A Practical Approach," IRL Press, Ltd., 1985. In general, conditions that increase stringency (i.e., select for the formation of more closely-matched duplexes) include higher temperature, lower ionic strength and presence or absence of solvents; lower stringency is favored by lower temperature, higher ionic strength, and lower or higher concentrations of solvents. Identifying toxicologically relevant genes in other non-rat animals may assist in determining which species is best suited for animal models by assessing which species is most susceptible to toxic responses.

In another aspect, gene expression profiles of rats can be compared when dosed with one drug and then compared to a second gene expression profile when dosed with another drug. The toxicologically relevant data may be correlated using the algorithms disclosed herein. The effects of drug-drug interaction may induce a similar set of genes to be up-regulated or down-regulated. The effect may be additive or multiplicative. In another embodiment, the effects of the drug-drug interaction may induce different set of genes which are not related in function. In another embodiment, the methods and set of toxicologically relevant genes disclosed herein allow target organs and toxic doses therein to be determined, as shown in Table 7, 8, 9, and 10. This is useful in drug design where the drug may have an intended target of one organ but have toxic multi- organ effects. In another embodiment, the methods and set of toxicologically relevant genes may be used to predict toxic response to agents which may take repeated exposure over a period of time for frank toxicity to appear. Examples of such agents are one-hit carcinogens (e.g., afiatoxin Bl, dimethylnitrosamine, ENU, etc.) or multi- dose carcinogens (e.g., phenobarbital and WY 14643). The molecular toxic response to these carcinogens may be determined in advance of any macroscopic changes which may occur in response to exposure to these agents.

X. Method of using toxicological response data to generate a toxicological database By collecting data from cells, tissues, or organs from rats in response to one or more agents at different dosages and/or at different time points, a database can be built with collection of information about toxicological responses, e.g., reference expression profiles. With the database, it will be possible to evaluate toxicological response to specific agents or combinations thereof. One practical application of toxicogenetics is to help rank a series of agents based upon gene expression. Initial ranking is done by determining the average percent of maximum alteration for a set of genes indicative of a specific stress or damage, for example, DNA damage (e.g., waf-1, DNA Pol beta, c-abl, cyclin G, Ape, and Mg t). Another method to use gene expression data for prioritizing lead agents is to construct a thorough dose-response curve for all the genes of interest. The EC₅o's for each gene induced beyond a threshold level is determined (the EC₅₀ is the concentration that induces a gene to half-maximum for that agent). Agents can then be ranked by the EC₅₀ average for the genes of interest. Agents with the lowest EC₅o's would be considered as more toxic.

The rat gene array can also generate information that can be used to predict downstream effects, such as which pathways are affected by certain agents. This is accomplished by looking at the differential gene expression and analyzing which pathways contain the toxicological response genes and also which pathways the genes can affect. This information in turn can be used to predict tissue responses, whole organ responses, and/or system responses. The ability to predict whole organ responses has great potential in the development of drugs, pharmaceutical compounds, and even in the use of chemicals.

The following Examples are provided to illustrate but not to limit the present invention in any manner. It will be apparent to one of skill in the art that modifications can be made while keeping in the spirit and scope of the present invention.

EXAMPLES

Example 1 Discovery and characterization of toxicology relevant genes by empirical data Section 1. Preparation and printing available rat genes on a microarray a. Polymerase chain reaction

Seventeen thousand two hundred and forty one rat genes were amplified by polymerase chain reaction (PCR) using M13 forward and M13 reverse primers. The sequence of the Ml 3 forward primer was CTCAAGGCGATTAAGTTGGGTAAC (SEQ ID NO:709) and the sequence of the Ml 3 reverse primer was

GTGAGCGGATAACAATTTCACACAGGAAACAGC (SEQ ID NO:710). The Ml 3 reverse primer had a C12 amine link attached to insure binding of the sense strand (5'- 3') of the PCR product to the glass microarray slide. The amine linker can be added during synthesis of a primer at several any commercial sources, e.g., Synthegen. The following ingredients were combined for the PCR reaction: 21 μl H₂0, 2.5 μl 10X PCR buffer, 0.12 μl of lOmM dNTPs, 1 μl of 25 ng/μl M13 forward primer, 1 μl of 25 ng/μl M13 reverse primer, a sample of the clone from glycerol stock, and 0.5 μl Taq polymerase for a total volume of 25 μl. The reaction mix was run at 95°C for 5 minutes and then cycled 35 times under the conditions of 95° C for 30 seconds, 45°C for 30 seconds, 72° C for 30 seconds, and followed by 72° C for 5 minutes and finally

4°C until samples are removed from the thermocycler. About 4 μl of the PCR product was removed and run on a 1% agarose gel to ascertain the success of the PCR reaction. b. Attaching toxicologically relevant genes to glass slides

The amplified product was purified by a standard ethanol precipitation method and alternatively by commercial PCR clean-up kits, e.g. Millipore, Qiagen. The cleaned-

up PCR product was then immobilized or "spotted" onto a glass slide which can react

with the amine group on the amplified product and form a covalent linkage. PCR product was spotted on the coated glass slide using an MD Generation II Array Spotter.

The terminology and equipment used in this example comprised the following:

Spotter: MD Generation II Array Spotter main instrument

Spotting Chamber: Area of spotter enclosed in glass which houses the pins, plates, trays and most spotter machinery.

Controller: Dedicated Dell Computer and Monitor to right of Spotter Unit Pins: (6) fine tubes in the Spotter Unit which pick-up and spot the Target

Slides: Std. size glass microscope slides with a special coating on one side Plates: Plastic 96 well plates which hold the Target solution to be spotted Target: A solution of PCR product which the spotter deposits on the slides.

N2 Tank: 5 ft. high steel gas tank labeled "Nitrogen, Compressed" N2 : The N2 gas from the N2 tank

Air Conditioner: Kenmore air conditioner installed in window of spotting chamber Humidifier 1 : Essick 2000 Evaporative Cooler against the window Humidifier 2: Bemis Airflow with white flexible duck into the Spotter Unit

Humidifier 3: Bemis Airflow against the wall Humidifier 4: Kenmore QuietComfort 7 Vacuum Pump: Gast Laboratory Oilless Piston Vacuum Pump Dampbox: The plastic sealable container containing an NaCl / water slurry

Materials used for reagent solutions were: Nanopure water, 0.2 M KC1 (1/10

dilution of Stock 2M KCL in water), and 95% EtOH. The temperature control was adjusted to 60°. The spotter chambers were adjusted to be greater than 39 % relative humidity and less than 65° C. The spotting pins were pre-washed for 20 cycles. The glass slides were first each blown with N2 gas for about 2 seconds per side. The slides were inserted into the Spotter following Array Spotter Run Values. The slides were aligned using a clean narrow rod orienting it on the center right edge of the slide and gently pushed to the left until the slide was aligned vertically against the metal pins. After slides were loaded and straightened, a visual check was done to make sure no more debris had fallen. The humidity was confirmed to be greater than 39% relative humidity. The MD spotter recognizes 16 plates as a maximum for a run and will pause automatically after 8 plates. The MD spotter also advances sequentially to plates in an invariable order and is not programmable to accommodate unique plate sourcing scheme. Therefore, it was important to manually rotate (or shuffle) plates to accomplish the spotting for the rat arrays. The genes (PCR products) were spotted in duplicate on each slide and a total of 3000 genes were printed on a single slide (total 6000 spots). There were 6 slides in a set for inclusion of all 17,241 genes. The printed (spotted) microarrays were examined for quality control purposes under a phase contrast microscope to evaluate spot morphology and presence of all genes.

c. Blocking (Slide Preparation post-spotting)

This blocking procedure is important because it reduces the non-specific background signals. The amounts provided in this protocol are for 19 slides, however, a skilled artisan may make modifications accordingly. More staining dishes and slide racks will be required if more than 19 slides are to be blocked. A clean glass container was obtained and filled with Nanopure H20. The container was placed on a hot plate and heated to a high temperature. A blocking solution was made by adding 2.5 ml of 20%) SDS to 500mL blocking solution bottle. The blocking solution was warmed in microwave for 2.5 minutes and checked to determine if the temperature had reached 50°C. If the temperature of the solution was not at yet 50°C, then the solution was warmed in the microwave at 10 second intervals until it reached the desired temperature. One staining dish was placed on an orbital shaker with 4x SSC solution and turned to an agitation speed of 75 rpm. Slides were placed in metal racks and placed in boiling water for several minutes (e.g., 2 minutes). The slides were taken out of boiling water and allowed to cool briefly. The slides were then transferred to staining container containing 4x SSC solution on orbital shaker for several minutes (e.g., 2 minutes), rinsed with nanopure water in a staining container, and then briefly placed in blocking solution for about 15 minutes. After 15 minutes, the slides were taken out of the blocking solution and rinsed three times by dipping into three separate containers with nanopure water each time. The tops of the slides were dabbed lightly with a tissue and the slides were placed in a centrifuge for about 5 minutes at a speed of 1000 rpm.

Section 2. Toxicity studies to obtain rat cDNA to test determine differential expression of genes a. Dosing of rats and harvesting of tissue after exposure to toxic doses of drugs/chemicals in vivo

Sprague-Dawley male rats, approximately 2.5 months old, were used for toxicity testing. The experimental design of exposing rats to toxic doses of drugs/chemicals includes determination of the toxic dosage and the route of administration of the compound. Rats are divided into treated rats that receive a specific concentration of the compound and the control rats that only receive the vehicle in which the compound is mixed into solution or suspension (e.g., saline). Where possible, saline was used as the vehicle. Rats are injected with a drug, compound, or appropriate vehicle intraperitoneal with a volume of lOml/kg body weight. The concentrations of each drug or chemical dosed are the dose at which toxicity has been documented by traditional toxicology methods (e.g. histopathology, serum chemistry, hematology) and a second dose is 25% of the toxic dose. The rats are dosed after not having food for 10 hours and then sacrificed at 6h, 24h, and 72h later. Three control rats and three treated rats are euthanized at each timepoint for each drug. Each rat is heavily sedated with an overdose of CO2 by inhalation and then a maximum amount of blood drawn. This blood is separated into a clot tube for isolation of serum, and into a heparinized tube for isolation of blood lymphocytes. Exsanguination of the rat by this drawing of blood kills the rat. The method of collecting the tissues is very important and ensures preserving the quality of the mRNA in the tissues. The body of the rat is then opened up and several prosectors rapidly remove the specified organs/tissues and immediately place them into liquid nitrogen. Blood lymphocytes, serum, urine, liver, lung, heart, testes, spleen, bone marrow, brain, and other targets that may be specific targets of the drug/chemical were harvested. All of the organs/tissues are completely frozen within 3 minutes of the death of the animal to ensure that mRNA does not degrade. The organs/tissues are then packaged into well-labeled plastic freezer quality bags and stored at -80 degrees until needed for isolation of the mRNA from a portion of the organ/tissue sample.

Serum chemistry changes were evaluated at 24 hours and 72 hours. Histopathology was evaluated by a pathologist at 72 hours for evidence of toxicity.

Hematology and urine analyses were evaluated at 72 hours.

b. Isolation of total RNA From Animal

To isolate high quality and high purity total RNA from tissue samples, the following materials are used: Qiagen RNeasy midi kits, 2-mercaptoethanol, liquid N₂, tissue homogenizer, dry ice.

It is important to take precautions to minimize the risk of RNA degradation by RNase. Samples should be kept on ice when specified, gloves are worn at all times and work areas and equipment are treated with an RNase inhibitor, e.g.,, RNase Zap

(Ambion® Products, Austin, TX). In order to prevent RNA degradation, it is highly preferable that the work area and materials used for this procedure are clean and RNase- free. Autoclaving tips and microfuge tubes does not eliminate RNases. The following

protocol is based on Qiagen® RNeasy® midi kit with modifications for optimal results.

This total RNA isolation technique is used for RNA isolation from animal tissue and can be modified to accommodate smaller samples. If tissue needs to be broken, it can be placed on a double layer of aluminum foil which is placed within a weigh boat containing a small amount of liquid nitrogen. The aluminum foil was placed around the tissue and then a blunt force was applied to the tissue with a small foil-wrapped hammer. For liver or kidney, about 0.15-0.20 g of tissue was weighed and placed in a 15 ml conical tube. All tissue were kept on dry ice when other samples were being weighed.

About 3.8 ml of RLT buffer was added to the tube containing the sample. The RLT buffer® from Qiagen can be prepared beforehand by adding 10 μl betamercaptoethanol to each 1.0 ml of lysis buffer needed. The tissue was homogenized using the rotor-stator homogenizer for 45 seconds. A IKA Ultra Turrax T25 homogenizer set at speed 4 with the S25N-10G dispersing element can be used. Alternatively, a Virtishear Cyclone 750W rotor/stator homogenizer (Virtis item # 278077) can be used with the 7 mm microfine sawtooth shaft and generator (195 mm long with a processing range of 0.25 ml to 20 ml, item # 372718). After homogenization, samples were stored on ice until all samples were homogenized. To clean the homogenizing tip between samples, the tip was first run for a few seconds in 95 % ethanol and then rinsed by squirting with fresh 95% ethanol. This process was repeated with nanopure water. The tissue lysate was centrifuged at room temperature for 10 minutes at 3700- 3800 rpm in a Beckman GS-6 (or equivalent) centrifuge to remove nuclei thus reducing DNA contamination.

The supernatant of the lysate was transferred to a clean 15 ml conical tubes containing an equal volume of 70% EtOH in DEPC treated H₂O, being careful not to include any of the pellet or fatty layer and mixed. About 3.8 ml of sample was added to the RNeasy spin column placed in a 15 ml centrifuge tube and centrifuged at 3000 x g (3690-3710 rpm, Beckman GS-6) for 5 min. The flow-through was discarded. The remaining sample was added to the appropriate column and spun at 3000 x g for 5 minutes and the flow-through was discarded.

About 4.0 ml of Buffer RW1 (Qiagen®) was added to the column and spun as before then about 2.5 ml of buffer RPE (Qiagen®) was added to column and spun at 3000 x g (3690-3710 rpm, Beckman GS-6) for 2 minutes. In this example, RPE buffer was supplied as a concentrate so 4 volumes of 95% EtOH was added before use. For the midi kit, about 220 ml of 95% EtOH would be added to 55 ml of RPE. Another 2.5 ml of buffer RPE was added and spun for 5 minutes to also dry out column. The column, including the tip, should be dry for the next elution step.

For elution, the column that has the RNA bound to a clean 15 ml tube was transferred and 200 μl of RNase- free water was added to the column, allowed to sit for 1 minute, and spun for 3 minutes at 3000 x g (3690-3710 rpm, Beckman GS-6). This step was repeated into the same tube but with 200 μl RNase-free water. c. Removal of contaminant DNA

Isolated RNA samples can be precipitated using the following lithium chloride (LiCl) process either before or after measuring absorbance reading for quantitation purposes. The volume of the sample was measured. To this, about 1/3 volume of LiCl

PPT Solution from Ambion (Cat # 9480) was added and mixed by inverting the tube. The LiCl should be in solution. If not, it may be necessary to adjust the pH to 8.0. The

solution was placed at -20 ° C for 30 minutes and centrifuged at 4°C and 13,000 RPM

for 10 minutes. If there is no visible pellet, it may help to return the sample to -20°C

overnight and then repeat the centrifugation. The supernatant was transferred to a separate tube and washed by adding 1 ml of ice cold 70% ethanol in DEPC treated

water and gently inverted. Then the tube was centrifuged at 4° C for 10 minutes and

the supernatant was discarded and the pellet was air dried. The pellet was resuspended in RNA storage buffer (Ambion Cat # 7000). Alternatively the contaminant DNA was removed by incorporating the DNAse step in Qiagen® midi kit procedure as described in the instructions for the kit.

d. Measure quantity of RNA To measure yield, the O.D. at 260 nm was taken and about 2.0 μl RNA was added to 98 μl H₂O. The following formula was used for calculations: (Absorbance) x (dilution factor) x (40V1000 = amount of RNA in μg/ml For a sample calculation: absorbance = 0.45 dilution factor = 50

(0.45 x 50 x 40) / 1000= RNA concentration in μg/ml

e. Microarray reverse transcription reaction

Fluorescence-labeled first strand cDNA probe was made from total or mRNA by first isolating RNA from control and treated cells, disclosed supra. This probe is hybridized to microarray slides spotted with DNA specific for toxicologically relevant genes. The materials needed to practice this example are: total or messenger RNA, primer, Superscript II buffer, dithiothreitol (DTT), nucleotide mix, Cy3 or Cy5 dye,

Superscript II (RT), ammonium acetate, 70% EtOH, PCR machine, and ice.

The volume of each sample that would contain 20μg of total RNA (or 2μg of mRNA) was calculated. The amount of DEPC water needed to bring the total volume of each RNA sample to 14 μl was also calculated. If RNA is too dilute, the samples are concentrated to a volume of less than 14 μl in a speedvac without heat. The speedvac must be capable of generating a vacuum of 0 Milli-Torr so that samples can freeze dry under these conditions. Sufficient volume of DEPC water was added to bring the total volume of each RNA sample to 14 μl. Each PCR tube was labeled with the name of the sample or control reaction. The appropriate volume of DEPC water and 8 μl of anchored oligo dT mix (stored at -20°C) was added to each tube.

Then the appropriate volume of each RNA sample was added to the labeled PCR tube. The samples were mixed by pipeting. The tubes were kept on ice until all samples are ready for the next step. It is preferable for the tubes to kept on ice until the next step is ready to proceed. The samples were incubated in a PCR machine for 10 minutes at 70°C followed by 4°C incubation period until the sample tubes were ready to be retrieved. The sample tubes were left at 4°C for at least 2 minutes. ^• The Cy dyes are light sensitive, so any solutions or samples containing Cy-dyes should be kept out of light as much as possible (e.g., cover with foil) after this point in the process. Sufficient amounts of Cy3 and Cy5 reverse transcription mix were prepared for one to two more reactions than would actually be run by scaling up the following recipes: For labeling with Cy3

8 ul 5x First Strand Buffer for Superscript II

4 ul 0.1 M DTT

2 ul Nucleotide Mix

2 ul of 1:8 dilution of Cy3 (e.g., 0.125mM cy3dCTP). 2 ul Superscript II

For labeling with Cv5

8 ul 5x First Strand Buffer for Superscript II 4 ul 0.1 M DTT 2 ul Nucleotide Mix

2 ul of 1:10 dilution of Cy5 (e.g., 0.1 mM Cy5dCTP). 2 ul Superscript II

About 18 μl of the pink Cy3 mix was added to each treated sample and 18 μl of the blue Cy5 mix was added to each control sample. Each sample was mixed by

pipeting. The samples were placed in a PCR machine for 2 hours at 45°C followed by

4°C until the sample tubes were ready to be retrieved. The samples were transferred to

Eppendorf tubes containing 600 μl of ethanol precipitation mixture. Some of the EtOH precipitation mixture was used to rinse the PCR tubes. The tubes were inverted to mix.

Samples were placed in -80°C freezer for at least 20-30 minutes. If desired, samples

may be left at -20°C overnight or over the weekend.

f. Removal of impurities from the reverse transcription reaction

In addition to the desired cDNA product, the completed RT reaction contains ^•impurities that must be removed. These impurities include excess primers, nucleotides, and dyes. One method of removing the impurities was by following the instructions in the QIAquick PCR purification kit (Qiagen catalog #120016). Alternatively the completed RT reactions were cleaned of impurities by ethanol precipitation and resin bead binding. The samples were centrifuged for 15 minutes at 20800 x g (14000 rpm in Eppendorf model 5417C) and carefully the supernatant was decanted. A visible pellet was seen (pink/red for Cy3, blue for Cy5). It is a preferable to centrifuge the tubes at a fixed position so the pellet will be at a known area in the tube. In some rare instances, the probe is seen spread on one side of the tube instead of a tight pellet. If the pellet is white or nonexistent, the reaction has not occurred to maximal efficiency. Ice cold 70% EtOH (about 1 ml per tube) was used to wash the tubes and the tubes were subsequently inverted to clean tube and pellet. The tubes were centrifuged for 10 minutes at 20800 x g (14000 rpm in Eppendorf model 5417C), then the supernatant was carefully decanted. The tubes were flash spun and any remaining

EtOH was removed with a pipet. The tubes were air dried for about 5 to 10 minutes. protected from light. The length of drying time will depend on the natural humidity of the environment. For example, an environment in Santa Fe would require about 2 to 5 minutes of drying time. It is preferable that the pellet is not overdried. When the pellets were dried, they are resuspended in 80 ul nanopure water. The cDNA/mRNA

hybrid was denatured by heating for 5 minutes at 95°C in a heat block and flash spun.

Then the lid of a "Millipore MAHV N45" 96 well plate was labeled with the appropriate sample numbers. A blue gasket and waste plate (v-bottom 96 well) was attached. Wizard DNA Binding Resin (Promega catalog #A1151) was shaken

immediately prior to use for thorough resuspension. About 160 μl of Wizard DNA

Binding Resin was added to each well of the filter plate that was used. If this was done with a multi-channel pipette, wide orifice pipette tips would have been used to prevent clogging. It is highly preferable not to touch or puncture the membrane of the filter

plate with a pipette tip. Probes were added to the appropriate wells (80 μl cDNA samples) containing the Binding Resin. The reaction is mixed by pipeting up and down -10 times. It is preferable to use regular, unfiltered pipette tips for this step. The plates were centrifuged at 2500 rpm for 5 minutes (Beckman GS-6 or equivalent) and then the filtrate was decanted. About 200 μl of 80% isopropanol was added, the plates were

spun for 5 minutes at 2500 rpm, and the filtrate was discarded. Then the 80% isopropanol wash and spin step was repeated. The filter plate was placed on a clean

collection plate (v-bottom 96 well) and 80 μl of Nanopure water, pH 8.0-8.5 was added.

The pH was adjusted with NaOH. The filter plate was secured to the collection plate with tape to ensure that the plate did not slide during the final spin. The plate sat for 5 minutes and was centrifuged for 7 minutes at 2500 rpm.

g. Fluorescence Readings of cDNA Probe and Hybridization on the Microarray It is optional to semi-quantitatively assess the incorporation of fluorescence into cDNA probes. This incorporation of fluorescence provides a measure of the quantity of dye incorporated in the cDNA of the cleaned-up RT product and provides evidence if the enzyme action or dye incorporation failed. Visual evaluation of the color of the RT product cleaned up using the QIAquick PCR purification kit (Qiagen cat#120016) is an alternative method to determine if the RT reaction failed.

It is preferable that a consistent amount of cDNA is pipeted into each well of the 384-well, 100 μl assay plate (Falcon Microtest cat#35-3980) plate because readings will vary with volume. Controls or identical samples should be pooled at this step, if required. The probes were transferred from the Millipore 96 well plate to every other well of the 384 well assay plate. This was done using a multi-channel pipette. For replicate samples that have been pooled, 60 μl aliquots were transferred into wells of the assay plate. The Cy-3 and Cy-5 fluorescence was analyzed using the Wallac Victor 1420 Multilabel counter workstation programmed for reading Cy3-Cy-5 in the 384-well

format and the data was saved to disk. The typical range for Cy-3 (20μg) is 250-

700,000 fluorescence units. The typical range for Cy-5 (20μg) is 100-250,000 fluorescence units. Settings for the Wallac 1420 fluorescence analyzer were as follows: Cyi

CW lamp energy = 30445

Lamp filter = P550 slot B3

Emission filter= D572 dysprosium slot A4

Emission aperture = normal

Count time = 0.1 s

Cy5

CW lamp energy = 30445

Lamp filter = D642 samarium slot B7

Emission filter= D670 slot A8

Emission aperture = normal

Count time = 0.1 s

h. Dry-down Process

Concentration of the cDNA probes is often necessary so that they can be resuspended in hybridization buffer at the appropriate volume. A sample of control cDNA (Cy-5) is mixed with each test cDNA (Cy-3). This is very important because it allows hybridization of treated and the appropriate control cDNA samples on the same microarray. Eppendorf tubes were labeled for each test sample and the mixed cDNA samples were added to the appropriate tubes. These tubes were placed in a speed-vac to dry down, with foil covering any windows on the speed vac. At this point, heat (45°C)

may be used to expedite the drying process. Time will vary depending on the machinery. The drying process takes about one hour for 150 μl samples dried in the

Savant. Samples may be saved in dried form at -20°C for up to 14 days. i. Microarray Hybridization

To hybridize labeled cDNA probes to single stranded, covalently bound DNA target genes on glass slide microarrays, the following material were used: formamide, SSC, SDS, 2 μm syringe filter, salmon sperm DNA (Sigma, cat # D-7656), human Cot- 1 DNA (Life Technologies, cat # 15279-011), poly A (40 mer: Life Technologies, custom synthesized), yeast tRNA (Life Technologies, cat # 15401-04), hybridization chambers, incubator, coverslips, parafilm, heat blocks. It is preferable that the array is completely covered to ensure proper hybridization.

About 30 μl of hybridization buffer was prepared per cDNA sample (control rat

cDNA plus treated rat cDNA). Slightly more than is what is needed should be made

since about 100 μl of the total volume made for all hybridizations can be lost during

filtration.

Hybridization Buffer: for 100 μl:

• 50% Formamide 50 μl formamide • 5X SSC 25 μl 20X SSC

• 0.1% SDS 25 μl 0.4% SDS

The solution was filtered through 0.2 μm syringe filter, then the volume was

measured. About 1 μl of salmon sperm DNA (lOmg/ml) was added per 100 μl of

buffer.

Alternatively, the hybridization buffer was made up as:

Hybridization Buffer: for 101 ul:

• 50%) Formamide 50 μl formamide

• 10X SSC 50 μl 20X SSC • 0.2% SDS 1 μl 20% SDS The solution was filtered through 0.2 μm syringe filter, then the volume was

measured. One microliter of salmon sperm DNA (9.7mg/ml), 0.5 μl Human Cot-1

DNA (5 μg/μl), 0.5 μl poly A (5 μg/μl), 0.25 μl Yeast tRNA (10 μg/μl) was added per

100 μl of buffer. Materials used for hybridization were: 2 Eppendorf tube racks, hybridization

chambers (2 arrays per chamber), slides, coverslips, and parafilm. About 30 μl of

nanopure water was added to each hybridization chamber. Slides and coverslips were

cleaned using N₂ stream. About 30 μl of hybridization buffer was added to dried probe

and vortexed gently for 5 seconds. The probe remained in the dark for 10-15 minutes at room temperature and then was gently vortexed for several seconds and then was flash spun in the microfuge. The probes were boiled for 5 minutes and centrifuged for 3 min

at 20800 x g (14000 rpm, Eppendorf model 5417C). Probes were placed in 70 °C heat block. Each probe remained in this heat block until it was ready for hybridization.

Pipette 25 μl onto a coverslip. It is highly preferable to avoid the material at the bottom of the tube and to avoid generating air bubbles. This may mean leaving about 1

μl remaining in the pipette tip. The slide was gently lowered, face side down, onto the

sample so that the coverslip covered that portion of the slide containing the array. Slides were placed in a hybridization chamber (2 per chamber). The lid of the chamber

was wrapped with parafilm and the slides were placed in a 42°C humidity chamber in a

42°C incubator. It is preferable to not let probes or slides sit at room temperature for long periods. The slides were incubated for 18-24 hours. i . Post-Hybridization Washing.

To obtain only single stranded cDNA probes tightly bound to the sense strand of target cDNA on the array, all non-specifically bound cDNA probe should be removed from the array. Removal of all non-specifically bound cDNA probe was accomplished by washing the array and using the following materials: slide holder, glass washing dish, SSC, SDS, and nanopure water. It is highly preferable that great caution be used with the standard wash conditions as deviations can greatly affect data.

Six glass buffer chambers and glass slide holders were set up with 2X SSC buffer heated to 30-34°C and used to fill up glass dish to 3/4th of volume or enough to submerge the microarrays. It is important to exercise caution in heating of the 2X SSC buffer since a temperature of greater than 35°C might strip off the probes. The slides were removed from chamber and placed in glass slide holders. It is preferable that the slides are not allowed dry out. The slides were placed in 2X SSC buffer but it is recommended that no more than 4 slides be placed per dish. Coverslips should fall off within 2 to 4 minutes. In the event that the coverslips do not fall off within 2 to 4 minutes, very gentle agitation may be administered. The stainless steel slide carriers were placed in the second dish and filled with 2X SSC, 0.1%SDS. Then the slides were removed from glass slide holders and placed in the stainless steel holders submerged in 2X SSC, 0.1%SDS and soaked for 5 minutes. The slides were transferred in the stainless steel slide carrier into the next glass dish containing 0. IX SSC and 0.1 %SDS for 5 minutes. Then the slides are transferred in the stainless steel carrier to the next glass dish containing only 0.1X SSC for 5 minutes. The slides, still in the slide carrier, were transferred into nanopure water (18 megaohms) for 1 second. To dry the slides, the stainless steel slide carriers were placed on micro-carrier plates with a folded paper towel underneath. The top of the slides was gently dabbed with a tissue. Then the slides were spun in a centrifuge (Beckman GS-6 or equivalent) for 5 minutes at 1000 rpm. It is very important that the slides spin dry instead of air dry, as air drying leads to increased background.

Section 3. Evaluation of differential expression of 17,241 genes in rats exposed to toxins a. Identification of rat toxicologically relevant genes

Sprague-Dawley male rats, approximately 2.5 months old, were used for toxicity testing. Tliree rats were injected intraperitoneally with a drug/chemical at each dose per sacrifice timepoint and three other rats were used as control animals as described above in section (a) of Toxicity studies. The drugs/chemicals dosed for the testing of the 17,241 gene array were as follows:

The tissue samples shown in the table above along with the corresponding tissue from a rat injected with the vehicle were processed for cDNA with dye incorporated as described in section 2. The set of 6 microarray slides these cDNA samples were hybridized on was described in section 1 and the target spotted on them were the PCR products from 17,421 genes. The washed and dried hybridized slides were scanned on Axon Instruments Inc. GenePix 4000A Micro Array Scanner and the fluorescent readings from this scanner converted into quantitation files on a computer using GenePix software.

b. Use of algorithms to identify, select, and evaluate toxicologically relevant 5. genes

A two-step approach was used in ranking candidate genes from the array comprising approximately 17,421 rat genes, known herein as "17k array", for possible inclusion on the comprehensive toxicity (CT) array.

First, three cutoff criteria were specified for individual gene values from 0 experiments involving expression analysis of the 17,421 rat genes: The three cutoff criteria were: fold induction/repression level, average fluorescence of the replicate spots used to calculate expression level, and coefficient of variation of the replicate spots. To calculate fold induction/repression level, the stored induction repression level of a gene in a particular experiment has been calculated as follows: 5 1). arrive at a treatment score for the gene. The treatment score was represented by the amount of Cy3 labeled cDNA from a treated source (e.g., laboratory animals dosed with a compound) that had bound to a complementary target DNA spot of the microarray slide. The amount of Cy3 labeled cDNA was detected by a microarray laser scanner at a wavelength of 532nm. 0 2) arrive at a control score for the gene. The control score was represented by the amount of Cy5 labeled cDNA from an untreated source that had bound to a complementary target DNA spot of the microarray slide. The amount of Cy5 labeled cDNA was detected by a microarray laser scanner at a wavelength of 635nm. The unit of measure was the pixel intensity or the average of several pixel intensities reported by a microarray laser scanner at coordinate on a microarray slide. The pixel intensity at that location was proportional to the number of photons detected by a photomultiplier tube when a spot of target DNA labeled with fluorescent probe was illuminated by a laser with a wavelength to which the dye is sensitive. For an Axon Instruments Inc. GenePix 4000A MicroArray Scanner, which was used in these experiments, these values are between 0 and 65535. 3) compute an un-normalized treated-to-control ratio by dividing the treatment score by the control score

4) compute a final, "normalized" induction score by dividing the un-normalized ratio by some normalization factor. For example, using the following 4-steps procedure above, calculation of Gene A is performed as follows: 1) Suppose that the average of its set of four raw treated values is 100,000 2) Suppose that the average of the set of its four raw control values is 25,000 3) The un-normalized ratio would thus be 4, and finally 4) If the normalization factor (designed to take into account environmental effects) turned out to be 2, one would end up with at a final, normalized induction score (often called fold induction) of 4 divided by 2, or 2. In this example, Gene A was induced two-fold. In all experiments conducted with respect to this invention, there were four replicates of each gene, with each replicate having a treated and a control value. Thus, the calculation of an expression level for each gene in an experiment involved aggregating eight data points.

The average fluorescence level of the replicate spots used to calculate the expression level is accomplished by a simple average of the four treated replicate values used in any experiment to calculate the expression level of a gene.

The coefficient of variation of the replicate spots was a conventional measure of variability, expressed as a percentage, that in this case was derived by dividing the standard deviation of the four replicate treated-to-control ratios by the average of the four replicated treated-to-control ratios. The latter criteria represent useful measures of data quality. Thus, initial screening is based on expression level and measurement quality.

Algorithms were written specifically to perform the entire process of ranking genes to be included from the 17K array on to the CT array. In the initial part of the program, the three criteria above were "ended" together, so that in order to "make the first cut" the gene would have to meet all three criteria. This was considered the first tier in the program.

The criteria are adjustable within the algorithms. For the actual ranking of the 17k array, the following criteria were used: induction/repression level: 2; fluorescence level: 400; and a coefficient of variation: 30%. To make the first cut and be selected as a potential toxicologically relevant gene, a gene only had to meet the 3 criteria within one experiment stored in the 17K warehouse of data. Likewise, relevant values for the gene would have been included each time it met the criteria within a different experiment. The data for genes that made the cut (and hence were selected as potential toxicologically relevant genes) and each time the genes made the cut were stored in a separate, temporary data table for ranking (the second tier in the process). A gene's data could be included more than once: one time for each experiment in which that gene met the three criteria.

Each of the factors listed in the table below was given a relative weight, as indicated:

Next, gene values that made the cut were aggregated into overall scores. It was necessary to "aggregate" the potentially more-than-one values for each gene into overall scores for the gene because data for a particular gene were included for each experiment in which that gene's values met the 3 cutoff criteria described above. Overall scores were aggregated for each six factors, as shown in the table above, and ranked for each gene, based on six ranking criteria: 1) Number of slides on which that gene met the cutoff criteria (NC = number of compounds). As noted, a gene could meet the 3 cutoff criteria described above in more than one of the experiments stored in the 17K warehouse. NC is a simple count of the number of different compounds (not experiments, as duplicate experiments were performed for each compound) in which that gene met the 3 criteria, 2) Percent of consistency between slides (% time the gene value made the cutoff criteria on the replicated slide for that initial slide) (CC). As mentioned above, duplicate experiments were performed for each compound. CC is a count of the number of times the gene made the cutoff in both of the duplicate experiment pair. Thus, a gene could have an NC (number of compounds) of 3 but a CC (compound consistency) of 2, meaning that in two of the three compounds it made the cutoff in each of the duplicate experiments, and in one of the compounds, it did not.

3) Average magnitude (absolute value) of fold induction for all occurrences where that gene made the cutoff criteria (FI). This is a simple average of the magnitude of the expression/repression levels for each set of data values for a particular gene.

4) coefficient of variation of those fold induction scores (unlike all the other ranking criteria, a lower coefficient of variation is deemed better) (CV). The coefficient of variation applied to the set of expression values for a particular gene to assess the variability of its scores. 5) Average fluorescence value of all replicate spots of occurrences where that gene made the cutoff criteria (FL). This is a simple average of the fluorescence levels of the treated values for each occurrence of a gene that had made the cut. 6) Tissue consistency, i.e., what percent of cutoff-meeting occurrences of the gene were in the same tissue (CT). Expression levels were measured not only in several compounds but in several tissues as well (liver, kidney, etc.) CT was calculated as the percentage of time the gene data values which made the cutoff were measured in the same tissue. For example, if a gene had made the cut in four experiments, twice in liver and twice in kidney, its tissue consistency would be 50%.

The following weightings were used in the actual process of ranking genes for inclusion on the CT array: NC=3, COl, Fl=5, CV=0, FL=0, CT=0. Thus, the final three criteria received no weight in this case.

Each gene was assigned a score between 0 and 100 for each ranking criterion. Each ranking criterion score was computed as follows: The range of values for all genes was computed for the criterion by subtracting the lowest value present among all scores from the highest. The temporary data table compiled from the 17K warehouse included scores for every gene that had met the initial 3 cutoff criteria. A gene would be present in the table with values for each experiment in which it had met or surpassed the 3 cutoff criteria. Scores were then aggregated from the gene occurrences of each gene into an overall score for that gene for each of the six criteria described above. For example, if Gene A made the cut in three experiments with respective induction scores of 4, 6, and 8 then the aggregated induction score for Gene A would be 6 (the average of the three values). Further, for example, suppose the gene with the highest overall score on the induction factor had an overall score of 10, and the lowest an overall score of 2. Then, Gene A would receive a rating of 50%, because its score was halfway between the highest and the lowest. The score for each gene was then calculated by subtracting the lowest value present from the value for that gene, then dividing by the range and multiplying by 100. In other words, the score for each gene is the percent above the minimum present toward the maximum. For example, if a gene's score was three- fourths of the way between the minimum present and the maximum for that criterion, its score would be between the minimum present and the maximum for that criterion, its score would be 5%. Since for the CV factor (coefficient of variation of fold inductions) lower was deemed better, the score thus computed was subtracted from

100 to invert the percentage.

The final ranking score for each gene was computed via a weighted combination of its score on the six ranking criteria. If a score could not be computed for a particular criterion, the entire value of that criterion was removed from the equation , and ranking was based solely on the remaining factors. Each of the ranking criteria could be weighted between 0 and 5, and weightings are relative, so that 2:2:2:2:2:2 would be the same as 4:4:4:4:4:4, etc. A zero weighting would drop the factor from the equation. For example, suppose that Gene A had the following scores: NC: 75%, CC: 50%, FT. 80%, CV: 25%, FL: 50%, and CT: 30%. Using the weightings described above (3, 1, 5, 0, 0, 0) the final score for Gene A would be calculated as follows:

(75*3 + 50*1 + 80*5 + 25*0 + 50*0 + 30*0) / 9 (NOTE: 9 is the total number of

"weightings" or 3+1+5)

(225 + 50 + 400 + 0 +0 + 0) 19

675/9 75 would be the final score for Gene A. A score was then computed for each discrete gene based on aggregating the individual values for that gene from one or more experiments where that gene had made the initial cut. The list of genes was then rank-ordered on the basis of final scores. The objective determination of how many genes to take from the top of the list to be added to the CT array was based on the number of experiments that genes showed a response in. At about gene number 450 on the list of rank-ordered genes the number of experiments that genes showed a response in started of often be only one experiment or one compound. It was desired that most genes on the array have response to different mechanisms of toxicity or different in different tissues. Therefore, the number of genes chosen from the top of the list of rank-ordered genes was 450. Since we wanted to minimize the number of duplicate genes added to an already established in-house set of rat genes (See Example 2) there were 50 genes that were excluded because of duplicity. Ultimately 400 genes were empirically chosen from the 17,241 rat gene set of microarrays as new genes for further evaluation of response to toxicity by specific toxicants and in specific tissues. These 400 genes are listed in Table 4.

Section 4. Evaluation of empirical data on specific tissue response of rat genes corresponding to the partial sequence discovered from the 17,241 gene set. a. Toxicity Studies for further evaluation of genes discovered empirically Male Spraque-Dawley rat were exposed to drugs and chemicals listed in table 3, tissues harvested, and cDNA samples prepared and hybridized following the description in Section 2 of Materials and Methods. b. Microarrays

Microarrays were printed with the 400 genes discovered empirically following the description for PCR and spotting slides in Section 1 of Materials and Methods. The washed and dried hybridized slides were scanned on Axon Instruments Inc. GenePix 4000A MicroArray Scanner and the fluorescent readings from this scanner converted into quantitation files on a computer using GenePix software. c. Analysis of quantitation files to evaluate toxicologically relevant genes Quantitation files were imported into Phase- 1 Matrix Express Software designed for analysis of differential gene expression data. The ratios if the fluorescent values of the treated and control cDNA samples hybridized on the same slide were determined for each spot and termed fold induction values (positive value for induction of gene response and negative value for suppression of gene response). These fold inductions are then normalized by the median fold induction value. The fold inductions for each gene is an average of the fold inductions for the 4 spots on the slide for each gene. If the coefficient of variance for the 4 spots is greater than 50% then the data for the gene is not entered for that gene on that slide. The Matrix Express software allows development of a warehouse containing the fold induction data from multiple experiments (microarrays). A warehouse was constructed by importing quantitation files and analyzing fold inductions for rats treated with drugs and chemicals listed in table 3. In addition, most samples were hybridized in duplicate and the data from 2 high-quality slides was averaged in the warehouse. For rats treated with every compound the liver and kidneys were always processed and evaluated for gene expression. Spleen, heart, testes, lung samples were evaluated the multiple organ toxicants. Spleen was evaluated for all immunotoxicants and 5 non-immunotoxicants, heart samples were evaluated for all heart toxicants, testes was evaluated for flutamide and all steroid compounds, lung was evaluated for all lung toxicants, and brain was evaluated for all brain toxicants. This warehouse contained approximately 2500 final experiments (primarily averages of 2 duplicate experiments to make 1 final experiment) at the time of evaluation for tissue specific response of the genes.

A gene was determined to be response in liver if it had a 2-fold induction (stimulation or suppression) in more than 1% of the experiments for liver samples.

Similarly a gene was determined responsive in the kidney if it had a 2-fold induction in more than 1% of the experiments for kidney samples. A 1% cut-off was a generous cutoff for liver and kidney because these organs were evaluated for all toxicants (including non-hepatic or renal toxicants). A gene was determined to be responsive in the heart, spleen, lung, testis, or brain if it had a 2-fold induction in more than 2% of the experiments for the respective organs. The heart, spleen, lung, testis, and brain cut-off was higher at 2% compared to 1% because there were fewer total experiments in the warehouse for each of these organs and a higher cut-off minimizes false positive results when dealing with this smaller number of experiments. Results

Discovery of 400 toxic response genes.

Four hundred genes were empirically chosen from the 17,241 rat gene set of microarrays as new genes for further evaluation of response to toxicity by specific toxicants and in specific tissues. These 400 genes are listed in Table 4.

Use of the 400 toxicology responsive genes in formation of a database demonstrating specific tissue response.

The toxicology database contained approximately 2500 final experiments (primarily averages of 2 duplicate experiments to make 1 final experiment), based on the compounds listed in Table 3, at the time of evaluation for tissue specific response of the^" genes. Table 7 shows the tissue specific response of toxicology genes chosen empirically from the 17,241 gene set demonstrated for each gene and Table 8 shows the same information from Table 7 with the genes with tissue specific response listed by tissue. Figures 1 through 6 show the differential gene expression of rats dosed with toxic compounds from this toxicology database. The differential expression between replicate microarrays, over time, between organs, and between different compounds is demonstrated in the figures showing the power of having a set of toxicology relevant genes to process rat toxicity studies with. Example 2 Production and characterization of known genes for toxicity response Section 1. Production of clones a. Identifying and isolating toxicologically relevant genes from rat or human databases One method that was used to identify and isolate toxicologically relevant genes for inclusion in a rat array was to search a public database (e.g., GenBank) for genes that have been identified as part of critical cellular pathways (e.g. metabolism, DNA synthesis). ' Once these genes were identified, primers were designed and used in an amplification process with cDNA library made from rat liver cells. The amplified product was cloned into an expression vector and sequenced to confirm that the sequence matched or was substantially similar to the gene sequence information obtained from GenBank. Confirmed amplified gene products were then incorporated into a rat array using the methods described in Example 1, section 1. Potential toxicologically relevant genes which have been identified and isolated in this manner are included in Table 4.

b. Identifying and isolating genes using de novo primers

Another method used to identify and isolate genes with some evidence of roles in critical cellular pathways was by first finding the sequence a public database (e.g., GenBank) and sequences corresponding within these genes were synthesized de novo and used in amplification reactions. The amplified product was cloned into an expression vector and sequenced to confirm that the sequence matched or was substantially similar to the gene sequence information obtained from GenBank. Confirmed amplified gene products were then incorporated into a rat array using the methods disclosed herein to immobilize the gene product, or target sequence, to a glass slide.

Section 2. Evaluation of empirical data on specific tissue response of bwwn genes a. Toxicity Studies for further evaluation of genes discovered empirically Male Spraque-Dawley rat were exposed to drugs and chemicals listed in table 3, tissues harvested, and cDNA samples prepared and hybridized following the description in Example 1, Section 2 of Materials and Methods.

b. Microarrays Microarrays were printed with the 300 genes produced as described in Section 1 of Materials and Methods in this Example 2. The washed and dried hybridized slides were scanned on Axon Instruments Inc. GenePix 4000A MicroArray Scanner and the fluorescent readings from this scanner converted into quantitation files on a computer using GenePix software. c. Analysis of quantitation files to evaluate potentially toxicologically relevant genes

Analysis of experiments in an approximately 2500 experiment warehouse produced from tissue samples from rats exposed to toxic doses of drugs and chemicals, Table 3, is the same as described in Example 1, Section 4.

Results

Potentially toxicology relevant genes which have been identified and isolated in this manner are included in Table 4. Table 9 shows the tissue specific response of genes with potential roles in critical cellular pathways demonstrated for each gene and

Table 10 shows the same information from Table 9 with the genes with tissue specific response listed by tissue. Figures 1 through 6 show the differential gene expression of rats dosed with toxic compounds from this toxicology database. The differential expression between replicate microarrays, over time, between organs, and between different compounds is demonstrated in the figures showing the power of having a set of toxicology relevant genes to process rat toxicity studies with.

Example 3 Discovery Of Novel Toxicity Responsive Genes By Transcriptome Profiling

Section 1. Identifying and isolating genes a. Processing treated and control tissue samples for RNA isolation Liver tissue from a rat sacrificed 24h after intraperitoneal injection of a toxic dose of aflatoxin Bl (1 mg/kg) and the appropriate liver tissue from the saline injected vehicle control rat were used to determine the differentially expressed genes in a rat exposed to a liver toxicant (aflatoxin). RNA was isolated from both liver samples using an RNA isolation kit from Qiagen (RNeasy Midi kit) followed by use of a Messageclean^® kit from Genhunter^®. The protocols from the MessageClean^® kit were modified to generate more optimal conditions for removing DNA contamination. Then, these ingredients were added: 50 μl total RNA, 5.7 μl lOx reaction buffer, 1.0 μl DNase 1 (10 units/μl) for a total volume of 56.7 μl. The ingredients were mixed well and incubated for 30 minutes at 37° Celsius. Then 40 μl phenol/chloroform mixture (1:1 volume) was added and the mixture was vortexed for 30 seconds and allowed to sit on ice for 10 minutes. Then the tube containing the mixture was spun in an Eppendorf centrifuge at 4 degrees for 5 minutes at maximum speed. The upper phase was collected, transferred to a new tube and 5 μl of 3M NaOAc and 200 μl 95% ethanol was added to the upper phase. The mixture was allowed to sit for at least one hour at -80° C and then spun for about 10 minutes at 4° C. The supernatant was removed and the RNA dried for a few minutes. Subsequently, the RNA was suspended in 11 μl DEPC H₂0. 1 μl was used to measure A_260/280 in 50 μl H₂0. The RNA was stored as 1-2 μg aliquots at -80°C. Immediately prior to differential display, the appropriate amount of RNA was diluted to 0.1 μg/μl with DEPC H₂0. It is important to avoid using the diluted RNA after freeze- thaw cycle. RNAimage^® kits were used and protocols from the RNAimage^® kits were altered to optimize more successful mRNA differential display. The following section describes the method by which this was accomplished:

b. Reverse transcription In a tube, the following ingredients were added: 9.4 μl dH₂0, 4.0 μl 5x RT buffer, 1.6 μl dNTP (250 μM), 2.0 μl of 0.1 μg/μl freshly diluted total RNA that was DNase- free, 2.0 μl H-TπM (2 μM) for a total volume of 19 μl. The ingredients were mixed well and incubated at 65°C for 5 minutes, 37°C for 60 minutes, 75°C for 5 minutes, and held at 4°C. After the tubes had been at 37°C for 10 minutes, and 1 μl of Superscript II reverse transcriptase (Life Technologies Inc.) was added to each reaction, and quickly mixed by finger tapping the tubes before the incubation continued. At the end of the reverse transcription, the tubes were spun briefly to collect condensation. The tubes were set on ice for PCR or stored at -20°C for later use. c. Polymerase chain reaction

The following ingredients were used for a PCR reaction: 10 μl dH 0, 2 μl 10X PCR buffer, 1.6 μl dNTP (25 μM), 2 μl of 2 μM H-AP primer, 2 μl of 2 μM H-T, _IM, 2

μl RT-mix described above (must contain the same H-TnM used for PCR), 0.2 μl α-³³P

dATP (2000 Ci/mmole), 0.2 μl Taq DNA polymerase from PE Biosystems for a total volume of 20 μl. The tube containing all these ingredients were mixed well by pipetting up and down and placed in a fhermocycler at 95°C for 5 minutes and then amplified for 40 cycles under the conditions of 94°C for 30 seconds, 40°C for 2 minutes, 72°C for 30 seconds and finally held at 4°C until the samples are removed from the thermocycler.

d. Gel electrophoresis

A 6% denaturing polyacrylamide gel in TBE was prepared and allowed to polymerize for at least 2 hours before using. Then the gel was run for about 30 minutes before any samples were loaded. It is important for all the sample wells in the gel to be flushed and cleared of all urea prior to loading any samples in the wells. About 3.5 μl of each sample was mixed with 2 μl of loading dye and incubated at 80°C for 2 minutes immediately before loading onto the 6% gel. In this example, the loading dye was xylene and after the gel was loaded with the samples obtained from the rounds of PCR, the gel was run at 60 watts of constant power until the xylene dye was about 6 inches from the bottom of the gel. Once the power was turned off, the gel was blotted onto a large sheet of exposed autoradiograph film. The gel was covered with plastic wrap and under dark conditions, the gel was placed in a large autoradiograph cassette with a new sheet of unexposed film, marked for orientation, and the film was exposed to the gel at -80°C. The exposure period can be anywhere from overnight to 72 hours. Once the film has been developed, bands of interest were identified by alignment with the developed film and subsequently isolated by cutting the band of interest out of the polyacrylamide gel with a clean scalpel blade. The isolated band was placed in 100 μl of water and boiled at 95% for 5 minutes.

e. PCR to amplify gel band PCR was set up to amplify the gel band. The re-amplification should be done using the same primer set and PCR conditions except the dNTP concentrations should be at 20 μM. The following ingredients were combined for the PCR reaction: 20.4 μl H₂0, 4 μl 10X PCR buffer, 3.2 μl of 250 μM dNTPs , 4 μl of 2 μM H-AP primers, 4 μl of 2 μM H-TnM, 4 μl template (out of the 100 μl containing gel band), and 0.5 μl Taq polymerase for a total volume of 40 μl. These ingredients were heated to 95°C for 5 minutes and then cycled for 40 cycles under the conditions of 94°C for 30 seconds, 40°C for 2 minutes, 72°C for 30 seconds followed by a final extension at 72°C for 5 minutes and finally held at 4°C until the samples are removed from the thermocycler. About 4 μl of the PCR reaction was removed and run on a 1% agarose gel to ascertain the success of the PCR reaction. Section 2. Cloning amplified fragments and Screening colonies a. Cloning amplified fragments

To clone the amplified fragments, products from different sources (e.g., GenHunter or InVitrogen) may be used to achieve the desired cloned product. In this example, InVitrogen's TOPO TA Cloning Kit® was used and the following material was combined in a reaction tube: 2 μl of freshly run PCR product, 2 μl of sterile H₂0, 1 μl of PCR-TOPO vector for a final volume of 5 μl. The combined ingredients were mixed gently and incubated for 5 minutes at room temperature. Then 1 μl of 6x TOPO Cloning Stop Solution was added and all combined ingredients were mixed for about 10 seconds at room temperature and then set on ice. One Shot™ cells were thawed on ice.

2 μl of the TOPO Cloning reaction was added to the One Shot™ cells, mixed, and incubated on ice for 30 minutes. The cells were heat shocked at 42°C for 30 seconds without shaking and incubated on ice for 2 minutes. Then 250 μl of room temperature SOC was added to the heat shocked cells and mixed. The cells were then placed at 37°C for 30 minutes. About 50-100 μl of the cells were spread on 2 XYT plates containing 100 μg/ml ampicillin and X-gal. The plates were incubated overnight at 37°C and the next morning, 3 white colonies were selected for analysis.

b. Screening colonies for correct recombinant plasmids PCR was used to ascertain whether the white colonies selected contained the correct recombinant plasmid. The following ingredients were combined for the PCR reaction: 21 μl H₂0, 2.5 μl 10X PCR buffer, 0.12 μl of lOmM dNTPs, 1 μl of 25 ng/μl T7 primer, 1 μl gene specific left or right primer at 25 ng/μl, template (a toothpick was " used to transfer colony from transformation plate to tube by swishing the toothpick around in the reaction mix), and 0.5 μl Taq polymerase for a total volume of 25 μl. The reaction mix was run at 95°C for 5 minutes and then cycled 35 times under the conditions of 95° C for 30 seconds, 45°C for 30 seconds, 72° C for 30 seconds, and followed by 72° C for 5 minutes and finally 4°C until samples are removed from the thermocycler. About 4 μl of the PCR product was removed and run on a 1% agarose gel to ascertain the success of the PCR reaction. Bacterial colonies corresponding to the colonies which yielded positive PCR results were grown overnight in LB media containing 100 μg/μl ampicillin at 37° C with constant shaking. Plasmid DNA were isolated from the overnight cultures and sequenced using a T7 primer. Sequences were then compared to sequences in the GenBank database to confirm that the correct gene fragment was cloned. Gene fragments were then amplified by PCR from the plasmid DNA. The unincorporated primers and dNTPs were removed and the resulting gene fragments were arrayed on glass slides for the purposes of measuring differential gene expression using the Phase- 1 Molecular Toxicology Microarray products.

Results RCT-289 and RCT-290 are the two toxicologically relevant genes identified using methods disclosed in this example. The gene sequences are listed in Table 4. Example 4. Real Time PCR reaction Materials and Methods

Total RNA was isolated from tissues and/or organs from rats dosed with toxic compounds listed in Example 1, Section 3, and then the mRNA within this total RNA

was converted into cDNA using 3 μg total RNA and 1.5 μl random hexamer primers.

After a 10 minute incubation at 70°C, the following components were added to the

reaction mixture: 6 μl of 5x first strand buffer, 3 μl 0.1 DTT, 1.5 μl 1 OmM dNTPs, 1.5

μl Superscript enzyme, and 6.5 μl DEPC-treated water. The reaction was incubated for

two hours at 45 °C and 1 μl of this reaction was used for the Real Time PCR (RT-PCR)

assay. For the RT-PCR assay, 50 μl reactions were set up with Rnase-free water,

Taqman® Universal PCR Master Mix (available from Applied Biosystem), target, and control primers /probes and cDNA. This method measures PCR product accumulation with a dual-labeled fluorogenic probe. The probes are labeled with 6-FAM on the 5' end and TAMRA on the 3' end. TAMRA is a quencher dye. This assay exploits the 5'- 3' exonuclease property of Taq polymerase. When the probe hybridizes to its target the reporter dye (FAM) is cleaved by the 5' exonuclease activity of the Taq polymerase and can emit a fluorescent signal. With increasing cycles of amplification, more signal is emitted and detected using an ABI 7700 sequence detector. For each gene, a set of two primers and a fluorogenic probe are designed and synthesized. For quantitation of mRNA, optimal design for probes and primers requires primers to be positioned over exoh-intron junctions. This step rules out amplification of contaminating genomic DNA. For our studies, primer and probe sets have been designed for 16 genes that are part of the 700 rat toxicologically relevant gene array, also referred to herein as "comprehensive toxicity anay" or "CT anay". These genes were up-regulated or down-regulated by toxic drugs/chemicals in rats exposed in vivo or rat cells exposed in culture. The probes and primer sets were tested for their ability to amplify genomic

DNA. If genomic DNA was amplified the probes and primers for that particular gene were not used for the RT-PCR assay. Results

Real-time PCR analysis was performed using RNA from the same rats that were dosed with various toxic chemicals/drugs used for CT array studies. Figures 7, 8 and 9 show the results of linear regression analysis of TaqMan vs. CT array data for 42 toxic chemicals/drugs. There is an excellent correlation (r=0.97395) between TaqMan data and CT array data for Cytochrome P450 1A2 (Figure 7). Analysis of TaqMan and CT array data for Fatty Acid Synthase showed a correlation of 0.86346 (Figure 8). Comparison of TaqMan and CT array data for Multidrug Resistant Protein- 1 produced a correlation of 0.73414 (Figure 9).

Example 5 Isolation of total RNA from adherent cultured cells

Total RNA of high quality and high purity was isolated from cultured cells by using Qiagen RNeasy midi kits and 2-mercaptoethanol. Precautions were taken to minimize the risk of RNA degradation by RNases by wearing gloves, treating work areas and equipment with an RNase inhibitor, for example, RNase Zap (Ambion® Products, Austin, TX) and keeping samples on ice. This total RNA isolation technique

was based on a Qiagen® RNeasy® midi kit and was used with some modification for

HepG2 (human hepatocyte) cells in T-75 flasks and maxi kit RNA isolation for cells in

T-175 flasks. Cells were checked under the microscope to make sure that they were viable.

Cells were dosed with an agent, which could be a drug, chemical, or pharmaceutical

composition, when they reached 60-80% confluence. It is preferable to avoid isolating

RNA from flasks that have reached 100% confluence.

For adherent cells, media was discarded and flasks were washed with lx cold

PBS twice (20 ml then 10 ml for T-75 flasks; 40 ml then 20 ml for T-175 flasks). After the second PBS wash, the remaining PBS was removed with a pipette. Freshly prepared

RLT buffer (RLT buffer requires the addition of 10 μl beta mercaptoethanol for each 1.0 ml RLT) was added directly to the cell culture flask. T-75 flasks received 3 ml RLT buffer and T-175 flasks received 5.0 ml RLT buffer. It is preferable to lightly agitate the flasks at this point. Flasks were lightly agitated to distribute the RLT buffer and the cells became a gelatinous layer. The cells were allowed to sit for 4 minutes, then fluid was withdrawn and placed in RNase- free tubes. An equivalent volume of 70% ethanol was added to each tube and vortexed to distribute evenly. If a precipitate with a string¬

like appearance forms, it is acceptable to remove and discard this string-like precipitate. The fluid was applied to a spin column and spun for 5 min at 3650 rpm in the Beckman

GS-6 (or a similar centrifuge). The flow-through was discarded. About 4 or 15 ml (T- 75 or T-175, respectively) of RWl buffer was applied and spun for 5 min at 3650 RPM. The flow through was discarded. About 2.5 ml RPE buffer (midi columns) or 10 ml RPE buffer (maxi columns) was applied and centrifuged for 3 minutes. The flow- through was discarded. Another 2.5 or 10 ml buffer RPE was applied and centrifuged for 5 minutes to dry out column before proceeding to the elution step. The column, including the tip, should be dry for the next step.

The column that has the RNA bound to it was transferred to a clean tube for elution. Then 150 μl of RNase-free water was added to midi columns and 500 μl of RNase-free water to columns, allowed to sit for 2-4 minutes and spun for 3 min at 3000 x g (3690-3710 rpm, Beckman GS-6 or a similar centrifuge). The elution was repeated with another 150μl or 500 μl of RNase-free water into the same tube. The elution was precipitated using the LiCl precipitation protocol, exemplified in Example 2, and resuspended in RNA storage buffer.

To measure yield, the O.D. reading was taken at 260 nm. About 2.0 μl RNA was added to 98 μl H2O and the O.D. reading was taken and calculated as follows:

(Absorbance) x (dilution factor) x (40V1000 = amount of RNA in μg/ml Example: absorbance = 0.45 dilution factor = 50 (0.45) x 50 x 40 = RNA concentration in μg/ml 1000 The yield should be between 200-400 μg of total RNA from a T-75 flask with greater than 50% confluency. The sample was stored in -80°C freezer.

Claims

CLAIMS What is claimed is:

1. A method of evaluating the toxicity of an agent, comprising the steps of: (a) exposing a test animal to the agent;

5 (b) measuring the expression of one or more toxic response genes selected from the group consisting of the genes corresponding to the partial gene sequences in Tables 6, 7, 8, 9, and 10 in the test animal in response to the agent, thereby generating a test expression profile; and (c) comparing the test expression profile with a reference expression profile

[0 indicative of toxicity, wherein toxicity of the agent is evaluated by determining whether a significant correlation exists between the test expression profile and the reference expression profile.

2. The method according to claim 1, wherein the genes corresponding to the partial gene sequences are responsive in kidney.

15 3. The method according to claim 1, wherein the genes corresponding to the partial gene sequences are responsive in liver.

4. The method according to claim 1 , wherein the genes corresponding to the partial gene sequences are responsive in spleen.

5. The method according to claim 1, wherein the genes corresponding to the partial 0 gene sequences are responsive in heart.

6. The method according to claim 1, wherein the genes coπesponding to the partial gene sequences are responsive in brain.

7. The method according to claim 1, wherein the genes conesponding to the partial gene sequences are responsive in lung.

8. The method according to claim 1, wherein the genes conesponding to the partial gene sequences are responsive in testis.

9. The method according to any one of claims 1-8, wherein the test animal is a rat.

10. The method according to any one of claims 1-8, wherein the test animal is a dog.

11. The method according to any one of claims 1 -8, wherein the test animal is a non- human primate.

12. The method according to any one of claims 1-8, wherein the test animal is a human.

13. The method according to claim 1, wherein the agent is administered at various dosages or for various lengths of time.

14. A method of evaluating the toxicity of an agent, comprising the steps of: (a) exposing a test animal to the agent;

(b) measuring the expression of one or more toxic response genes selected from the group consisting of the genes conesponding to the partial gene sequences in ^' Tables 6, 7, and 8 in the test animal in response to the agent, thereby generating a test expression profile; and (c) comparing the test expression profile with a reference expression profile indicative of toxicity, wherein toxicity of the agent is evaluated by determining whether a significant correlation exists between the test expression profile and the reference expression profile.

15. The method according to claim 14, wherein the genes conesponding to the partial gene sequences are responsive in kidney.

16. The method according to claim 14, wherein the genes conesponding to the partial gene sequences are responsive in liver.

17. The method according to claim 14, wherein the genes conesponding to the partial gene sequences are responsive in spleen.

18. The method according to claim 14, wherein the genes corresponding to the partial gene sequences are responsive in heart.

19. The method according to claim 14, wherein the genes corresponding to the partial gene sequences are responsive in brain.

20. The method according to claim 14, wherein the genes conesponding to the partial gene sequences are responsive in lung.

21. The method according to claim 14, wherein the genes corresponding to the partial gene sequences are responsive in testis.

22. The method according to any one of claims 14-21, wherein the test animal is a rat.

23. The method according to any one of claims 14-21, wherein the test animal is a dog.

24. The method according to any one of claims 14-21, wherein the test animal is a non- human primate.

25. The method according to any one of claims 14-21, wherein the test animal is a human.

26. The method according to claim 14, wherein the agent is administered at various dosages or for various lengths of time.

27. A method of evaluating the toxicity of an agent, comprising the steps of:

(a) exposing a test animal to the agent;

(b) measuring the expression of a set of toxic response genes selected from the group consisting of the genes conesponding to the partial gene sequences in Table 4 in the test animal in response to the agent, thereby generating a test expression profile; and

(c) comparing the test expression profile with a reference expression profile indicative of toxicity, wherein toxicity of the agent is evaluated by determining whether a significant conelation exists between the test expression profile and the reference expression profile.

28. The method according to claim 27, wherein the set of toxic response genes consists of at least 25 genes.

29. The method according to claim 27, wherein the set of toxic response genes consists of at least 50 genes.

30. The method according to claim 27, wherein the set of toxic response genes consists of at least 100 genes.

31. An anay comprising one or more polynucleotides selected from the group consisting of the genes corresponding to the partial gene sequences in Tables 6, 7, 8, 9, and 10 or fragments of at least 20 nucleotides thereof.

32. The array according to claim 31, wherein the genes conesponding to the partial gene sequences are responsive in kidney.

33. The anay according to claim 31, wherein the genes conesponding to the partial gene sequences are responsive in liver.

34. The anay according to claim 31, wherein the genes conesponding to the partial gene sequences are responsive in spleen.

35. The array according to claim 31, wherein the genes conesponding to the partial gene sequences are responsive in heart.

36. The array according to claim 31, wherein the genes conesponding to the partial gene sequences are responsive in brain.

37. The array according to claim 31 , wherein the genes conesponding to the partial gene sequences are responsive in lung.

38. The array according to claim 31, wherein the genes conesponding to the partial gene sequences are responsive in testis.

39. An array comprising one or more polynucleotides selected from the group consisting of the genes conesponding to the partial gene sequences in Tables 6, 7, and 8 or fragments of at least 20 nucleotides thereof.

40. The array according to claim 39, wherein genes conesponding to the partial gene sequences are responsive in kidney.

41. The array according to claim 39, wherein the genes conesponding to the partial gene sequences are responsive in liver.

42. The array according to claim 39, wherein the genes corresponding to the partial gene sequences are responsive in spleen.

43. The array according to claim 39, wherein the genes conesponding to the partial gene sequences are responsive in heart.

44. The array according to claim 39, wherein the genes conesponding to the partial gene sequences are responsive in brain.

45. The array according to claim 39, wherein the genes conesponding to the partial gene sequences are responsive in lung.

46. The array according to claim 39, wherein the genes conesponding to the partial gene sequences are responsive in testis.

47. An array comprising one or more polynucleotides selected from the group consisting of the genes conesponding to the partial gene sequences in Table 4 or fragments of at least 20 nucleotides thereof.

48. The array according to claim 47, wherein the set of toxic response genes consists of at least 25 genes.

49. The array according to claim 47, wherein the set of toxic response genes consists of at least 50 genes.

50. The anay according to claim 47, wherein the set of toxic response genes consists of at least 100 genes.

51. An anay comprising a set of polynucleotides of at least 20 nucleotides in length substantially homologous to a set of toxic response genes selected from the group consisting of the genes corresponding to the partial gene sequences in Tables 6, 7, and 8.

52. An anay comprising one or more polynucleotides which are homologous to the polynucleotides of the anay of claim 31.

53. The array according to claim 52, wherein the polynucleotides conespond to human genes.

54. The array according to claim 52, wherein the polynucleotides conespond to murine genes.

55. The anay according to claim 52, wherein the polynucleotides correspond to non- human primate genes.

56. The array according to claim 52, wherein the polynucleotides conespond to canine genes.

57. An array comprising one or more polynucleotides which are homologous to the polynucleotides of the array of claim 39.

58. The array according to claim 57, wherein the polynucleotides conespond to human genes.

59. The anay according to claim 57, wherein the polynucleotides conespond to murine genes.

60. The anay according to claim 57, wherein the polynucleotides conespond to non- human primate genes.

61. The anay according to claim 57, wherein the polynucleotides conespond to canine genes.

TABLE 1

Generic Name

ritodrine tetracyclines verapamil rosiglitazone theophylline vincristine salicylates thiamine warfarin salmeterol thiazide xartfhine saquinavir thioguanine xylometazoline scopσlamine thiopurine zafirlukast seldane thiothixene zaici^'tabine selegiline tiagabine zidovudine sertraliπe tϊ opidfne zolpidem sibutramine tienilic acid sildenafil citrate timolol simethicone tiopronin si vastatin tirofiban s-mephenytoin tobramycin sodium ferric gluconate tobramycin/dexamethasone so an tocainide somatostatin tolbumamide sotalol tolcapone spironolactone tolterodine stanol esters topotecan streptozotocin tαremifene succinimide tramadol sucralfate trandolapril sulfacytine trastuzu ab sulfadoxine trazodone suifamethoxazole tretinoin sulfamethoxazole triamcinolone sulfasalazine triamterene/HCTZ sulfinpyrazone triamterine sulfisoxazole triamterine sumatriptan triazolam

(s)- warfarin trihexyphenidyl tacrine trilostane tamoxifen trimeth/sulfa eth tamsulσsin trimethobenzamide telmisartan trimethoprim temazepam troglitazone terazosin trovafloxacin terbinafine HCI urokinase terbutaline sulfate ursodio) terfenadine valproic acid terpin hydrate valsartan testolactone vancomycin tetracycline HCI venlafaxine TABLE 2 Industrial Chemicals

1 ,2-Dibromomethane Cyclophosphamide Monobromomethane

2,4-dinitrotoluene DDT Monochlorobenzene

2-methylpentane DEHP n-hexane

3-methylpentane Dichlorobenzene Nickel

4,4'-methylene bis Dichloromethane Nitrobenzene

7, 12- Dieldrin Nitroglycerine dimethylbenz[a]anthracene Diethylamine Nitrous oxide

Acetone Diethystilbesterol Organophosphorus

Acrylamide Dimethylacetamide Parathione

Acrylonitrile Dimethylformamide Pentachlorophenol

Apha methylstyrene Dinitroorthocresol Phenol

Aluminum Dioxane Phtalic anhydride

Aniline Endrin Polychlorinated biphenyl

Antimony Enflurane Polycyclic hydrocarbons

Arsenic Ethylbenzene Propyleneglycol

Barium Ethylene oxide Selenium

Baygon Ethyleneglycol dinitrate Silver

Benzene Ethyleneglycol(s) Stryrene

Benzidine Fluoride Synthetic pyrethroids

Beryl ium . Furfural T-butylhydroperoxide

Bta-napthylamine Furfuryl alcohol TCDD

Biphenyl Germanium Tellerium

Cadmium Halothane Tert-butylphenol

Carbamate(s) Hexachlorobenzene Tetrachloroethylene

Carbaryl Hexachlorobutadiene Thalium

Carbon disulfide Isopropanol Toluene

Carbon monoxide Isopropylnitrate Toluene diisocyanate

Carbon tetrachioride Lead Trichloroethane

Chloroform Lead tetraethyl Trichloroethylene

Chromium VI Lindane Triethylamine

Cobalt Maleic anhydride Triethylbenzenes

Copper Manganese Uranium

Cumene Mercury Vanadium

Cyanamide Methanol Vinyl chloride

Cyanides Methylchloride Xylene

Cyclohexane Methylethylketone Zinc

Cyclohexanone Methylmercury Table 3. List of compounds dosed in rats for toxicity studies

Liver Immuno / Bone Marrow chlorpromazine cyclosporin A clofibrate hydroxyurea clofibric acid phenylhydrazine diflunisal dexamethasone tetracycline estradiol erythromycin tamoxifen ethanol azathioprine chloroform busulfan alpha-naphthol isothiocyanate 5-fluorouracil dimethylnitrosamine benzene isoniazid cyclophosphamide carbon tetrachloride clozapine ketoconazole thalidomide cycloheximide dipyrone acetaminophen prednisone bromobenzene benzo-a-pyrene Brain aflatoxin naloxone phalloidin phenobarbital

2-AAF vincristine colchicine thioacetamide Heart valproic acid doxorubicin atorvastatin theophylline lovastatin quinidine simvastatin nifedipine caffeine

Kidney cisplatin Lung gentamicin carmustine puromycin Paraquat amphotericin B streptozotocin Multiorgan ganciclovir lipopolysaccharide indomethacin methotrexate mercuric chloride cadmium chloride naproxen

Testes flutamide Table 4 Phase-1 Rat CT Gene Names, Accession Numbers, and Sequences

CTCTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATT

TGGCCCTCGAGGCCAAGAATTCGGCACGAGGCTGGTCCACTAAC

TCCAGGGACTGTGGGACAGAGGAACAAACAAGAAAGAACTCGAG

GCCTCGCTGAGTGGCGCGCTTGCTGAGTGCTGCCACATCCCGC

AAGCTGAGCAGGTATCCCAACTCTGTTCCTGCCCGGTAGACCAC

CCGAGGTGGTGAGTGTGGTCTTGTCTTCCAGATTCGTAGGACAG

AAGCTCCAGGAGGAGGACCCGCCCAACATGGCATCGGAGAGCG

Argininosuccinate

D13978 GGAAGCTATGGGGTGGCCGATTTGCAGGCTCGGTCGACCCCAC SEQ ID NO:20 lyase

CATGGACAAGTTCAACTCATCTATCGCCTATGACCGGCATCTGTG

GAATGTGGACCTGCAGGGAAGCAAGGCCTACAGCAGGGGCCTG

GAGAAGGCAGGGCTTCTCACCAAAGCTGAGATGCAGCAGATACT

GCAAGGCCTGGACAAGGTGGCTGAAGAGTGGGCCCAAGGCATC

TTCAAATTGTACCCTAATGATGAAGACATCCACACGGCCAACGAG

CGGCGCCTGAAGGAACTCATTGGTGAAGCTGCAGGGAAGTTACA

CACAGGCAGAAGTCGCAA

TCTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTT

GGCCCTCGAGGCCAAGAATTCGGCACGAGGGTGACAAAGAGGC

GCGGGCCTCCCCGCTCTGCAGCTCTCCCAGGCTCCAGCATTAAT

TGTTGTGATAAATTTGTAATTGTAGCTTGTTCTCCTACCACCTGAC

Arginosuccinate

M36708 TGGGGCTGCTGTGCCCCCCCTCACCTCCCCCCCACCCACAGGC SEQ ID NO:21 synthetase 1

TTTGTTCCCTGGTCCCCTATAGCCTACAAAAGTGGTCATCGAAGG

GAAGGGGGGGTGGCAGGCAGCTGCAGAAAGCGCGTAAAATGAC TTAAAAG GTTACATTAGTCTTTCATTTGTCAAAAAAAAAAAAA

AAAAAAAAAAA

CTTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTT

GGCCCTCGAGGCCAAGAATTCGGCACGAGGCAAAAACTGGAAAC

TCCTCACGGGCTACCCAGGCTGTGGTTACTGGTTCCCGCCACCG

TCTCAGTCCAACATCTCTGAGGTACCTTCAGTGGACTCACCAACC

AAGACTCTCTGGCTCTTTGACATCAATCGGGACCCTGAAGAAAGA

CATGACGTGTCCCGGGAACATCCCCACATCGTCCAGAACCTTCT

Arylsulfatase B D49434 TTCCCGCCTACAGTACTACCATGAACATTCTGTGCCTTCTTACTTC SEQ ID NO:22

CCACCTTTGGACCCCCGCTGTGATCCCAAGGGTACCGGTGTATG

GAGCCCCTGGATGTAGGGCTCAGGGGAGGTGGGGCTGGAGTAC

ATTTCTGTGCAGGCTAGCCCTCAGGCCCATACTCTCCTGGCTTCT

CCATCATCCCCCACCCTGTCACCTGGCCCTCACGCTGTATAACC

CACTGAGGGAGTCCAATTTCAACCCACAGTACATTTTTAAAGCCA

GTAAMTCTGGAAGGATCCTGANAAACAAAAA

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGAGAGCTCTGTATTTTT

CACTTCTCACTTAGATCTAAACTTGGAAACTTTTCTCAGAAGTTAA

GTGTCCTTTGACCTCCTCTCTTCTGAATTGCAGAAACCAGACCAG

ATTTTGGTATTTGGTAAAATGACTTCTTGTGTTGCTGAAGAACCTA

TTAAAAAGATTGCCATCTTCGGAGGGACTCATGGAAATGAACTGA

CTGGAGTGTTTCTAGTTACTCACTGGCTAAAGAATGGCGCTGAAG

TTCACAGAGCAGGGCTGGAAGTGAAGCCATTCATTACCAACCCA

Aspartoacylase NM 024399 SEQ ID NO:23

AGAGCGGTGGAGAAGTGCACCAGATACATTGACTGTGACCTGAA

CCGTG I I I ITGACCTTGAAAATCTTAGCAAAGAGATGTCTGAAGA

TTTGCCGTATGAAGTGAGAAGGGCTCAAGAAATAAATCACTTATT

TGGTCCAAAAAATAGTGATGATGCCTACGATGTCGTTTTTGACCT

TCATAACACTACTTCTAACATGGGTTGCACTCTTATTCTTGAGGAT

TCCAGGAATGACTTTTTAATCCAGATGTTTCACTATATTAAGACCT

GCATGGCTCCATTACCCTGCTCTGTTTACCTCATCGAGCCATCCT

TCCTCAANGGGGGGGGGGGGGG

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGGACCTTTGGGACTGAC

CCCTGCCTCCACTCTCATGATGCCCTATACTATTCCCCTTAAGGT

CTAGGATGAATTTGTATCCTGTCCATTGAAATGTGTCATCCAGTAT

ATTCCAGATGCTGCTGGCCTAAACTTGTCTGAGGAAGGGGTTGTT

ACTCACCTCTTCAAAATGAGTGGATTCCTGCTTGTTTGCTTTTAAC

ATP-stimulated AGCTCAGATGTCTTTTCTACATATTAGAAGACCACAACACCACTG glucocorticoid- GATATTTCAATGGAAACGTCTAAAGCATTATTGGATAATAACTTGC

NM 024381 SEQ ID NO:24 receptor translocation TATTCTTGTTGCTTAGACATTTTCTGTACAGTGTTTGCCAAAATTG promoter (Gyk) AAATTTTTCAGGTGTTTTACACTGTCTCACTAATTGTCATGGTTCA

TGGCTTTCTGTCTGGATCTTACAGGGATAGATAGAATACTTTCTTT

TTCTGCT I^' I I TTTTCATTCCTCCTTTTTATATTTTTACTCTGTATGT

ATAACATACATACCTATATATTTTATATGCTGAGGGTAGCCCATTT

TTAAATTAAGAGCACATTATATTCAGTAAGTTATAAGAGGGCTGGT

CTTAAGTGGACTACTATGTATATAAATTTGAGGGGGGCAAGCTGT

ACACATTTTTGGGCAACNGTTATGCATAT

ill

CTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGGTCTCCTTCACTTCG

CCCTCCAGCCGCGGTGGCTGCAGCGCAACTTCCAGATAGCGGA

GTGGCCTCAGCTGCGAGCCGAGCGGTGGCGGCAGCGCCCCTCA

GGACACCCGCAGATCACCTTTTCCCCGCGACTTCGCCATGGCTG

AATGTTGTGTACCGGTATGCCAACGGCCAATTTGTATCCCTCCAC

Voltage-dependent CCTATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAG

GATTTGGTTTTGGGTTGGTAAAGCTGGATGTGAAAACGAAGTCAT SEQ ID NO: anioπ channel 2 NM 031354 GCAGTGGTGTGGAATTTTCAACATCTGGCTCATCTAATACAGACA 154

(Vdac2) CTGGTAAAGTCAGTGGGACCTTGGAGACCAAGTACAAATGGTGT

GAGTATGGTCTGACTTTCACAGAGAAATGGAACACTGACAACACT

CTGGGGACGGAGATTGCAATTGAAGACCAGATTTGTCAAGGTΓT

GAAACTGACCTTTGACACCACGTTTTCACCAAACACAGGAAAGAA

AAGTGGTAAAATCAAGTCTGCTTACAAGANGGAATGTATAAACCT

TGGCTGTGATGTTGATTTTGATTTTGCTGGGACCTGCCATCCATG

GGTCACCCGTNTTTGGNTACGGGGGGGGGGGGGGNG

AGGTGTGNAAATGACCGAGGAACTCAGATTTCTTGAATTGACTAA

GACTTCACCAATGGGGTCAGAGGTAAACTTTGGTCGTGGGCGAA

AGTTCNTCCGAACTGTCTGAAGATTCGCTGCTGACATCAGAGTTC

AGGCTATTGGTCTCTAAGTTATAATTAAAGCCGGAGCTGATCAGA

GAGTCCTCTGGGGGACTAGAAGAAATCTTCAGTTCTGATTCCTCC

TTCCTCTCCCGTGCTAGAATGATTTTGGTCCACAGGTCTTCCTGG

TTGTCAAATTTTATCTCAGAGGCTGACACGTAGCAGGGCTCACTC

TGAAGATAGCGTTCCAACTCCAGGCAGGTCTGTTGCCAATATTCC SEQ ID NO:

Zinc finger protein AF001417

TCCAGGGACGGCAGAGCCGAGAAGTAGCCCGTTTCGTGCACAAT 155

CTGTAGTTCCTGGAAGATGCTACACATTGGGAGCACATCCATGTC

GGGTTGGAAAAGACAGTCCCCGCTGTCGGGAAAACAGGGAGGT

GAACGATCAGGAGTCGGAGCAGAAACTGTTCCCGGGAGCGCAG

GTGAAAGTTTCATGCAAACTGGATGGCGCTGCAATCGGACGCCG

GGTCCGGACCCTCCCGCAGCCCGCAGCGCGCCGAGCCCACGCA

ATATTTGCCTCGTGCCGAATTCTTGGCCTCGAGGGCCAAATTCCC

TATAGTGAGTCGTATTAAATTCGTAATCATGTCATANNNNG

Genes Discovered by Empirical Data that do not match the sequence of a known gene

TCTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTT

GGCCCTCGAGGCCAAGAATTCGGCACGAGGGTCACACGTCACTT

TCCAATTCTGCCCCCACTCCAGGGCTGGCTCCTCCCCCTTCACC

CTCCAGGGCTGGCTCCTCCCCCTTCACATTCCAGGGCTGGCTCC

TCCCCCTTCACACTCCAGGGCTGGCTCCTCCCCCTTCACACTCC

AGGGCTGGCTCTTCCCTCTTCACTGCTTTGTGACTCTGGTTTTrA

TTTCTGAATAAAAAAAAAAAAAAAATCCCGTGTGCCATTCCCACTC

TCCCAGTGTTGCTATTGTGTGGAATGAGGTCACAGGAGGACGAG SEQ ID NO:

Phase-1 RCT-002

TCCTCCACAATAAAMCCTCTCTTTTCCTTTAAAAAAAAAAAAAAA 156

AAAAAAAAAATGGAAGCGGCCGCAAGCTTATTCCCTTTAGTGAGG

GTTAATTrrAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGAC

TGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACAT

CCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCG

ATCGCCCTTCCCAACAGTTGCGCACCTGAATGGCGAATGGGACC

CGCCCTGTANCGGCGCATTAACGCGGCGGGTGTGGNGGNTACN

CCACGTGACCGCTACACTTGC

TTATCCATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGGTGAGGTGTTCTCGTG

GTTACGATAGGTCTCTTCCCTGTGATATTCATTTGCAGATGGCTG

GACTGATCAAGCAGTACAGAATGGAGGTCGGAGGGAGAGAAGG

TCCTCCAGGGAGATGAGAAATCGCCGAGCACCTTAAGTCTCAAG

GTTTGCTGACGGCCAAGACCAGGCTTTGAATGAATGGTGAACTC

AGAGGGGAGCGCGTTGGCCTGAGGAACCCACGGATGCCAGTGT

TGGTCTATTCTTGCTTTCAGGTACCCCTTGGAACACAGAATAGCA SEQ ID NO:

Phase-1 RCT-049

GTCTAGTCCTGCTGCCACCCCCACAAGGCTGGGCATGGTTCAAA 193

GGCATGCAGGATGCAAAGAAGAGTCAGCTTTGGCTGGGGAGGA

GTGGTTTGGTGTACACTGCTACTGAAATAGAAACTTTTGGCCTTC

TGTCTGTAGAAATAAAAATCTGACTTGGTGATGTTTTTAAAAAAAA

AAAAAAAAAAAAAACATTGCGGCCGCAAGCTTATTCCCTTTAGTG

AGGGTTAATTTTACTTGGCACTGGCCGTCGTTTTACAACGTCGTG

ACTGGGNAAAACCTGGCGTTNCCCAACTTAATCCCTTGCACACAT

TCCCCTTTCGCCAGT

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGGCAATCATGGCTCCG

GGTTGGCCGCGGCCTCTGCCGCAGCTCCTCGTGTTGGGATTCG

GGTTGGTGTTGATACGCGCCACGGCCGGGGAGCAAGCACCAGG

CAACGCCCCATGCTCAAGCGGCAGCTCCTGGAGCGCGGACCTC

GACAAGTGCATGGACTGCGCTTCTTGTCCAGCGCGACCACACAG

CGACTTCTGCCTGGGATGCGCAGCAGCACCTCCTGCCCACTTCA

GGATGCTATGGCCCATTCTGGGAGGCGCTCTTAGTCTGGCCCTG SEQ ID NO:

Phase-1 RCT-050

GTTTTGGCGCTGGTTTCTGGTTTCCTGGTCTGGAGACGATGCCG 194

CCGGAGAGAAAAGTTTACTACCCCCATAGAGGAGACTGGTGGAG

AAGCTGCCCAGGTGTGGCACTGATCCAGTGAGGAGCACCCGCG

CTGGTGCCCATTCATCGTCCATTCATTCATTCTGGAGCCAGCCTG

GCTTTCCAGAGACAAGCCGCGCCAGACTCTTCCAACCACAAGGG

GGTGGGGCGAGGTGGTGATTCACCTCCAAGGACTGGGCTTANG

GTTCAGGGGANCCTTCCAGGGTGTCTAATTGCCCTGTCTCTGGN

TCTGGGGCAGACAGANANCCTCAAGCTAGGTCACAA

GACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGGCC

CTCGAGGCCAAGAATTCGGCACGAGGGCAAAAGCCCACTTTGCC

ATTATATTTGTAGGTGTAAACATAACA l I I I7CCCTCAACACTTCC

TAGGATTAGCGGGGATACCTCGTCGTTACTCTGATTATCCAGATG

CTTACACCACATGAAATACAGTCTCCTCTATAGGCTCATTCATCTC

ACTTACGGCCGTCCTTGTAATGATCTTCATGATTTGAGAAGCCTT

CGCATCAAAACGAGAAGTACTCTCAATTTCCTACTCCTCAACTAA

CCTAGAATGACTGCATGGATGCCCCCCACCCTACCACACATTCG SEQ ID NO:

Phase-1 RCT-051

AAGAACTTCCTACGTAAAAGTTAAATAAGAAAGGAAGGATTCGAA 195

CCCCCTACAACTGGTTTCAAGCCAATTTCATAACCATTATGTCTTT

CTCAATAAAAAAAAAAAAAAAAAAAAAACAATTGCGGCCGCAAGC

TTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGCCGTC

GTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT

AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG

CGAANAAGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAACC

TGAATGGCGAATGGGACC

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGGCACGGTTCCATGTCA

CAAACAGAAAGGTCAGGAACACTGAGGTCTGTGAATGTCACTGC

TGCAGCGAGGTCATGTCACTCCTCTGTCTACTCTGTCAAGTGTCT

TACTCTACTGGACGCCAGATAGAAACTTAAGGTAACTTCTGACAT

GTGTCAGTCTAACAATAAACTAGGGCTTCGTCATCTTCTGGTTGG

TAAAAGATGTGGTCCAGAGAACGTAGGAACATGCCTGGAGAGAC

CTAATGTGCTCTTGTTCTGCAAACCCATGGGCATTATTTCCCTCT SEQ ID NO:

Phase-1 RCT-052

CCGCTCAAGAGCTCATACTGGAAGCATGCTGACCACCTGGCTGG 196

AATTCGAAAACCTCAAGCCTGAAGGCAAAGTGCAGCACATGTCT

GTGGAGAAATGGCAAGCGGTCGAGATGAGGGTGTAAAGGATATT

GGGGTATGGCATAAAGACAGGCAGGTTGCAGAAAAGCTCAGATC

TTTCCCCGTGGTTGACTGTGCTAGAAAAACTGTTTGAAGCAGGGC

GTAGGGAAAAGCGGGATTAAAGAGTACTACCTTTATTACTCCTTC

CCTCCAGAATANGTGCAAATCCCTCACCATGCCCATTTCCTGCCA

CCTGGGGGTAAGGATGTGGCAC

TTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGGCAGTTTGATGCTGT

GTTCGCCGTAGAGCAGTAGTTCTCTACGTGTGGGCCGTGACCCT

TTTGGGAGCCACACCTCAGATAGTTACCTTACAATTCATAACGGT

AGCAAAATTAGTTATGAAGTAGCAACATAGAAAATTTTATGGTTGG

GGTCACCCAAGGATAAAGAACTGTATTAAAGGGTCATAGTGTTTG

GAAGGTTGAGGACCAGTGAATTAAGTGGAATTTTTACACTAAGAG

AGTGGTAGAACCAGGATGCAGGCAGTGTACACATTGTTGGGGAG

SEQ ID NO:

Phase-1 RCT-081 CTGCAGGCTCAGTTCTCAGGACAGGACCTGGATGCGGGCAGAG 225

TGCAGTGTTGGGGAGCTGTGGGTAACAGTCACTTAAGTGGGTTG

ATCAAAACGTGAACACTACCTCCATGCCAGACAAGGGCCTTGCT

GATGATACAGGGACGGCAAGATTGGAACACGGCAACAGCTCTGA

AGCCTGTGGCCCTGACCAGTGAGCCCCGCCTTCTCACAGGCTGC

CAGCACCCANGCAGCTGTNCCGCCTCTGTCTGCACCTGCTCTAG

CCGGCCACACATCTTCATCANTTGGGATTGGGATTGANCCTGAN

CTGCCGGTGTCTGTAATTATCTAATTTCGCTGGNGGNATTCCACC

ANCCTCTG

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGGGAAGAAGAAGCTGA

CAACAAAGACTTCAAAGAAGATGGAGAGAAAGGGGAGCCTGTGA

GCACTGTCTAGATCTGCCCTCTGTGAGATCATAATTTGGTAACAC

GTACCTTCCTGTTGTAATGTTAATAGAGATAAATA I I I I I ATCAGA

TATTTTATAAACAGTGCTTTTCTTTAGCATCATTCAATCTCAGATCA

TCATCATACCAGTTATTAGTTGCAAAATACCTAACATGACACCTTT

ATACATTTTGTGATTATAGTAGTGCAAAATAGGAAATGTATACTTG SEQ ID NO:

Phase-1 RCT-082

C CTTTGTGAATTTCATTGTGTGTAAGTTATGTATTAAATCTTTGA 226

GTTTCAACTTTATTCTTATACGTGGTAATTTTGCAGAGTAAGAGAA

TTCCAAAAGAAAGAGTTTGGCACAACTTTGCTGTAGTTCTCTAGG

TTGCTTTTATAAAGAAGGTCAACTATTTTCAGGTAATGCCAAGAGT

TAGGATTGCCATrACCAAATATAACTGTATTAGTAGCTTGGAAAGA

ATATAAAATTTTAATTTCA I I IT I GAAGAAATTTTGAATGTTTATTTC

AGGAGGGCAGTTTTGACTATATGTGTATGCACAAAGTTTTGCTGG

GATTTATCCATAATAAAACC

TATGACATGATTACCAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAAATTCGGCACGAGGTGATTATTGTGATGG

AAATTCTCTTTGTACCACCTTAAATTAGTTTGTTAATCCAAAGTGG

AGGAAGACAGCAATAAAATGAATCCAAGTTTAAAAATGGGAAGAC

ATAGGGTAAGAGCTCTCTATTATAAAACTGATTGCATTGTGTTTCT

TCTTACACATCAGTATATTGCATAGCTCTCAATGAAACATTGACGA

ACTTGCTAAGCTTACTTTTCACAAACTCAAAAAATCCTTTAAAGGG

SEQ ID NO:

Phase-1 RCT-083 CATAGGAAAAAAAATCATTCAACAATAATACCCTTTTGCTTCCTTA 227

GAGCTATACTAAAGTATAGAATTTCAAAACAGGACACCCTTAGATT

TTCCACCTATTCGTAACATGGACGCTGGAACTCACAGGAGAGCT

GTCTGTGGTTCCACAAACATCATAI ITTT^'I GGTGAGTGACTGTGG

TTGTGATTACAGAGCAAGAAGTAAGGCTCTCCAGGCAGTGATGG

CTACTTCAGGTATGACTACCATGAAAGACTATGTGGAATTTCTTTT

ACCTTTGGAAATGTTTGAAAAGCTAGTAAAAAGAATTAGGGAATTT

AAAATTTCANGGGAAAAATATG

TNATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGACAAAAGTCACCATG

GCGTACCTATGAAGAGACCAACAGGTACCGTCTTGTATGCACATA

TATTACCCACACACGCATCACGCATATCCGCACCGTTTGTTTCCT

ATATACAGGCATAAAATAGAGTAAGCCCAGGTAGTTTTTAAAGTA

CCCTTCCGTGTGACTACCGTTGTCGTTCGCAAAGCTGAGAATAAA

AAGTTGTTCATTATGTCTGGAAAGGAGTCGAGTTTTGTCCTGTGA

GCATGTCGGGCTAAGAAGAACATCAGGGCTCCCACTAAGGTTAT

CTTCCCGCTGACAAACCGTAAGGGAGCCATCGGAGCTCACAACC SEQ ID NO:

Phase-1 RCT-084

AAATTGTTCTCTGTGGAATGAAGCTAGTGCCAGCCTGTGGCTTTC 228

GGGCTCAGCAGGAGCTAGGGTAAGGNAAGTGTCTTGGTACATTT

CAATGCTGTTGCTTACTAAAGGTTTTAACCCCACACGCACTTGCG

TGCGCGCGCGCGCACACACACACACACACACATATGCTTCTTTC

CTCTGCAGTCTGGTTTGGCCTTGTGCTTTTGAGTTTGCCTTCTGN

CAGCCACTAAGGTCACATGTTGTCTTTGGTGTAGTGGAGATTACA

TGCGTANAGGNCCNCATATGGACTCCTCCGTTTCCATTTCGGAN

CATACANAANGNCAGAGGGTTTTTGGTTTNGGTTGGNTTTTCCTT

TAAAAA

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGGCCATGGAGTTTGACT

TGGCTGCTGGTACGCTCCCCGGGAGTGGTGGATTTGCGGTGCA

AGGGGCCGGACTCAAAGCCTGGGATTCCTACAGAAGGGACGTC

CCGTCGCCTACACAACTCATTTAACTCCCCTCTTCTCTGCAGCCC

TGGGCCCTGGTTCTAAGAAGCCAGAGGGGGCTGGTCAAGTGGG

AGACCCCAAACACTGTCCTCTAAAGGCGCCGGGCCGGCCAGAG

GCAGGCGCTGCTCACAAGCCGAGGCATGGCCCTGGCGGCTCCT

Phase-1 RCT-156 SEQ ID NO:

CCGACTCCAGCAGTAGTAGCAGCAGCAGCAGCTCCAGCGACTCA 290

GAGGCAGAGGGGAAGGCGCACGCCGCTGGCTGCAAGAAGCATG

AACGCTCCTCAGACAAGGCCAAGAAACCCAAAGTGAAGAAGGAG

AGGAAAAAGAAAGAGAAGACTCCCCATTAACTTATTAAACTTGCA

GCCCTTTCCGCTCCCCGGCGCCCTCTGCCGGGCAGGAGCGGAG

GCCGCGCCGAGCCCAAAAAANNNNNNNNNNNNNNNNANNNNCC

TTTGCGGCCGCAAGCTTATTCCCTTTAGNGAGGGTTAATTTTACT

TGGCACTGGCCGNCGTTTTACAACGTCGNGATGGGAAAACCCTG

GCGTTACCCCAACTTAATCC

ANGACATGATTACGAATTTAATACGACTCACTATAGGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGGCAAGCGAACAGGG

TCTAGCAAAGAGGAGCTACGGANACAGACAGACATTTTAAGTTTT

CCAAAGAATCATCACCTTCTGCCGCAGGTCGCTTCCTCATCCCTG

GACACAGCTCCGCTAACCCANCCGGACTGTCTGACGAGTCAGGC

ATTTGGTCCACCAAATGCCGGTCCTCANAGTTTGCCTGAGACCCA

ATTGAAGGCACCGCCTGGCGGCTCCCGCTGACATCCAAGCTCTC

CTGCGCCGGCACCTTGCAGGCGCTCTTGGGGGGGCGCGGGGG SEQ ID NO:

Phase-1 RCT-158

TCTGTAGTAGAACTCGGGCAAGCTGCCCCTCTCCACCTCCTGCC 291

ACTCGTATCTGCCCTCCAGGGGCTTATGATTCTGAAAGTCGAAAT

TCCACTTGCGCTGGCTCGCTTCTTCCATATCTCGGCAGTGCTTCT

CCAAGTCCCGGGTTAATTCTTCATGATTGACCGGGCCGAANAAG

TTTCTGCANGCGGAAGGCTTGGGGTGCTCGGTTTGTCTGGCGTT

CATCCGCTCCAGGCTCGGGCTCCGTTANACACTCTCACGTTTGA

CATCTTCCTCCCCGGGCGGGNGTGGACACCGCCTCTNCTCTCTC

CGAAAAAAAAAAAAAAAAAAAAAAAACATTGCGGCCNCAA

TCTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTT

GGCCCTCGAGGCCAAGAATTCGGCACGAGGGAGCCACTGGGTA

ACCTGGCCAGCAACCTTCTCTGAAGCTGAATCAAAAACTAAATAG

GAGAATATGGCAAGTGCAGACTGGGGATATGAAAGCAAAAATGG

TCCTGACCAATGGAGCAAACTATATCCCATTGCCAATGGAAACAA

CCAGTCTCCTATTGATATTAAAACCAGCGAAGCCAAACATGATTC

CTCTCTGAAACCAGTCAGCGTCTCCTACAATCCTGCAACTGCCAA

AGAAATTGTTAATGTGGGACATTCTTTCCATGTAGTTTTTGATGAC SEQ ID NO:

Phase-1 RCT-161

AGTAGCAACCAGTCAGTGCTGAAAGGTGGCCCTCTTGCTGATAG 292

CTATCGGCTCACCCAGTTCCATTTTCACTGGGGCAACTCAAACGA

CCATGGCTCTGAACACACCGTGGATGGAGCCAAATATTCTGGAG

AGCTTCACTTAGTTCACTGGAATTCAGCCAAGTACTCCAGTGCTG

CTGAAGCCATCTCGAAGGCTGATGGGCTGGCAATCATTGGGGTT

TTGATGAANGGTGGGTCCAGCCAACCCNAACCTGCANAAAGTAC

TGGATGCCCTAANCTCAGTTAAAACTAANGGAAAACNANCCCCAT

TCNCCAATTTTGACCTTCCAGTCTCCTTCCTT

ATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGAATTTAAGCATATTAGT

CAGCGGAGAAGCTTCGGCGAGCAGAAGTGGACTTGGAGCGCGT

GCGGGTGTGGTACAAGCTGGACGAGCTGTTTGAGCAGGAACGTA

ATGTTCGCACAGCCATGACCAACAGAGCAGGATTGCTTGCCCTG

ATGCTGCACCAAACCATCCAACACGATCCACTTACTACCGACCTT

CGCTCTAGTGCTGACCGCTGAAAGTCACCAGCCCAGAGCCTCTC

AGCCCTGCATTCAGTCAGGGAGGGGCTCTGCATTTCAGCTCGCT SEQ ID NO:

Phase-1 RCT-162

CTTCCTCCGTTCATCTGTTTATTCTACCACCCTTAGTTTTCTTCTTA 293

CCATCCATGTTTTGGCTTCTGTTTGCCCTTATCAGAAGGGTCTCT

GCTTTCCCTTTGTCTCCTCTCCATAGTCAGTGCTGGGTGAAAGTC

AAGTTTACTCAGCCTTGCCTATACCCTCCCCCAAAATAAACAGGT

TTTGTTAATAAAATTTTGAACAAGAATAAAAAAAAAAAAAAAAAAAA

AAACAATTGCGGCCGCAAGCTTATTCCCTTTAGNGANGGTTAATT

TTACTTGGCACTGGCCGTCGTTTTACAACGTCGTGGACTGGGAA

AAACCTGGCGGTTACCCAACTTAATCGCCTTGC

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGAGCACGGTGACTTAAT

AGAGCTCGGCTCTGCCATGAAGTCCGTTGCTCTATTCCTCATGG

GCATCATCTTCCTGGATCACTGTGGAGTTCGAGGAACCCTAGTG

ATAAGGAATCAGCGATGCTCCTGCATCAGCACCAGCCAAGGCAC

ATTCCACTACAAATCCCTCAAAGACCTCAAACAGTTTGCCCCAAG

CCCTAACTGCAACAAAACTGAAATCATCGCTACACTGAAGAACGG

AGATCAAACCTGCCTAGACCCAGATTCAGCAAGGGTGAAGAAGC

SEQ ID NO:

Phase-1 RCT-169 TGATGAAAGAATGGGAGAAAAAGATCAGCCAAAAGAAAAAGCAAA

298

AGAGGGGGAAAAACCATCAAAGGAGCAAGAAAACCCGAAAAGCT

AAAACACCCCACCATCCGGAGTCAAAGAAGACTGCATAAGAGAC

CACTTTACCAACAAGCGCTCTGCATCTAAACAGCTTTTAGATCATA

CTAAAACGCCTTCCCTTTAATACACAACTCGTTCACTACAAAAAAA

AAAAAAAAAAAGTGAGCGGCCGCAAGCTTATTCCCTTTAGTGAGG

GTTAATTTTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGGA

CTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCAC

ATCCCCTTTCGC

I I I I I I I IT I I I I I I I I TCATTAAATGCTCTTTTTATTTAAATTTGTCA TGTGTAAAACACTACAAGGATTTGCCGAGCACACCAAGGTGGCC ATGAGAGCAATCACAAATCAGTAAGCCTTCTATTTAGCCCTCTTTC TCCAGCCATTCCTTATAGGCCCCGGCATAGTTTCGAGCCCCTGT GTATCCAAGACCTTGTGCCAGCTGTGTGGCCTGGAGGCCCCGCC

SEQ ID NO:

Phase-1 RCT-170 TGCCCATCTGACAGAAGAAAATAAGATTCTTGTCTTCTAGCTTTG 299 GCTTCTCAGCACAGTATGAAGTCTGAAAAGCAGCTGGGTCCATG TTCAAGGCCATTTCCAACTCAGACACTGAGAGGGGACAAATTGG AAAGCTAGTGGCATGCAGAGGTTCACAAGATGGGGCTGAAAGAG CTGAATGAATCCTGGCAGCAGCCTATTGCAGAGACCTTCCAAACA TACG

CTATGACATGATTACGAATTNATACGACTCACTATAGGGGAATTT

GGCCCTCGAGGCCAAGAATTCGGCACGAGGCTTTCCATCCATAT

TACCACCCTGGTTATTTCCCAAGCCAGCTCCACCCCCTCTACTGT

TACCAAACCCACCCTGATTCCCAAAGCCACCTGGATTACCACCAA

ATCTTCCACTNCTTTCTAACTGTNTATTGCTATTATGCTTAGGTTC

AGCATTGGATATATGCACGCTGATTCCTTTAATGATCAAGTCCTCT

CCACAAAGAGACTGGGCAACCTTATCATCTGCAAAGGTAACAAAG

GCAAAAGCTCTGAATGGTTTGGGAATGAAGACATCTACCACTTCT SEQ ID NO:

Phase-1 RCT-171

CCATACTGACAGAAGAACTGCTGAAGCTCTTCAGCAGTCATGTCC 300

TCTGTACAACGTCCAAAAAAAACCTTTGCGGCCGCAAGCTTATTC

CCTTTAGTGAGGGTTAATTTTAGCTTGGGCACTGGCCGTCGTTTT

ACAACGTCGTGACTGGGAAAACCTGGCGTTACCCAACTTAATCG

CCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAN

AGGCCCGCACCGATCGCCCTTCCCAACAGTrGCGCAGCCTGGAA

TGGCGAATGGGACGCGCCCTGTANCGGCGCATTAAGCGCGGGC

GGGTGTGGTGGGT

TATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGG

CCCTCGAGGCCAAGAATTCGGCACGAGGCAGACTCTGGAGAAG

GTGTGCGTGCAGACTGTGGAGAGCGGAGCTATGACCAAGGACC

TGGCTGGCTGCATCCATGGCCTCAGCAATGTGAAGCTGAATGAG

CACTTCCTGAACACCACAGACTTCCTGGACACCATTAAGAGCAAC

CTGGACAGAGCTCTGGGCAAGCAGTAGGGGTGGACACTACACTA

CCCAGCTCCAGTGGGTGCTCCGTACATGGTAGAGGGTGGGCGT

TGTAGCCCCCCTCTCTGGTGGCCTTTCTAGGGGATTA I I I T I I I A SEQ ID NO:

Phase-1 RCT-173 CATATATATATATATGATGGAGATGTTTTTTAAAGCATGTGAGCAA 301

TTTCCCTCACAGTGGACACGAGGCAGGAACGGTGCGCTTTACCT

CAGCCAGTCAGTGTGTTTTGCATACTGTAATTTATATTGCCCTGA

GTCACGTGGTGCCATATTTAGCTACTAAAAAGCTCTTCACAAANN

NNCNNNNNNNNNNNAATNNNNNCAATTGCGGCCGCAAGCTTATT

CCCTTTAGTGAGGGrrMTTTTAGCTTGGCACTGGCCGTCGTTTT

ACAACGTCGTGACTGGNAAAACCCTGGCGTTACCCAACTTTAATC

GCCTTGNAGCACATCCCCCTTTCGCCAGCTGGCGTAA

TTCTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATT

TGGCCCTCGAGGCCAAGAATTCGGCACGAGGGGAGGTGCCTTC

TGTGTTCTAGCCTTGGTGATCTTAGCAACTTTAAGCCTGTCAACA

ATATCTGATTTTAAGAATGTAGCAGTGTGGGAAGATGGTCATGGA

CCTTTAGATGTCTCAGGAACTGAAAGTTCAGAGACATCTAAACCA

CCACGTCTCACACCACCATGATCCTGATGAACTCAACGGCTGCG

ATGAACTCAACTGCTGCACCCATTCGTTCCCAGCAAATAGGAGAG

SEQ ID NO:

Phase-1 RCT-197 AAATTAATTGCAGTTACTAATAACATGACTGTTCCAGAAAAGCCCC 322

CCCCTTTGGGAAAGTTTTGTTTAGCATGATTCAGAATAGTAGTGA

CTCTTAGAAAGATCATGGATAAGTTCCAACAAGTTGAGCAAATTTA

TCAAGAGTTAACTAGAAGGAAAAGAGAAACTAACATTGAGCAAGA

MCGAAAGAAATTATAGAATGGTTACAAAAGTTTCCTTTTTATTCT

GAGGGCCCATAGAGTTTAAACTTTATTAAAATAAAGGTAAATGTTA

AATGTATATCTGGGTACCCACAAGTCTGGTAGTATAACTGCAGNT

TTCTAAACTATTGTTTGCGGCTGAGAA

TTNACATGATTACGAATTTAATACGACTCACTATAGGGAATTTGGC

CCTCGAGGCCAAGAATTCGGCACGAGGGGAAGGAGAAGGAGCT

GGTGGTGGCCGAGACAGTGGAAGAAGTGAAAAAAGCACCTGTTT

TGGTGTGTCCACCCTTACGAAGCCGAGCATACACACCACCCAGT

GATCTCCAGAGTCGCTTGGAATCTCATATTAAAGAAGTTCTTGGG

TTCATCTCTTCCTAATAATTGGCAAGATATCTCCCTGGATGATGGA

CATGTGAAGTTCAGACTCCTAGCAAATTTAGCTGATGACTTAGGC

CATGCAGTACCTAACTCCAGGCTTCACCAAATGTGCAGGGTCAG

AGATGTTCTTGATTTCTATAATGTTCCTGTTCAAGACAGATCTAAA SEQ ID NO:

Phase-1 RCT-198

TTTGATGAACTCATTGCTAGTAATTTACCTCCCAATTTGAAAATCA 323

GTTGGAATTACTGAGCAGTCCAGTCAGAACACAGTGAGATCATTC

TCATTCTTCTCATTGGGTGACTGACAGCGAACTTTGTGAGATGTT

ACCTATTAGAACTTGGTTCAGAACTTCC I NTH I N ^'CTTTTCTC

CTΓGGAGAAGACACATΠ I N ΓΠ CTCTCTGGAGCATCCACAAAG

AAAACATTATCACATTTGCTAAAGCTATTTATCCCCAATAAAATCA

AGTCTTGGTAATTATGAAAACATTCTTATTCCTGGTATATAGTCAG

GGTTGTTGAGAGGACANAAAGTGGTAACATGN

CTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGCCTTCACCTGACCTC

CGGGCGGCAGAATGGAAGAAGGTGAGGACCCAGGAAGTCTGAT

TAAAGTGATCCACTTGCTGGTCTTGTCTGGTGTCTGGGGCATGCA

GATGTGGGTGACCTTTGCCTCAGGCTTCCTGCTTTTCCGGAGCC

TCCCGAGGCACACGTTTGGACTTGTGCAGAGCAAGCTCTTCCCA

GTCTATTTTCACGTCTCCTTGGGTTGTGCCTTCATCAACCTCTGC

SEQ ID NO:

Phase-1 RCT-202 ATCTTGGCACCACAGCGGGCCTGGATCAACCTCACGCTGTGGGA 324

AATCAGTCAGCTTACCCTACTGCTTCTGAGTCTCACACTGGCTAC

CATCAATGCTCGCTGGCTCGAGGCTCGCACCACAGCTACCATGT

GGGCCCTGCAGAGTATAGAGAAAGAGCGAGGCCTGGGGACAGA

GGTGCCAGGCAGCCTCCAGGGCCCTGACCCCTACCGCCAGCTG

CGGGAGAAGGACCCCAAGTACAGTGCTCTCCGGCAGAAATTCTT

CTACTACCATGGCCTGTCTTCCCTCTGCAACCTGGGGGTGTCTG

CTGAGCAATGGTC

CTTTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATT

TGGCCCTCGAGGCCAAGAATTCGGCACGAGGCTAGCTTTCGTTT

CTTTGCTATGTCTGGACGTGGGAAGCAGGGCGGCAAGGCTCGC

GCCAAGGCCAAGACCCGGTCCTCCCGGGCGGGCCTGCAGTTTC

CCGTGGGCCGCGTGCACCGTCTGCTGCGTAAGGGCAACTATTC

GGAGCGGGTGGGCGCCGGCGCCCCGGTGTACCTGGCGGCCGT

GCTGGAGTACCTGACGGCCGAGATCCTGGAGCTGGCGGGCAAC

GCAGCGAGGGACAACAAGAAGACGCGCATCATCCCGCGCCACC SEQ ID NO:

Phase-1 RCT-204 TGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTG 325

GGCCGCGTGACCATCGCACAGGGCGGCGTTCTGCCAAACATCC

AGGCGGTGCTGCTGCCCAAGAAGACCGAGAGCCACCACAAGGC

TAAGGGGAAGTAAGACCAGGGATCACCAAAGGCTCTTTTCAGAG

CCNCCTATAAAAAAAAAAAAAAAAAAAAAAAAAACNATTGCGGCC

GCAAGCTTATTCCCTTTAGTGAGGGTTAATTTTACTTGGCACTGG

CCGTCGTTTTACANCGTCGTGACTGGGAAAAACCCTGGNGTTAC

CCCAACTTAANNCCCTTGCAGCANNTCCCCCTTTCGC

CTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGCTCCATCCTCAAGTG

GACAAGAACTGTGCATCTGTCGTCCTGTGAGCCCAGCAGGACCT

GCCCAGGAGGCTCCAGAGTCAGTCATGGCTTTCTGTGCTGCAGG

CCCTTGACCCAGACAGGGCAGGAATCTCCCCAAAATCCCAGTGA

GGGAGGATCCAACCTGTGATCAGACTCCGGTCTTCTGACCCCTG

CCTTCCTACTCCTGCATCCTGTCCCATCACAGACAGCCCTCCTCA

CAGCCTGGTTCATCTGCCTTGTCCTCCAACAGTGCTCTCTTGGGA SEQ ID NO:

Phase-1 RCT-219 GACAAGAGATTCAGAAGGGGAGGCAGGAACTCGAGCTTGACTTC 338

CACCTGTCCACCTGTTGGGAGTTCTGTCCAATGTGTGACCAACG

ACAATAAACCATAGCAAGCCGTGAAAAAAAAAAAAAAAAAAAACA

CATGCGGCCGCAAGCTTATTCCCTTTAGTGAGGGTTAATTTTAAC

CTTGGCACTGGCCGTCGTTΠTACAACGTCGTGAACTGGGAAAAA

CCCTGGCNGTTCCCAACTTTAATCGCCTTGCAGCACATTCCCCCT

TTCGCNAGCTGGNGGTAANAAACGAAAAAGGCCCCCCACCGAAT

CNCCCTTCCAAACATTTCCCACCNTNAATGGGCAAATGGGACCC

CCCCTTGTAAC

CTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGGTGTAGTACCTGTAG

GGAGTACGGCCTCTCAGAACACTCAGGTTCTTTATAAACTTTGTC

TTGGTTTTAAGAGAAAAGGAATGTCAGTGTAATGCTCTGGAGGCA

GAGGCAGGCGGGTCACTGGGGGTTCAAGGACAGCTTGGTCTTC

ATAGCAAGTTCCAAGCTGTACAGGGCTACGCTGTAAGACCTGAC

CCAAAAACAGCAAACAAGAAGGAAGGAAGAGAAAATAGTATCTAG

SEQ ID NO:

Phase-1 RCT-220 AGATGGAACCAACTGATGCAGCAGCAGTGGCGTGGGGTTTCCAG 339

ACTCAGAAATTTCTTCTTTTCTAATTCTTAAGGACATTTGGTTTCCA

TGCTAACCTTTCCCCTGACACAGACTTAAAAGATCTGCAACAAGG

GGAGGCGCTTTCTCTTTAGAATGTAGAGAGGAGAGGAATTTGTTT

TTATTTTAACTATTAAATCATGATAAACTGACTGCTGAGACTTCCC

TAGCATTCCTTTAAAGTATTTTGTACAGAAGAGAAGAACCCTCCT

GGAGCGGCCCAGGTAGGTAAGTCTGTGCTGTACACAGCACCTCT

CTGCCTCTTCCACTGCTGTGTCACCCT

TTATGACATGATTACGAATTTAATACGACTCACTATAGGGAATTTG

GCCCTCGAGGCCAAGAATTCGGCACGAGGCTAACCCTGTCCACG

CTCCTGCCTGCAACCCTCTCCCTGCTTGGCACAGTCGAGGAGGA

AGATGCTCTTTGCCTATCCCAGCTGCACCCTGGCTTCCTGCTCAA

GGGAAGTGAGCACCCCACTTCCTGTGCTAGTTAGTGCCTGATTC

TCTGGGTGAGTCCCCGGGCGGACTCCCTCAGCCCCTTTCTCTGG

TACAGTGGTGTCCGCCCGACTGCCTCCTGTAACCCCATCTTCTAA

GCCATCAATTTTATGTTACTATATTGCCCTTTGTGGGGTGGGAGA SEQ ID NO:

Phase-1 RCT-221

GGGATCTCCTGGCTCTGCGACTTGCCCCTTTGCCGAATAGTTACT 340

GTTCTTGACTTGAAGAGAAGCAACGTGTGGGGACCTCCCCACTG

CCCCAGCCCAGACTTCTTCGGAAGGGTTGGAAGTTGCTAGACAA

ATCAGAATGTAGAAGGTGGAGGATTCTGAGGAGGAGGCAGAGAA

TTCTGACTGGGGAGGTATANGTTGGGTCCTCTGCCTCCCACGGC

TGCAANGTGTGTCTGACCTCTGGAGCTCAGCCCCTCCCCCCTTT

CTCTTCAGTGCTGACAAGATGTCNATAAACTTATTTTCATACAATT

AAAAAAAAAAAA

TNTNGGANATGATTACGANTTTAATACGACTCACTATAGGGAATTT

GGCCCTCGAGGCCAAGAATTCGGCACGAGGAGGAACTGTGTCA

GGAAGGTAGAGAGCTGCCGATCTAAAACCTGGGAAAGAATGGAC

CGTCTAGCAAGGGGAGAGCAAGCAGACAAAGAAGCTTCCTTCTT

CCATGTTCATATAGGTTTCCAGCAGAAGGTGTGCCCCAGATTAAA

GGTATGTCTCTAGCTCCAGATGTATTCAAGTTGACAACCAAGAAT

AGTCATCACATAGTTCCTCATTGAGGAAAGTCAAAGCAGGAAGTA

AGGTAAGAATCATGGGAAAATGCTACTTGCTGTTTCCCCATCTCT SEQ ID NO:

Phase-1 RCT-222

GGTTTGCTTTCTCACAGGTTCATGCCTAGCTAGTTTTCTAATATAG 341

CTCAAGGACCACCTGTCTAGGGAATGGTGCCACCCGTAGTGGGC

TGGGCAGTCTAGATAATCTACCACACACATCAACCCCCTGCCCC

CTTCTCAGGTGACCCTACACTGTGTCCACCACACACATCTACCCT

TACCCCTTCTCGCTAATTCAGACCNNCNCNCACCNNNNCNNNAC

NCNNNACANNNNNANTTGGAAGCGGCCCAAGCTTATTCCCTTTA

GGGGAGGGTTAATTTTACCTTGGCNCTGGCCGNCGTTTTACAAC

GTCNTGGACTGGGAAANCCCTGGCNTNNCCCAACTGAATC

£C6Z0/Z0Sfl/I3d Z89990/Z0 OΛV

£C6Z0/Z0Sfl/I3d Z89990/Z0 OΛV

£C6Z0/Z0Sfl/I3d Z89990/Z0 OΛV

CTATAGAATACTCAAGCTTATGCATCAAGCTTGGTACCGAGCTCG

GATCCACTAGTACCGGCCGCCAGTGTGCTGGAATTCGCCCTTCG

CGGGATCCCCAGATTTCTTTGATGACCTGGAACCTTTTAGGATAA

CTCCTTTCAGCGCTATTGGTTTGGAGCTCTGGTCCATGACATCCG

ACATCTT I I I I GACAACTTTATCATTAGTGGTGACCGAAGAGTAGT

TGATGACTGGGCCAATGATGGGTGGGGCCTGAAGAAAGCTGCTG

ATGGGGCTGCAGAGCCAGGTGTAGTGGGGCAGATGCTGGAGGC

SEQ ID NO:

Calnexin 18889 AGCTGAAGAGCGTCCATGGCTTTGGGTGGTCTACATTCTGACTG 443

TAGCGTTGCCAGTGTTCCTTGTGATCCTCTTCTGCTGTTCTGGAA

AGAAACAGTCCAATGCTATGGAGTACGAGAAGACAGATGCTCCC

CAGCCAGATGTGAAGGACGAAGAAGGGAAGGAAGAAGAGTAGA

ACAAGGGAGATGAAGAGGAAGAAGAGGAGAAGCTTGAAGAGAAA

CAGAAGAGTGATGCTGAAGAAGATGGTGGCACTGGCAGTCAAGA

TGAGGAGATAGCCTCGAGGGCAAGGGCGAATTCTGCAGATATCC

ATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCNATTC

TGGGGAATTGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAG

TGTGATGGATATCTGCAGAATTCGCCCTTCGCGGGATCCTGATG

ACCCCACAGATTCCAAGCCTGAGGACTGGGACAAGCCAGAGCAC

ATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGACGAAGA

GATGGATGGAGAGTGGGAACCACCAGTGATTCAAAATCCTGAAT

ACAAGGGCGAATGGAAGCCACGTCAAATTGACAACCCAGATTAC

AAGGGTACCTGGATACACCCAGAGATTGACAATCCTGAATACTCC

CCCGATGCGAATATCTATGCCTATGATAGTTTTGCTGTACTGGGC SEQ ID NO:

Calreticulin D78308

TTAGACCTCCGGCAGGTCAAGTCTGGCACAAT I I I I^'GACAACTTC 444

CTCATCACCAATGATGAGGCCTATGCAGAGGAGTTTGGCAATGA

GACCTGGGGTGTCACCAAGGCTGCAGAGAAGCAGATGAAGGAC

AAGCAGGATGAGGAGCAGAGGCTTAAGGAAGAAGAAGAAGACAA

GAAGCGTAAAGAGGAAGAGGAGGCCGAGGATAAAGAGGATGAG

GAAGCTTGGCCAAGGGCGAATTCCAGCACACTGGCGGCCGTTAC

TAGTGGATCCGAGCTCGGTACCAAACTTGATGCATAGCTTGAGTA

TTCTATAGTGTCACCTAAATAGCTTGGCGTA

NTGNCNATGATTACGCCAAGCTATTTAGGTGACACTATAGAATAC

TCAAGCTATGCATCAAAGCTTGGTACCGAGCTCGGATCCACTAGT

AACGCCCGCCAGTGTGCTGGAATTCGCCCTTTAGATGTTGCCTC

CATTGGACTGCACGACCTTCGAGAGAGGCTGACCATCATTCCCC

AGGACCCCATTTTGTTCTCGGGGAGTCTGAGGATGAATCTCGAC

CCTTTCAACAAATATTCAGATGAGGAGGTTTGGAGGGCCCTGGA

GTTGGCTCACCTCAGATCCTTTGTGTCTGGCCTACAGCTTGGGTT

Canalicular

GTTATCCGAAGTGACAGAGGGTGGTGACAACCTGAGCATAGGGC SEQ ID NO: multispecific organic D86086

AGAGGCAGCTCCTATGCCTGGGCAGGGCTGTGCTTCGAAAATCC 445 anion transporter

AAAATCCTGGTCCTGGATGAAGCCACGGCTGCAGTGGATCTCGA

GACGGATAGCCTCATTCAGACGACCATCCGAAAGGAGTTCTCCC

AGTGCACGGTCATCACCATCGCTCACAGGCTGCACACCATCATG

GACAGTGACAAGATAATGGTCCTAGACAACGGGAAGATTGTCGA

GTATGGCAGTCCTGAAGAAGTGCTGTCCAACAGAGGTTCCTTCTA

AAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGA

GCATGCATCTAGAGGGCCA

NNGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATG

GATATCTGCAGAATTCGCCCTTCAGGGCTCTGAGCACACCGTGA

ACAAAAAAAAATATGCTGCAGAGCTTCACTTGGTTCACTGGAACA

CCAAATATGGGGATTTTGGAAAAGCTGTGCAGCACCCAGATGGA

CTGGCTGTTTTGGGTA I ^"I I I TTGAAGATTGGACCTGCCTCACAA

GGCCTTCAGAAAATCACTGAAGCACTGCATTCCATTAAAACAAAG

GGGAAACGTGCAGCCTTTGCTAACTTTGATCCTTGCTCCCTTCTT

SEQ ID NO:

Carbonic anhydrase I X58294 CCTGGAAACTTGGACTACTGGACATATCCTGGCTCTCTGACCACT 446

CCGCCCCTGCTGGAATGTGTGACCTGGATAGTGCTCAAGGAACC

CATTACTGTCAGCAGTGAGCAGATGTCTCATTTCCGTAAACTGAA

CTTCAATTCGGAGGGGGAGGCTGAAGAACTGATGGTGGACAACT

GGCGTCCAGCTCAACCGCTGAAGAACAGAAAGATCAAGGGCGG

GTTTCCCC I I I I I l AAAAATTAAAAAAAATGGGACCCCCCCTTGGC

CAAGCCTTGGGGGGGGGTCCCCAAAAAAAAAAAAGGGGGGCGG

AAAATTTTCCCAAGCCACCAACCTTGGGGCGGGGGG

£C6Z0/Z0Sfl/13d Z89990/Z0 OΛV

CTATGNCATGATTACGCCAAGTATTTAGGTGACATATAGAATACT

CAAGCTATGCATCAAGCTTGGTACCGAGCTCGNATCCACTAGAA

CGGCCGCCAGTGTGCTGGAATTCGCCCTTCACGGTGGCCATCTG

TGAAGTCCCAGGATTGGATCTTCGAGATGCTGTCCTTGCAGAACA

ATTACACTATTAACAACAAAAGAAACGGAGTTGCAAGGCTCAACA

TCTTCTTCAAGGAGCTGAACTATAAAACTAATTCGGAGTCTCCTTC

TGTCACGATGGTCAGCCTCCTGTCCAACCTGGGCAGCCAGTGGA

Epithelial sodium

GCCTGTGGTTTGGCTCGTCCGTGCTCTCTGTGGTGGAGATGGCG SEQ ID NO: channel alpha subunit U54699

GAGCTCATCTTCGACCTCCTGGTCATCACACTTCTCATGCTGCTA 522

(alpha-ENaC)

CGCCGGTTCCGGAGCCGGTACTGGTCTCCAGGACGAGGGGCCA

GGGGTGCCAGGGAGGTGGCCTCCACTCCAGCTTCCTCCTTCCC

GTCCCGTTTCTGTCCTCACCCTACATTCCCACCACCTTCTTCGCC

CCAGCAGGGCATGACCCCTCCCCTGGCCCTGACAGCCCCTCCA

CCCGCCTATGCTACTCTAGGCCCCAGTGCCCCTCCACTGGACTC

TGCAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCT

CGAGCATGCATCTAGAGGGCCCAATTCGC

TTAATGCAGCTGGCACGACAGGTTTCCCGACTGNAAAGCGGGCA

GTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCAC

CCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAA

TTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG

ATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTAT

GCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGC

CAGTGTGCTGGAATTCGCCCTTGCGCGAATTCGGGGAATCCTTG

SEQ ID NO:

Epoxide hydrolase X65083 TGGGAACTCCAGAAGATCCCAAGGTCAGCAAAATTACTACTGAG 523

GAGGAAATAGAGTATTACATACAGCAGTTCAAGAAGTCTGGCTTC

AGAGGCCCTCTAAACTGGTATCGAAACACAGAAAGAAACTGGAA

GTGGAACTGTAAGGCGTTGGGAAGGAAGATCTTGGTCCCTGCCC

TGATGGTCACAGCTGAGAAGGACATTGTACTCCGTCCTGAAATGT

CCAAGAACATGGAAAACTGGATCCCTTTCCTGAAAAGGGGACAC

ATCGAAAAGCTTGGCCAAGGGCGAATTCTGCAGATATCCATCACA

CTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTC

GTTCCAGTATTGTTGTCACAGGGATAAATAATATTTATCAGCAGTT

TTTGAACAGACAAATTTCTATTTCTATCTTGGAAAAAAAAAGGCAA

ATTTGCCACATTCTCAGGTTATGGCTAGGGGTGTCATTATGGTTC

AAATCCTGCTGAGTATTACATGGTAAGCCTTACTGGCTTTATCCC

TGTGGATTTGGTGGCCTCTGAAGTATTCTTGAACATTGTGTTCTG

L25527 TGTCCTGGCATTGAGTCCAGCATAATGTCCGTTATTCTTAGTTCA SEQ ID NO:

E-selectin

GTGCAAAAAGACTTAAAAAGTCAGAATCCTGTGGCCCATCACAAG 524

GCAMGGTTATCCTAAATCTCTTTTTGATTAGAAAATCCCAGGATT

ATATCTGCAATAAACCTATTTTCAAGATGAGACATTAATAATCAGT

GTGAAATTCTGAGTATTTAATGGTAGCTGGTTTTCAGACATGGTA

CTATCAAAAGGATAGAAAGTAAAGAGAGTGTATATCTGGGGTTCC

CA

GAATTGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGA

TGGATATCTGCAGAATTCGCCCTTGATCCAAATGTGTAGAAGGCA

TGGTGGAGATCTTTGACATGTTGCTGGCTACGTCAAGTCGATTCC

GCATGATGAACCTGCAGGGAGAAGAGTTTGTGTGCCTCAAATCA

ATCATTTTGCTTAATTCTGGAGTGTACACATTTCTATCCAGCACCT

TGAAGTCTCTGGAAGAGAAGGACCACATCCACCGAGTCCTGGAC

AAGATCACAGACACTTTGATCCACTTGATGGCCAAAGCTGGCCTG

ACTCTGCAGCAACAGCATCGCCGTCTGGCCCAGCTCCTCCTCAT SEQ ID NO:

Estrogen receptor Y00102

CCTTTCCCATATCCGGCACATGAGTAACAAAGGCATGGAGCATCT 525

CTACAACATGAAATGCAAGAATGTCGTGCCTCCCTATGACCTGCT

GCTGGAGATGCTGGATGCTCATCGTCTTCATGCCCCCGCCAGTC

GCATGGGAGTGCCCCCGGTGGAGCCTAGCCAGAGCCAGCTGAC

CACCACCAGCTCCACTTCAGCACATTCCTTAAGCTTGGCCAAGG

GCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCT

CGGTACCCAACTTGATGCATAGCTTGAGTATTCTATAGTGCACCT

AAATAGCTTGGCG

TTTGAGAATCGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAG

TGTGATGGATATCTGCAGAATTCGCCCTTATCGCGGAATTCCCTC

ACAGCGACACGGATCCAAGTACTTGGCCACAGCAAGTACCATGG

ACCATGCCCGGCATGGCTTCCTCCCAAGGCACAGAGACACGGG

CATCCTTGACTCCATCGGGCGCTTCTTTAGCGGTGACAGGGGTG

CGCCCAAGCGGGGCTCTGGCAAGGACTCACACACAAGAACTACC

CACTACGGCTCCCTGCCCCAGAAGTCGCAGAGGACCCAAGATGA

AAACCCAGTAGTCCACTTCTTCAAGAACATTGTGACACCTCGTAC

SEQ ID NO:

Myelin basic protein M25889 ACCCCCTCCATCCCAAGGAAAGGGGAGAGGCCTGTCCCTCAGCA 607

GATTTAGCTGGGGAGGAAGAGACAGCCGCTCTGGATCTCCCATG

GCAAGACGCTGAGAGCCTCCCTGCTCAGCCTTCCCGAATCCTGC

CCTCGGCTTCTTAATATAACTGCCTTAAACGTTTAATTCTACTTGC

ACCAAATAGCTAGTTAGAGCAGACCCTCTCTTAATCCCGTGGGG

CAAGCTTGGCCAAAAGGGCGAATTCCAGCACACTGGCGGGCGG

TACTAGTGGATCCGAGCTCGGGACCAAGCTTGATGCATAGCTTG

AGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGGCA

TAGCTGGT

ANNGGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGAT

GGATATCTGCAGAATTCGCCCTTCGGTTTCCTGCCCTTTCACCTG

TTGGGCATCCGAGAGACCTGGGATGACCGCTGGATCAATGATGT

GGAGGACAGCTACGGGCAGCAGTGGACCTACGAGCAGAGGAAG

ATTGTGGAGTTCACCTGCCACACGGCCTTCTTTGTCAGTATCGTG

GTAGTGCAGTGGGCTGACTTGGTCATCTGCAAGACCAGAAGGAA

TTCTGTCTTCCAGCAGGGAATGAAGAACAAGATCTTAATATTTGG

CCTCTTTGAAGAGACAGCTCTTGCTGCTTTCCTGTCCTACTGCCC SEQ ID NO:

Na/K ATPase alpha-1 M14511

TGGGATGGGTGCAGCCCTTAGGATGTATCCCCTCAAACCTACTT 608

GGTGGTTCTGTGCCTTCCCCTACTCCCTTCTCATCTTCGTGTATG

ACGAGGTGCGGAAGCTCATCATCAGGCGACGCCCTGGCGGCTG

GGTGGAGAAGGAAACCTACTACTAGCCCACTGCCCTGCACGCCG

TGGAACATTGTGCCACACACTGCACCTACCCCTAAGGGCGAATT

CCAGCACACTGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCA

AGCTTGATGCATAGCTTGAGTATTCTATAGTGNCACCTAAATAGC

TGGCGTAATCATGGGCATAGCTGTTNCTGTGTGAA

NGNGNGNNTGGCGGNANGNNGTNNCCNTNGNGANCNANGATGA

NAAAAAAAGNGNGTNNCNGAGGNGGNNNTNNGAGAGACNNCNA

CGGCCTCNCATNCGGCCNNNNNCNANNCAGNANNGGAGAGCCG

NNNGGNAGACNNGNGNNNCNNCACACNAANNAAAGNGTCCGTC

GCCAGCNNCGCCCCAGTNNNCGCCNCCGGAAAACNNNGGAGCG

CNNNGGTANGACNGCNGTCGNGGCAGGCCGGCCCNGGGTGGN

AGGAAANCTCCANAATTTCGNCCNNAGTCNCGGGANCANNGNNG

GGGGNCCCNGACCNACNGGGNTCANTNTTAGAAAGAAGAAAANA

AGANATNCCGANGTTNAGNAAGATTTCAAAACAACGGGCCCCAC

NCGTCAAAGNAGAAGCAGCTTNGTGGAAAAGAATNAANAAAAAC

NADPH cytochrome GGGAAGGGANCNNTATNGTANTNTATGGCTCCCAGACGGGAACC SEQ ID NO:

M10068 P450 oxidoreductase GNTGAGGAGTTTTTNCAACCGGCTGTNCAAAGGAATGNCCNCCC 609

GCTACGGGATGNGGGGCAAGNCCGCAGACCCTGAAGAGTATGA

CTTGNNCGNCCTGAGCAGCCTGCCTGAGATCGACAAGTCCCCTG

GTAGTCTTCTGCATGGCCACATACGGAGAGGGCGAACCCCACGG

ACAATGCGCAGGACTTCTATGACTGGCTGCAGGAGACTGACGTG

GACCTCACTGGGGTCAAGTTTGCTGTATTTGGTCTTGGGAACAAG

ACCTATGAGCACTTCAATGCCATGGGCAAGTATGTGGACCAGCG

GCTGGAGNAGCTTGGCGCCCAGCGCATCTTTGAGTTGGGCCTTG

GTGATGATGACGGGAACTTGGAAGAGGATTTCATCACGTGGAGG

GAGCAGTTCTGGCCAGCTGTGTGCGAGTTCTTTGGGGTAGAAGC

CACTGGGGAGGAGTCGAGCATTCGCCAGTATAGCTC

Table 5

Gene Name Homology

Phase-1 RCT-002 no significant homology found with a known complete gene

Phase-1 RCT-003 no significant homology found with a known complete gene

Phase-1 RCT-006 sdpr=serum deprivation response [mice, NIH3T3 cells, mRNA, 2909 nt]

Phase-1 RCT-007 M. musculus mRNA for protein expressed at high levels in testis

Phase-1 RCT-008 Messenger RNA for rat preproalbumin

Mus musculus adult male liver cDNA, RIKEN full-length enriched library,

Phase-1 RCT-009 clone: 1300003M23, full insert sequence

Rattus norvegicus methylmalonate semialdehyde dehydrogenase gene

Phase-1 RCT-010 (Mmsdh)

Phase-1 RCT-012 no significant homology found with a known complete gene

Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched library,

Phase-1 RCT-013 clone:4632417K18, full insert sequence

Phase-1 RCT-014 Rat brain nicotinic receptor alpha 7 subunit

Phase-1 RCT-015 Mus musculus ubiquitin conjugating enzyme 7 mRNA, complete eds

Phase-1 RCT-017 M.musculus mRNA for HIRA protein >gi|1771287|emb|X99712.1 |MMHIRA

Phase-1 RCT-018 no significant homology found with a known complete gene

Phase-1 RCT-020 Mus musculus cysteine and histidine-rich domain (CHORD)-containing,

Phase-1 RCT-022 Mus musculus, clone MGC: 19042 IMAGE:4188988, mRNA

Phase-1 RCT-024 Mus musculus, tubulin alpha 8, clone MGC:28850 IMAGE:4507364, mRNA,

Mouse DNA sequence from clone RP23-278F12 on chromosome 11 ,

Phase-1 RCT-025 complete sequence

Phase-1 RCT-027 Mus musculus adult male kidney cDNA

Phase-1 RCT-028 no significant homology found with a known complete gene

Phase-1 RCT-029 no significant homology found with a known complete gene

Phase-1 RCT-030 Homo sapiens putative protein-tyrosine kinase (LOC51086),

Mouse 10, 11 days embryo cDNA, RIKEN full-length enriched library,

Phase-1 RCT-031 clone:2810437P06

Phase-1 RCT-032 no significant homology found with a known complete gene

Phase-1 RCT-033 no significant homology found with a known complete gene

Phase-1 RCT-034 no significant homology found with a known complete gene

Mus musculus adult male stomach cDNA. RIKEN full-lenαth enriched librarv

Table 6

Table 7

Table 8

Liver responsive genes Cytochrome P4502C39 (alternate clone 2)

22kDa integral peroxisomal membrane protein Cytochrome P450 2D18

3-beta-hydroxysteroid dehydrogenase (HSD3B1) Cytochrome P-450Md

3-hydroxyisobutyrate dehydrogenase D-dopachrome tautomerase

60S ribosomal protein L6 (alternate clone 1 ) Decorin

Acetyl-CoA carboxylase Diazepam binding inhibitor

Acyl-CoA dehydrogenase, medium chain Dimethylarginine imethylaminαhydrolase

Adrenodoxin reductase Endogenous retroviral sequence, 5' and 3' LTR

Aldehyde dehydrogenase, microsomal Equilbrative nitrobenzylthioinosine-sensitive nucleoside transporter

Alpha-1 acid glycoprotein ERG-2

Alpha-1 microglobuiin/bikunin precursor (Ambp) Fetuin protein (IRL685)

Alpha-2-macroglobulin, sequence 2 Gamma-actin, cytoplasmic

Alpha-2-microglobulin Gap junction membrane channel protein beta 1 (Gjb1)

Alpha-fibrinogen Glutathione S-transferase alpha subunit

Alpha-prothymosin Glutathione S-transferase P1

Apolipoprotein C1 Glycine methyltransferase

Apoptosis-regulating basic protein Heme oxygenase

Argininosuccinate lyase Hemoglobin alpha 1 chain

Arginosuccinate synthetase 1 Hemoglobin alpha 1 chain (alternate clone)

Aspartoacylase Hemopexin (alternate clone)

ATP-stimulated glucocorticoid-receptor translocation promoter (Gyk) Hepcidin antimicrobial peptide (Hamp)

Beta-actin, sequence 2 Hepcidin antimicrobial peptide (Hamp) (alternate clone)

Beta-alanine synthase High affinity IgE receptor gamma chain (FcERIgamma)

Betaine homocysteine methyltransferase (BHMT) Histidine-rich glycoprotein

Beta-tubulin, class I HMG-CoA synthase, cytosoiic

Calgranulin B HMG-CoA synthase, mitochondrial

Calpactin 1 heavy chain IgE binding protein

Carbamyl phosphate synthetase I Inositol polyphosphate multikinase (Ipmk)

Carbonic anhydrase III, sequence 2 Insulin-like growth factor I, exon 6

Cathepsin L, sequence 2 Inter-alpha-inhibitor H4 heavy chain (Itih4)

Cdc2-related protein kinase (NCLK) Interferon related developmental regulator IFRD1 (PC4)

Cofilin Intracellular calcium-binding protein (MRP14)

Complement factor I (CFI) Intracellular calcium-binding protein (MRP8)

Contrapsin-like protease inhibitor (CPi-21) Iron-responsive element-binding protein

CTP:phosphocholine cytidylyltransferase Lecithin:cholesteroI acyltransferase

Cystatin C L-gulono-gamma-lactone oxidase

Cytochrome c oxidase subunit I Malate dehydrogenase, cytosoiic

Cytochrome c oxidase subunit I (alternate clone) Matrin F/G

Cytochrome c oxidase subunit I (alternate clone) Melanoma-associated antigen ME491

Cytochrome P4502C23 Membrane bound cytochrome b5

Cytochrome P450 2C39 Methylacyl-CoA racemase alpha

Cytochrome P450 2C39 (alternate clone 1) MHC class I antigen RT1.A1(f) alpha-chain MHC class II antigen RT1.B-1 beta-chain

MHC class II antigen RT1.B-1 beta-chain (alternate clone)

Mullerian inhibiting substance

Mx1 protein

Na/H antiporter (APNH1)

NADH-cytochrome b5 reductase

NADP-dependent isocitrate dehydrogenase, cytosoiic

Neuronal cell adhesion molecule (NrCAM)

NGF-inducible anti-proliferative putative secreted protein (PC3)

N-hydroxy-2-acetylaminofluorene sulfotransferase (ST1C1 )

NIPK

Nucleosome assembly protein

Osteoactivin

Osteopontin

Pancreatic secretory trypsin inhibitor type II (PSTI-II)

Pancreatic secretory trypsin inhibitor type II (PSTI-II) (alternate clone)

PAR interacting protein

Phase-1 RCT-002

Phase-1 RCT-008

Phase-1 RCT-009

Phase-1 RCT-010

Phase-1 RCT-012

Phase-1 RCT-013

Phase-1 RCT-014

Phase-1 RCT-015

Phase-1 RCT-024

Phase-1 RCT-027

Phase-1 RCT-029

Phase-1 RCT-030

Phase-1 RCT-031

Phase-1 RCT-033

Phase-1 RCT-034

Phase-1 RCT-038

Phase-1 RCT-039

Phase-1 RCT-040

Phase-1 RCT-041

Phase-1 RCT-049

Phase-1 RCT-050

Phase-1 RCT-051

Phase-1 RCT-052

Phase-1 RCT-055

Phase-1 RCT-056

Phase-1 RCT-057

Phase-1 RCT-058

Phase-1 RCT-152 Phase-1 RCT-265

Phase-1 RCT-154 Phase-1 RCT-268

Phase-1 RCT-158 Phase-1 RCT-270

Phase-1 RCT-161 Phase-1 RCT-271

Phase-1 RCT-164 Phase-1 RCT-274

Phase-1 RCT-165 Phase-1 RCT-277

Phase-1 RCT-166 Phase-1 RCT-278

Phase-1 RCT-168 Phase-1 RCT-280

Phase-1 RCT-169 Phase-1 RCT-281

Phase-1 RCT-170 Phase-1 RCT-284

Phase-1 RCT-176 Phase-1 RCT-285

Phase-1 RCT-178 Phase-1 RCT-288

Phase-1 RCT-179 Phase-1 RCT-289

Phase-1 RCT-182 Phase-1 RCT-290

Phase-1 RCT-185 Phase-1 RCT-291

Phase-1 RCT-187 Phase-1 RCT-293

Phase-1 RCT-189 Phase-1 RCT-296

Phase-1 RCT-191 Phase-1 RCT-297

Phase-1 RCT- 92 Phosphatidylethanolamine-binding protein

Phase-1 RCT-196 Phospholipase D

Phase-1 RCT-197 Preproalbumin

Phase-1 RCT-198 Preproalbumin (alternate clone)

Phase-1 RCT-204 Preproalbumin (alternate clone)

Phase-1 RCT-205 Preproalbumin, sequence 2

Phase-1 RCT-207 Protein disulfide isomerase related protein

Phase-1 RCT-208 Protein O-mannosyltransferase 1 (Pomtl )

Phase-1 RCT-211 Protein tyrosine phosphatase, receptor type, D

Phase-1 RCT-214 Pyruvate kinase, muscle

Phase-1 RCT-215 Retinol dehydrogenase type III

Phase-1 RCT-218 Retinol-binding protein (RBP)

Phase-1 RCT-225 Ribosomal protein L13

Phase-1 RCT-227 Ribosomal protein L27

Phase-1 RCT-233 Ribosomal protein S17

Phase-1 RCT-237 Ribosomal protein S8

Phase-1 RCT-239 Schlafen-4

Phase-1 RCT-241 Selenoprotein P

Phase-1 RCT-242 Stathmin

Phase-1 RCT-251 Stearyl-CoA desaturase, liver

Phase-1 RCT-252 Sulfotransferase K2

Phase-1 RCT-253 Thioredoxin-1 (Trx1)

Phase-1 RCT-255 Transferrin

Phase-1 RCT-256 Ubiquitin D (Ubd)

Phase-1 RCT-261 UDP-glucuronosyltransferase

Phase-1 RCT-264 Urinary protein 2 precursor Vacuole membrane protein 1 D-dopachrome tautomerase

Very long-chain acyl-CoA synthetase Decorin

VL30 element Diazepam binding inhibitor

Voltage-dependent anion channel 2 (Vdac2) Dimethylarginine dimethylaminohydrolase

Zinc finger protein Endogenous retroviral sequence, 5' and 3' LTR

ERG-2

Kidney responsive genes Gamma-actin, cytoplasmic

3-beta-hydroxysteroid dehydrogenase (HSD3B1 ) J Glutathione S-transferase alpha subunit

3-hydroxyisobutyrate dehydrogenase Glutathione S-transferase P1

60S ribosomal protein L6 (alternate clone 1 ) Heme oxygenase

Acetylcholine receptor epsilon Hemoglobin alpha 1 chain

Acetyl-CoA carboxylase Hemoglobin alpha 1 chain (alternate clone)

Acyl-CoA dehydrogenase, medium chain Hemopexin (alternate clone)

Adrenodoxin reductase High affinity IgE receptor gamma chain (FcERIgamma)

Alpha-1 acid glycoprotein HMG-CoA synthase, cytosoiic

Alpha-1 microglobuiin/bikunin precursor (Ambp) HMG-CoA synthase, mitochondrial

Alpha-2-macroglobulin, sequence 2 IgE binding protein

Alpha-2-microglobulin Inter-alpha-inhibitor H4 heavy chain (Itih4)

Alpha-fibrinogen Interferon related developmental regulator IFRD1 (PC4)

Apolipoprotein C1 Intracellular calcium-binding protein (MRP14)

Apoptosis-regulating basic protein Iron-responsive element-binding protein

Argininosuccinate lyase Malate dehydrogenase, cytosoiic

Arginosuccinate synthetase 1 Melanoma-associated antigen ME491

Aspartoacylase Membrane bound cytochrome b5

Beta-actin, sequence 2 Methylacyl-CoA racemase alpha

Beta-alanine synthase MHC class I antigen RT1.A1(f) alpha-chain

Betaine homocysteine methyltransferase (BHMT) MHC class II antigen RT1.B-1 beta-chain

Beta-tubulin, class I MHC class II antigen RT1.B-1 beta-chain (alternate clone)

Calgranulin B Mullerian inhibiting substance

Calpactin I heavy chain Mx1 protein

Carbamyl phosphate synthetase I NADP-dependent isocitrate dehydrogenase, cytosoiic

Carbonic anhydrase HI, sequence 2 NGF-inducible anti-proliferative putative secreted protein (PC3)

Cathepsin L, sequence 2 NIPK

CDK108 Osteoactivin

Contrapsin-like protease inhibitor (CPi-21 ) Osteopontin

CTPrphosphochoIine cytidylyltransferase Pancreatic secretory trypsin inhibitor type II (PSTI-II)

Cystatin C Pancreatic secretory trypsin inhibitor type II (PSTI-II) (alternate clone)

Cytochrome c oxidase subunit I PAR interacting protein

Cytochrome c oxidase subunit I (alternate clone) Phase-1 RCT-008

Cytochrome c oxidase subunit I (alternate clone) Phase-1 RCT-009

Cytochrome P450 2C23 Phase-1 RCT-010

Cytochrome P450 2C39 (alternate clone 1 ) Phase-1 RCT-012

Cytochrome P450 2C39 (alternate clone 2) Phase-1 RCT-013

Cytochrome P4502D18 Phase-1 RCT-015

RAC protein kinase beta Gamma-actin, cytoplasmic

Retinol dehydrogenase type I Glutathione S-transferase alpha subunit

Retinol-binding protein (RBP) Heme oxygenase

Ribosomal protein L13 Hemoglobin alpha 1 chain

Ribosomal protein S17 Hemoglobin alpha 1 chain (alternate clone)

Ribosomal protein S8 Hepcidin antimicrobial peptide (Hamp)

Scavenger receptor class B type I Hepcidin antimicrobial peptide (Hamp) (alternate clone)

Schlafen-4 High affinity IgE receptor gamma chain (FcERIgamma)

Selenoprotein P Histidine-rich glycoprotein

Stathmin HMG-CoA synthase, mitochondrial

Stearyl-CoA desaturase, liver IgE binding protein

Sulfotransferase K2 Interferon related developmental regulator IFRD1 (PC4)

Traπsferriπ Intracellular calcium-binding protein (MRP14)

Transitional endoplasmic reticulum ATPase Intracellular calcium-binding protein (MRP8)

Ubiquitin D (Ubd) Malate dehydrogenase, cytosoiic

UDP-glucuronosyltransferase Melanoma-associated antigen ME491

Urinary protein 2 precursor Mx1 protein

Vacuole membrane protein 1 NADP-dependent isocitrate dehydrogenase, cytosoiic

Very long-chain acyl-CoA synthetase Neuropeptide Y

VL30 element. NGF-inducible anti-proliferative putative secreted protein (PC3)

Voltage-dependent anion channel 2 (Vdac2) Nucleosome assembly protein

Zinc finger protein Osteoactivin

Phase-1 RCT-006

Heart responsive genes Phase-1 RCT-009 -beta-hydroxysteroid dehydrogenase (HSD3B1) Phase-1 RCT-010

Acyl-CoA dehydrogenase, medium chain Phase-1 RCT-013

Alpha-2-microglobulin Phase-1 RCT-018

Alpha-fibrinogen Phase-1 RCT-022

Apoptosis-regulating basic protein Phase-1 RCT-024

Argininosuccinate lyase Phase-1 RCT-027

Beta-actin, sequence 2 Phase-1 RCT-039

Beta-tubulin, class I Phase-1 RCT-050

Calgranuliπ B Phase-1 RCT-055

Calpactin I heavy chain Phase-1 RCT-056

Cathepsin L, sequence 2 Phase-1 RCT-058

Cdc2-related protein kinase (NCLK) Phase-1 RCT-059

Cofilin Phase-1 RCT-060

Contrapsin-like protease inhibitor (CPi-21) Phase-1 RCT-065

Cytochrome c oxidase subunit I Phase-1 RCT-074

Cytochrome c oxidase subunit I (alternate clone) Phase-1 RCT-079

Decorin Phase-1 RCT-085

Dimethylarginine dimethylaminohydrolase Phase-1 RCT-087

Endogenous retroviral sequence, 5' and 3' LTR Phase-1 RCT-090

ERG-2 Phase-1 RCT-102 Acyl-CoA dehydrogenase, medium chain

Alpha-1 acid glycoprotein

Alpha-2-macroglobulin, sequence 2

Alpha-2-micrbglobulin

Alpha-fibrinogen

Apoptosis-regulating basic protein

Aspartoacylase

Calgranulin B

Carbamyl phosphate synthetase I

Cytochrome c oxidase subunit I (alternate clone)

Decorin

Diazepam binding inhibitor

Dimethylarginine dimethylaminohydrolase

ERG-2

Heme oxygenase

Hemoglobin alpha 1 chain

Hemoglobin alpha 1 chain (alternate clone)

Hepcidin antimicrobial peptide (Hamp)

Histidine-rich glycoprotein

Insulin-like growth factor I, exon 6

Intracellular calcium-binding protein (MRP 14)

Intracellular calcium-binding protein (MRP8)

Methylacyl-CoA racemase alpha

MHC class I antigen RT1.A1(f) alpha-chain

MHC class II antigen RT1.B-1 beta-chain

MHC class II antigen RT1.B-1 beta-chain (alternate clone)

Mx1 protein

Neuropeptide Y

Pancreatic secretory trypsin inhibitor type II (PSTI-II)

Phase-1 RCT-006

Phase-1 RCT-008

Phase-1 RCT-009

Phase-1 RCT-013

Phase-1 RCT-027

Phase-1 RCT-033

Phase-1 RCT-051

Phase-1 RCT-055

Phase-1 RCT-059

Phase-1 RCT-065

Phase-1 RCT-084

Phase-1 RCT-087

Phase-1 RCT-102

Phase-1 RCT-117

Phase-1 RCT-125

Phase-1 RCT-146 Complement factor I (CFI)

Phase-1 RCT-165 Contrapsin-like protease inhibitor (CPi-21)

Phase-1 RCT-173 CTP:phosphochoJine cytidylyltransferase

Phase-1 RCT-178 Cystatin C

Phase-1 RCT-205 Cytochrome c oxidase subunit I

Phase-1 RCT-214 Cytochrome c oxidase subunit I (alternate clone)

Phase-1 RCT-225 Cytochrome P450 2C23

Phase-1 RCT-233 Cytochrome P4502C39

Phase-1 RCT-239 Cytochrome P450 2C39 (alternate clone 2)

Phase-1 RCT-241 Cytochrome P450 2D18

Phase-1 RCT-246 Decorin

Phase-1 RCT-255 Dimethylarginine dimethylaminohydrolase

Phase-1 RCT-264 Endogenous retroviral sequence, 5' and 3' LTR

Phase-1 RCT-287 ERG-2

Preproalbumin Fetuin protein (IRL685)

Preproalbumin (alternate clone) Gamma-actin, cytoplasmic

Preproalbumin (alternate clone) Glutathione S-transferase alpha subunit

Preproalbumin, sequence 2 Heme oxygenase

Retinol dehydrogenase type I Hemoglobin alpha 1 chain

Retinol-binding protein (RBP) Hemoglobin alpha 1 chain (alternate clone)

Schlafen-4 Hemopexin (alternate clone)

Stearyl-CoA desaturase, liver Hepcidin antimicrobial peptide (Hamp)

Tissue plasminogen activator High affinity IgE receptor gamma chain (FcERIgamma)

Transferrin Histidine-rich glycoprotein

UDP-glucuronosyltransferase HMG-CoA synthase, cytosoiic

Urinary protein 2 precursor HMG-CoA synthase, mitochondrial

Vacuole membrane protein 1 IgE binding protein

Insulin-like growth factor I, exon 6

Spleen responsive genes Intracellular calcium-binding protein (MRP14)

3-hydroxyisobutyrate dehydrogenase Intracellular calcium-binding protein (MRP8)

60S ribosomal protein L6 (alternate clone 1 ) Melanoma-associated antigen ME491

Alpha-2-microglobulin Methylacyl-CoA racemase alpha

Alpha-fibrinogen MHC class I antigen RT1.A1(Q alpha-chain

Alpha-prothymosin MHC class II antigen RT1.B-1 beta-chain

Apolipoprotein C1 MHC class II antigen RT1.B-1 beta-chain (alternate clone)

Argininosuccinate lyase Mx1 protein

Aspartoacylase Neuropeptide Y

Beta-actin, sequence 2 Osteoactivin

Betaine homocysteine methyltransferase (BHMT) Pancreatic secretory trypsin inhibitor type II (PSTI-II)

Beta-tubulin, class I Pancreatic secretory trypsin inhibitor type II (PSTI-II) (alternate clone)

Calgranulin B Phase-1 RCT-007

Calpactin I heavy chain Phase-1 RCT-008

Carbonic anhydrase III, sequence 2 Phase-1 RCT-009

Cofilin Phase-1 RCT-012 Phase-1 RCT-214

Phase-1 RCT-221

Phase-1 RCT-225

Phase-1 RCT-228

Phase-1 RCT-230

Phase-1 RCT-235

Phase-1 RCT-236

Phase-1 RCT-241

Phase-1 RCT-243

Phase-1 RCT-251

Phase-1 RCT-253

Phase-1 RCT-264

Phase-1 RCT-274

Phase-1 RCT-276

Phase-1 RCT-277

Phase-1 RCT-278

Phase-1 RCT-280

Phase-1 RCT-284

Phase-1 RCT-286

Phase-1 RCT-288

Phase-1 RCT-293

Phosphatidylethanolamine-binding protein

Preproalbumin

Preproalbumin (alternate clone)

Preproalbumin, sequence 2

Protein disulfide isomerase related protein

Protein O-mannosyltransferase 1 (Pomtl)

Protein tyrosine phosphatase, receptor type, D

Putative membrane fatty acid transporter

Pyruvate kinase, muscle

RAC protein kinase beta

Retinol dehydrogenase type I

Retinol-binding protein (RBP)

Ribosomal protein L13

Ribosomal protein L27

Ribosomal protein S17

Ribosomal protein S8

Schlafen-4

Selenoprotein P

Stathmin

Thioredoxin-1 (Trx1 )

Tissue plasminogen activator

Transferrin Ubiquitin D (Ubd)

Urinary protein 2 precursor

Vacuole membrane protein 1

VL30 element

Voltage-dependent anion channel 2 (Vdac2)

Testes responsive genes

3-beta-hydroxysteroid dehydrogenase (HSD3B1)

3-hydroxyisobutyrate dehydrogenase

Acetylcholine receptor epsilon

Alpha-1 acid glycoprotein

Alpha-1 microglobuiin/bikunin precursor (Ambp)

Alpha-2-microglobulin

Alpha-prothymosin

Apolipoprotein C1

Argininosuccinate lyase

Beta-tubulin, class I

Calgranulin B

Calpactin I heavy chain

Carbonic anhydrase III, sequence 2

Cdc2-related protein kinase (NCLK)

Cofilin

Contrapsin-like protease inhibitor (CPi-21)

Cystatin C

Cytochrome c oxidase subunit I

Cytochrome c oxidase subunit I (alternate clone)

Cytochrome P4502C23

Cytochrome P450 2C39

Cytochrome P4502C39 (alternate clone 1)

D-dopachrome tautomerase

Decorin

Diazepam binding inhibitor

Dimethylarginine dimethylaminohydrolase

Endogenous retroviral sequence, 5' and 3' LTR

ERG-2

Glutathione S-transferase alpha subunit

Heme oxygenase

Hemoglobin alpha 1 chain

Hemoglobin alpha 1 chain (alternate clone)

Hemopexin (alternate clone)

High affinity IgE receptor gamma chain (FcERIgamma)

Histidine-rich glycoprotein

HMG-CoA synthase, mitochondrial

IgE binding protein

Phase-1 RCT-280 Transferrin

Phase-1 RCT-282

Phase-1 RCT-284

Phase-1 RCT-293

Phosphatidylethanolamine-binding protein

Preproalbumin

Preproalbumin (alternate clone)

Preproalbumin, sequence 2

Retinol dehydrogenase type I

Retinol-binding protein (RBP)

Ribosomal protein S17

Schlafen-4

Selenoprotein P

Stathmin

Stearyl-CoA desaturase, liver

Sulfotransferase K2

Urinary protein 2 precursor

Very long-chain acyl-CoA synthetase

VL30 element

Voltage-dependent anion channel 2 (Vdac2)

Brain responsive genes

Alpha-2-microglobulin

Argininosuccinate lyase

Calgranulin B

CDK108

ERG-2

Hemoglobin alpha 1 chain

Hemoglobin alpha 1 chain (alternate clone)

Neuropeptide Y

Phase-1 RCT-002

Phase-1 RCT-008

Phase-1 RCT-057

Phase-1 RCT-083

Phase-1 RCT-096

Phase-1 RCT-102

Phase-1 RCT-194

Phase-1 RCT-264

Phase-1 RCT-280

Phase-1 RCT-294

Preproalbumin

Preproalbumin (alternate clone)

Preproalbumin, sequence 2 Table 9

Table 10

Cytochrome P450 2C 1 Glyceraldehyde 3-phosphate dehydrogenase

Cytochrome P450 2C12 Heme binding protein 23

Cytochrome P450 2E1 Hemopexin

Cytochrome P450 3A1 Hepatic lipase

Cytochrome P450 4A1 Hepatocyte growth factor receptor

Cytochrome P450 4A1 , 50-mer Hepatocyte nuclear factor 4

Defender against cell death-1 Histone 2A

Deoxycytidine kinase HMG CoA reductase

Disulfide isomerase related protein (ERp72) Hydroxysteroid sulfotransferase a

DNA polymerase beta Hypoxanthine-guanine phosphoribosyltransferase

DNA topoisomerase I ID-1

Dopamine transporter IkB-a

Dynein light chain 1 Insulin-like growth factor binding protein 1

Ecto-ATPase Insulin-like growth factor binding protein 3

Elongation factor-1 alpha Insulin-like growth factor binding protein 5

Endothelin converting enzyme Insulin-like growth factor I

Enolase alpha Integrin betal

Enoyl CoA hydratase (mitochondrial) Interferon gamma

Epidermal growth factor Interferon inducible protein 10

Epithelial sodium channel alpha subunit (alpha-ENaC) lnterleukin-1 beta

Epoxide hydrolase lnterleukin-18

E-selectin lnterleukin-6

Estrogen receptor Jagged 1

Extracellular-signal-regulated kinase 1 JNK1 stress activated protein kinase

F1-ATPase beta subunit K-cadherin

Fas antigen Keratinocyte growth factor

Fatty acid synthase Lactate dehydrogenase-B

Fatty acyl-CoA oxidase Lipopolysaccharide binding protein

Ferritin H-chain Lipoprotein lipase

Fibrinogen gamma chain Liver fatty acid binding protein

Gadd153 Low density lipoprotein receptor

Gadd45 Lysyl oxidase

Gamma-glutamyl transpeptidase Macrophage inflammatory protein-1 alpha

Glucokinase Macrophage inflammatory protein-2 alpha

Glucose transporter 2 Macrophage metalloelastase

Glucose-6-phosphate dehydrogenase Major acute phase protein alpha-1

Glucose-regulated protein 78 Malic enzyme

Glucosylceramide synthase Maspin

Glutamine synthetase Matrix metalloproteiπase-1

Glutathione peroxidase Metallothionein 1

Glutathione S-transferase theta-1 Methylenetetrahydrofolate reductase

Glutathione S-transferase Ya Mitogen activated protein kinase (P38)

Glutathione S-transferase Yb2 subunit Monoamine oxidase A

Glutathione synthetase Monoamine oxidase B Monocyte chemotactic protein receptor (CCR2) Senescence marker protein-30

Multidrug resistant protein-1 Serotonin transporter (SERT)

Multidrug resistant protein-2 Sodium/bile acid cotransporter

Na/K ATPase alpha-1 Sodium/glucose cotransporter 1

NADPH cytochrome P450 oxidoreductase Sorbitol dehydrogenase

NADPH cytochrome P450 reductase Stem cell factor

NADPH quinone oxidoreductase-1 (DT-diaphorase) Sterol carrier protein 2

Neurofibromin (NF1 tumor suppressor) Superoxide dismutase Cu/Zn

Neutral endopeptidase 24.11 (enkephalinase) Superoxide dismutase Mn

Nucleoside diphosphate kinase beta isoform Suppressor of cytokine signaling 3

Organic anion transporter 3 Syndecan-1

Organic anion transporter K1 T-cell cyclophilin

Organic anion transporting polypeptide 1 TGF-beta receptor type I

Organic cation transporter 2 Thiopurine methyltransferase

Organic cation transporter 3 Thioredoxin-2 (Trx2)

Omithine aminotransferase Thrombin receptor (PAR-1)

Omithine decarboxylase Thrombomodulin

Oxygen regulated protein 150 Thymidylate synthase p53 Thymosin beta-10

P55CDC Tissue factor p70 ribosomal protein S6 kinase alpha-1 Tissue factor pathway inhibitor

Paraoxonase 1 Tissue inhibitor of metalloproteinases-1

Peroxisomal 3-ketoacyl-CoA thiolase 1 Tissue inhibitor of metalloproteinases-3

Peroxisomal 3-ketoacyl-CoA thiolase 2 Transforming growth factor-beta3

Peroxisomal acyl-CoA oxidase Transthyretin

Peroxisome assembly factor 2 Tyrosine aminotransferase

Peroxisome proliferator activated receptor gamma Ubiquitin conjugating enzyme (RAD 6 homologue)

Phenylalanine hydroxylase UDP-glucuronosyltransferase 1A6

Phosphoglycerate kinase UDP-glucuronosyltransferase 2B

Pim1 proto-oncogene Uncoupling protein 2

Presenilin-1 Urate oxidase

Prostaglandin H synthase Urokiπase plasminogen activator receptor

Protein disulfide isomerase (PDI) Vascular cell adhesion molecule 1 (VCAM-1 )

Protein kinase C betal Vascular endothelial growth factor

Protein tyrosine phosphatase alpha Vesicular monoamine transporter (VMAT)

RAD Wa l

Ref-1

Renal organic anion transporter Kidney responsive genes

Retinoid X receptor alpha 14-3-3 zeta

Ribosomal protein L13A 25-DX

Ribosomal protein S9 25-hydroxyvitamin D3-1 alpha-hydroxylase

S-adenosylmethionine decarboxylase 3-methyladenine DNA glycosylase

S-adenosylmethionine synthetase 60S ribosomal protein L6

Sarcoplasmic reticulum calcium ATPase Activating transcription factor 3 Adrenomedullin c-myc

Aflatoxin B1 aldehyde reductase Collagen type I

Alanine aminotransferase Complement component C3

Alcohol dehydrogenase 1 Connexin-32

Aldehyde dehydrogenase 2 Cyclin D1

Alpha 1-antitrypsin Cyclin dependent kinase 4 alpha-1 ,2-fucosyltransferase Cyclin E

Alpha-2-macroglobulin Cyclin G

Alpha-tubulin Cytochrome c oxidase subunit II

Apolipoprotein All Cytochrome c oxidase subunit IV

Apolipoprotein CHI Cytochrome P450 11A1

Apolipoprotein E Cytochrome P450 17A

Aquaporin-2 Cytochrome P450 1A1

Aryl hydrocarbon receptor Cytochrome P450 1A2

Aryl sulfotransferase Cytochrome P450 1B1

BAK Cytochrome P450 2A3

Bcl-2 Cytochrome P450 2B1/2B2

Beta-actin Cytochrome P450 2C11

Bile salt export pump (sister of p-glycoprotein) Cytochrome P450 2C12

Bilirubin UDP-glucuronosyltransferase isozyme 1 Cytochrome P4502E1

Biliverdin reductase Cytochrome P450 3A1

BRCA1 Cytochrome P450 4A1

C4b-binding protein Cytochrome P450 4A1 , 50-mer

Calcineurin-B Deoxycytidine kinase

Calnexin DNA binding protein inhibitor ID2

Calreticulin DNA topoisomerase I

Canalicular multispecific organic anion transporter Dopamine transporter

Carbonic anhydrase II Dynein light chain 1

Carbonic anhydrase I Ecto-ATPase

Carbonyl reductase Elongation factor-1 alpha

Carnitine palmitoyl-CoA transferase Endothelin converting enzyme

Catalase Eπolase alpha

Catechol-O-methyltransferase Enoyl CoA hydratase (mitochondrial)

Cathepsin B Epidermal growth factor

Cathepsin L Epithelial sodium channel alpha subunit (alpha-ENaC)

CCR-5 Epoxide hydrolase

CD44 metastasis suppressor gene Estrogen receptor

Cellular nucleic acid binding protein (CNBP) Extracellular-signal-regulated kinase 1

Cellular retinoic acid binding protein 2 F1-ATPase beta subunit

Ceruloplasmin Fas antigen

Cholesterol esterase Fatty acid synthase c-H-ras Fatty acyl-CoA oxidase c-jun Ferritin H-chain

Clusterin Fibrinogen gamma chain Gadd153 MAP kinase kinase

Gadd45 Maspin

Gamma-glutamyl transpeptidase Matrix metalloproteinase-1

Glucokinase Metallothionein 1

Glucose transporter 2 Monoamine oxidase B

Glucose-6-phosphate dehydrogenase Multidrug resistant protein-1

Glucose-regulated protein 78 Multidrug resistant protein-2

Glutathione peroxidase Multidrug resistant protein-3

Glutathione S-transferase theta-1 Na/K ATPase alpha-1

Glutathione S-transferase Ya NADPH cytochrome P450 oxidoreductase

Glutathione S-transferase Yb2 subunit NADPH cytochrome P450 reductase

Glutathione synthetase NADPH quinone oxidoreductase-1 (DT-diaphorase)

Glyceraldehyde 3-phosphate dehydrogenase Neurofibromin (NF1 tumor suppressor)

Heme binding protein 23 Neutral endopeptidase 24.11 (enkephalinase)

Hemopexin Notch 1

Hepatic lipase Octamer binding protein 1

Hepatocyte growth factor receptor Organic anion transporter 3

Hepatocyte nuclear factor 4 Organic anion transporter K1

Histone 2A Organic anion transporting polypeptide 1

Hypoxanthine-guanine phosphoribosyltransferase Organic cation transporter 2

Hypoxia-inducible factor 1 alpha Organic cation transporter 3

ID-1 Omithine aminotransferase

IkB-a Omithine decarboxylase

Insulin-like growth factor binding protein 1 Oxygen regulated protein 150

Insulin-like growth factor binding protein 3 p55CDC

Insulin-like growth factor binding protein 5 Paraoxonase 1

Insulin-like growth factor I Peroxisomal 3-ketoacyl-CoA thiolase 1

Integrin betal Peroxisomal 3-ketoacyl-CoA thiolase 2

Integrin beta-4 Peroxisomal acyl-CoA oxidase

Interferon inducible protein 10 Peroxisome assembly factor 1 lnterleukiπ-1 beta Peroxisome assembly factor 2 lnterleukin-10 Peroxisome proliferator activated receptor gamma lnterleukin-6 Phenylalanine hydroxylase

JNK1 stress activated protein kinase Phosphoglycerate kinase

Keratinocyte growth factor Poly(ADP-ribose) polymerase

Lactate dehydrogenase-B Proliferating cell nuclear antigen gene

Lipoprotein lipase Prostaglandin H synthase

Liver fatty acid binding protein Protein kinase C betal

Low density lipoprotein receptor Renal organic anion transporter

Macrophage inflammatory protein-1 alpha Ribosomal protein L13A

Macrophage inflammatory protein-2 alpha Ribosomal protein S9

Major acute phase protein alpha-1 S-adenosylmethionine synthetase

Major basic protein 1 Senescence marker protein-30

Malic enzyme Sodium/bile acid cotransporter Sodium/glucose cotransporter 1 Cathepsin S

Sorbitol dehydrogenase CD44 metastasis suppressor gene

Stem cell factor Ceruloplasmin

Sterol carrier protein 2 c-fos

Superoxide dismutase Cu/Zn Cholesterol esterase

Superoxide dismutase Mn Ciliary neurotrophic factor

T-cell cyclophilin Clusterin

Thiol-specific antioxidant (natural killer cell-enhancing c-myc factor B)

Collagen type II

Thiopurine methyltransferase

Complement component C3

Thioredoxin-2 (Trx2)

Cyclin G

Thrombin receptor (PAR-1 )

Cyclin-dependent kinase 4 inhibitor P27kip1

Thymosin beta-10

Cytochrome c oxidase subunit II

Tissue inhibitor of metalloproteinases-1

Cytochrome c oxidase subunit IV

Tissue inhibitor of metalloproteinases-3

Cytochrome P450 11A1

Transthyretin

Cytochrome P450 17A

Tryptophan hydroxylase

Cytochrome P450 2C11

Tyrosine aminotransferase

Cytochrome P450 2C12

Tyrosine protein kinase receptor (UFO)

Cytochrome P450 2E1

UDP-glucuronosyltransferase 1A6

Cytochrome P4504A1

UDP-glucuronosyltransferase 2B

DNA topoisomerase I

Uncoupling protein 2

Ecto-ATPase

Urate oxidase

Enoyl CoA hydratase (mitochondrial)

Urokinase plasminogen activator receptor

Epidermal growth factor

Very long-chain acyl-CoA dehydrogenase

Extracellular-signal-regulated kinase 1

Vesicular monoamine transporter (VMAT)

F1-ATPase beta subunit

Farnesol receptor

Heart responsive genes Fatty acid synthase

Adenine nucleotide translocator 1

Fibrinogen gamma chain

Alpha 1-antitrypsin

Gadd153

Alpha-fetoprotein

Gadd45

Apolipoprotein E

Glucose-regulated protein 78

Aryl hydrocarbon receptor

Glutamine synthetase

Aryl sulfotransferase

Glutathione S-transferase Ya

Bax (alpha)

Hypoxia-inducible factor 1 alpha

Beta-actin

IkB-a

Calnexin

Insulin-like growth factor I

Calreticulin

Integrin betal

Carbonic anhydrase II

Interferon inducible protein 10

Carbonic anhydrase III lnterleukin-6

Carbonyl reductase

JNK1 stress activated protein kinase

Caspase 6

Lactate dehydrogenase-B

Caspase 7

Lipoprotein lipase

Catalase

Macrophage inflammatory protein-2-alpha

Cathepsin L Macrophage metalloelastase Cytochrome c oxidase subunit II

MAP kinase kinase Cytochrome P450 11A1

Metallothionein 1 Cytochrome P450 17A

Monoamine oxidase A Cytochrome P450 1A1

Monoamine oxidase B Cytochrome P450 1A2

NADPH quinone oxidoreductase-1 (DT-diaphorase) Cytochrome P450 2B1/2B2

Organic anion transporter K1 Cytochrome P4502C11

Organic anion transporting polypeptide 1 Cytochrome P450 2C12

Omithine decarboxylase. Cytochrome P450 3A1

Oxygen regulated protein 150 Cytochrome P450 4A1 , 50-mer

Peroxisomal 3-ketoacyl-CoA thiolase 1 Endothelin-1

Peroxisome proliferator activated receptor gamma Epithelial sodium channel alpha subunit (alpha-ENaC)

Prostaglandin H synthase Epoxide hydrolase

Protein kinase C betal Estrogen receptor

PTEN/MMAC1 Extracellular-signal-regulated kinase 1

RAD Famesol receptor

Ref-1 Fatty acid synthase

Renal organic anion transporter Fibrinogen gamma chain

Retinoid X receptor alpha Gadd153

Sarcoplasmic reticulum calcium ATPase Glucose transporter 2

Sodium/bile acid cotransporter Glucose-regulated protein 78

Sodium/glucose cotransporter 1 Glucosylceramide synthase

Superoxide dismutase Mn Glutamine synthetase

Tissue inhibitor of metalloproteinases-1 Glyceraldehyde 3-phosphate dehydrogenase

UDP-glucuronosyltransferase 2B Hepatic lipase

Vascular endothelial growth factor ID-1

IkB-a

Lung responsive genes Interferon inducible protein 10

3-methyladenine DNA glycosylase Lactate dehydrogenase-B

Adenine nucleotide translocator 1 Lipoprotein lipase

Adrenomedullin Lysyl hydroxylase

Alpha 1-antitrypsin Lysyl oxidase

Apolipoprotein All Macrophage inflammatory protein-2 alpha

Apolipoprotein E Macrophage metalloelastase

Aryl hydrocarbon receptor Major acute phase protein alpha-1

Aryl sulfotransferase Malic enzyme

Bax (alpha) Maspin

Calbindin-D (9K) Metallothionein 1

Calcineurin-B Multidrug resistant protein-1

Carbonic anhydrase I Multidrug resistant protein-2

Catechol-O-methyltransferase Na/K ATPase alpha-1 c-fos NADPH cytochrome P450 oxidoreductase c-jun NADPH cytochrome P450 reductase

Connexin-32 Organic anion transporter K1 Omithine decarboxylase Collagen type II p55CDC Complement component C3

Peroxisomal 3-ketoacyl-CoA thiolase 1 Connexin-32

Peroxisome proliferator activated receptor alpha C-reactive protein

Peroxisome proliferator activated receptor gamma CXCR4

Protein kinase C betal Cyclin G

RAD Cytochrome c oxidase subunit II

Renal organic anion transporter Cytochrome P450 11A1

Retinoid X receptor alpha Cytochrome P450 17A

Sarcoplasmic reticulum calcium ATPase Cytochrome P450 1A2

Sodium/glucose cotransporter 1 Cytochrome P450 2C11

Stem cell factor Cytochrome P450 2C12

Suppressor of cytokine signaling 3 Cytochrome P450 2E1

Tissue factor Cytochrome P450 3A1

Tissue inhibitor of metalloproteinases-1 Cytochrome P450 4A1

Tissue inhibitor of metalloproteinases-3 Defender against cell death-1

Transthyretin Disulfide isomerase related protein (ERp72)

Urate oxidase Dynein light chain 1

Very long-chain acyl-CoA dehydrogenase Elongation factor-1 alpha

Enolase alpha

Spleen responsive genes Epidermal growth factor

25-DX Epithelial sodium channel alpha subunit (alpha-ENaC)

60S ribosomal protein L6 Epoxide hydrolase

Alcohol dehydrogenase 1 Extracellular-signal-regulated kinase 1

Alpha 1-antitrypsin Ferritin H-chain

Alpha-tubulin Fibrinogen gamma chain

Apolipoprotein All Gamma-glutamyl transpeptidase

Apolipoprotein CHI Glucose transporter 2

Apolipoprotein E Glucose-regulated protein 78

Aryl sulfotransferase Glucosylceramide synthase

Aspartate aminotransferase, mitochondrial Glutamine synthetase

Beta-actin Glutathione peroxidase

BRCA1 Glyceraldehyde 3-phosphate dehydrogenase

Calnexin Heme binding protein 23

Calreticulin Hemopexin

Carbonic anhydrase II Hepatocyte nuclear factor 4

Carbonic anhydrase III Hypoxanthine-guanine phosphoribosyltransferase

Catalase IkB-a

Cathepsin L Integrin betal

Cathepsin S Interferon gamma

Ceruloplasmin Interferon inducible protein 10

Cholesterol esterase lnterleukin-1 beta

Ciliary neurotrophic factor JNK1 stress activated protein kinase

Clusterin Keratinocyte growth factor

Multidrug resistant protein-1 Stem cell factor

Multidrug resistant protein-2 Superoxide dismutase Cu/Zn

MutL homologue (MLH1 ) Superoxide dismutase Mn

Na/K ATPase alpha-1 T-cell cyclophilin

Organic anion transporting polypeptide 1 Thrombin receptor (PAR-1)

Omithine aminotransferase Tissue inhibitor of metalloproteinases-1

Omithine decarboxylase Tissue inhibitor of metalloproteinases-3

Phosphoglycerate kinase Transthyretin

Pim1 proto-oncogene Urokinase plasminogen activator receptor

Poly(ADP-ribose) polymerase Very long-chain acyl-CoA dehydrogenase

Proliferating cell nuclear antigen gene

Protein kinase C betal Brain responsive genes

PTEN/MMAC1 BRCA1

Ref-1 Calcineurin-B

Renal organic anion transporter Liver fatty acid binding protein

Retinoid X receptor alpha Transthyretin

Sodium/glucose cotransporter 1 Tyrosine aminotransferase

Sorbitol dehydrogenase