JP2004535776A - Rat toxicity related gene and its use - Google Patents

Abstract

The present invention provides a set of toxicologically relevant rat genes that are useful for determining a toxicological response.

Description

【Technical field】
[0001]
This application claims priority from US Provisional Applications Nos. 60 / 264,933 and 60 / 308,161, filed January 29, 2001 and July 26, 2001, respectively. Are both incorporated herein by reference.
[0002]
The present invention relates to the field of toxicology. More particularly, the present invention provides a set of rat gene sequences useful for assessing the toxicological response to various agents.
[Background Art]
[0003]
Each year, many new drugs and compounds are discovered, produced, and incorporated into the public domain. The guidelines provided by the U.S. Food and Drug Administration (FDA) require that toxicity tests be performed before new drugs or compounds are approved for use in humans. Although toxicological testing is an important part of drug development, toxicology testing traditionally requires long-term clinical trials in both animal models and humans, and the cost of implementation is quite often high. A two-year toxicity test in rats can cost about $ 800,000. See, for example, Casalett and Doull's Toxicology, 4th edition, M.E. O. Amdur et al., Pergamon Press, New York, N.M. Y. See page 37 (1991). Furthermore, because there are so many compounds obtained from high-throughput screening of combinatorial chemical libraries, conventional toxicology tests are no longer sufficient to assess the toxicity of a drug or compound. Furthermore, conventional toxicological methods hardly reveal the molecular mechanism of toxicity, making it difficult to estimate the toxicity results from animal models by applying them to humans. Moreover, conventional toxicity methods often result in numerous failures in the next stages of drug development and after launch.
[0004]
In recent years, a new field of toxic genetics has emerged that examines the toxicological response to drugs or compounds at the molecular level, for example, differential gene expression. One major focus of toxic genetics is the study of differential gene expression evoked in response to chemical or environmental stress. One primary purpose of most applied toxicology tests is to identify one or more organs, one or more systems that have been damaged by exposure to drugs or other environmental factors. Examples of some major toxic target organs include, but are not limited to, liver, kidney, pancreas, heart, lung, brain, thymus, and hypothalamus. Examples of major toxic target systems include, but are not limited to, the immune system, nervous system, digestive system, and circulatory system. By examining patterns of gene expression, toxicologists can gain insight into the basic mechanisms of chemical toxicity. In addition, by measuring gene expression, it is possible to identify threshold concentrations with little health risk.
[0005]
Several methods and kits for determining toxicity have been reported. See, for example, WO 00/47761, U.S. Patent Nos. 5,585,232, 5,589,337, and 5,811,231, and pending U.S. Provisional Patent Application Nos. 60 / 220,057, and See No. 60 / 254,232. However, toxic genetics has enabled a better understanding of organ and system toxic mechanisms and made it easier to predict adverse consequences before detecting with more effort and time. If the toxicity manifested at the organ level is caused by a change in the expression of the relevant gene, detection of a change in gene expression can serve as an early warning of the next adverse consequence. Changes in gene expression can take weeks, months, or even years, before the results appear in an organ or system. To reduce dependence on the observation of late-onset toxicity by measuring changes in gene expression, as long as a causal relationship is shown between early changes in gene expression and late-onset toxicity Can be. A better understanding of molecular mechanisms through toxic genetics can also improve the accuracy of predictions from animal models to humans and from in vitro systems to in vivo states. Molecular approaches to toxicology can save time, money, and animal resources.
[0006]
With the advent of molecular and recombinant technologies, analysis of genes and molecules provides another method by which toxicity can be measured. Differential gene expression techniques involve detecting changes in gene expression in cells that have been exposed to various stimuli. The stimulus may be in the form of a growth factor, receptor-ligand binding, transcription factor, or exogenous factor such as a drug, chemical, or pharmaceutical compound.
[0007]
Several methods have been reported for detecting differential gene expression. One method uses an expression sequence tag (EST) using a polynucleotide array containing, for example, genes for which the full-length cDNA has been correctly sequenced or genes defined by high-throughput single-pass sequencing of random cDNA clones. ). Researchers focused on detecting changes in expression of individual mRNAs can use various methods to detect changes in gene expression, such as microarrays and gel electrophoresis. Other methods focus on using the polymerase chain reaction (PCR) and / or reverse transcriptase polymerase chain reaction (RT-PCR) to define tags and attempt to detect differentially expressed genes. I was guessing. Many groups have used PCR methods to establish a database of mRNA sequence tags that could be used to compare gene expression in different tissues (Williams, JGK, Nucl. Acids Res., 18: 6531, 1990; Welsh, J. et al., Nucl. Acids Res., 18: 7213, 1990; Woodward, SR, Mamm. Genome, 3: 73, 1992; Nadeau, JH. Mamm Genome 3:55, 1992). This method has also been applied to compare mRNA populations in a process called mRNA Differential Display.
[0008]
The process of isolating mRNA from cells or tissues exposed to stimuli such as drugs and chemicals and analyzing expression by gel electrophoresis can be labor intensive and lengthy. To that end, microarray technology offers a faster and more efficient method of detecting differential gene expression. Analysis of differential gene expression by microarray requires immobilized nucleotides on a substrate and nucleotides from cells exposed to the stimulus can be contacted with the immobilized nucleotides to generate a hybridization pattern. This microarray technology detects secretory and membrane-related gene products, gathers pharmacological information about cancer, stage-specific gene expression in malaria by Plasmodium falciparum, translation products in eukaryotes, and Or other scientific research. See, for example, Diehn M et al. Nat Genet. 25 (1): 58-62 (1993); Scherf, U.S.A. Other Nat Genet. 24 (3) 236-44 (1993); E. FIG. Other Mol Microbiol 35 (1): 6-14 (1993); Johannes G. et al. See other Proc Natl Acad Sci USA 96 (23) 13118-23 (1993). Microarray technology has also been used to investigate drug-induced changes in gene expression in M. tuberculosis. For example, Wilson M.S. Other Proc Natl Acad Sci. 96 (22): 12833-8 (1999).
DISCLOSURE OF THE INVENTION
[Problems to be solved by the invention]
[0009]
There is a need for a method that is quick, efficient, cost-effective, can generate large amounts of toxicological data, and saves many animals used in laboratory tests. There is also a need for a method of effectively selecting genes that are toxicologically related to the agent being tested and that can predict toxicity at the cell, organ, or system level. A toxicological information database capable of obtaining information about one or more agents to be tested and obtaining information on how the agents affect a particular organ or system; There is also a need for algorithms that can be used to identify toxicologically relevant genes and correlate toxicity between agents and target genes.
[0010]
Molecular toxicological analysis or toxicogenetics can provide a vast amount of information in the form of a database from the collection of toxicological response data that is considered useful for toxicological analysis. The present invention and its embodiments as set forth herein meet the foregoing needs.
[0011]
The disclosures of all patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety.
[Means for Solving the Problems]
[0012]
The present invention provides a toxicity response gene and its use.
[0013]
In one aspect, the invention relates to (a) exposing a test animal to an agent; (b) corresponding to the partial gene sequences of Tables 6, 7, 8, 9, and 10 in the test animal in response to the agent. Measuring the expression of one or more toxicity response genes selected from the genes to be generated, thereby generating a test expression profile; and (c) comparing the test expression profile with a reference expression profile indicative of toxicity. A method for assessing the toxicity of an agent by determining whether there is a significant correlation between a test expression profile and a reference expression profile. . In one embodiment, the group of genes corresponding to the partial gene sequence responds in kidney, liver, spleen, heart, lung, testis, or brain. In another embodiment, the test animal is a rat, dog, non-human primate, or human. In another embodiment, the agents are administered at different doses or at different times.
[0014]
In another aspect, the present invention provides a method comprising: (a) exposing a test animal to an agent; (b) responding to the agent from genes corresponding to the partial gene sequences of Tables 6, 7, and 8 in the test animal. Measuring the expression of one or more selected toxic response genes, thereby generating a test expression profile; and (c) comparing the test expression profile with a reference expression profile indicative of toxicity. A method of assessing the toxicity of an agent by determining whether there is a significant correlation between a test expression profile and a reference expression profile. In one embodiment, the group of genes corresponding to the partial gene sequence responds in kidney, liver, spleen, heart, lung, testis, or brain. In another embodiment, the test animal is a rat, dog, non-human primate, or human. In another embodiment, the agents are administered at different doses or at different times.
[0015]
In another aspect, the present invention provides a method comprising: (a) exposing a test animal to an agent; (b) one selected from a gene corresponding to the partial gene sequence of Table 4 in the test animal, which responds to the agent. Or measuring the expression of a plurality of toxicity response genes, thereby generating a test expression profile, and (c) assessing the toxicity of the agent by comparing the test expression profile with a reference expression profile indicative of toxicity. A method is provided for assessing the toxicity of an agent by determining whether a significant correlation exists between a test expression profile and a reference expression profile. In one embodiment, the set of toxicologically relevant genes consists of at least 25 genes. In another embodiment, the set of toxicologically relevant genes consists of at least 50 genes. In another embodiment, the set of toxicologically relevant genes consists of at least 100 genes.
[0016]
In another aspect, the invention provides an array comprising one or more polynucleotides selected from genes corresponding to the partial gene sequences of Tables 6, 7, 8, 9, and 10, or a fragment of at least 20 nucleotides thereof. I will provide a. In one embodiment, the group of genes corresponding to the partial gene sequence responds in kidney, liver, spleen, heart, lung, testis, or brain.
[0017]
In another aspect, the invention provides an array comprising one or more polynucleotides selected from the genes corresponding to the partial gene sequences in Tables 6, 7, and 8, or a fragment of at least 20 nucleotides thereof. In one embodiment, the group of genes corresponding to the partial gene sequence responds in kidney, liver, spleen, heart, lung, testis, or brain.
[0018]
In another aspect, the present invention provides an array comprising one or more polynucleotides selected from the group consisting of a gene corresponding to the partial gene sequence of Table 4 or a fragment of at least 20 nucleotides thereof. In one embodiment, the set of toxicity response genes consists of at least 25 genes. In another embodiment, the set of toxicity response genes consists of at least 50 genes. In another embodiment, the set of toxicity response genes consists of at least 100 genes.
[0019]
In another aspect, the invention corresponds to at least 20 nucleotides in length that is substantially homologous to a set of toxicity response genes selected from the genes corresponding to the partial gene sequences in Tables 6, 7, and 8. An array comprising a set of polynucleotides is provided.
[0020]
In another aspect, the present invention relates to a method for constructing a polynucleotide comprising one or more polynucleotides selected from genes corresponding to the partial gene sequences of Tables 6, 7 and 8 or a fragment of at least 20 nucleotides thereof. An array comprising one or more polynucleotides homologous to the nucleotide is provided. In one embodiment, the polynucleotide corresponds to a human, murine, non-human primate, or canine gene.
[0021]
Table 1 is a list of drug substances that can potentially elicit very high toxic responses in some individuals.
[0022]
Table 2 is a list of industrial chemicals that can potentially elicit very high toxic responses in some individuals.
[0023]
Table 3 is a list of drugs and chemicals used to generate the data shown in Tables 7, 8, 9, and 10. These compounds were selected for their ability to induce the following conditions. That is, liver degeneration / necrosis, hepatocellular hypertrophy, hepatocyte vacuole, renal tubule degeneration / necrosis, renal glomerular necrosis, myocardial degeneration, myocardial inflammation, spleen lymphocyte depletion / apoptosis, spleen lymphocyte hyperplasia, Neurotoxicity, skeletal muscle degeneration and inflammation, multiple tissue necrosis and inflammation, repair, including proliferation.
[0024]
Table 4 is a list of 700 rat genes and / or gene sequences determined to be toxic response genes.
[0025]
The table is divided into three sections. The first section lists genes found using experimental data from a set of 17,241 genes, which, when searched for in the GenBank database, matches a known complete rat gene. ing. The second section lists genes found using experimental data from a set of 17,241 genes that do not match a known complete rat gene when the genes are searched in the NCBI GenBank database. are doing. These genes are listed in numerical order by Phase 1 RCT number. The clones of the genes in the first and second sections use the pT7T3D-PAC vector. The gene sequences in this table may include a small portion of the vector in the sequence. The following vector sequence portions can be included in the sequences listed in Table 4 and should not be included when referring to a gene or gene sequence itself. The sequence using the M13 reverse primer
There are TAATACGACTCACTATAGGGAATTTGGCCCTCGAGGCCAAGAATTC (SEQ ID NO: 701), which can be followed by the insert, followed by
Also includes those that can be followed by GCGGCCGCAAGCTTATTCCCTTTTAGGAGGGTTAAT (SEQ ID NO: 702). The sequence of the complementary strand is as follows:
ATTAACCCTCACTAAAGGGAATAAGCTTGCGGCCGC (SEQ ID NO: 703), followed by an insert, followed by
GAATTCTTGGCCTCGAGGCCAAAATTCCCTATAGTGAGTCGTATTA (SEQ ID NO: 704) can also be followed.
[0026]
The third set of genes in this table refers to genes selected based on their potential role in important cellular pathways and the toxic response of experimental data. Clones for this third set of genes used the pCRII-TOPO vector. The gene sequence in Table 4 may include a small portion of the vector in the sequence. The following vector sequence portions can be included in the sequences listed in Table 4 and should not be included when referring to a gene or gene sequence itself. Sequences that use the T7 promoter as a primer include those that include ATATCTGCAGAATTCGCCCTT (SEQ ID NO: 705) followed by an insert, which can be followed by AAGGGCGAATTCCAGCACACT (SEQ ID NO: 706). Sequences of the reverse complement include those that include AGTGTGCTGGAATTCGCCCT (SEQ ID NO: 707), which can be followed by an insert, followed by AAGGGCGAATTCTGCAGATAT (SEQ ID NO: 708). The gene designated "Phase 1 RCT" is shown in more detail in Table 5.
[0027]
Table 5 is a list of phase 1 RCT genes and their homology, where known genes (rat, mouse, human) were identified by a BLAST search of NCBI GenBank. The phrase "no significant homology found for known complete gene" means that BLAST search did not reveal significant (> 97%) homology to any known complete gene Is shown.
[0028]
Table 6 is a list of genes found by testing 17,241 genes on the 17,241 gene microarray and response data that provided the basis for selecting each gene. These 400 genes were selected after first filtering all gene data for acceptable fold induction values (> 2), coefficient of variation (COV, <30), and fluorescence values (fluor,> 400), Genes meeting these criteria were then ranked by the number of experiments the gene responded to, the COV between two slides, and the fold induction. After the name of the gene, details of the compound that elicited an acceptable response (passed through the filter), the tissue, drug or chemical dose evaluated, and the point at which the animal was killed after intraperitoneal injection of the compound Continued the list.
[0029]
Table 7 is a list showing the tissue-specific response of toxicological genes experimentally selected from the set of 17,241 genes. The data evaluated for this tissue response was obtained by administering the compounds listed in Table 3 to rats, and then determining differential gene expression, thereby establishing a database of approximately 2500 experiments (ie, , Data from one microarray). The tissue response is more than doubled in 1% of experiments for specific tissues for liver and kidney, and more than 2 times for 2% of experiments in specific tissues for heart, lung, spleen, testis, and brain. This table is summarized by the data for each gene.
[0030]
Table 8 is a list showing tissue-specific responses of the toxicological genes of Table 7 for each tissue.
[0031]
Table 9 is a list showing tissue specific responses of toxicological genes selected by details of their role in important cellular pathways. The data evaluated for this tissue response is obtained by administering the compounds listed in Table 3 to rats and determining differential gene expression, thereby establishing a database of about 2500 experiments. The tissue response is more than doubled in 1% of experiments for specific tissues for liver and kidney, and more than 2 times for 2% of experiments in specific tissues for heart, lung, spleen, testis, and brain. This table is summarized by the data for each gene.
[0032]
Table 10 is a list showing tissue-specific responses of the toxicological genes of Table 9 for each tissue.
BEST MODE FOR CARRYING OUT THE INVENTION
[0033]
The present invention provides a set of toxicologically relevant rat genes that can be used to assess the toxic response to drugs, chemicals, and / or compounds.
[0034]
I. General techniques
In practicing the present invention, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, and Use techniques that fall within the technical scope of Such techniques are described in Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989) and Molecular Cloning: A Laboratory Manual, 3rd Edition (Metal Cloning: A Laboratory Manual). Sambrook and Russel, 2001); (collectively referred to herein as "Sambrook"); Current Protocols in Molecular Biology (ed. FM Ausubel et al., Eds. 1987, 2001). PCR: The polymerase chain reaction (PCR: The Polymerase Chain Reaction) (Mullis et al., Eds., 1994); Harlow and Lane (1988) antibody, laboratory manual (Antibodies, A Laboratory Manual), Cold Spring Harbor Publications, New York, and Harlow and 1999, using the antibody and the experimental method. Room Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (collectively referred to herein as "Hallow and Lane in chemistry and other current protocols, Harlow and Lane, Nucleotide, Gasoline, and Cancer", Cold Spring Harbor Laboratory Press). Nuc Leic Acid Chemistry) John Wiley & Sons, Inc. It is fully described in documents such as New York, 2000.
[0035]
II. Definition
As used herein, "toxicity" refers to the enhanced microscopic or macroscopic response of a cell, tissue, organ, or system to a low or average dose of an agent. These responses can lead to observable symptoms such as dizziness or nausea, and can also lead to toxic symptoms. Toxicity often results in adverse side effects that differ in degree or type from the response of the majority of individuals at the recommended dose.
[0036]
"Obvious toxicity" refers to toxicity for which a response can be observed with the naked eye. Examples of overt toxic responses include, but are not limited to, clinical observations, serum chemistry, hematology, urinalysis, histopathology, or macroscopic findings of tissues and organs at necropsy .
[0037]
"Toxicological response" refers to a response at the cell, tissue, organ, or system level upon exposure to an agent, including genes and / or proteins that include both up-regulation and down-regulation of such genes. Up-regulation or down-regulation of a gene encoding a protein involved in the repair or control of cytotoxicity; or regulation of a gene in response to the presence of an agent.
[0038]
As used herein, the terms “toxic gene”, “toxicologically relevant gene”, and “toxic response gene” can be used interchangeably. These terms can be defined as genes whose message or protein levels change upon exposure to noxious stimuli. The particular set of genes that a cell induces will vary, inter alia, depending on the type of damage or toxic risk caused by the agent and which organs are most threatened.
[0039]
As used herein, “gene expression indicative of a toxicological response” refers to the relative expression level of a toxic gene or toxic response gene. The profile of the gene expression profile can be measured in a sample, such as a sample containing various cell types, various tissues, various organs, or fluids (eg, blood or urine, spinal fluid, serum). These profiles can include a “test expression profile” and a “reference expression profile”.
[0040]
"Substantially homologous" or "substantially identical" is at least when the largest corresponding position is compared and aligned to by measurement or visual inspection using one of the following sequence comparison algorithms: Refers to sequence homology in which 70%, preferably at least 80%, preferably at least 85%, more preferably at least 90% nucleotide or amino acid residues are identical. Two sequences (amino acids or nucleotides) can be compared for their entire full length (eg, the shorter of the two if they are of significantly different lengths). In sequence comparison, typically one sequence acts as a reference sequence, which is compared to a test sequence. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, the subsequence coordinates are specified, and if necessary, the parameters of the sequence algorithm program. The percent identity of the test sequence to the reference sequence is then calculated using sequence comparison algorithms, based on the designated program parameters. Optimal sequence alignments for comparison are described, for example, in Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Am. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), by a computerized realization of these algorithms (GAP, BESTFIT, FASTA, and TFASTA, Wisconsin Genetics Software Package, Genetics Computer Group, 575 ScienceWice, 575 Science. ), Or by visual inspection (see generally the current protocols in Molecular Biology by Ausubel et al, supra, Green Publishing and Wiley Interscience, New York). When using any of the above algorithms, use default parameters such as window length and gap penalty. Also, the fact that two nucleic acid sequences or polypeptides are substantially identical means that a first polypeptide (eg, a polypeptide encoded by a first nucleic acid) is a second polypeptide (eg, a second nucleic acid). (Polypeptide encoded by). Thus, a polypeptide is generally substantially identical to a second polypeptide, where the two peptides differ only by conservative substitutions.
[0041]
As used herein, the term “gene” refers to a polynucleotide that encodes a protein product and includes RNA, mRNA, cDNA, single-stranded DNA, double-stranded DNA, complementary strand, and fragments thereof. Points to an array. Genes can include introns and exons.
[0042]
The term "gene sequence" refers to a gene, a full-length gene, or a portion thereof.
[0043]
As used herein, "array" and "microarray" can be used interchangeably and refer to a collection of nucleotide sequences at a central position. The array can be placed on a solid substrate, such as a glass slide, or on a semi-solid substrate, such as a nitrocellulose membrane. The nucleotide sequence may be DNA, RNA, any permutation of these, including nucleotide analogs. The nucleotide sequence may be a partial sequence of a gene, a primer, a whole gene sequence, a non-coding sequence, a coding sequence, a published sequence, a known sequence, or a novel sequence.
[0044]
"Agents" to which an individual can have a toxicological response include, for example, drugs and pharmaceutical compounds, household chemicals, industrial chemicals, environmental chemicals, and other chemicals to which the individual can be exposed And compounds. Exposure to agents, including inhalation and environmental exposure, can cause physical and secondary contact.
[0045]
As used herein, "differential expression" refers to a change in the expression level of a gene and / or a protein encoded by said gene in a cell, tissue, organ, or system upon exposure to an agent. As used herein, differential gene expression includes differential transcription and translation, and message stabilization. Differential gene expression includes both up-regulation and down-regulation of gene expression.
[0046]
The term "rat" refers to a mammal of the genus Rattus, and is any one of a number of rodents (Rattus and related genera) that are fairly large in size and also differ in structural detail (eg, tooth size) from the related mouse. Species can be included. Rat strains that can be used include, but are not limited to, Sprague-Dawley, Wistar, and Fisher.
[0047]
The term "sample" as used herein refers to a substance supplied by an individual. The sample can include cells, tissues, parts of tissues, organs, parts of organs, or fluids (eg, blood, urine, serum). The sample is characterized in a preferred embodiment by including at least two different genes and may include genes from multicellular types. Samples include, but are not limited to, eukaryotic, mammalian, or human origin.
[0048]
The terms "protein," "polypeptide," and "peptide" can be used interchangeably herein and refer to a polymer of amino acids of any length. The polymer can be linear or branched, can contain modified amino acids, and is interrupted by non-amino acids. It can also be modified, naturally or by intervention, by disulfide bond formation or glycosylation, myristylation, acetylation, alkylation, phosphorylation, dephosphorylation. This definition also includes polypeptides that contain one or more amino acid analogs (eg, including unnatural amino acids), as well as other variations known in the art.
[0049]
As used herein, the term "significant correlation" has its ordinary meaning in the art, and the likelihood of an observed difference (p-value) that occurs by accident (or a "similar" measurement) In the case of, the observed difference may not be seen) is approximately below the predetermined level, ie, p-value <0.05, preferably p-value <0.01, more preferably p-value <0.01. It means that the value <0.001. Various suitable statistical techniques are well known to those skilled in the art and can be used to measure statistical significance (eg, Student's t-test {for comparison of two samples} or ANOVA {ANOVA}, confidence interval) Standard statistical methods such as analysis; software such as SAS System Version 8 (SAS Institute Inc., Cary, NC, USA) can be used for analysis).
[0050]
An "individual" is a vertebrate, preferably a mammal, and more preferably a human. Mammals include, but are not limited to, livestock, sport animals, pets, primates, mice, and rats.
[0051]
III. Identification of a set of toxicologically relevant genes
Identification of a set of toxicologically relevant genes can be achieved by several methods. One method that can be used is to clone the gene as described above to make it toxicologically relevant. Primers are generated using, for example, sequences published in the literature and GenBank, and then used to PCR amplify from relevant libraries to identify toxicologically relevant candidate genes of interest. And can be cloned into a plasmid or expression vector depending on the desired use. Gene sequences (complete or partial) can be placed between other toxicologically relevant genes in the microarray for high throughput testing as disclosed below.
[0052]
Alternatively, the plasmid may be used to increase the copy number of the toxicologically relevant candidate gene in question, in order to replicate to a higher copy number, and then used in any commercially available kit (eg, Qiagen). And Promega). The purified, toxicologically relevant candidate genes are used to “spot” on a microarray, or the purified nucleic acid is then inserted into an expression vector and transfected into mammalian cells, eg, rat cells. The cells can be exposed to a compound and a toxicological response can be observed. Overt toxicity can be confirmed by observing changes in cell morphology or cytoskeletal rearrangements, which can be determined by examination under a microscope, or by observing cell apoptosis or cell necrosis. In another alternative, "transcriptome profiling", described in detail below, can be used, in which nucleic acid is isolated from both exposed and unexposed cells to achieve any level of Tests can be performed to determine whether a compound causes up-regulation or down-regulation of the toxicologically relevant gene in question.
[0053]
Another method that can be used to identify a set of toxicologically relevant genes is to test for available rat genes in which there are approximately 17,421 known rat genes, The purpose is to examine the response of the gene using tissues from a toxicity test and select those that have differential expression. Differential expression can be assessed by any number of methods. One method that can be used is by microarray analysis. Described herein are methods of using microarray analysis to determine differential gene expression. Another method for determining differential gene expression is the reverse transcriptase-polymerase chain reaction (RT-PCR), for example, the Taqman® technique. This document shows how to use Taqman® technology. Another method that can be used to detect differential gene expression is the commercially available Invader® technology from Third Wave. Another method that can be used to determine differential expression is Northern blot analysis. Other methods that can be used include AFLP and SAGE (Klein, PE, et al., Genome Res. 10 (6): 789-807 (2000); Wang, X. and Feuerstein, G. Z., Cardiovasc Res. 35 (3): 414-21 (1997)) Feuerstein, G. et al. Z. And Wang X. Can J. et al. Physiol Pharmacol. 75 (6): 731-4 (1997); Hough, C.E. D. Et al., Cancer Res. 60 (22): 6281-7 (2000); Q. Et al., Anal Biochem. 287 (1): 144-52 (2000)).
[0054]
One method that can be used to identify a set of toxicologically relevant genes is to compare the gene expression profile of control rats with the gene expression profile of rats treated with the agent by " The use of an "open system", whereby response genes are selected. Alternatively, selecting response genes using a comparison of gene expression profiles from control rat cells (or rat cell lines) with rat cells (or rat cell lines) treated with the agent. Can be. This is referred to herein as “transcriptome profiling”. This method experimentally determines which genes are toxicologically relevant by analyzing differential gene expression. In one embodiment, the experimental rats are divided into two groups. One group is exposed to one or more agents at different concentrations and for different times. The other group of rats is not exposed to any agent and serves as a control group. The rat is then killed and organs such as the liver, spleen, kidney, testis, heart, lung, thymus, etc. are harvested and cells are obtained therefrom for molecular analysis of gene expression. In addition, serum proteins in the circulating blood can be analyzed to obtain another measurement and compared to unexposed rats.
[0055]
After exposing the experimental group to at least one agent, RNA from both groups is isolated and reverse transcribed in a PCR reaction to produce cDNA, which is amplified to produce double-stranded DNA. PCR is performed in the presence of a radioactive DNA substrate, which is incorporated into double-stranded DNA. On a polyacrylamide gel, DNA from treated cells is separated by length next to DNA from untreated populations. The intensity of the one or more bands obtained is compared between the treated and untreated cell groups. Bands showing different radioactive intensities are excised from the gel, amplified by PCR, cloned and sequenced. The sequence is compared to known gene sequences in public databases such as GenBank. In this way, novel rat genes that are toxicologically relevant, as well as known rat genes of varying degrees of similarity, are discovered and identified. The examples disclosed herein illustrate how one of ordinary skill in the art could implement this aspect of the invention.
[0056]
If a subsequence of the rat gene is found that does not match any publicly available gene sequence database, the techniques, texts (see Sambrook et al., Below), and sources available to those of skill in the art may experiment more than necessary It is possible to determine the sequence of the rest of the gene and obtain a full-length gene without performing In one embodiment, the full-length gene is obtained by using a portion of the rat gene sequence known to be a primer, which is used in a PCR reaction with a rat cDNA library with random primers. Use in combination. The PCR reaction is performed on a standard agarose gel, the amplified bands are identified, excised from the gel and sequenced.
[0057]
Each of these methods is disclosed in more detail below. Other factors to consider in identifying a toxicologically relevant gene include, but are not limited to, the choice of one or more agents, the dose administered, and the route of administration.
[0058]
IV. Selection of active substance
The agent to be tested can be selected based on different criteria. In one aspect, the criteria for the compound being tested is the damage observed in a particular organ. In one embodiment, cisplatin, amphotericin B, and gentamicin are selected because they are observed to cause renal tubular epithelial cytotoxicity. In another embodiment, clofibrate, gemfibrozil, and WY14643 are selected because it is observed that proliferation of liver peroxisomes is affected by clofibrate, gemfibrozil, and WY14643. In another aspect, the criterion for selection is function. For example, cisplatin causes apoptosis and reactive oxygen species, amphotericin B increases cell membrane permeability to ions and causes renal vasoconstriction, and gentamicin causes lysosomal phospholipid accumulation.
[0059]
Other toxins generally affect organs, for example, some renal toxins include, but are not limited to, cisplatin, gentamicin, puromycin, and amphotericin B. Liver toxins include, but are not limited to, chlorpromazine, clofibrate, diflunisal, tetracycline, erythromycin, and ethanol. Immunotoxins include, but are not limited to, cyclosporin A, lipopolysaccharide (LPS), hydroxyurea, phenylhydrazine, dexamethasone, estradiol, and tamoxifen. Cardiac toxins include but are not limited to doxorubicin. Multi-organ toxins include, but are not limited to, methotrexate and cadmium chloride.
[0060]
Another criterion for selecting an agent to be tested is to select those agents to which the individual is regularly exposed in the environment, such as by a prescription or over-the-counter drug. Another criterion for testing an agent is an agent that needs to be tested for toxicity for FDA approval or for other toxicity requirements, eg, in preclinical or clinical trials. Tables 1 and 2 list some agents that can be selected according to the above criteria.
[0061]
V. Determination of dose
The dose of agent used in rat experiments can be determined using several methods. In one aspect, the reported dose is used as a starting point, and the dose is gradually increased and decreased from the reported dose. The increment is at least about ± 1%, 5%, 10%, 25%, 35%, 45%, 50%, 60%, 70%, 80%, 90%, or 95%. Up-regulation or down-regulation of markers in the blood, including but not limited to serum chemistry and hematology, can be used to determine if toxicity has been reached. In another aspect, in particular, the tissue pathology of an organ that is a specific target for the compound in question can be examined to determine if a pathological change has occurred in response to administration of the compound. In one embodiment, the pathological changes include liver degeneration / necrosis, hepatocellular hypertrophy, hepatocyte vacuole, renal tubule degeneration / necrosis, renal glomerular necrosis, myocardial degeneration, myocardial inflammation, spleen lymphocyte depletion / Includes apoptosis, spleen lymphocyte hyperplasia, neurotoxicity, skeletal muscle degeneration and inflammation, multiple tissue necrosis and inflammation, repair, including proliferation. In one embodiment, in another aspect, molecular changes in response to administration of various doses of one or more agents are determined by analyzing gene expression associated with exposure to such agents. .
[0062]
Experimental dose determination using cell culture is influenced by many factors, including the nature and potency of the agent, its mechanism of action, the type of cells targeted by the agent, and the number of cells. To determine the dose required in an experiment, a low dose level of the agent is added, then the dose is increased in steps and the exposure time to the agent is increased. If the agent is lipophilic and readily penetrates the lipid bilayer of the cell, a lower initial concentration can be used and / or the exposure time to the agent can be shorter. If the agent cannot easily penetrate the cell barrier and needs to be actively or passively transported across the cell membrane, a slightly higher initial concentration can be used and / or Exposure time can be longer. By gradually increasing the dose while monitoring the toxicological response and cell morphology, one of skill in the art can determine the dose at which a toxicological response occurs from the rate of cell death and the growth pattern. However, it should be noted that a toxicological response occurs that is a visible change, including but not limited to the physical structure and integrity of the cell (eg, morphology, growth pattern, etc.). For example, when monitoring cytotoxic as well as molecular toxic responses, differential gene expression increases the likelihood of finding a preferred dose.
[0063]
Changes in gene expression are toxic at doses at which treatment is withdrawn or reduced and no longer returns to normal, i.e., doses that do not return to the state of cells, organs, or systems that existed before treatment with the compound. Becomes clinically significant. Treatment beyond a certain dose or time renders the cells toxicologically relevant. This toxic dose is indicated by an identifiable gene expression pattern that is quite different from the pattern observed at doses lower than the toxic dose. The method of analyzing gene expression and correlating it with gene expression data is described below.
[0064]
VI. Administration of the active substance
The administration of the agent in question can be effected by various routes. The route may vary and may be intraperitoneal, intravenous, subcutaneous, transcutaneous, intramuscular, enteral, transdermally, transmucosal, sustained release polymer compositions (eg lactide polymer) It will be readily appreciated by those skilled in the art that it can be performed by perfusion, lung (eg, inhalation), nasal, oral, and the like. Injectables can be prepared in conventional forms, such as solutions or suspensions, solid forms suitable for solution or suspension, which are dissolved in a liquid prior to injection, or emulsions. The agent can be administered in a pharmaceutically acceptable form, eg, with an excipient. Suitable excipients include, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like. Formulations for delivering one or more agents parenterally and orally are known in the art and are described in Remington: The Science and Practice of Pharmacy, Mack Publishing. (2000).
[0065]
When a carrier is used to administer the agent, the carrier is compatible with the agent being tested and is not harmful (ie, does not harm) to the treated rat. Must be acceptable. For solid compositions, conventional non-toxic carriers include, for example, mannitol and lactose, starch, magnesium stearate, magnesium carbonate, saccharin sodium, talc, cellulose, glucose, sucrose, pectin, dextrin, tragacanth, methyl cellulose, sodium carboxymethyl cellulose, Low melting point wax, cocoa butter and the like are included, and those similar to these can be used. The active compounds as defined above can be formulated as suppositories, for example using polyalkylene glycols and using, for example, propylene glycol as carrier.
[0066]
In one aspect, it is preferred that the administered agent contains a sufficient amount of the agent to produce a certain toxicological response in rats at the molecular or physiological level.
[0067]
VII. Method for identifying toxicologically relevant genes using known rat genes
In one aspect, the rat gene, which is a toxicologically relevant candidate gene, was described in the art or publicly available databases, such as GenBank. Primers are designed using toxicologically relevant candidate rat sequences and used in PCR reactions to amplify rat genes from a cDNA library. A cDNA library can be obtained in vitro or from a variety of rat cells obtained from commercial sources, such as the American Type Culture Collection (ATCC). The production of cDNA involves the reverse transcription of isolated RNA, which is well known in the art (see, eg, Sambrook et al., supra). The rat gene fragment amplified by PCR is cloned into any standard plasmid expression vector that can be obtained from a number of commercial sources (eg, Promega, InVitrogen, New England BioLabs, etc.) and sequenced. Then, the obtained sequence information is compared with the GenBank database to confirm that the cloned DNA is a specific rat gene, that is, a specific rat gene whose primers are designed to match the gene. Once the sequence is clearly confirmed, the amplified gene is included in the array in addition to the panel of genes.
[0068]
In another aspect, the sequence of a non-rat (eg, human) gene, a candidate gene that is toxicologically relevant, has been described. Primers to these toxicologically relevant non-rat genes are designed, synthesized and subsequently used in PCR reactions with a rat cDNA library to amplify homologous rat genes. A homologous rat gene may or may not have the exact sequence of the non-rat gene for which the primer was designed. The amplified rat genes are then added to the gene panel and included in the array.
[0069]
In another aspect, a rat gene or gene sequence, which is a toxicologically relevant or toxicologically relevant gene, is used to generate a toxicologically relevant gene in another rodent, eg, a mouse. To determine. If the homology between the rat and mouse gene sequences is high and is considered to be about 97%, the toxicological relevance of non-rats can be reliably determined without undue experimentation.
[0070]
In another embodiment, the target sequence to be included in the rat array is obtained by newly synthesizing nucleotides immobilized on a substrate such as a glass slide. The target sequence is from a gene that can exhibit one or more toxicological responses.
[0071]
VII. (A) Differential display method
Several differential display methods can be used to identify the gene in question. Differential gene expression can be monitored using gel electrophoresis and polynucleotide microarrays, or techniques that include commercially available techniques, including Invader® or Taqman®.
[0072]
In one aspect, the results of PCR synthesis of mRNA isolated from tissues of treated and control rats or their cell lines (converted to cDNA prior to PCR) are subjected to gel electrophoresis and produced by these mRNA populations. Compare the performed bands. Bands shown in an image of one gel from one mRNA population, but not others, indicate that one mRNA is present in one population and the other is not, thus indicating a difference. Next, genes that are easily expressed are shown. Messenger RNAs obtained from control and treated rats or their cell lines use any oligonucleotide sequence of 10 nucleotides (random decamer) as the 5 'primer and 3' fluorescently labeled "anchor primer" Can be compared by using a set of 12 oligonucleotides complementary to the poly A tail. These primers are then used to amplify a partial sequence of the mRNA with the addition of deoxyribonucleotides. These amplified sequences are then resolved on a sequencing gel such that each sequencing gel has 50-100 mRNA sequences. These sequencing gels are then compared to each other to determine which of the amplified segments are differentially expressed (Liang, P. et al. Science 257: 967, 1992; Welsh, J. et al. Nucl. Acid Res. 20: 4965, 1992; Liang, P. et al., Nucleic Acids Res. 21 (14): 3269-75 (1993)).
[0073]
VII (B) transcriptome profiling
Using an open system, rat cells can be exposed to drugs and / or chemicals at various concentrations and then harvested at various times. Rat cells can be obtained from a variety of sources including, but not limited to, tissue samples, organs, blood, skin, biological fluids (eg, urine, spinal fluid, semen, etc.), and cell lines. Transcriptome profiling can also be obtained in rats administered in vivo. Immobilized cell lines can be obtained from commercial sources, such as Gibco BRL Life Sciences, or from other sources, such as the American Type Culture Collection (ATCC). Other methods of obtaining rat cells include isolating cells obtained from tissue biopsies, blood, skin, or biological fluids, for example, from rats administered in vivo. As is well known to those skilled in the art, isolation of cells from a tissue sample can be performed using any of a variety of techniques.
[0074]
Sources from which cells can be obtained may be any of several organs, including but not limited to liver, lung, heart, testis, kidney, spleen, thymus, and brain. In one embodiment, liver cells can be used for toxicity testing, where the agent administered is one that is known or is believed to cause liver dysfunction or liver toxicity. In other embodiments, if the target of the action delivered by the agent is known, the use of cells from the target organ will result in a more beneficial toxicological response than a random selection of tissue. Information is brought. In another embodiment, where the agent being tested produces an unknown effect, a panel of cells isolated from various sources can be used. In an alternative, the liver cells can be used without knowledge of the active targets of the agents, since the liver is known to process many toxins. Although the toxicological response may not be the most ideal compared to the results that can be obtained by one skilled in the art when using the target tissue of the agent's action, the advantage of using liver cells is It would be possible to identify potentially relevant genes and subsequently test other organs to determine toxicity in other organs or to identify which organs are targets for the agent. By testing cells from one tissue source (the liver in this situation) rather than isolating cells from many tissue sources, time is saved.
[0075]
Rat cells obtained in vitro or obtained from commercial or non-commercial sources, cultured immediately after necropsy or frozen for storage and cultured in culture for the duration of the experiment Can be. A wide variety of basal cell support media can be used to keep the pH of the liquid within a range that promotes the survival of rat cells. Non-limiting examples include F12 / DMEM, Ham's F10 (Sigma), CMRL-1066, Minimal essential medium (MEM, Sigma), RPMI-1640 (Sigma), Dulbecco's Modified Eamed's EM (Eggle's Modified Eagle's EM) , Sigma), and Iscover's Modified Eagle's Medium (IMEM). Further, Ham and Wallace, Meth. Enz. 58:44 (1979); Barnes and Sato, Anal. Biochem. , 102: 255 (1980). Cells can be grown on plates or in flasks. The cells are grown and increased to the level desired and required for DNA or RNA isolation. The cells are removed from the plate or flask and the DNA or RNA is isolated. If cells are attached, trypsin or another equivalent can be used to separate the cells from the plate or flask. As a source of DNA and RNA, preferably at least about 1 × 10^TwoCells, more preferably at least about 1 × 10^ThreeCells, more preferably at least about 1 × 10^FourCells, more preferably at least about 1 × 10^FiveCells, more preferably at least about 1 × 10⁶Cells, even more preferably at least about 1 × 10⁷Use individual cells. In one embodiment, tissue is harvested (isolated nucleic acids) after administration to rats and exposure to toxic amounts of drugs / chemicals in vivo. This embodiment is further described in the examples.
[0076]
The isolated nucleic acid is then amplified to produce a product that can be attached to a substrate. In a preferred embodiment, the substrate is a solid substrate (eg, a glass slide). The amplification process involves using a primer having a reactive group (eg, an amine group or derivative thereof) at one end of the primer, which is incorporated into the amplification product. One example of a reactive primer that can be used is an amine primer obtained from Synthegen. The length of the gene fragment attached to the slide glass may vary. The more nucleotides of a gene are present in the array, the tighter the binding and the greater the specificity in binding. However, it is important to consider that longer fragments are more difficult to amplify and may contain point mutations or other amplification-related errors. Thus, the desired length of genes or fragments thereof contained in the array balances the high specificity of binding obtained with long (eg> 1 kb) gene sequences with the high mutation rate associated with longer fragments. Should be taken into account. The gene fragment attached to the glass slide is at least about 25 base pairs (bp) in length, at least about 50 bp in length, more preferably at least about 100 bp in length, more preferably at least about 100 bp in length. 200 bp, more preferably at least about 300 bp, more preferably at least about 400 bp, more preferably at least about 500 bp in length. In a preferred embodiment, the length of the gene fragment is about 500 bp. The region of the gene used to attach the array to the solid substrate to form the array can be any portion of the gene, including the coding portion, the non-coding portion, the 5 'end, the 3' end, and the like. In a preferred embodiment, about 500 base pairs at the 3 'end of the rat gene involved in the toxicological response are selected for inclusion in the array.
[0077]
Preparation of VII (C) microarray
Several techniques for attaching a gene or fragment thereof to a solid substrate such as a glass slide are well known to those skilled in the art. One method involves attaching an amine group, a derivative of an amine group, another group with a positive charge, or another group that reacts to one end of a primer used to amplify a gene or gene fragment and including it in the array. is there. Subsequent amplification of the PCR product will incorporate this reactive group at one end of the product. The amplified product is then contacted with a solid substrate, such as a glass slide, which is coated with an aldehyde or another group that is covalently linked to the reactive group of the amplified PCR product, and is therefore a slide. It becomes covalently bonded to glass. Other methods using aminoproprylsilane surface chemistry and other methods of making microarrays are disclosed. For example, Nuwaysir, E .; F. Other Molecular Carcinogenesis (Molecular Carcinogenesis), 24: 153-159 (1999); D. Other Nucleic Acids Res. 28 (22): 4552-7 (2000); And Schreiber, S .; L. Science 289 (5485): 1760-1763 (2000); Lockhart, D .; J. And Winzeler, E .; A. Nature 405 (6788): 827-836 (2000); D. The Scientist 14 (17): 25 (2000); and Cortese, J. et al. D. See The Scientist 14 (11): 26, (2000). Other embodiments of the present invention are further described in the Examples.
[0078]
Other methods of using arrays are known, for example, arrays of polymers such as nucleic acids immobilized on a solid substrate are described, for example, in US Pat. Nos. 5,744,305, 5,510,270, 5 No. 5,677,195, No. 5,624,711, No. 5,599,695, No. 5,451,683, No. 5,424,186, No. 5,412,087, No. 5,384. , No. 5,252,743, and No. 5,143,854, and PCT WO92 / 10092, PCT WO93 / 09668, and PCT WO97 / 10365. Photolithography and fabrication techniques in which each probe array can occupy a very small area of the support, eg, a few microns, are described in US Pat. No. 5,631,734. Substrates having a surface to which the array of polynucleotides is attached include silicon or glass. Substrates that allow light to pass through and can be optically detected can be used, as described, for example, in US Pat. No. 5,545,531.
[0079]
VIII. Algorithms for analysis and evaluation of toxicologically relevant genes
The ranking of candidate genes from rat genes, for example, a set of 17,421 rat genes, referred to herein as the "17K array", may be included in a total toxicity (CT) array. , A multi-stage approach can be used. First, no matter what experiment is performed using the 17K array, three cut-off criteria can be defined for individual gene values. That is, 1) induction magnification / suppression level, 2) average fluorescence level of replication spots (reflecting expression level), and 3) mutation coefficient of replication spots. Initial screening to obtain this "cut" is based on expression levels and measured quality.
[0080]
Second, the values of the genes that yielded the cuts were collected into an overall score and ranked for each gene, based on six ranking criteria. That is, 1) the number of slides where the gene satisfies the cut-off criterion (NC), 2) the percent consistency between slides (the number of times the gene value on the second slide relative to the first slide satisfies the cut-off criterion %) (CC), 3) Average magnitude of fold induction (absolute value) (FI) in all cases where the gene satisfies the cutoff criterion, 4) Mutation coefficient of these fold induction scores (all other rankings) Unlike the criteria, the lower ones are considered better) (CV), 5) the mean fluorescence value (FL) of all replicate spots when the gene meets the cut-off criteria, and 6) tissue consistency ( Some percent of genes that meet cutoff criteria were in the same tissue) (CT).
[0081]
Each gene was assigned a score from 0 to 100 for each ranking criterion. Each ranking reference score was calculated as follows. That is, by subtracting the lowest value in all scores from the highest value, the calculation was performed based on the range of all genes. The score for each gene was then calculated by subtracting the lowest value present from the value for that gene, then dividing by the above range and multiplying by 100. In other words, the score for each gene is the ratio of the existing minimum value to the maximum value. For example, if the score of a gene is three-quarters of the difference between the maximum value in the criterion and the minimum value present, the score will be 75%. In the case of the CV factor (mutation coefficient of fold induction), the calculated score was subtracted from 100 and converted to a percentage since lower values were considered better.
[0082]
The final ranking for each gene can be calculated via a weighted combination of its scores based on six ranking criteria. If the score cannot be calculated for a particular criterion, the entire value of that criterion is removed from the equation, so ranking is based solely on the remaining factors.
[0083]
IX. How to use toxicologically relevant genes
In one aspect, the invention provides a method for exposing a test animal (eg, a rat) to an agent and measuring the expression of one or more toxicologically relevant genes in the test animal to determine the specific agent. Provide a method for determining toxicity. This produces a test expression profile that can later be compared to a reference expression profile to determine the toxicity of the agent. This can be done, for example, by routine statistical analysis of the test expression profile and the reference expression profile, for example, by determining a significant correlation. In one embodiment, the agent is selected from Table 1 or 2. In another embodiment, the agent is a drug, drug candidate, or pharmaceutical compound. Toxic doses and exposure times required to reach toxic doses are determined using the methods described herein. In another embodiment, the test expression profile includes a gene or gene sequence from Tables 4, 6, 7, 8, 9, or 10. In another embodiment, the reference profile includes one or more expression profiles obtained experimentally from, for example, Tables 4, 6, 7, 8, 9, or 10. In another embodiment, the test gene expression profile can be compared to a reference gene expression profile stored in a database, such as a total toxicity (CT) database. In another embodiment, the gene expression profile is associated with responsiveness in a particular organ, for example, responsiveness in the kidney, liver, spleen, heart, lung, testis, brain.
[0084]
In another embodiment, a toxicologically relevant rat gene is used to obtain an array comprising polynucleotides selected from genes corresponding to the partial gene sequence of the toxicologically relevant gene. In one embodiment, the array comprises a gene or subgene sequence of at least 20 nucleotides each. In another embodiment, the array comprises a gene or partial gene sequence of at least 50 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, or at least 500 nucleotides, respectively. In another embodiment, the array includes toxicologically relevant genes corresponding to the partial gene sequences in Table 4. In other embodiments, the array comprises toxicologically relevant genes corresponding to the partial gene sequences of Tables 6, 7, 8, 9, or 10. In yet another embodiment, the array is toxicologically corresponding to a partial gene sequence associated with responsiveness in a particular organ, such as in the kidney, liver, spleen, heart, lung, testis, brain. Contains related genes.
[0085]
In another embodiment, toxicologically from animals other than rats (eg, humans and dogs, non-human primates) by using the arrays described herein to select for substantially homologous sequences. Related gene sequences can be obtained. As known to those skilled in the art, homology can be determined by using the calculated sequence alignments described above or by hybridization techniques. Nucleic acid hybridization depends on factors such as the degree of complementarity and the stringency of hybridization reaction conditions. Stringency can be used to identify nucleic acid duplexes with a high degree of complementarity. Means for adjusting the stringency of a hybridization reaction are well-known to those of skill in the art. See, e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual", 2nd edition, Cold Spring Harbor Laboratory Press, 1989; Ausubel et al., "Current Protocols in Molecular Biology". "John Wiley & Sons, 1996 and periodically revised editions; and Hames et al.," Nucleic Acid Hybridization: A Practical Approach ", IRL Press, Ltd. , 1985. In general, conditions that increase stringency (ie, select to form a more closely matched duplex) include higher temperatures, lower ionic strength, and the presence or absence of a solvent; , The ionic strength is increased, and the solvent concentration is increased or decreased. Identification of toxicologically relevant genes in other non-rat animals can help determine which species are most suitable for animal models by assessing which species are most likely to cause a toxic response. it can.
[0086]
In another aspect, the gene expression profile of a rat can be compared when administering one drug and compared to a second gene expression profile when administering another drug. Toxicologically relevant data can be correlated using the algorithms disclosed herein. A similar set of genes can be up-regulated or down-regulated by the effects of drug-drug interactions. This effect may be additive or synergistic. In another embodiment, the effects of drug-drug interactions can trigger different sets of genes that are unrelated to function. In another embodiment, according to the methods disclosed herein and the set of toxicologically relevant genes, as shown in Tables 7, 8, 9, and 10, the toxic dose to the target organ and its interior is determined. It will be possible to decide. This is useful for drug design when the drug has only one target organ and does not cause toxicity to multiple organs. In another embodiment, a method and a set of toxicologically relevant genes can be used to predict a toxic response to an agent, in which case repeated exposure is performed during periods of overt toxicity. Examples of such agents include one-hit carcinogens (eg, aflatoxin B1, dimethylnitrosamine, ENU, etc.), or multidose carcinogens (eg, phenobarbital or WY14643). The molecular toxic response to these carcinogens can be determined prior to any macroscopic changes that occur in response to exposure to these agents.
[0087]
X. How to use toxicological response data to generate a toxicological database
By collecting cell, tissue, or organ data from rats in response to one or more agents at different doses and / or at different time points, information about the toxicological response, such as a reference expression profile, can be obtained. The collected database can be constructed. This database allows the toxicological response to a particular agent or combination thereof to be evaluated.
[0088]
One practical application of toxic genetics is to help rank a series of agents based on gene expression. Initial ranking is performed by determining the average percent change maximum for a set of genes that is indicative of a particular stress or injury, eg, DNA damage (eg, waf-1, DNA Pol β, c-abl, cyclin G, Ape, and Mgmt).
[0089]
Another method of using gene expression data to prioritize lead agents is to construct a complete dose-response curve for all genes in question. EC of each gene caused above threshold level₅₀(EC₅₀Is the concentration at which up to 50% of the gene responds to the agent). The agent is then replaced by the EC for the gene in question.₅₀It can be ranked by average. EC₅₀Agents with the lowest are considered to be more toxic.
[0090]
Rat gene arrays can also generate information that can be used to predict inductive effects, such as which pathway a particular agent affects. This is accomplished by observing differential gene expression and analyzing which pathways include the toxic response gene and which pathways the gene affects. This information can be used to predict tissue, whole organ, and / or system responses. The ability to predict whole organ responses is likely to have enormous potential, even in the development of drugs, pharmaceutical compounds, and the use of chemicals.
[0091]
The following examples are for illustrative purposes and do not limit the invention in any way. It will be apparent to those skilled in the art that modifications may be made while retaining the spirit and scope of the invention.
Embodiment 1
[0092]
Discovery and characterization of toxicologically relevant genes from experimental data
Section 1 Preparation and printable rat genes on microarray
a. Polymerase chain reaction
17,241 rat genes were amplified by polymerase chain reaction (PCR) using M13 forward and M13 reverse primers. The sequence of the M13 forward primer was CTCAAGGCGATTAAGTTGGGTAAC (SEQ ID NO: 709), and the sequence of the M13 reverse primer was GTGAGCGGATAACAAATTTCACACAGGAAACAGC (SEQ ID NO: 710). The M13 reverse primer had a C12 amine linkage attached to ensure binding of the sense strand (5-3 ') of the PCR product to the glass microarray slide. The amine linker can be added during the synthesis of the primer with any of a number of commercial sources, such as Synthegen.
[0093]
The following components were combined for the PCR reaction: H_Two21 liters of O, 2.5 liters of 10 × PCR buffer, 0.12 liters of 10 mM dNTP, 1 liter of 25 ng / l M13 forward primer, 1 liter of 25 mg / l M13 reverse primer, sample of clone from glycerol stock, and Taq polymerase 0.5 liters were combined to make a total volume of 25 liters. The mixture was reacted at 95 ° C. for 5 minutes, and then cycled at 95 ° C. for 30 seconds, 45 ° C. for 30 seconds, 72 ° C. for 30 seconds, and then at 72 ° C. for 5 minutes 35 times. Performed at 4 ° C. until the sample was removed from the thermocycler. Approximately 4 liters of the PCR product were removed and run on a 1% agarose gel to ensure that the PCR reaction was successful.
[0094]
b. Binding of toxicologically relevant genes to glass slides
The amplified product was purified by a standard ethanol precipitation method or by a commercially available PCR cleanup kit such as Millipore, Qiagen and the like. The cleaned PCR product was then immobilized or "spotted" on a glass slide capable of reacting with the amine groups of the amplification product and forming a covalent bond. PCR products were spotted on coated glass slides using an MD Generation II array spotter. The terms and equipment used in this example were as follows:
Spotter: Main equipment of MD Generation II Array Spotter
Spot chamber: area of glass-enclosed spotter that houses pins, plates, trays, and most spotter machinery
Controller: Dedicated Dell computer and monitor on right side of spotter unit
Pins: (6) fine tubes in spotter unit to lift and spot target
Slides: Standard size microscope slides with a special coating on one side
Plate: plastic 96-well plate holding target solution to be spotted
Target: PCR product solution deposited on slide by spotter
N2 tank: Approximately 1.5 m (5 ft) high steel gas tank labeled "Nitrogen, Compressed"
N2: N2 gas from N2 tank
Air conditioner: Kenmore air conditioner installed in window of spot chamber
Humidifier 1: Essick 2000 evaporative cooler for window
Humidifier 2: Bemis Airflow with white soft duck into spotter unit
Humidifier 3: Bemis Airflow on wall
Humidifier 4: Kenmore QuietComfort 7
Vacuum pump: Gast Laboratory oilless piston vacuum pump
Dump box: Plastic sealable container containing NaCl / water slurry
[0095]
The materials used for the reagent solution were Nanopure water, 0.2 M KCl (1/10 dilution of stock 2 M KCL in water), and 95% EtOH. Temperature control was adjusted to 60 °. The spotter chamber was adjusted so that the relative humidity was above 39% and below 65 ° C. Spot pins were prewashed for 20 cycles. First, N2 gas was sprayed on each side of the slide glass for about 2 seconds. The slide was inserted into the spotter according to the array spotter run values. The slide was aligned by aligning a clean wand with the center right edge of the slide and gently pushing to the left until the slide was positioned perpendicular to the metal pins. After the slide was placed and straightened, a visual inspection was performed to confirm that no debris had fallen. Regarding humidity, it was confirmed that the relative humidity was higher than 39%. The MD spotter recognizes up to 16 plates in one operation and automatically pauses after 8 plates. Also, MD spotters are not programmed to support a scheme that steps through the plates in an invariant order and supplies only one plate. Therefore, it was important to manually rotate (or shuffle) the plate in order to perform a spot operation on the rat array. The genes (PCR products) were spotted twice on each slide, and a total of 3000 genes were printed on one slide (6000 spots total). A set of six slides was used to include all 17,241 genes. Using a phase contrast microscope, the printed (spot) microarray was tested for quality control purposes and the morphology of the spot and the presence of all genes were evaluated.
[0096]
c. Blocking (slide preparation after spotting)
This blocking procedure is important because it reduces non-specific background signals. The volume obtained with this protocol is 19 slides, but those skilled in the art will be able to make appropriate changes. When blocking more than 19 slides, more stained dishes and slide racks are required. A clean glass container was obtained and filled with Nanopure H20. The container was placed on a hot plate and heated to a high temperature. A blocking solution was prepared by adding 2.5 ml of 20% SDS to a 500 ml blocking solution bottle. The blocking solution was warmed in the microwave for 2.5 minutes and checked to determine if the temperature had reached 50 ° C. If the temperature of the solution was not yet 50 ° C., the solution was warmed in the microwave at 10 second intervals until the desired temperature was reached. One stained petri dish was placed on an orbital shaker containing a 4 × SSC solution, and the stirring speed was set to 75 rpm. The slide was placed on a metal rack and placed in boiling water for several minutes (eg, 2 minutes). Slides were removed from boiling water and cooled briefly. The slides are then transferred to a staining vessel containing the 4 × SSC solution, placed on an orbital shaker for a few minutes (eg, 2 minutes), rinsed with nanopure water in the staining vessel, and then briefly placed in the blocking solution for about 15 minutes. placed. After 15 minutes, the slides were removed from the blocking solution and rinsed three times by immersing each in three separate containers containing nanopure water. The tissue was gently pressed against the top of the slide and the slide was centrifuged at 1000 rpm for about 5 minutes.
[0097]
Section 2 Toxicity test to obtain rat cDNA for testing to determine differential expression of genes
a. Tissue collection after administration of rats and exposure to toxic amounts of drugs / chemicals in vivo
Toxicity studies were performed using approximately 2.5 months old Sprague-Dawley male rats. Designing experiments that expose rats to toxic doses of drugs / chemicals involves determining the toxic dose and the route of administration of the compound. Rats are divided into treated rats that received a particular concentration of the compound and control rats that received only a vehicle in which the compound was mixed in a solution or suspension (eg, saline). Where possible, saline was used as the vehicle. Rats were injected intraperitoneally with a drug, compound or appropriate vehicle in a volume of 10 ml / kg body weight. The concentration of each drug or chemical administered is the dose at which toxicity is recorded by conventional toxicological methods (eg, histopathology, serum chemistry, hematology), and the second dose is a toxic dose of 25%. %. Rats were dosed after 10 hours without food and then sacrificed at 6, 24, and 72 hours. Three control rats and three treated rats are euthanized at each time point for each drug. Each rat receives CO by inhalation_TwoThe overdose was very sedative, followed by a maximum blood draw. The blood is collected in a clot tube for serum isolation and in a heparinized tube for blood lymphocyte isolation. The rats are killed by phlebotomy of the rats by drawing this blood. The method of harvesting the tissue is very important and ensures the quality of the mRNA in the tissue. The rat's body is then dissected, and certain organs / tissues are quickly removed by some dissertants and immediately placed in liquid nitrogen. Blood lymphocytes, serum, urine, liver, lung, heart, testis, spleen, bone marrow, brain, and other targets that could be specific targets for drugs / chemicals were collected. All organs / tissues are completely frozen within 3 minutes of the death of the animal to ensure that mRNA is not degraded. The organ / tissue is then packed into a well-labeled plastic freezer quality bag and stored at -80 degrees until needed to isolate mRNA from a portion of the organ / tissue sample.
[0098]
Serum chemistry changes were assessed at 24 and 72 hours. Histopathological assessment was performed by a pathologist 72 hours later for toxicity assessment. Hematology and urine analysis were assessed after 72 hours.
[0099]
b. Isolation of total RNA from animals
To isolate high quality and high purity total RNA from tissue samples, the following materials were used: Qiagen RNeasy midi kit, 2-mercaptoethanol, liquid N_TwoUse tissue homogenizer, dry ice.
[0100]
It is important to take precautionary measures to minimize the risk of RNA degradation caused by RNase. Samples should be kept on ice if specified, always gloved in the work area, and the device is treated with a ribonuclease inhibitor such as RNase Zap (Ambion® Products, Austin, TX). It is highly preferred that the working area and the materials used in this procedure are clean and free of ribonuclease to prevent RNA degradation. Autoclaving of the chip and centrifuge tube does not remove ribonuclease. The following protocol is based on the Qiagen® RNeasy® midi kit, modified for optimal results. This total RNA isolation technique is used to isolate RNA from animal tissue and can be modified to accommodate smaller samples.
[0101]
If tissue needs to be disrupted, the tissue can be placed on two layers of aluminum foil placed in a weigh boat containing a small amount of liquid nitrogen. An aluminum foil was placed around the tissue, and the tissue was then subjected to a blunt force with a small hammer wrapped in foil.
[0102]
For liver or kidney, approximately 0.15-0.20 g of tissue was weighed and placed in a 15 ml conical tube. When weighing other samples, all tissues were kept on dry ice.
[0103]
About 3.8 ml of RLT buffer was added to the tube containing the sample. Qiagen's RLT Buffer® can be prepared in advance by adding 10 μl of β-mercaptoethanol to 1.0 ml of each required lysis buffer. The tissue was homogenized using a rotor-stator homogenizer for 45 seconds. An IKA Ultra Turrax T25 homogenizer equipped with a S25N-10G ejection element and set at a speed of 4 can be used. Alternatively, a Virtisear Cyclone 750W rotor / stator homogenizer (Virtis product # 278077) can be used with a 7 mm micro-sawtooth shaft and generator (195 mm long, processing range 0.25-20 ml, product # 372718). After homogenization, samples were stored on ice until all samples were homogenized. To clean the homogenized chip between samples, the chip was first run in 95% ethanol for a few seconds and then rinsed by spraying a fresh 95% ethanol. This process was repeated with nanopure water.
[0104]
Tissue lysates were centrifuged at 3700-3800 rpm for 10 minutes at room temperature using a Beckman GS-6 (or equivalent) centrifuge to remove nuclei and thus reduce DNA contamination.
[0105]
The supernatant of the lysate was carefully treated with DEPC-treated H so that it did not contain any pellets or any fat layer and was not mixed._TwoTransfer to a clean 15 ml conical tube containing an equal volume of 70% EtOH in O. About 3.8 ml of the sample was added to an RNeasy spin column placed in a 15 ml centrifuge tube, and centrifuged at 3000 × g (3690-3710 rpm, Beckman GS-6) for 5 minutes. The passed fraction was discarded. The remaining sample was added to the appropriate column, spun at 3000 × g for 5 minutes, and the flow through was discarded.
[0106]
About 4.0 ml of Buffer RW1 (Qiagen®) is added to the column and spun as before, then about 2.5 ml of Buffer RPE (Qiagen®) is added to the column to 3000 × g (3690-3710 rpm, Beckman GS-6) for 2 minutes. In this example, the RPE buffer was supplied as a concentrate, so 4 volumes of 95% EtOH were added before use. In the midi kit, about 220 ml of 95% EtOH is added to 55 ml of RPE. An additional 2.5 ml of Buffer RPE was added and spun for 5 minutes, again drying the column completely. The column containing the chip should be dried for the next elution step.
[0107]
For elution, transfer the column with the bound RNA to a clean 15 ml tube, add 200 μl of ribonuclease-free water to the column, let stand for 1 minute, 3000 × g (3690-3710 rpm, Beckman GS-6). ) For 3 minutes. This step was repeated in the same tube except using 200 μl of ribonuclease free water.
[0108]
c. Removal of contaminating DNA
The isolated RNA sample can be precipitated using the lithium chloride (LiCl) process described below, before or after measuring the absorbance reading for quantification. The volume of the sample was measured. For this, about 1/3 volume of the LiCl PPT solution from Ambion (catalog # 9480) was added and mixed by inverting the tube. LiCl should be in solution. If not, it may be necessary to adjust the pH to 8.0. The solution was placed at -20 ° C for 30 minutes and centrifuged at 13,000 RPM for 10 minutes at 4 ° C. If there is no visible pellet, return the sample to -20 ° C overnight and then help repeat the centrifugation. The supernatant was transferred to a separator tube, washed by adding 1 ml of ice-cold 70% ethanol dissolved in DEPC-treated water and gently inverted. The tube was then centrifuged at 4 ° C. for 10 minutes, the supernatant discarded and the pellet air dried. The pellet was resuspended in RNA storage buffer (Ambion catalog # 7000).
[0109]
Alternatively, contaminating DNA was removed by incorporating the DNAse step into the Qiagen® midi kit procedure as described in the kit instructions.
[0110]
d. Measuring the amount of RNA
To determine the yield, the O.D. D. To obtain about 2.0 μl of RNA and 98 μl of H_TwoAdded to O. The following equation was used in the calculations.
(Absorbance) x (dilution coefficient) x (40) / 1000 = amount of RNA g / ml
In the sample calculation,
Absorbance = 0.45
Dilution factor = 50
(0.45 × 50 × 40) / 1000 = RNA concentration μg / ml
[0111]
e. Microarray reverse transcription reaction
As disclosed above, fluorescently labeled first-strand cDNA probes were prepared from total or mRNA by first isolating RNA from control and treated cells. The probe is hybridized to microarray slides spotted with DNA specific for the toxicologically relevant gene. Materials required to carry out this example include total or messenger RNA, primers, Superscript II buffer, dithiothreitol (DTT), nucleotide mix, Cy3 or Cy5 dye, Superscript II (RT), ammonium acetate, 70 % EtOH, PCR machine, and ice.
[0112]
The volume of each sample containing 20 μg of total RNA (or 2 μg of mRNA) was calculated. The amount of DEPC water required to bring the total volume of each RNA sample to 14 μl was also calculated. If the RNA is diluted too much, concentrate the sample without heating in a speed vac to a volume of less than 14 μl. The speed vac must be able to generate a vacuum of 0 mTorr so that the sample can be lyophilized under these conditions. A sufficient volume of DEPC water was added to bring the total volume of each RNA sample to 14 μl. Each PCR tube was labeled with the name of the sample or control reaction. An appropriate volume of DEPC water and 8 μl of anchor oligo dT mix (stored at −20 ° C.) were added to each tube.
[0113]
An appropriate volume of each RNA sample was then added to a labeled PCR tube. The samples were mixed by pipetting. The tubes were kept on ice until all samples were ready for the next step. The tubes are preferably kept on ice until ready for the next step. The samples were incubated at 70 ° C. for 10 minutes in a PCR machine, then at 4 ° C. until the sample tubes could be removed. The sample tube was left at 4 ° C for at least 2 minutes.
[0114]
The Cy dye is photosensitive, so any solution or sample containing the Cy dye should be kept out of the light reach as possible after this point in the process (eg, covered with foil). Sufficient amounts of the Cy3 and Cy5 reverse transcription mixtures were prepared for one or two more reactions than actually performed by scaling up according to the recipe below.
When labeling with Cy3
8 ul of 5x first strand buffer for Superscript II
0.1M DTT 4ul
Nucleotide mix 2ul
2 ul of a 1: 8 dilution of Cy3 (eg 0.125 mM cy3dCTP)
Superscript II 2ul
When labeling with Cy5
8 ul of 5x first strand buffer for Superscript II
0.1M DTT 4ul
Nucleotide mix 2ul
2 ul of a 1:10 dilution of Cy5 (eg 0.1 mM cy5dCTP)
Superscript II 2ul
[0115]
About 18 μl of the pink Cy3 mixture was added to each treated sample, and 18 μl of the blue Cy5 mixture was added to each control sample. Each sample was mixed by pipetting. The sample was placed in a PCR machine at 45 ° C. for 2 hours, then at 4 ° C. until ready to remove the sample tube. The sample was transferred to an Eppendorf tube containing 600 μl of the ethanol precipitation mixture. A portion of the EtOH precipitation mixture was used to rinse the PCR tube. The tube was inverted to mix. Samples were placed in a -80 C freezer for at least 20-30 minutes. If desired, the samples can be left overnight at -20 ° C or over the weekend.
[0116]
f. Removal of impurities from reverse transcription reaction
In addition to the desired cDNA product, a complete RT reaction contains impurities that must be removed. Such impurities include excess primers, nucleotides, and dyes. One method of removing impurities was performed according to the instructions for the QIAquick PCR purification kit (Qiagen catalog # 120016).
[0117]
Alternatively, impurities were eliminated from the complete RT reaction by ethanol precipitation and resin bead binding. The sample was centrifuged for 15 minutes at 20800 × g (14000 rpm for Eppendorf type 5417C) and the supernatant was carefully decanted. Visible pellets were visible (pink / red for Cy3, blue for Cy5). The tube is preferably centrifuged at a fixed location, so that the pellet will be in a known area of the tube. Very rarely, you can see the probe spread on one side of the tube instead of the tight pellet. If the pellet is white or absent, the reaction will not take place at maximum efficiency. The tubes were washed using ice-cold 70% EtOH (about 1 ml per tube) and the tubes were subsequently inverted to clean the tubes and pellets. The tube was centrifuged for 10 minutes at 20800 × g (14000 rpm for Eppendorf type 5417C), then the supernatant was carefully decanted. The tube was spun and all remaining EtOH was removed with a pipette. The tubes were air dried for about 5-10 minutes while protected from light. The length of drying time depends on the natural humidity of the environment. For example, in a Santa Fe environment, a drying time of about 2-5 minutes is required. Preferably, the pellets are not too dry. Once the pellet has dried, resuspend the pellet in 80 ul of nanopure water. The cDNA / mRNA hybrid was denatured by heating in a 95 ° C. heat block for 5 minutes and flash spun. The lid of the "Millipore MAHV N45" 96-well plate was then labeled with the appropriate sample number. A blue gasket and waste plate (V-bottom 96 wells) were attached. Wizard DNA binding resin (Promega Catalog # A1151) was shaken immediately before use for resuspension. About 160 μl of Wizard DNA binding resin was added to each well of the filter plate used. If this is done with a multichannel pipette, use a wide orifice pipette tip to prevent clogging. It is highly preferred that the pipette tip does not contact or puncture the filter membrane. Probes were added to the appropriate wells (80 μl cDNA sample) containing the binding resin. Mix the reactants by raising and lowering the pipette 1-10 times. In this step, it is preferable to use a defined, unfiltered pipette tip. Plates were centrifuged (Beckman GS-6 or equivalent) for 5 minutes at 2500 rpm, and the filtrate was decanted. About 200 μl of 80% isopropanol was added, the plate was spun at 2500 rpm for 5 minutes and the filtrate was discarded. The washing and spinning steps with 80% isopropanol were then repeated. The filter plate was placed on a clean collection plate (v-bottom 96 wells) and 80 μl of nanopure water (pH 8.0-8.5) was added. The pH was adjusted with NaOH. The filter plate was secured to the collection plate with tape to ensure that the plate did not slip during the final rotation. The plate was left for 5 minutes and centrifuged at 2500 rpm for 7 minutes.
[0118]
g. Fluorescence reading of cDNA probe and hybridization on microarray
Optionally, the incorporation of fluorescence into the cDNA probe is assessed semi-quantitatively. This incorporation of fluorescence can measure the amount of dye incorporated into the cDNA of the cleaned RT product, and can provide evidence of enzymatic action or failure of dye uptake. Visually assessing the color of the RT product that has been cleaned using the QIAquick PCR purification kit (Qiagen catalog # 120016) is an alternative way to determine if the RT reaction has failed.
[0119]
Since readings vary by volume, it is preferable to pipet a consistent amount of cDNA into each well of a 384 well 100 μl assay plate (Falcon Microtest catalog # 35-3980) plate. In this step, a control or identical sample should be pooled if necessary. Probes were transferred from the Millipore 96-well plate to every other well of a 384-well assay plate. This was done using a multi-channel pipette. For pooled duplicate samples, 60 μl aliquots were transferred to wells of the assay plate. Cy-3 and Cy-5 fluorescence were analyzed using a Wallac Victor 1420 multilabel counter workstation programmed to read Cy3-Cy-5 in a 384-well format, and the data was saved to disk. A typical range for Cy-3 (20 μg) is 250-700,000 fluorescent units. A typical range for Cy-5 (20 μg) is 100-250,000 fluorescent units. The settings for the Wallac 1420 Fluorescence Analyzer were as follows.
Cy3
CW lamp energy = 30445
Lamp filter = P550 slot B3
Emission filter = D572 dysprosium slot A4
Emission aperture = normal
Count time = 0.1 seconds
Cy5
CW lamp energy = 30445
Lamp filter = D642 samarium slot B7
Emission filter = D670 slot A8
Emission aperture = normal
Count time = 0.1 seconds
[0120]
h. Dry down process
The concentration of the cDNA probe is often required so that the cDNA probe can be resuspended in the hybridization buffer in an appropriate volume. A sample of the control cDNA (Cy-5) is mixed with each test cDNA (Cy-3). This is very important as it allows the processed and appropriate control cDNA samples to hybridize on the same microarray. An Eppendorf tube was labeled for each test sample, and the mixed cDNA samples were added to the appropriate tubes. The tubes were placed in a speed bag and all speed back windows were covered with foil and dried down. At this time, heat (45 ° C.) can be used to speed up the drying process. Time varies from machine to machine. The drying process takes about 1 hour when drying 150 μl of sample with Savant. Samples can be stored in dry form at -20 <0> C for up to 14 days.
[0121]
i. Microarray hybridization
The following materials were used to hybridize a labeled cDNA probe to a single-stranded covalent DNA target gene on a glass slide microarray. Formamide, SSC, SDS, 2 μm syringe filter, salmon sperm DNA (Sigma, catalog # D-7656), human Cot-1 DNA (Life Technologies, catalog # 15279-011), poly A (40-mer, Life Technologies, custom synthesis), yeast tRNA (Life Technologies, Catalog # 15401-04), hybridization chamber, incubator, coverslip, paraffin, heat block. Preferably, the array is completely covered to ensure proper hybridization.
[0122]
Hybridization buffer was prepared at approximately 30 μl per cDNA sample (control rat cDNA plus processed rat cDNA). The total volume made for all hybridizations, approximately 100 μl, should be made slightly more than needed, as it can be lost during filtration.
[0123]
The solution was filtered using a 0.2 μm syringe filter and then its volume was measured. About 1 μl (10 mg / ml) of salmon sperm DNA was added per 100 μl of buffer.
[0124]
Alternatively, a hybridization buffer was prepared as follows.
[0125]
The solution was filtered using a 0.2 μm syringe filter and then its volume was measured. 1 μl of salmon sperm DNA (9.7 mg / ml), 0.5 μl of human Cot-1 DNA (5 μg / μl), 0.5 μl of poly A (5 μg / μl), 0.5 μl of yeast tRNA per 100 μl of buffer. 25 μl (10 μg / μl) was added.
[0126]
The materials used for hybridization were two Eppendorf tube racks, hybridization chambers (two arrays per chamber), slides, coverslips, and parafilm. About 30 μl of nanopure water was added to each hybridization chamber. Slides and coverslips_TwoUsing a stream of water. About 30 μl of hybridization buffer was added to the dried probe and gently agitated for 5 seconds. The probe was left in the dark for 10-15 minutes at room temperature, then gently agitated for a few seconds and then spun in a microfuge. The probe was boiled for 5 minutes and centrifuged at 20800 × g (14000 rpm, Eppendorf type 5417C) for 3 minutes. The probe was placed in a 70 ° C. heat block. Each probe was left in the heat block until ready for hybridization.
[0127]
Pipette 25 μl on a coverslip. It is highly preferred that the material does not touch the bottom of the tube and that no air bubbles form. This means that about 1 μl remains on the pipette tip. The slide was gently lowered onto the sample with the surface of the slide facing down, so that the slide portion containing the array was covered with a coverslip. Slides were placed in the hybridization chamber (2 per chamber). The chamber lid was wrapped in parafilm and the slide was placed in a 42 ° C humidity chamber in a 42 ° C incubator. Preferably, the probe or slide is not brought to room temperature for an extended period. Slides were incubated for 18-24 hours.
[0128]
j. Washing after hybridization
To obtain only single-stranded cDNA probes that are tightly bound to the sense strand of the target cDNA on the array, all non-specifically bound cDNA probes should be removed from the array. Removal of all non-specifically bound cDNA probes was performed by washing the array and using the following materials: slide holder, glass-washed petri dish, SSC, SDS, and nanopure water. It is highly preferred that care be taken, as the data can be significantly affected by the variations under standard cleaning conditions.
[0129]
Six glass buffer chambers and glass slide holders can be used to heat 2x SSC buffer to 30-34 ° C to fill 3/4 volume of a glass Petri dish or enough to soak a microarray Was set as follows. It is important to exercise caution when heating 2 × SSC buffer, as the probe may come off at temperatures above 35 ° C. The slide was removed from the chamber and placed on a glass slide holder. Preferably, the slide is not completely dried. The slides are placed in 2 × buffer solution, and the number of slides is preferably four or less per petri dish. Cover slips should drop within 2-4 minutes. If the cover slip is not dropped within 2 to 4 minutes, the stirring may be performed very gently. A stainless steel slide carrier was placed in a second Petri dish and filled with 2 × SSC, 0.1% SDS. The slide was then removed from the slide glass holder, placed in a stainless steel holder submerged in 2 × SSC, 0.1% SDS, and immersed for 5 minutes. The slides in the stainless steel slide carrier were transferred for 5 minutes to the next glass dish containing 0.1 × SSC and 0.1% SDS. The slide in the stainless steel carrier was then transferred to the next glass dish containing 0.1 × SSC for 5 minutes. Slides that were still in the slide carrier were transferred to nanopure water (18 Mohm) for 1 second. To dry the slides, a stainless steel slide carrier was placed on a microcarrier plate with a folded paper towel. The tissue was gently pressed against the top of the slide. The slides were then placed in a centrifuge Beckman GS-6 or equivalent) and spun at 1000 rpm for 5 minutes. Spin-drying rather than air-drying is very important, as air-drying slides will increase background.
[0130]
Section 3 Evaluation of differential expression of 17,241 gene in rats exposed to toxin
a. Identification of toxicologically relevant rat genes
Toxicity studies were performed using Sprague-Dawley male rats approximately 2.5 months old. As described in section (a) of the toxicity test, three rats were injected intraperitoneally with the drug / chemical at each dose at the time of sacrifice and another three rats were used as control animals. did. Drugs / chemicals administered for testing of the 17,241 gene array were as follows.
[0131]
[0132]
The tissue samples shown in the table above, along with the corresponding tissues of the rats injected with the vehicle, were processed for cDNA with dye uptake as described in Section 2. The set of six microarray slides that hybridized these cDNA samples was as described in Section 1 and the targets spotted on them were PCR products from 17,421 genes. The washed and dried hybridized slides are scanned on an Axon Instruments Inc. GenePix 4000A microarray scanner, and the reading of the fluorescence from the scan is performed using GenePix software. And converted it to a quantified file on a computer.
[0133]
b. Use algorithms to identify, select and evaluate toxicologically relevant genes
To rank candidate genes from an array containing approximately 17,421 rat genes, referred to herein as a "17k array", so that they can be included in a total toxicity (CT) array, two steps were taken. The technique was used.
[0134]
First, from experiments involving expression analysis of 17,421 rat genes, three cut-off criteria were determined for individual gene values. The three cut-off criteria were the fold induction / repression level, the average fluorescence of the duplicate spots used to calculate the expression level, and the coefficient of variation of the duplicate spots. To calculate fold induction / inhibition levels, the induction / inhibition levels of the genes recorded in a particular experiment were calculated as follows.
[0135]
1) Achieving processing scores for genes. Treatment scores were expressed as the amount of Cy3-labeled cDNA from the treated source (eg, the laboratory animal to which the compound was administered) bound to the complementary target DNA spot on the microarray slide. The amount of Cy3-labeled cDNA was detected with a microarray laser scanner with a wavelength of 532 nm.
[0136]
2) Achieving a control score for the gene. Control scores were expressed as the amount of Cy5-labeled cDNA from the untreated source bound to the complementary target DNA spot on the microarray slide. The amount of Cy5-labeled cDNA was detected with a microarray laser scanner with a wavelength of 635 nm. The unit of measurement was the pixel intensity at the coordinates on the microarray slide or the average of several pixel intensities, as reported by the microarray laser scanner. The pixel intensity at that position was proportional to the number of photons detected by the photomultiplier when a spot of target DNA labeled with a fluorescent probe was irradiated with a laser of a wavelength sensitive to the dye. Axon Instruments Inc. used in these experiments. For GenePix 4000A microarray scanners, these values are between 0-65535.
[0137]
3) Calculate the unnormalized ratio of treated and control by dividing the treatment score by the control score.
[0138]
4) Calculate the final "normalized" induction score by dividing the ratio of unnormalized states by some normalization factor. For example, using the above four-step procedure, the calculation of gene A is performed as follows. 1) Let the average of the four raw value sets for the processed one be 100,000. 2) The average of the raw value set for that control is 25,000. 3) The unnormalized ratio thus becomes 4, and finally 4) If the normalization factor (designed to take environmental factors into account) becomes 2, the final normalized induction score (often times the induction factor and Called) is obtained by dividing 4 by 2, that is, 2. In this example, gene A was induced 2-fold. In all experiments performed with respect to the present invention, there were four replicates for each gene, and each replicate had a treatment value and a control value. Therefore, when calculating the expression level of each gene in one experiment, it is necessary to combine eight data points.
[0139]
The average fluorescence level of the replication spot used to calculate the expression level is achieved by a simple average of the four processed replication values used in any experiment to calculate the expression level of the gene.
[0140]
The coefficient of variation of a replicate spot is a conventional measure of variability and is expressed as a percentage, in which case the standard deviation of the ratio of the processed and control of the four replicates to the four replicate treatments It is derived by dividing by the average of the ratio of the already processed to the control. The latter criterion represents a useful measure of data quality. Therefore, initial screening is based on expression levels and quality of measurement.
[0141]
The algorithm was specifically written so that the entire process of ranking the genes included in the CT array from the 17K array was performed. In the early part of the program, it is assumed that a gene must meet all three criteria in order to “end” the three criteria together and thus create a “first cut”. This was considered the first layer of the program.
[0142]
The criteria can be adjusted within the algorithm. The following criteria were used in the actual ranking of the 17K array. That is, induction / suppression level: 2, fluorescence level: 400, and mutation coefficient: 30%. To make the first cut and select it as a potential toxicologically relevant gene, the gene only needs to meet three criteria in one experiment stored in the 17K data warehouse. Similarly, a value associated with a gene is included each time the criteria are met in a different experiment. Data on the gene that made the cut (and thus was selected as a potential toxicologically relevant gene), and each time a gene made a cut, was stored in a separate temporary data table for ranking (Second layer of the process). Gene data can be included multiple times, once for each experiment in which the gene meets the three criteria.
[0143]
Each of the factors listed in the table below was given as a relative weight as indicated.
[0144]
[0145]
Next, the values of the genes that produced the cuts were summarized into an overall score. Since data for a particular gene was included in each experiment where the gene value met the three cut-off criteria described above, it was necessary to "aggregate" the potential multiple values for the gene into an overall score. there were. The overall score was summarized for each of the six factors and ranked for each gene based on six ranking criteria, as shown in the table above. 1) Number of slides where the gene meets cutoff criteria (NC = number of compounds). As noted, the gene was able to meet the three cutoff criteria described above in multiple experiments stored in a 17K warehouse. NC is simply a count of the number of different compounds whose genes meet the three criteria (not an experiment; duplicate experiments are performed for each compound), 2) Percent consistency between slides ( For that initial slide, on replicated slides,% of time that gene value met cutoff criteria (CC). Duplicate experiments were performed for each compound as described above. CC is a count of the number of times that a gene has made a cutoff in both sets of experiments performed in duplicate. Thus, the gene has a NC (number of compounds) of 3 but a CC (compound identity) of 2, which means that for two of the three compounds a cutoff was made in each of the duplicate experiments, This means that no cutoff was made for the remaining one. 3) Average magnitude (absolute value) of the induction factor (FI) for all cases where the gene meets the cut-off criterion. This is a simple average of the magnitude of expression / repression levels in each set of data values for a particular gene. 4) Mutation coefficients of these fold induction scores (unlike all other ranking criteria, lower mutation coefficients are considered better) (CV). To evaluate the variability of the score, a mutation coefficient was applied to a set of expression values for a particular gene. 5) Average fluorescence (FL) of all replicate spots when gene meets cutoff criteria. This is a simple average of the fluorescence levels of the processed values for each case of the gene that made the cut. 6) Tissue identity, ie what percentage of the genes that meet the gene cutoff are in the same tissue (CT). Expression levels were measured in some tissues as well as in some compounds (such as liver and kidney). In the same tissue, CT was calculated as a percentage of the time at which the gene data value that produced the cutoff was measured. For example, if the gene was cut in four experiments, ie, twice in the liver and twice in the kidney, the tissue identity would be 50%.
[0146]
The actual process of ranking genes for inclusion in a CT array used the following weightings: NC = 3, CC = 1, Fl = 5, CV = 0, FL = 0, CT = 0. Thus, the last three criteria were not weighted in this case.
[0147]
A score of 0-100 was assigned to each gene for each ranking criterion. The score for each ranking criterion was calculated as follows. By subtracting the lowest value of all scores from the highest value, the range of values for all genes was calculated relative to the reference. Temporary data tables created from the 17K warehouse contained scores for each gene that met the initial three cutoff criteria. For each gene, the values for each experiment that meet or exceed the three cutoff criteria are shown in the table. The scores were then summarized from the gene occurrence for each gene into a comprehensive score for that gene for each of the six criteria described above. For example, if gene A made a cut in three experiments and the induction scores were 4, 6, and 8, respectively, the induction score summarized for gene A would be 6 (average of the three values). Further, for example, the gene having the highest overall score with respect to the inducer has an overall score of 10, and the lowest overall score is 2. In this case, the score is halfway between the highest and lowest values, so Gene A will get a rating of 50%. The score for each gene was then calculated by subtracting the lowest value shown from the value for that gene, then dividing by the range and multiplying by 100. In other words, the score for each gene is a percentage with the minimum value being 0 and the maximum value being 100. For example, if a gene's score is three-quarters of the indicated minimum and maximum value for that criterion, the score will be between the minimum and maximum values shown for that criterion, and the score will be 5%. Become. Since lower values are more preferred for the CV factor (mutation coefficient of fold induction), the score so calculated was subtracted from 100 to take the reciprocal of that percentage.
[0148]
The final ranking score for each gene was calculated via a weighted combination of that score for the six ranking criteria. If a score could not be calculated for a particular criterion, all values for that criterion were dropped from the equation and ranked based solely on the remaining factors. Each of the ranking criteria is weighted between 0 and 5 and the weighting is relative, so 2: 2: 2: 2: 2: 2 is 4: 4: 4: 4: 4: 4. And so on. If the weight is zero, the factor is dropped from the equation. For example, assume that Gene A has the following scores: NC: 75%, CC: 50%, FI: 80%, CV: 25%, FL: 50%, and CT: 30%. Using the above weightings (3,1,5,0,0), the final score for gene A is calculated as follows:
(75 × 3 + 50 × 1 + 80 × 5 + 25 × 0 + 50 × 0 + 30 × 0) / 9 (Note: 9 is the total number of “weightings”, ie, 3 + 1 + 5)
(225 + 50 + 400 + 0 + 0 + 0) / 9
675/9
75 is the final score for Gene A.
[0149]
A score was then calculated for each individual gene based on combining the individual values for that gene from one or more experiments where the gene made an initial cut. The list of genes was then sorted by rank based on the final score. The targeted decision on how many genes to get from the top of the list to add to the CT array was based on the number of experiments in which the gene responded. On a rank-ordered list of genes, at around 450 genes, the number of experiments in which a gene responds often starts with only one experiment or one compound. It is desirable that most genes on the array respond to different mechanisms of toxicity or different tissue differences. Therefore, the number of genes selected from the top of the gene list arranged in rank order was 450. Since we want to minimize the number of duplicated genes added to the rat gene set (see Example 2) already established in-house, there are 50 genes that have been eliminated due to duplication. Finally, 400 genes from the set of 17,241 rat genes on the microarray were experimentally selected as new genes to further evaluate the toxicity to specific toxicants and the response to toxicity in specific tissues. did. Table 4 lists these 400 genes.
[0150]
Section 4 Evaluation of experimental data on specific tissue responses of rat genes corresponding to subsequences found from the set of 17,241 genes
a. Toxicity tests for further evaluation of experimentally discovered genes
Male Sprague-Dawley rats were exposed to the drugs and chemicals listed in Table 3, tissues were harvested, and further cDNA samples were prepared and hybridized as described in Section 2 for materials and methods.
[0151]
b. Microarray
The 400 genes discovered by the experiment were printed on a microarray according to the description of PCR and slide spotting in Section 1 on Materials and Methods. Washed, dried and hybridized slides were prepared using Axon Instruments Inc. Were scanned with a GenePix 4000A microarray scanner and the fluorescence readings obtained from the scanner were converted to a computer quantification file using GenePix software.
[0152]
c. Analysis of quantification files to evaluate toxicologically relevant genes
The quantification file was imported into Phase 1 Matrix Express software designed for analysis of differential gene expression data. The ratio of the fluorescence values of the treated and control cDNA samples hybridized on the same slide was determined for each spot and the fold induction value was determined (positive value for induction of gene response, suppression of gene response) Unknown value for). The induction fold was then normalized by the central induction fold value. The fold induction for each gene is the average of the fold induction of the four spots on the slide for each gene. If the coefficient of variation of the four spots is greater than 50%, the data for that gene is not included in the gene on the slide. Matrix Express software makes it possible to develop warehouses containing (microarray) induction magnification data from multiple experiments. The warehouse was constructed by taking the quantification file and analyzing the fold induction of rats treated with the drugs and chemicals listed in Table 3. In addition, most samples were hybridized in duplicate, and data from two high quality slides were averaged in an warehouse. Rats treated with any of the compounds were treated for liver and kidney and evaluated for gene expression. Spleen, heart, testis, and lung samples were evaluated for multi-organ toxin. Spleens were evaluated for all immunotoxins and 5 non-immunotoxins, heart samples were evaluated for all heart toxins, testes were evaluated for flutamide and all steroid compounds, and lungs were for all lung toxins. The brain was evaluated for all brain toxins. The warehouse contained approximately 2500 final experiments (mainly two averages to perform one final experiment) when assessing the tissue-specific response of the gene.
[0153]
The gene was determined to respond in the liver if the fold induction was 2 (stimulation or suppression) in more than 1% of experiments on liver samples. Similarly, the gene was determined to respond in the kidney at a fold induction of 2 in more than 1% of experiments on kidney samples. Since these organs were evaluated for all toxins, including non-hepatic or renal toxins, a cut-off of 1% was sufficient for liver and kidney. For heart, spleen, lung, testis, or brain, a gene was determined to respond to these organs if the fold induction was 2 in more than 2% of the experiments for each organ. Heart, spleen, lung, testis, and brain cutoffs were 2% higher than 1% because the total number of warehouse experiments for each of these organs was small. Also, when dealing with such a small number of experiments, a high cutoff minimizes false positive results.
[0154]
result
Discovery of 400 toxicity response genes
400 genes from the set of 17,241 rat genes on the microarray were experimentally selected as new genes to further evaluate toxicity to specific toxins and response to toxicity in specific tissues. Table 4 lists these 400 genes.
[0155]
Use of 400 toxicologically responsive genes to form a database demonstrating specific tissue responses
The toxicology database included approximately 2500 final experiments based on the compounds listed in Table 3 when assessing the tissue-specific response of the genes (primarily performing one final experiment). Perform the same experiment twice on average). Table 7 shows the tissue specific response of toxicological genes experimentally selected from the set of 17,242 genes demonstrated for each gene, and Table 8 shows similar information from Table 7. Wherein genes that respond specifically to tissues are shown for each tissue. Figures 1 to 6 show the differential gene expression of rats administered toxic compounds from this toxicology database. Differential expression of replicating microarrays, organs, and different compounds over time is demonstrated in these figures, demonstrating that a set of toxicologically relevant genes can perform toxicology studies in rats .
Embodiment 2
[0156]
Generation and characterization of known genes for toxic responses
Section 1 Creating clones
a. Identification and isolation of toxicologically relevant genes from rat or human databases
One method used to identify and isolate toxicologically relevant genes for inclusion in a rat array is to search public databases (eg, GenBank) and search for critical cellular pathways (eg, metabolism and DNA). (Synthesis). After identifying these genes, primers were designed and used in the amplification process with a cDNA library generated from rat liver cells. The amplification product was cloned into an expression vector and sequenced to confirm that the sequence was consistent with or substantially similar to the gene sequence information obtained from GenBank. The identified amplified gene product was then incorporated into a rat array using the method described in Example 1, section 1. The potential toxicologically relevant genes thus identified and isolated are included in Table 4.
[0157]
b. Gene identification and isolation using novel primers
Another method used to identify and isolate genes based on some evidence of their role in critical cellular pathways is to first find the sequence in a public database (eg, GenBank) Sequences corresponding to these genes were newly synthesized and used for the amplification reaction. The amplified product was cloned into an expression vector and sequenced to confirm that the sequence was consistent or substantially similar to the gene sequence information obtained from GenBank. The identified amplified gene product was then incorporated into a rat array using the methods disclosed herein to immobilize the gene product or target sequence on a glass slide.
[0158]
Section 2 Evaluation of experimental data on specific tissue responses of known genes
a. Toxicity tests to further evaluate genes discovered by experiment
Exposing male Sprague-Dawley rats to the drugs and chemicals listed in Table 3, harvesting tissue, preparing cDNA samples, as described in Example 1, Section 2 for Materials and Methods, Hybridized.
[0159]
b. Microarray
The microarray was printed with 300 genes generated as described in section 1 of the Materials and Methods of this Example 2. The washed, dried and hybridized slides are scanned with an Axon Instruments Inc. GenePix 4000A microarray scanner, and the fluorescence readings obtained from the scanner are read using GenePix software. And converted it into a computer quantification file.
[0160]
c. Analysis of quantification files to evaluate potential toxicologically relevant genes
The analysis of the experiments in Table 3, about 2500 experimental warehouses generated from tissue samples from rats exposed to toxic doses of drugs and chemicals, is similar to that described in Section 4 of Experiment 1. .
[0161]
result
The potential toxicologically relevant genes thus identified and isolated are included in Table 4. Table 9 shows the tissue-specific responses of the genes with potential roles in critical cellular pathways demonstrated for each gene, and Table 10 is similar to the information from Table 9, Genes that respond specifically to tissue are listed for each tissue. Figures 1 to 6 show the differential gene expression of rats administered toxic compounds from this toxicological database. Differential expression of replicating microarrays, organs, and different compounds over time is demonstrated in these figures, demonstrating that a set of toxicologically relevant genes can perform toxicology studies in rats .
Embodiment 3
[0162]
Discovery of novel toxicity response genes by transcriptome profiling
Section 1 Gene Identification and Isolation
a. Processing of processed and control tissue samples for RNA isolation
Using liver tissue from rats killed 24 hours after intraperitoneal injection of toxic doses of aflatoxin B1 (1 mg / kg) and appropriate liver tissue from vehicle control rats injected with saline, hepatotoxin was used. Genes differentially expressed in rats exposed to (aflatoxin) were determined. RNA was isolated from both liver samples using a Qiagen RNA isolation kit (RNeasy Midi kit), followed by a Genhnter® Messageclean® kit. The protocol from the MessageClean® kit was modified to produce more optimal conditions for removing DNA contaminants. Then, these components, ie, 50 liters of total RNA, 5.7 liters of 10 × reaction buffer, and 1.0 liter of DNase I (10 units / l) were added to bring the total volume to 56.7 liters. These components were mixed well and incubated at 37 degrees Celsius for 30 minutes. Then 40 liters of a phenol / chloroform mixture (1: 1 by volume) were added, the mixture was stirred for 30 seconds and left on ice for 10 minutes. The tube containing the mixture was then spun in an Eppendorf centrifuge at maximum speed for 5 minutes at 4 degrees. The upper phase was collected and transferred to a new tube, and 5 liters of 3M NaOAc and 200 liters of 95% ethanol were added to the upper phase. The mixture was left at -80 ° C for at least 1 hour, then spun at 4 ° C for about 10 minutes. The supernatant was removed and the RNA was dried for several minutes. Thereafter, the RNA was transferred to DEPC H_TwoO. Suspended in 11 liters. 1 liter to H_TwoA in 50 liters of O_260/280Was used to measure. RNA was stored as a 1-2 g aliquot at -80 ° C. Immediately before the differential display, an appropriate amount of RNA is_TwoDiluted with O to 0.1 g / l. It is important to avoid using diluted RNA after freeze-thaw cycles.
[0163]
The RNAimage® kit was used and the protocol from the RNAimage® kit was modified to optimize the more successful mRNA differential display. The following section describes how this was achieved.
[0164]
b. Reverse transcription
In a tube, the following components, dH_Two9.4 liters, 4.0 liters of 15 × RT buffer, 1.6 liters of dNTP (250M), 2.0 liters of 0.1 g / l freshly diluted total RNA without DNase, HT₁₁2.0 liters of M (2M) was added to bring the total volume to 19 liters. These components were mixed well and incubated at 65 ° C for 5 minutes, 37 ° C for 60 minutes, 75 ° C for 5 minutes and kept at 4 ° C. After holding the tubes at 37 ° C. for 10 minutes, 1 liter of Super Script II reverse transcriptase (Life Technologies Inc.) was added to each reaction and the tubes were gently beaten with a finger to mix quickly. Thereafter, the incubation was continued. At the end of the reverse transcription, the tube was spun briefly to collect the condensate. Tubes were set on ice to perform PCR, or tubes were stored at -20 C for later use.
[0165]
c. Polymerase chain reaction
The following components: dH_TwoO 10 l, 10 x PCR buffer 2 l, dNTP (25 M) 1.6 l, 2 M H-AP primer 2 l, 2 M H-T₁₁M 2 liters, RT-mix as described above (same HT for PCR)₁₁M must contain) 2 liters, α-³³A total volume of 20 liters was obtained by combining 0.2 liters of PdATP (2000 Ci / mmol) and 0.2 liters of Taq DNA polymerase manufactured by PE Biosystems, and a PCR reaction was performed using the total volume. The tube containing all of these components is mixed well by raising and lowering the pipette and placed in a thermocycler at 95 ° C for 5 minutes, then 30 seconds at 94 ° C, 2 minutes at 40 ° C, 30 minutes at 72 ° C. Amplification was performed by running 40 cycles under the condition of 2 seconds and finally kept at 4 ° C. until the sample was removed from the thermocycler.
[0166]
d. Gel electrophoresis
A 6% denaturing polyacrylamide gel in TBE was prepared and polymerized for at least 2 hours before use. The gel was then run for about 30 minutes, after which any sample was introduced. It is important to flush all sample wells of the gel to remove any urea before introducing any samples into the wells. Approximately 3.5 liters of each sample was mixed with 2 liters of the introduced dye and incubated on a 6% gel immediately after incubation at 80 ° C. for 2 minutes. In this example, the dye introduced was xylene, and after introducing the sample from the PCR performed several times into the gel, the gel was run until the xylene dye was about 15 cm (about 6 inches) from the bottom of the gel. At a constant power of 60 watts. After the power was turned off, the gel was blotted onto one large exposed autoradiographic film. Cover the gel with plastic wrap and place the gel in a large autoradiographic cassette with one new unexposed film marked in the dark, and place the gel at -80 ° C. Exposure. Exposure time may be anywhere between overnight and 72 hours. After developing the film, identify the band in question by performing an alignment operation with the developed film, and then cut out the band in question from the polyacrylamide gel using a clean scalpel. Was isolated. The isolated band was placed in 100 liters of water and boiled at 95% for 5 minutes.
[0167]
e. PCR to amplify gel bands
PCR was set up to amplify the gel band. Re-amplification should be performed using the same primer set and PCR conditions, except that the dNTP concentration is 20M. To perform the PCR reaction, the following components, ie, H_Two20.4 liters of O, 4 liters of 10 × buffer, 3.2 liters of 250M dNTP 4 liters of 2M H-AP primer, 2M HT₁₁4 liters of M, 4 liters of template (from 100 liters containing gel band) and 0.5 liters of Taq polymerase were combined to make a total volume of 40 liters. The components are heated at 95 ° C. for 5 minutes, then repeated for 40 cycles at 94 ° C. for 30 seconds, 40 ° C. for 2 minutes, 72 ° C. for 30 seconds, and finally at 4 ° C. until the sample is removed from the thermocycler. Held in. About 4 liters of the PCR reaction was removed and run on a 1% agarose gel to confirm that the PCR reaction was successful.
[0168]
Section 2 Cloning of amplified fragments and screening of colonies
a. Cloning of amplified fragments
Cloning of the amplified fragment may be accomplished by using products obtained from various sources (eg, GenHunter or In Vitrogen) to achieve the desired cloning product. In this example, In Virtrogen's TOPO TA Cloning Kit® was used and the following materials were used: 2 liters of freshly run PCR product, sterile H_Two2 liters of O and 1 liter of PCR-TOPO vector were combined in a tube to a final volume of 5 liters. The combined components were mixed gently and incubated at room temperature for 5 minutes. One liter of 6 × TOPO cloning stop solution was then added and all the combined components were mixed at room temperature for about 10 seconds, then placed on ice. One Shot ™ cells were thawed on ice. Two liters of the TOPO cloning reaction was added to One Shot ™ cells, mixed, and incubated on ice for 30 minutes. Cells were heat shocked at 42 ° C. for 30 seconds without shaking and incubated on ice for 2 minutes. The heat shocked cells were then mixed with 250 liters of room temperature SOC and mixed. The cells were then brought to 37 ° C. for 30 minutes. About 50 to 100 liters of cells were spread on two XYT plates on which 100 g / ml of ampicillin and X-gal were placed. The plates were incubated overnight at 37 ° C. and the next morning, three white colonies were selected for analysis.
[0169]
b. Screening colonies for the correct recombinant plasmid
PCR was used to confirm that the selected white colonies contained the correct recombinant plasmid. To perform the PCR reaction, the following components, ie, H_Two21 liters of O, 2.5 liters of 10 × PCR buffer, 0.12 liters of 10 mM dNTP, 1 liter of 25 ng / l T7 primer, 1 liter of 25 ng / l gene-specific left or right primer, template (tube from transformation plate to tube) A toothpick was used to transfer the colonies to the reaction mixture, which was performed by swiping the toothpick in the reaction mixture) and 0.5 liter of Taq polymerase to a total volume of 25 liters. The reaction mixture was run at 95 ° C. for 5 minutes, then repeated 35 times at 95 ° C. for 30 seconds, 45 ° C. for 30 seconds, 72 ° C. for 30 seconds, and then at 72 ° C. for 5 minutes, and finally, a sample from the thermocycler. Was kept at 4 ° C. until it was removed. Approximately 4 liters of the PCR product was removed and run on a 1% agarose gel to confirm that the PCR reaction was successful. Bacterial colonies corresponding to those that yielded a positive PCR result were grown overnight in LB medium containing 100 g / l ampicillin with shaking at 37 ° C. Plasmid DNA was isolated from overnight cultures and sequenced using T7 primers. The sequence was then compared to the sequence in the GenBank database to confirm that the correct gene fragment was cloned. The gene fragment was then amplified from the plasmid DNA by PCR. Unincorporated planeers and dNTPs were removed and the resulting gene fragments were aligned on glass slides for measuring differential gene expression using a phase 1 molecular toxicology microarray product.
[0170]
result
RCT-289 and RCT-290 are two toxicologically relevant genes identified using the methods disclosed in this example. The gene sequences are listed in Table 4.
Embodiment 4
[0171]
Real-time PCR reaction
Materials and methods
Total RNA was isolated from the tissues and / or organs of rats to which the toxic compounds listed in Example 1, section 3 were administered, and then the mRNA in this total RNA was replaced with 3 μg of total RNA and 1.5 μl of random hexamer primer. Used to convert to cDNA. After incubation at 70 ° C. for 10 minutes, the reaction mixture contains the following components: 6 μl of 5 × first strand buffer, 3 μl of 0.1 DTT, 1.5 μl of 10 mM dNTP, 1.5 μl of Superscript enzyme, and 6.5 μl of DEPC-treated water. Was added. The reaction was incubated at 45 ° C. for 2 hours, and 1 μl of this reaction was used for real-time PCR (RT-PCR) assays. For the RT-PCR assay, 50 μl of reaction was prepared using Rnase-free water, Taqman® Universal PCR Master Mix (available from Applied Biosystem), target, and control primers / probes and cDNA. In this method, the accumulation of PCR products is measured using a dual-labeled fluorogenic probe. The probe was labeled at the 5 'end with 6-FAM and at the 3' end with TAMRA. TAMRA is a quenching dye. This assay takes advantage of the 5'-3 'exonuclease properties of Taq polymerase. When the probe is hybridized to its target, the reporter dye (FAM) can be cleaved by the 5 'exonuclease activity of Taq polymerase, releasing a fluorescent signal. As the amplification cycle increases, more signal is emitted and detected using the ABI 7700 sequence detector. A set of two primers and a fluorogenic probe is designed and synthesized for each gene. Quantification of mRNA requires that primers be positioned on exon-intron junctions in order to optimally design probes and primers. This step disables the amplification of contaminated genomic DNA. In our work, primers were used for 16 genes, which are part of a toxicologically relevant 700 rat gene array, also referred to herein as a "total toxicity array" or "CT array". And a set of probes were designed. These genes were up- or down-regulated by toxic drugs / chemicals in rats exposed in vivo or rat cells exposed in culture. The probe and primer pairs were tested for their ability to amplify genomic DNA. When genomic DNA was amplified, probes and primers for that particular gene were not used in the RT-PCR assay.
[0172]
result
Real-time PCR analysis was performed using RNA from the same rats that received the various toxic chemicals / drugs used for CT array studies. FIGS. 7, 8, and 9 show the results of a linear regression analysis of TaqMan vs. CT array data for 42 toxicological substances / drugs. There is an excellent correlation (r = 0.97395) between TaqMan data and CT array data for cytochrome P450 1A2 (FIG. 7). Analysis of TaqMan and CT array data for fatty acid synthase shows a correlation of 0.86346 (FIG. 8). Comparison of TaqMan and CT array data for multidrug resistance protein-1 produced a correlation of 0.73414 (FIG. 9).
Embodiment 5
[0173]
Isolation of total RNA from adherent cultured cells
High quality, high purity total RNA was isolated from cultured cells using the Qiagen RNeasy midi kit and 2-mercaptoethanol. To minimize the risk of RNA degradation caused by ribonuclease, wear gloves and treat the working area and device with a ribonuclease inhibitor such as, for example, RNase Zap (Ambion® Products, Austin, Tex.). Precautionary measures were taken by keeping on ice. This total RNA isolation technique is based on the Qiagen® RNeasy® midi kit and, with some modifications, in a T-75 flask for HepG2 (human hepatocyte) cells. For maxi-kit RNA isolation of cells, used in T-175 flasks.
[0174]
The cells were checked under a microscope to make sure they were viable. When cells reached 60-80% confluence, the cells were administered drugs, such as drugs, chemicals, or pharmaceutical compositions. It is preferred not to isolate RNA from flasks that have reached 100% confluence.
[0175]
For adherent cells, the medium was discarded and the flask was washed twice with 1 × cold PBS (20 ml then 10 ml for T-75 flask; 40 ml then 20 ml for T-175 flask). After the second PBS wash, the remaining PBS was removed with a pipette. Freshly prepared RLT buffer (RLT buffer requires the addition of 10 μl β-mercaptoethanol for every 1.0 ml of RLT) was added directly to the cell culture flask. The T-75 flask contained 3 ml of RLT buffer, and the T-175 flask contained 5.0 ml of RLT buffer. At this point, it is preferable to stir the flask lightly. The flask is gently agitated to disperse the RLT buffer and the cells form a gel-like layer. The cells are allowed to settle for 4 minutes, then the fluid is withdrawn and placed in RNase-free tubes. An equal volume of 70% ethanol was added to each tube and agitated to evenly disperse. If a precipitate having a string-like appearance is formed, the string-like precipitate may be removed and discarded. The fluid was added to the spin column and spun at 3650 rpm for 5 minutes using a Backman GS-6. The passed fraction was discarded. About 4 ml or 15 ml of RW1 buffer (T-75 or T-175, respectively) was added and spun at 3650 RPM for 5 minutes. The passed fraction was discarded. About 2.5 ml of RPE buffer (middle column) or 10 ml of RPE buffer (large column) were added and centrifuged for 3 minutes. The passed fraction was discarded. An additional 2.5 ml or 10 ml of buffer RPE was added and centrifuged for 5 minutes to completely dry the column before proceeding to the elution step. The column containing the chip should be dried for the next step.
[0176]
The column to which the RNA was bound was transferred to a clean tube for elution. Then, 150 μl of RNase-free water was added to the middle column, 500 μl of RNase-free water was added to the column, allowed to stand for 2 to 4 minutes, and rotated at 3000 × g for 3 minutes (3690 to 3710 rpm, Beckman) GS-6 or similar centrifuge). Elution was repeated with an additional 150 μl or 500 μl of RNase-free water in the same tube. The eluate was precipitated using the LiCl precipitation protocol exemplified in Example 2 and resuspended in RNA storage buffer.
[0177]
To determine the yield, the O.D. D. Was read at 260 nm. Approximately 2.0 μl of RNA is replaced with 98 μl of H_TwoO. D. Was calculated and calculated as follows.
(Absorbance) x (dilution coefficient) x (40) / 1000 = amount of RNA g / ml
Example: absorbance = 0.45
Dilution factor = 50
(0.45 × 50 × 40)= RNA concentration μg / ml
The yield should be between 200-400 μg of total RNA from the T-75 flask at> 50% confluence. This sample was stored in a freezer at -80 ° C.
[0178]
[Table 1-1]
[Table 1-2]
[Table 1-3]
[Table 1-4]
[Table 1-5]
[0179]
[Table 2]
[0180]
[Table 3]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
[0286]
[0287]
[0288]
[0289]
[0290]
[0291]
[0292]
[0293]
[0294]
[0295]
[0296]
[0297]
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
[0307]
[0308]
[0309]
[0310]
[0311]
[0312]
[0313]
[0314]
[0315]
[0316]
[0317]
[0318]
[0319]
[0320]
[0321]
[0322]
[0323]
[0324]
[0325]
[0326]
[0327]
[0328]
[0329]
[0330]
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364]
[0365]
[0366]
[0367]
[0368]
[0369]
[0370]
[0371]
[0372]
[0373]
[0374]
[0375]
[0376]
[0377]
[0378]
[0379]
[0380]
[0381]
[0382]
[0383]
[0384]
[0385]
[0386]
[0387]
[0388]
[0389]
[0390]
[0391]
[0392]
[0393]
[0394]
[0395]
[0396]
[0397]
[0398]
[0399]
[0400]
[0401]
[0402]
[0403]
[0404]
[0405]
[0406]
[0407]
[0408]
[0409]
[0410]
[0411]
[0412]
[0413]
[0414]
[0415]
[0416]
[0417]
[0418]
[0419]
[0420]
[0421]
[0422]
[0423]
[0424]
[0425]
[0426]
[0427]
[0428]
[0429]
[0430]
[0431]
[0432]
[0433]
[0434]
[0435]
[0436]
[0437]
[0438]
[0439]
[0440]
[0441]
[0442]
[0443]
[0444]
[0445]

[Brief description of the drawings]
[0446]
FIG. 1 shows the identity of the differential gene response on two microarrays spotted with the 700 rat genes listed in Table 4. As a differential expression, cDNA specimens from the liver of rats exposed to aflatoxin at 1 mg / kg for 72 hours were hybridized to slides and compared to cDNA specimens from appropriate control rats hybridized simultaneously on slides. For each of the nine genes shown, one bar graph is from one microarray and the second bar data is from a second microarray.
FIG. 2 shows similar differential gene expression responses in two different organs from two identically treated rats of lipopolysaccharide (LPS) treated 6 hours after exposure. The data shown are liver data from two rats (first and second bar graphs for each gene) and kidney data from two rats (third and second). 4 are for each gene). For two of the five genes shown, differential expression was increased in the kidney rather than the liver, and for three of these genes, differential expression was increased in the liver than the kidney.
FIG. 3 shows the time course of toxicity-induced differential gene expression in rat liver. Rats were treated with lipopolysaccharide by a single intraperitoneal injection (8 mg / kg). The data shown are two animals killed after 6 hours (first and second bar graphs for each gene), two animals killed after 24 hours (third and fourth bar graphs for each gene), 72 Two animals killed after hours (fifth and sixth bar graphs for each gene). For the five genes shown, differential expression is greater in the liver at 6 hours than at 24 hours, with little differential expression at 72 hours.
FIG. 4 shows the progression of toxicity-induced differential gene expression over time in rat heart. Rats were treated with lipopolysaccharide by a single intraperitoneal injection (8 mg / kg). The data shown are two animals killed after 6 hours (first and second bar graphs for each gene), two animals killed after 24 hours (third and fourth bar graphs for each gene), 72 Two animals killed after hours (fifth and sixth bar graphs for each gene). For the 13 genes shown, differential expression is greater in the heart at 6 hours than at 24 hours, with little differential expression at 72 hours.
FIG. 5 shows the correlation of these agent-treated livers of rats in vivo treated with erythromycin estrate and tetracycline. The white square indicates the region where the correlation between the experiments is highest. The correlation between experiments in which rats were administered erythromycin estrate was high (white squares), and the correlation between experiments in which rats were administered tetracycline was high. The correlation between one compound experiment and the other compound experiment was not very high (dark grey and box), and the 700 genes expressed in the livers of rats exposed to these two toxins were different It was shown. This is expected because erythromycin and tetracycline have different hepatotoxic mechanisms.
FIG. 6 shows a correlation matrix of toxic compounds classified into four types by mechanism. Gene expression data from rat CT arrays tested in rat liver were identified by sequential paired gene identification. Areas in white boxes indicate higher correlation. Abbreviations are as follows: PAH: polyaromatic hydrocarbon, TCDD, benzo (a) pyrene, dimethylbenzanthracene; PP: peroxisome proliferator, gemfibrozil, diethylhexyl phthalate, Wy14,643; CS: corticosteroid, Prednisone, triamcinolone; NM: Nitrogen mustard, mechlorethamine, cyclophosphamide, melphalan, chlorambucil.
FIG. 7 shows a very similar response of the gene cytochrome P450 1A2 using a microarray platform (symbol O and dashed line) and a TacMan real-time PCR platform (symbol and solid line).
FIG. 8 shows very similar responses of gene fatty acid synthase using a microarray platform (symbol O and dashed line) and a TacMan real-time PCR platform (symbol and solid line).
FIG. 9 shows very similar responses of gene multidrug resistant protein-1 using a microarray platform (symbol O and dashed line) and a TacMan real-time PCR platform (symbol and solid line).

Claims (61)

A method of assessing the toxicity of an agent, comprising:
(A) exposing the test animal to the agent;
(B) measuring the expression of one or more toxic response genes selected from the group consisting of the genes corresponding to the partial gene sequences in Tables 6, 7, 8, 9 and 10 in the test animal in response to the agent; Generating a test expression profile thereby, and (c) comparing the test expression profile with a reference expression profile indicative of toxicity, wherein there is a significant correlation between the test expression profile and the reference expression profile. Assessing the toxicity of the agent by determining whether is present,
The above method comprising: The method according to claim 1, wherein the gene corresponding to the partial gene sequence responds in the kidney. The method according to claim 1, wherein the gene corresponding to the partial gene sequence responds in the liver. The method according to claim 1, wherein the gene corresponding to the partial gene sequence responds in the spleen. The method according to claim 1, wherein the gene corresponding to the partial gene sequence responds in the heart. The method according to claim 1, wherein the gene corresponding to the partial gene sequence responds in the brain. The method according to claim 1, wherein the gene corresponding to the partial gene sequence responds in the lung. The method according to claim 1, wherein the gene corresponding to the partial gene sequence responds in the testis. The method according to any one of claims 1 to 8, wherein the test animal is a rat. The method according to any one of claims 1 to 8, wherein the test animal is a dog. The method according to any one of claims 1 to 8, wherein the test animal is a non-human primate. The method according to any one of claims 1 to 8, wherein the test animal is a human. 2. The method of claim 1, wherein the agent is administered at different dosages or at different times. A method of assessing the toxicity of an agent, comprising:
(A) exposing the test animal to the agent;
(B) measuring the expression of one or more toxic response genes selected from the group consisting of the genes corresponding to the partial gene sequences in Tables 6, 7 and 8 in the test animal in response to the agent; Generating an expression profile; and (c) comparing the test expression profile with a reference expression profile indicative of toxicity, wherein there is a significant correlation between the test expression profile and the reference expression profile. Assessing the toxicity of the agent by determining whether
The above method comprising: 15. The method according to claim 14, wherein the gene corresponding to the partial gene sequence responds in the kidney. The method according to claim 14, wherein the gene corresponding to the partial gene sequence responds in the liver. The method according to claim 14, wherein the gene corresponding to the partial gene sequence responds in the spleen. 15. The method of claim 14, wherein the gene corresponding to the partial gene sequence responds in the heart. The method according to claim 14, wherein the gene corresponding to the partial gene sequence responds in the brain. 15. The method of claim 14, wherein the gene corresponding to the partial gene sequence responds in the lung. The method according to claim 14, wherein a gene corresponding to the partial gene sequence responds in the testis. The method according to any one of claims 14 to 21, wherein the test animal is a rat. The method according to any one of claims 14 to 21, wherein the test animal is a dog. The method according to any one of claims 14 to 21, wherein the test animal is a non-human primate. The method according to any one of claims 14 to 21, wherein the test animal is a human. 15. The method of claim 14, wherein the agent is administered at different doses or at different times. A method of assessing the toxicity of an agent, comprising:
(A) exposing the test animal to the agent;
(B) measuring the expression of a set of toxic response genes selected from the group consisting of the genes corresponding to the partial gene sequences in Table 4 in the test animal in response to the agent, thereby generating a test expression profile ,
(C) comparing the test expression profile with a reference expression profile indicative of toxicity, the method comprising determining whether there is a significant correlation between the test expression profile and the reference expression profile; Assessing the toxicity of the substance,
The above method comprising: 28. The method of claim 27, wherein said set of toxicity response genes comprises at least 25 genes. 28. The method of claim 27, wherein the set of toxicity response genes comprises at least 50 genes. 28. The method of claim 27, wherein the set of toxicity response genes comprises at least 100 genes. An array comprising one or more polynucleotides selected from the group consisting of the genes corresponding to the partial gene sequences in Tables 6, 7, 8, 9 and 10, or fragments of at least 20 nucleotides thereof. The array according to claim 31, wherein the gene corresponding to the partial gene sequence responds in the kidney. The array according to claim 31, wherein the gene corresponding to the partial gene sequence responds in the liver. The array according to claim 31, wherein the gene corresponding to the partial gene sequence responds in the spleen. 32. The array of claim 31, wherein genes corresponding to the partial gene sequences respond in the heart. The array according to claim 31, wherein the gene corresponding to the partial gene sequence responds in the brain. 32. The array of claim 31, wherein genes corresponding to the partial gene sequences respond in the lung. The array according to claim 31, wherein the gene corresponding to the partial gene sequence responds in the testis. An array comprising one or more polynucleotides selected from the group consisting of genes corresponding to the partial gene sequences of Tables 6, 7 and 8, or fragments of at least 20 nucleotides thereof. 40. The array of claim 39, wherein the gene corresponding to the partial gene sequence responds in the kidney. The array according to claim 39, wherein the gene corresponding to the partial gene sequence responds in the liver. The array according to claim 39, wherein the gene corresponding to the partial gene sequence responds in the spleen. 40. The array of claim 39, wherein the gene corresponding to the partial gene sequence responds in the heart. The array according to claim 39, wherein the gene corresponding to the partial gene sequence responds in the brain. 40. The array of claim 39, wherein the gene corresponding to the partial gene sequence responds in the lung. 40. The array of claim 39, wherein the gene corresponding to the partial gene sequence responds in the testis. An array comprising one or more polynucleotides selected from the group consisting of genes corresponding to the partial gene sequences in Table 4 or fragments of at least 20 nucleotides thereof. 48. The array of claim 47, wherein the set of toxicity response genes comprises at least 25 genes. 48. The method of claim 47, wherein the set of toxicity response genes comprises at least 50 genes. 48. The array of claim 47, wherein the set of toxicity response genes comprises at least 100 genes. An array comprising a set of polynucleotides substantially homologous to a set of toxicity response genes selected from the group consisting of the genes corresponding to the partial gene sequences of Tables 6, 7, and 8 and corresponding to at least 20 nucleotides in length . 32. An array comprising one or more polynucleotides homologous to the polynucleotides of the array of claim 31. 53. The array of claim 52, wherein the polynucleotide corresponds to a human gene. 53. The array of claim 52, wherein the polynucleotide corresponds to a murine gene. 53. The array of claim 52, wherein the polynucleotide corresponds to a non-human primate gene. 53. The array of claim 52, wherein the polynucleotide corresponds to a canine gene. 40. An array comprising one or more polynucleotides homologous to the polynucleotides of the array of claim 39. 58. The array of claim 57, wherein the polynucleotide corresponds to a human gene. 58. The array of claim 57, wherein the polynucleotide corresponds to a murine gene. 58. The array of claim 57, wherein the polynucleotide corresponds to a non-human primate gene. 58. The array of claim 57, wherein the polynucleotide corresponds to a canine gene.