WO2002064776A2

WO2002064776A2 - Signal transduction proteins 15b3, 15b3-1 and 15b3-2, and related dna sequences

Info

Publication number: WO2002064776A2
Application number: PCT/EP2002/001562
Authority: WO
Inventors: Armin Schneider; Achim Fischer; Bettina Klausner; Moritz Rossner; Birgitta Kammandel; Rebecca Widenmeyer; Bernhard Götz; Gisela Eisenhardt; Stephanie Jomana Naim; Dieter Newrzella
Original assignee: Axaron Bioscience Ag
Priority date: 2001-02-14
Filing date: 2002-02-14
Publication date: 2002-08-22
Also published as: AU2002250943A1; WO2002064776A3; DE10106835A1

Abstract

The invention relates to DNA sequences, expression vectors containing the inventive DNA sequences, host cells, gene products of the cited DNA sequences coding for signal transduction proteins, and other derivatives of the cited objects of the invention. Said DNA sequences and gene products either have a protective action, i.e. impart a certain resistance to apoplexy, or they cause an increase in ischaemic damage. The invention also relates to the use of the inventive DNA sequences or the signal transduction proteins expressed by said DNA sequences as pharmaceuticals, and to the non-therapeutic uses of the inventive DNA sequences or gene products.

Description

Signal transduction proteins 15B3, 15B3-1 and 15B3-2 and underlying DNA sequences

The present invention relates to (i) DNA sequences, (ii) expression vectors which contain DNA sequences according to the invention, (iv) host cells which have expression vectors according to the invention, (v) gene products which are encoded by sequences according to the invention, (vi) transgenic animals modified with respect to sequences according to the invention, (vii) antibodies directed against gene products according to the invention, (viii) methods for the expression or isolation of gene products according to the invention, (ix) the use of DNA sequences or gene products according to the invention as medicaments, (x) pharmaceutically active Compounds and processes for their preparation and uses of such compounds according to the invention and (xi) non-therapeutic uses of DNA sequences or gene products according to the invention.

It is known from the prior art that the pathophysiology of the stroke, that the Ras / Erk signal transduction pathway has a great influence on NMDA receptor / NOS activation and the neuronal ischemic preconditioning. The proteins of the Ras / Erk cascade represent pharmacological targets because specific inhibitors can be found based on defined biochemical functions.

Stroke is the third leading cause of death and the main cause of disabilities in western industrialized nations. Every year around 250,000 people in Germany suffer from a stroke, a third die within the first month, 60% retain hindrances back. So far, there is no effective therapy for the majority of these patients. The majority of all strokes in Western countries are due to cerebral blood flow disorders caused by thrombosis or embolism. For this reason, many of the previous therapy concepts have been based on thrombolysis (for example by means of streptokinase, rtPA, Ancrod). From the prior art, however, Newer Ar is now also known that a spontaneous reperfusion occurs in the majority of ^"strokes. BEITEN in rodents also suggest that the damage is rather larger by reperfusion in a certain time window.

Clinical efficacy has been partially demonstrated for thrombolysis, but has not led to therapy that can be used in the majority of strokes. Recent research developments are therefore based on the development of new drugs that directly influence the cell death program in neurons.

In order to develop novel concepts for the treatment of cerebral ischemia, the most pronounced form of which is stroke, changes in gene expression are registered in newer model systems of cerebral ischemia, which are functionally related to the extent of brain damage. The best available animal model is the so-called filament model, in which a coated nylon thread closes the branch of the cerebral artery. By pulling back the thread, blood circulation to the infarct area is possible. New therapeutic targets can be identified from the analysis of the transcriptome at different post-ischemic times. open up pathways for acute therapy. Individual gene products that are subject to regulation during preconditioning have already been identified (eg IL-lra, TIMP-1, hsp-72). So far, however, a protective effect of the identified proteins has not been clearly demonstrated.

The object of the present invention is to identify further proteins and their underlying nucleotide sequences which have a protective effect, in particular impart a certain resistance to the stroke, as well as those which cause an expansion of the ischemic damage. Another object of the present invention is to provide methods on the basis of identified proteins which make it possible to develop pharmaceuticals which can intervene therapeutically in the corresponding pathophysiology. The provision of corresponding pharmaceuticals is therefore also an object of the present invention.

The present invention solves this problem by the subject matter of claims 1, 5, 6, 8, 11, 12, 15, 16, 17, 20, 23, 26 and 27. Advantageous embodiments are described in the respective subclaims.

One object of the present invention relates to nucleic acid sequences, in particular DNA sequences, which contain a sequence region which is suitable for a polypeptide with an amino acid sequence of AS 312 to AS 711 (15B3), AS 180 to AS 579 (15B3-1) or AS 306 to AS 705 (15B3-2) (numbering according to FIG. 4), including all functionally homologous derivatives, fragments or alleles. In particular, all nucleic acid sequences are included, those with the invention Hybridize sequences, including the complementary sequences in the double strand (claim 1).

In a further preferred embodiment, DNA sequences are disclosed whose gene product codes for a polypeptide, as shown in one of FIGS. 9, 11 or 13 for the sequences 15B3, 15B3-1 or 15B3-2, including all functionally homologous derivatives, alleles or Fragments of such a DNA sequence and also infunctional derivatives, alleles, analogs or fragments (for example DN variants) which can inhibit the physiological function, for example apoptotic signal cascade (claim 2). DNA sequences hybridizing with these DNA sequences according to the invention (including the sequences of the complementary DNA strand) are also disclosed. Derivatives, analogs, fragments or alleles of this type are prepared by standard methods (Sambrook et al. 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY). 8, 10 or 12, one or more codon (s) are inserted, deleted or substituted in order to obtain, after transcription and translation, a polypeptide which has a difference in at least one amino acid compared to the native sequences shown in Figures 9, 11 or 13.

The subject matter of the present application also includes partial DNA sequences of the sequences shown in FIGS. 8, 10 or 12. These partial sequences typically contain at least 60, more preferably at least 150 and even more preferably at least 250 nucleotides comprising fragments of the nucleotide sequences shown in FIGS. 8, 10 or 12. In particular, preferred partial sequences for polypeptides encode that of AS 312 (15B3), 180 (15B3-1) or 306 (15B3-2) run at least 20 AS in the direction of the N-terminus and possibly extend to the N-terminus (numbering according to Figure 4). Furthermore, the partial sequence coding for at least 20 AS can also begin at a codon lying further proximally or distally from the aforementioned points. Partial sequences which code for at least one LRR are very particularly preferred, preferably at least 2 and more preferably at least 5 (LRRs are indicated in FIG. 4 by arrows). Those partial nucleotide sequences which code for at least one of the LRRs marked in FIG. 4 or nucleotide sequences which contain at least one of the LRRs indicated in FIG. 4 are particularly preferred. All derivatives, analogs or alleles of the aforementioned partial sequences disclosed are also disclosed. The AS sequences resulting from these partial DNA sequences according to the invention are also disclosed as such or as a constituent in larger recombinant proteins. All native splice variants of the sequences according to the invention also belong to the scope of the present invention.

Also preferred are nucleic acid sequences, in particular DNA sequences, which code for a protein which has at least 60% sequence identity, preferably at least 80% and even more preferably at least 95%, with the sequences shown in FIGS. 9, 11 or 13. After isolation and sequencing, the nucleotide sequences according to the invention shown in FIGS. 8, 10 or 12 or their functional or non-functional equivalents, such as, for example, allele variants or isoforms, are obtainable. For the purposes of the present invention, allele variants are understood to mean variants which have 60 to 100% homology at the amino acid level, preferably 70 to 100%, very particularly preferably 90 to 100%. Allelic variants include in particular those functional or infunctional len variants which can be obtained by deleting, inserting or substituting nucleotides from the sequences shown in FIGS. 8, 10 or 12, at least one of the essential biological properties being retained.

Homologous or sequence-related DNA sequences can be isolated from all mammalian species, including humans, by conventional methods by homology screening by hybridization with a sample of the nucleic acid sequences according to the invention or parts thereof. Functional equivalents are also to be understood as homologs of the sequences shown in FIGS. 8, 10 or 12, for example their homologues from other mammals, shortened sequences, single-stranded DNA or RNA of the coding and non-coding DNA sequence. Such functional equivalents can be isolated from other vertebrates such as Mammalia, starting from the DNA sequences shown in FIGS. 8, 10 or 12 or parts of these sequences, for example using conventional hybridization methods or the PCR technique. According to the invention, all sequences hybridizing with the sequences according to FIGS. 8, 10 or 12 are also included. These DNA sequences hybridize under standard conditions with the sequences according to the invention. Short oligonucleotides of the conserved regions, which can be determined in a manner known to the person skilled in the art, are advantageously used for the hybridization. However, longer fragments of the nucleic acids according to the invention or the complete sequences can also be used for the hybridization.

These standard conditions vary depending on the nucleic acid sequence used (oligonucleotide, longer fragment or complete sequence) or on the type of nucleic acid (DNA or RNA) used for the hybridization. So For example, the melting temperatures for DNA: DNA hybrids are approx. 10 ° C lower than those of DNA: RNA hybrids of the same length. Under standard conditions, for example, depending on the nucleic acid, temperatures between 42 and 58 ° C in an aqueous buffer solution with a concentration between 0.1 to 5 x SSC (1 X SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.2 ) or additionally in the presence of 50% formamide, such as 42 ° C in 5 x SSC, 50% formamide. The hybridization conditions for DNA: DNA hybrids are advantageously 0.1 × SSC and temperatures between approximately 20 ° C. to 45 ° C., preferably between approximately 30 ° C. to 45 ° C. For DNA: RNA hybrids, the hybridization conditions are advantageously 0.1 × SSC and temperatures between approximately 30 ° C. to 55 ° C., preferably between approximately 45 ° C. to 55 ° C. These specified temperatures for the hybridization are, for example, calculated melting temperature values for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide. The experimental conditions for DNA hybridization are in relevant textbooks of genetics, such as in Sambrook et al. ("Molecular Cloning", Cold Spring Harbor Laboratory, 1989), and can be calculated according to formulas known to the person skilled in the art, for example depending on the length of the nucleic acids, the type of hybrid or the G + C content. The person skilled in the art can obtain further information on hybridization from the following textbooks: Ausübel et al. (eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York; Harnes and Higgins (eds), 1985, Nuclear Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed), 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford. Equivalents of nucleic acid sequences according to the invention also include derivatives of the sequences shown in FIGS. 8, 10 or 12, such as promoter variants. The promoters which are upstream of the specified nucleotide sequences together or individually can be changed by one or more nucleotide changes, by insertion (s) and / or deletion (s), functionality or effectiveness of the promoters being retained or, depending can be changed as required. For example, the effectiveness of the promoters can be increased by changing their sequence, or they can be completely replaced by more effective promoters, including organisms of other species. According to the invention, derivatives are also to be understood to mean variants whose nucleotide sequence in the range -1 to -1000 before the start codon have been changed such that the gene expression and / or the protein expression is changed, preferably increased.

Furthermore, derivatives are also to be understood as variants which were preferably changed at the 3 'end. As such "tags" in the literature, for. B. Hexa-histidine anchor known or epitopes that can be recognized as antigens of various antibodies (Studier et al., Meth. Enzymol., 185, 1990: 60 - 89 and Ausubel et al. (Eds.) 1998, Current Protocols in Molecular Biology, John Wiley & Sons, New York). and / or at least one signal sequence for transporting the translated protein, for example into a specific cell organelle or into the extracellular space.

In addition, a nucleic acid construct according to the invention or a nucleic acid according to the invention, for example according to FIGS. 8, 10 or 12 or their derivatives, variants, homologs or, in particular, fragments can also be expressed in a therapeutically or diagnostically suitable form. To the genius For the recombinant protein, vector systems or 0-ligonucleotides can be used which extend the nucleic acids or the nucleic acid construct by certain nucleotide sequences and thus code for modified polypeptides which, for example, serve for easier purification.

DNA sequences which contain one of the (c) DNA sequences indicated in FIG. 8, 10 or 12 are further preferred (claim 4).

Furthermore, according to the invention, all DNA sequences which code for a protein which essentially corresponds to the amino acid sequence of the proteins 15B3, 15B3-1 or 15B3-2 according to FIGS. 9, 11 or 13 are preferably disclosed. These DNA sequences receive only a small number of changes compared to the sequences given in the aforementioned figures, for example they can be isoforms. The number of sequence changes will typically not be greater than 10. Such DNA sequences, which essentially correspond to the DNA sequences coding for the proteins 15B3, 15B3-1 or 15B3-2 and which likewise code for a biologically active protein, can be obtained by generally known mutagenesis methods and the biological activity of the proteins encoded by the mutants can be identified by screening methods, for example binding studies or the ability to express the biological function, for example in connection with apoptosis. The corresponding mutagenesis methods include “site-directed” mutagenesis, which provides for the automatically carried out synthesis of a primer with at least one base change. After the polymerization reaction, the heteroduplex vector is converted into a suitable netes cell system transferred (eg E. coli) and isolated transformed clones isolated.

In addition, all methods familiar to the person skilled in the art for the production, modification and / or detection of DNA sequences according to the invention, which can be carried out in vivo, in situ or in vitro, are suitable (PCR (Innis et al. PCR Protocols: A Guide to Methods and Applications) or chemical synthesis). Appropriate PCR primers can be used, for example, to introduce new functions into a DNA sequence according to the invention, such as Restriction interfaces, termination codons. In this way, sequences according to the invention can be designed accordingly for transfer into cloning vectors.

The present invention further relates to expression vectors or a recombinant nucleic acid construct which, as described above, contains a nucleic acid sequence according to the invention, typically a DNA sequence (claim 5). Advantageously, the nucleic acid sequences according to the invention are functionally linked to at least one genetic regulatory element, such as, for example, transcription and translation signals. Depending on the desired application, this linkage can lead to a native expression rate or also to an increase or decrease in the native gene expression. With the expression vectors produced in this way, host organisms or host cells can then be transformed, e.g. Cell cultures from mammalian cells.

The expression vector according to the invention will typically use the native regulatory element (s), ie the promoter and / or enhancer Region of the gene for the protein 15B3, 15B3-1 or 15B3-2, for example from mammals, in particular corresponding human regulatory sequences. Possibly. these native 15B3, 15B3-1 or 15B3-2 regulatory sequences can also be genetically modified in order to produce a changed expression intensity. In addition to these native 15B3, 15B3-1 or 15B3-2 regulatory sequences or instead of these native 15B3, 15B3-1 or 15B3-2 regulatory sequences, native regulatory elements according to the invention for other genes can be connected upstream and / or downstream (5 ' - or 3 'regulatory sequences) and, if necessary, also have been genetically modified so that the natural regulation is switched off under the control of the 15B3, 15B3-1 or 15B3-2 regulatory sequences and the expression of the genes - as desired - this can be increased or decreased.

Advantageous regulatory sequences for the method according to the invention are, for example, in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq, T7, T5, T3 contain, gal, trc, ara, SP6, 1-PR or in the 1-PL promoter, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are, for example, in the gram-positive promoters such as amy and SP02, in the yeast promoters such as ADC1, MFa, AC, P-60, CYC1, GAPDH or in mammalian promoters such as CaM-Kinasell, CMV, Nestin, L7, BDNF, NF , MBP, NSE, beta-globin, GFAP, GAP43, tyrosine hydroxylase, kainate receptor subunit 1, glutamate receptor subunit B included. In principle, all natural promoters with their regulatory sequences, such as those mentioned above, can be used for an expression vector according to the invention. In addition, synthetic promoters can also be used advantageously. These regulatory sequences are intended to enable the targeted expression of the nucleic acid sequences according to the invention. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately. The regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase it. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

Regulatory sequences are all elements familiar to the person skilled in the art which can influence the expression of the sequences according to the invention at the transcription and / or translation level. In particular, in addition to promoter sequences, so-called "enhancer" sequences are to be emphasized, which can bring about increased expression via an improved interaction between RNA polymerase and DNA. The so-called "locus control regions", "silencers" or respective partial sequences thereof may be mentioned as further regulatory sequences. These sequences can be used advantageously for tissue-specific expression. So-called terminator sequences will also advantageously be present in an expression vector according to the invention and, according to the invention, are subsumed under the term "regulatory sequence".

A preferred embodiment of the present invention is the linkage of the nucleic acid sequence according to the invention with a promoter, the promoter typically being located 5 '"upstream" from a DNA sequence according to the invention. Further regulation signals, such as, for example, 3 '-terminal, polyadenylation signals or enhancers, can be functionally contained in the expression vector. In addition, nucleic acid sequences according to the invention, in particular for the sequences according to FIGS. 8, 10 or 12 or for the corresponding proteins, can be contained in one or more copies in a gene construct according to this invention, or, if appropriate, can also be localized on separate gene constructs.

The term “expression vector” includes both recombinant nucleic acid constructs or gene constructs, as described above, and complete vector constructs, which typically contain further elements in addition to the DNA sequences according to the invention and any regulatory sequences. These vector constructs or vectors are used for expression in a suitable host organism. Advantageously, at least one DNA sequence according to the invention, for example the 15B3 gene or a partial sequence of the 15B3 gene, is inserted into a host-specific vector which enables optimal expression of the genes in the selected host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Eds. Pouwels PH et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). In addition to plasmids, vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, viruses such as SV40, CMV, baculovirus, adenovirus, Sindbis virus, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally. Linear DNA is typically used for integration into Mammalia. The expression of nucleic acid sequences according to the invention can advantageously be increased by increasing the number of gene copies and / or by strengthening regulatory factors which have a positive effect on gene expression. For example, regulatory elements can preferably be amplified at the transcription level by using stronger transcription signals, such as promoters and enhancers. In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA or increasing the reading efficiency of this mRNA on the ribosomes. To increase the number of gene copies, the nucleic acid sequences or the homologous genes can be incorporated, for example, into a nucleic acid fragment or into a vector which preferably contains the regulatory gene sequences assigned to the respective genes or promoter activity having an analogous effect. In particular, those regulatory sequences are used which increase gene expression.

Nucleic acid sequences according to the invention can be cloned together with the sequences coding for interacting or for potentially interacting proteins into a single vector and then expressed in vitro in a host cell or in vivo in a host organism. Alternatively, each of the potentially interacting nucleic acid sequences and the sequences coding for 15B3, 15B3-1 or 15B3-2 can each be brought into a single vector and these separated into the respective organism using customary methods, such as, for example, transformation, transfection, transduction, Electroporation or particle gun can be spent.

In a further advantageous embodiment, at least one marker gene (for example antibiotic resistance genes and / or genes which code for a fluorescent protein, in particular GFP), can be contained in an expression vector according to the invention, in particular a complete vector construct.

The present invention further relates to host cells which have been transformed with a DNA sequence according to the invention and / or an expression vector according to the invention, in particular a vector construct (claim 6). In principle, all cells are suitable as host cells that allow expression of DNA sequences according to the invention alone or in combination with other sequences, in particular regulatory sequences. All cells of a pro- or eukaryotic nature can be considered as host cells, for example bacteria, fungi, yeasts, plant or animal cells. Preferred host cells are bacteria such as Escherichia coli, Streptomyces, Bacillus or Pseudomonas, eukaryotic microorganisms such as Aspergillus or Saccharomyces cerevisiae or the usual baker's yeast (Stinchcomb et al., Nature, 282: 39, (1997)).

In a preferred embodiment, however, cells from multicellular organisms are selected for the expression of DNA sequences according to the invention. This also happens against the background of a possibly required glycosylation (N- and / or O-coupled) of the encoded proteins. This function can be carried out in a suitable manner in higher eukaryotic cells - in comparison to prokaryotic cells. In principle, any higher eukaryotic cell culture is available as a host cell, although cells from mammals, for example monkeys, rats, hamsters or humans, are very particularly preferred. A large number of established cell lines are known to the person skilled in the art. In a by no means exhaustive list named the following cell lines: 293T (embryonic kidney cell line), (Graham et al., J. Gen. Virol., 36:59 (1997)), BHK (baby hamster kidney cells), CHO (cells from the hamster ovaries), (Urlaub and Chasin, PNAS (USA) 77: 4216, (1980)), HeLa (human cervical carcinoma cells) and further cell lines, such as HEK293, Sf9 or COS cells, which have been established especially for laboratory use. Human cells, in particular cells of the immune system or adult stem cells, for example stem cells of the blood-forming system (from the bone marrow) are very particularly preferred (claim 7). Human transformed cells according to the invention, in particular autologous cells of the patient, are suitable after (above all ex vivo) transformation with DNA sequences according to the invention or expression vectors according to the invention, very particularly as a medicament for, for example, gene therapy purposes, that is to say after cell removal, possibly ex vivo Expansion, transformation, selection and final retransplantation.

The combination of a host cell and an expression vector according to the invention which matches the host cells, such as plasmids, viruses or phages, such as plasmids with the RNA polymerase / promoter system, the phages 1, Mu or other tempered phages or transposons, and / or further advantageous regulatory sequences form a host cell according to the invention which can serve as an expression system. Preferred expression systems according to the invention based on host cells according to the invention are, for example, the combination of mammalian cells, such as, for example, CHO cells, and vectors, such as, for example, pcDNA3neo vector, or, for example, HEK293 cells and CMV vector, which are particularly suitable for mammalian cells.

Another aspect of the present invention are the gene products of the DNA sequences according to the invention (claim 8). U.N- For the purposes of this invention, gene products are understood to mean both primary transcripts, that is to say RNA, preferably mRNA, and proteins or polypeptides, in particular in purified form (claim 9). According to the invention, these proteins have at least one LRR sequence, preferably at least 5, more preferably at least 8 and most preferably 10 or even more than

10 LRR sequences and regulate or transport in particular apoptotic or necrotic, possibly also inflammatory signals or signals which concern cell growth or cell plasticity. Typically, they are directly or indirectly involved in signal transduction via the Ras cascade. A purified gene product is preferred if it contains at least one of the amino acid sequences given in FIG. 4 (and also contained in FIGS. 9, 11 and 13 (for an LRR domain), or a function-homologous or function-inhibiting (infunctional) allele "Contains a fragment, analog or derivative of this sequence or typically consists of such an amino acid sequence. Functional homology is defined in the sense of the present invention in such a way that at least one of the essential functional properties of those according to FIG.

Proteins 15B3, 15B3-1 or 15B3-2 shown in FIG. 11 or 13 are retained. Typically, functionally homologous proteins according to the invention will in particular have a characteristic, for example at least 60%, preferably at least 80% sequence identity in the sequence sections designated as leucine-rich regions (LRRs), which represent protein interaction domains and typically 20-28 amino acids with a specific core consensus. Sequence of leucines and asparagines (LXXLXLXXN) have. A functionally homologous allele, derivative or analog of the amino acid sequences disclosed in FIGS. 9, 11 or 13 is typically at least four, preferably at least at least 6 and even more preferably have at least 8 LRRs with the aforementioned consensus sequences.

A derivative is understood to mean, in particular, those AS sequences which have been modified by modifications to their side chains. For example. by conjugation of an antibody, enzyme or receptor to an AS sequence according to the invention. Derivatives can also be the coupling of a sugar or fatty (acid) residue or a phosphate group or any modification of a side chain, in particular a free OH group or NH2 group or at the N or C terminus. In addition, the term "derivative" also includes fusion proteins in which an amino acid sequence according to the invention is coupled to any oligo- or polypeptides.

Sequences that are characterized by at least one AS change compared to the native sequence (insertion, substitution) are referred to as "analogs". In the context of the present invention, such conservative substitutions are preferred in which the physicochemical character (space filling, basicity, hydrophobicity, etc.) of the exchanged AS is retained (polar AS, long aliphatic chain, short aliphatic chain, negatively or positively charged AS, AS with aromatic group). The substitutions can be biologically functional, some. Functional or bio-functional sequences result. For example, arginine residues can be exchanged for lysine residues, valine residues for isoleucine residues or aspartic acid residues for glutamic acid residues. However, one or more amino acids can also be interchanged, added or removed in their order, or several of these measures can be combined with one another. The proteins modified in this way compared to the ones in FIG. 9, 11 or 13 typically have at least 60%, preferably at least 70% and particularly preferably at least 90% sequence identity to the sequences in the aforementioned figures, calculated according to the algorithm of Altschul et al. (J. Mol. Biol., 215, 403-410, 1990). The isolated protein and its functional variants can advantageously be isolated from the brain of mammals such as Homo sapiens, Rattus norvegicus or Mus musculus. Homologs from other mammals are also to be understood as functional variants.

Analogs are preferred according to the invention if the secondary structure as occurs in the native sequence is also retained in them. In addition to conservative substitutions, less conservative AS variations can also be introduced into the native sequence according to the invention. They typically retain their biological function, in particular as a transducer of an apoptotic or necrotic, cell proliferative, growth-indicating or regenerative signal. The effect of a substitution or deletion can easily be checked by appropriate investigations, for example binding assays or cytotoxic tests.

Nevertheless, according to the invention, sequences are also included which produce a so-called dominant-negative effect, ie, due to their changed primary sequence, still have binding activity to a sequence upstream in the cascade, but cannot pass the signal downstream. Analogs of this type therefore function as inhibitors of biological function, in particular as inhibitors of apoptosis, cell growth, cell proliferation, cell plasticity or cell regeneration. Such analogs are produced by genetic engineering measures, typically by the so-called "site directed "mutagenesis of a DNA sequence which codes for a protein according to the invention (typically 15B3, 15B3-1 or 15B3-2). This produces the DNA sequence on which the analogue is based, which ultimately contains the protein in a recombinant cell culture (Sambrook et al., 1989, see above). All derivatives of the above-described analogs are also disclosed, as is the DNA sequence on which the above-described AS sequences are based.

Furthermore, fragments of a native AS sequence according to the invention also form part of the subject matter of the present invention. Fragments are characterized by deletions (N- or C-terminal or also intrasequential). They can have a dominant-negative or dominant-positive effect.

The gene products (proteins) according to the invention also include all those gene products (proteins) which, according to the invention, are derived from DNA derivatives, DNA fragments or DNA alleles of the DNA sequences shown in FIGS. 8, 10 or 12 after transcription and translation ,

In addition, the proteins according to the invention can be chemically modified. For example, there may be a protecting group at the N-terminus. Glycosyl groups can be added to hydroxyl or amino groups, lipids can be covalently linked to the protein according to the invention, as can phosphates or acetyl groups and the like. Any chemical substances, compounds or groups can also be bound to the protein according to the invention by any synthetic route. Additional amino acids, for example in the form of individual amino acids or in the form of peptides or in the form of protein domains and the like, can also be used with the N- and / or C-terminus of a protein according to the invention, but in particular also at the N- or the C-terminus of a leucine-rich domain may be fused, but may also be integrated into the sequence of the leucine-rich domain according to the invention.

In particular, so-called signal or "leader" sequences at the N-terminus of the amino acid sequence of a protein according to the invention are preferred, which lead the peptide cotranslationally or post-translationally into a specific cell organelle or into the extracellular space (or the culture medium). Ren. Amino acid sequences can also be present at the N- or at the C-terminus, which allow the binding of the amino acid sequence according to the invention to antibodies as antigen. Particularly noteworthy here is the flag peptide, the sequence of which in the single-letter code of the amino acids is: DYKDDDDK. Or a His tag with at least 3, preferably at least 6, histidine residues. These sequences have strong antigenic properties and thus allow the recombinant protein to be checked and purified quickly. Monoclonal antibodies that bind the flag peptide are available from Eastman Kodak Co., Scientific Imaging Systems Division, New Haven, Connecticut.

The present invention furthermore relates to at least 20, more preferably at least 30 and even more preferably at least 50, amino acid segments of the sequences disclosed in FIGS. 9, 11 or 13. Such partial sequences can, for example, be chemically synthesized by methods familiar to the person skilled in the art and can preferably be used as antigens for the production of antibodies. These subsections are preferably regions of the sequences disclosed in FIGS. 9, 11 or 13 that at least partially make up the protein surface in the spatial model of the proteins. Transgenic animals are a further subject of the present invention (claim 11). The transgenic animals according to the invention are animals which have been genetically modified in such a way that they express or contain an amount of a gene product according to the invention which is modified in comparison to the normal animal in at least one tissue. Here, according to the invention, those animals are also included that either tw. or completely no longer have, or (b) indeed have sequences according to the invention at the genetic level, but cannot transcribe and / or translate them and therefore no longer contain the gene product. In addition, in a transgenic animal, the native 15B3 sequence (s), 15B3-1 or 15B3-2 sequence (s) (whether present or not present) can be supplemented by at least one DNA sequence according to the invention at least one DNA sequence according to the invention may be substituted. In particular, the substituted and / or supplemented sequence (s) can be sequences according to the invention which are non-native in nature.

The production of transgenic and “knock-out” animals, in particular mice, rats, pigs, fruit flies or zebra fish, with respect to the sequences according to the invention, is carried out in a manner familiar to the person skilled in the art. For this purpose, for example, a 15B3, 15B3-1 or 15B3-2 cDNA sequence or native or non-native variant expressed in transgenic mice, eg under an NSE promoter in neurons, under an MBP promoter in oligodendrocytes etc. The genetically modified animals can then be examined in different disease models (eg experimentally induced stroke, MCAO ) The production of "knock-out" animals can also provide clues on the effects of inhibitors on the whole organism, since a "knock out model" corresponds in this respect to the inhibition of native sequences according to the invention.

According to the invention, all multicellular organisms can be transgenic, in particular mammals, for example mice, rats, sheep, cattle or pigs. In principle, transgenic plants are also conceivable. The transgenic organisms can also be so-called "knock-out" animals. The transgenic animals can contain a functional or non-functional nucleic acid sequence according to the invention or a functional or non-functional nucleic acid construct alone or in combination with a functional or non-functional sequence which codes for 15B3 proteins.

A further embodiment of the transgenic animals described above are transgenic animals, in their germ cells or all or part of the somatic cells or in their germ cells or all or part of the somatic cells the native 15B3 nucleotide sequence (s) have been modified by genetic engineering or interrupted by the insertion of DNA elements. A further possibility of using a nucleotide sequence according to the invention or parts thereof is the generation of transgenic or knock-out or conditional or region-specific knock-out animals or specific mutations in genetically modified animals (Ausubel et al. (Eds.) 1998, Current Protocols in Molecular Biology, John Wiley & Sons, New York and Torres et al., (Eds.) 1997, Laboratory protocols for conditional gene targeting, Oxford University Press, Oxford). Via transgenic overexpression or genetic mutation (zero mutation or specific deletions, insertions or changes) by homologous recombination in embryonic stem cells, animal models can be generated which provide valuable further information about the (patho-) physiology of the sequences according to the invention. Animal models produced in this way can represent essential test systems for evaluating novel therapeutic agents which influence the biological function of proteins according to FIGS. 9, 11 or 13 for neural, vascular or other processes.

The present invention furthermore relates to an antibody which recognizes an epitope on a gene product according to the invention, in particular a protein according to the invention according to FIGS. 9, 11 or 13 or derivatives, fragments or isoforms or alleles (claim 12), but also against, for example , mRNA according to the invention can be directed. In the sense of the present invention, the term “antibody” encompasses both polyclonal antibodies and monoclonal antibodies (claim 13), chimeric antibodies, anti-idiotypic antibodies (directed against antibodies according to the invention), all of which are present in bound or soluble form and, if appropriate, by "Label" can be marked, as well as fragments of the aforementioned antibodies. In addition to the fragments of antibodies according to the invention in isolation, antibodies according to the invention can also occur in recombinant form as fusion proteins with other (protein) components. Fragments as such or fragments of antibodies according to the invention as components of fusion proteins are typically produced by the methods of enzymatic cleavage, protein synthesis or the recombination methods familiar to the person skilled in the art. As antibodies according to the present invention thus both polyclonal, monoclonal, human or humanized or recombinant antibodies or fragments thereof, single chain antibodies or synthetic antibodies.

The polyclonal antibodies are heterogeneous mixtures of antibody molecules which are produced from sera from animals which have been immunized with an antigen. However, the subject of the invention also includes polyclonal monospecific antibodies which are obtained after the antibodies have been purified (for example via a column which is loaded with peptides of a specific epitope). A monoclonal antibody contains an essentially homogeneous population of antibodies which are specifically directed against antigens, the antibodies having essentially the same epitope binding sites. Monoclonal antibodies can be obtained by methods known in the art (e.g., Koehler and Milstein, Nature, 256, 495-397, (1975); U.S. Patent 4,376,110; Ausübel et al., Harlow and Lane "Antibodies" : Laboratory Manual, Cold Spring, Harbor Laboratory (1988); Ausubel et al., (Eds), 1998, Current Protocols in Molecular Biology, John Wiley & Sons, New York).). The description contained in the abovementioned references is included as part of the present invention in the disclosure of the present invention.

Antibodies according to the invention which have been genetically engineered can also be produced by methods as described in the aforementioned publications. In short, antibody-producing cells are attracted to this and the mRNA, provided the optical density of the cells is sufficient, is lysed with guanidinium thiocyanate, acidified with sodium acetate, extracted with phenol, chloroform / isoamyl alcohol, precipitated with isopropyl alcohol. panol and washing with ethanol isolated from the cells in a known manner. Then the reverse transcriptase is used to synthesize cDNA from the mRNA. The synthesized cDNA can be inserted directly or after genetic manipulation, for example by "site directed mutagenesis", introduction of insertions, inversions, deletions or base exchanges into suitable animal, fungal, bacterial or viral vectors and expressed in the corresponding host organisms. Bacterial or yeast vectors such as pBR322, pUC18 / 19, pACYC184, lambda or yeast mu vectors for cloning the genes and expression in bacteria such as E. coli or in yeast such as Saccharomyces cerevisiae are preferred. Specific antibodies against the proteins according to the invention can be suitable both as diagnostic reagents and as therapeutic agents for diseases in which 15B3 is of pathophysiological importance.

Antibodies according to the invention can belong to one of the following immunoglobulin classes: IgG, IgM, IgE, IgA, GILD and possibly a subclass of the abovementioned classes, such as the subclasses of the IgG or mixtures thereof. IgG and its subclasses such as IgGl, IgG2, IgG2a, IgG2b, IgG3 or IgGM are preferred. The IgG subtypes IgGl / k or IgG2b / k are particularly preferred. A hybridoma cell clone that produces monoclonal antibodies according to the invention can be cultivated in vitro, in situ or in vivo. Large titers of monoclonal antibodies are preferably produced in vivo or in situ.

The chimeric antibodies according to the invention are molecules which contain different constituents, which are derived from different animal species (e.g.

Antibodies that have a variable region derived from a mouse monoclonal antibody is derived, and have a constant region of a human immunoglobulin). Chimeric antibodies are preferably used, on the one hand, to reduce the immunogenicity in use and, on the other hand, to increase the yields in production, for example murine monoclonal antibodies give higher yields from hybrid cell lines, but also lead to higher immunogenicity in humans , so that human / murine chimeric antibodies are preferably used. Chimeric antibodies and methods for their preparation are known from the prior art (Cabilly et al., Proc. Natl. Sei. USA 81: 3273-3277 (1984); Morrison et al. Proc. Natl. Acad. Sei USA 81: 6851-6855 (1984); Boulianne et al. Nature 312 643-646 (1984); Cabilly et al., EP-A-125023; Neuberger et al., Nature 314: 268-270 (1985); Taniguchi et al. , EP-A-171496; Morrion et al., EP-A-173494; Neuberger et al., WO 86/01533; Kudo et al., EP-A-184187; Sahagan et al., J. Immuno1. 137: 1066-1074

(1986); Robinson et al., WO 87/02671; Liu et al., Proc. Natl.

Acad. Sci USA 84: 3439-3443 (1987); Sun et al., Proc. Natl. Acad. Be USA 84: 214218 (1987); Better et al., Science 240: 1041-1043 (1988) and Harlow and Lane, Antibodies: A Laboratory Manual, as cited above. These citations are included as part of the disclosure in the present invention.

Such an antibody according to the invention against a leucine-rich sequence section on a protein according to FIGS. 9, 11 or 13 is very particularly preferably directed as an epitope (claim 14).

An anti-idiotypic antibody of the present invention is an antibody which is a determinant generally related to that

Antigen binding site of an antibody according to the invention as is sociated, recognizes. An anti-idiotypic antibody can be produced by immunizing an animal of the same type and the same genetic type (for example a mouse strain) as the starting point for a monoclonal antibody against which an anti-idiotypic antibody according to the invention is directed. The immunized animal will recognize the idiotypical determinants of the immunizing antibody by the production of an antibody which is directed against the idiotypic determinants (namely an anti-idiotypisher antibody according to the invention) (US Pat. No. 4,699,880). An anti-idiotypic antibody according to the invention can also be used as an immunogen in order to elicit an immune response in another animal and to produce an anti-idiotypic antibody there. The epitope construction of the anti-anti-idiotypic antibody may, but need not, be identical to the original monoclonal antibody that caused the anti-idiotypic reaction. In this way, by using antibodies directed against idiotypic determinants of a monoclonal antibody, other clones which express antibodies of identical specificity can be identified.

Monoclonal antibodies, which are directed against proteins, analogs, fragments or derivatives of these proteins according to the invention, can be used to bind anti-idiotypic antibodies in corresponding animals, such as, for. B. the BALB / c mouse. Spleen cells from such an immunized mouse can be used to produce anti-idiotypic hybridoma cell lines that secrete anti-idiotypic monoclonal antibodies. Anti-idiotypic monoclonal antibodies can also be coupled to a carrier (KLH, "keyhole lim- pet hemocyanin ") and can then be used to immunize further BALB / c mice. The sera of these mice then contain anti-anti-idiotypic antibodies which have the binding properties of the original monoclonal antibodies and are specific for an epitope of the protein according to the invention or one The anti-idiotypic monoclonal antibodies thus have their own idiotypic epitopes or "idiotopes" which are structurally similar to the epitope under investigation.

The term "antibody" is intended to include both intact molecules and fragments thereof. Fragments are all shortened or modified antibody fragments with one or two binding sites complementary to the antigen, such as antibody parts with a binding site formed by the light and heavy chain corresponding to the antibody, such as Fv, Fab or F (ab ') 2 fragments or single-strand fragments, called. Shortened double-strand fragments such as Fv, Fab or F (ab ') 2 are preferred. Fab and F (ab ') ₂ fragments lack an Fc fragment, such as present in an intact antibody, so that they can be transported faster in the bloodstream and have comparatively less non-specific tissue binding than intact antibodies. It is emphasized here that Fab and F (ab ') ₂ fragments of antibodies according to the invention can be used in the detection and quantification of proteins according to the invention. Such fragments are typically made by proteolytic cleavage using enzymes such as. B. papain (for the production of Fab fragments) or pepsin (for the production of F (ab ') ₂ , fragments) can be used, or can be obtained by chemical oxidation or by genetic engineering manipulation of the antibody genes. The present invention also relates to mixtures of antibodies for the purposes of the present invention. In addition to the antibodies, mixtures of antibodies can also be used for all of the methods or uses described according to the present invention. Both purified fractions of monoclonal antibodies, polyclonal antibodies or mixtures of monoclonal antibodies are used as medicaments and are used in the production of medicaments for the treatment of cerebral ischemia (eg stroke), degenerative diseases, in particular newly-regenerative diseases, and neurological diseases, such as, for example Epilepsy, as well as tumor diseases.

Antibodies according to the invention, including the fragments of these antibodies, or mixtures thereof, can be used in a sample for the quantitative or qualitative detection of a gene product according to the invention, in particular proteins according to FIGS. 9, 11 or 13 or their fragments or derivatives, or also for detection of cells that express and, if necessary, secrete proteins according to the invention. In this respect, the use of antibodies according to the invention as diagnostic agents is disclosed. For example, the amount of gene product according to the invention and possibly. the activity (e.g. specific phosphorylation) of the proteins is determined according to FIGS. 9, 11 or 13. The detection can be achieved with the aid of immunofluorescence methods, the fluorescence-labeled antibodies in combination with light microscopy, flow cytometry or fluorometric detection.

Antibodies according to the invention in the sense of the invention (this includes fragments of these antibodies or mixtures of antibodies) are suitable for histological examinations. gene, such as in the context of immunofluorescence or immunoelectromicroscopy, for the in situ detection of a protein according to the invention. The in situ detection can take place in that a histological sample is taken from a patient and labeled antibodies according to the invention are added to such a sample. The antibody (or a fragment of this antibody) is applied to the biological sample in labeled form. In this way it is not only possible to determine the presence of protein according to the invention in the sample, but also the distribution of the protein according to the invention in the tissue examined. The biological sample can be a biological fluid, a tissue extract, harvested cells, such as. B. immune cells or cardiac muscle or liver cells, or generally cells that have been incubated in a tissue culture. Depending on the type of labeling, the labeled antibody can be detected by methods known in the art (eg by fluorescence methods). The biological sample can also on a solid phase support, such as. B. nitrocellulose or another carrier material, so that the cells, cell parts or soluble proteins are immobilized. The carrier can then be washed one or more times with a suitable buffer, with subsequent treatment with a detectably labeled antibody according to the present invention. The solid phase support can then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on the solid phase support can then be determined using a conventional method.

Glass, polystyrene, polypropylene, polyethylene, dextran, nylon amylases, natural or modified celluloses, polyacrylamides and magnetite are particularly suitable carriers. The carrier can be of either partially soluble or insoluble character to meet the conditions of the present invention. The carrier material can take any shape, e.g. B. in the form of beads, or cylindrical or spherical, with polystyrene beads are preferred as a carrier.

Detectable antibody labeling can be done in different ways. For example, the antibody can be bound to an enzyme, the enzyme finally being used in an immunoassay (EIA). The enzyme can then react later with a corresponding substrate, so that a chemical compound is formed which can be detected in a manner familiar to the person skilled in the art and, if necessary, quantified, e.g. B. by spectrophotometry, fluorometry or the other optical method. The enzyme can be malate dehydrogenase, staphylococcal nuclease, delta-5 steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triosephosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparticase, glucose oxydase, -Galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase or acetylcholinesterase. The detection is then enabled via a chromogenic substrate that is specific for the enzyme used for the labeling and can finally be e.g. by visual comparison of the substrate converted by the enzyme reaction compared to control standards.

Furthermore, the detection can be ensured by other immunoassays, for example by radioactive labeling of the antibodies or antibody fragments (that is to say by means of a radioimmunoassay (RIA; Laboratory Techniques and Biochemistry in Molecular Biology, Work, T. et al. North Holland Publishing Company, New York (1978). The radioactive isotope can be detected and quantified using scintillation counters or auto-radigraphy.

Fluorescent compounds can also be used for labeling, for example compounds such as fluororescin isothiocyanate, rhodamine, phyoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine. Also fluorescent-emitting metals, such as. B. ¹⁵² E or other metals from the lanthanide group can be used. These metals are attached to the antibody via chelate groups, such as. B. Diethylenetriaminepentaacetic acid (ETPA) or EDTA coupled. Furthermore, the antibody according to the invention can be coupled via a compound which acts with the aid of chemiluminescence. The presence of the chemiluminescence-labeled antibody is then detected via the luminescence which arises in the course of a chemical reaction. Examples of such compounds are luminol, isoluminol, acridinium ester, imidazole, acridinium salt or oxalate ester. Similarly, bioluminescent compounds can also be used. Bioluminescence is a subspecies of chemiluminescence found in biological systems, where a catalytic protein increases the efficiency of the chemiluminescent reaction. The detection of the bioluminescent protein is again carried out via luminescence, with luciferin, luciferase or “aequorin” being considered as the bioluminescent compound.

An antibody according to the invention can be used for use in an immunometric assay, also known as a "two-site" or "sandwich" assay. Typical immunometric assay systems include so-called "forward" assays, which are distinguished by the fact that body are bound to a solid phase system and that the antibody is brought into contact with the sample being examined in this way. In this way, the antigen is isolated from the sample by the formation of a binary solid phase-antibody-antigen complex from the sample. After an appropriate incubation period, the solid support is washed to remove the remainder of the liquid sample, including any unbound antigen, and then contacted with a solution containing an unknown amount of the labeled detection antibody. The labeled antibody serves as a so-called reporter molecule. After a second incubation period that allows the labeled antibody to associate with the antigen bound to the solid phase, the solid phase support is washed again to remove unreacted labeled antibodies.

In an alternative form of assay, a so-called "sandwich" assay can also be used. A single incubation step can be sufficient if the antibody bound to the solid phase and the labeled antibody are both applied to the sample to be tested at the same time. After the incubation is complete, the solid phase support is washed to remove residues of the liquid sample and the non-associated labeled antibodies. The presence of labeled antibody on the solid phase support is determined in the same way as in the conventional "forward" sandwich assay. In the so-called reverse assay, a solution of the labeled antibody is first gradually added to the liquid sample, followed by the addition of unlabeled antibody, bound to a solid phase support, after a suitable incubation time has elapsed. After a second incubation step, the solid phase support becomes conventional washed to remove sample residues and labeled antibody that has not responded. The determination of the labeled antibody which has reacted with the solid phase support is then carried out as described above.

According to the present invention, methods for the expression of gene products according to the invention, in particular thus of polypeptides according to FIGS. 9, 11 or 13, including all derivatives, analogs and fragments, are further disclosed, for which host cells are transformed with an expression vector according to the invention (claim 15). This method for the expression of gene products which are based on a DNA sequence according to the invention does not serve to concentrate and purify the corresponding gene product, but rather to improve the cell metabolism by introducing the DNA sequences according to the invention via the expression of the associated gene product to influence. Here, in particular, the use of the host cells transformed with the aid of expression vectors as a medicament or for the production of a medicament, in particular for the purpose of treating diseases, for example tumor diseases, neurological diseases, neurodegenerative diseases (for example multiple sclerosis, Parkinson's disease), cerebral ischemia (e.g. stroke). In general, host cells according to the invention are made available in the case of diseases which are based on incorrect regulation of apoptosis, necrosis, cell proliferation, cell growth or cell plasticity. The autologous or allogeneic host cells transformed in this way ex vivo according to the invention can then be transplanted to patients.

According to a further aspect of the present invention, a method for isolating gene products with at least a partial sequence which is homologous with the amino acid sequence of 15B3, 15B3-1 or 15B3-2 according to the invention, at least over a partial sequence of at least 20, preferably at least 30 AS, the host cells being transformed with an expression vector according to the invention and then cultivated under suitable conditions which promote expression are so that the gene product can finally be purified from the culture (claim 16). The gene product according to the invention of the DNA sequence according to the invention can, depending on the expression system, be isolated from a culture medium or from cell extracts. The person skilled in the art can readily recognize that the respective isolation methods and the method for the purification of the recombinant protein encoded by a DNA according to the invention strongly depend on the type of the host cell or also on the fact whether the protein is secreted into the medium. For example, expression systems can be used which lead to the secretion of the recombinant protein from the host cell. In this case, the culture medium must be concentrated using commercially available protein concentration filters, for example Amicon or Millipore Pelicon. After the concentration step, a purification step can be carried out, for example a gel filtration step or a purification using column chromatography methods. Alternatively, however, an anion exchanger can be used which has a matrix with DEAE.

All materials known from protein purification, such as acrylamide or agarose or dextran or the like, serve as the matrix. However, a cation exchanger can also be used, which then typically contains carboxymethyl groups. HPLC steps can then be used to further purify a polypeptide encoded by a DNA according to the invention. It can be one or more Act steps. In particular, the "reversed phase" method is used. These steps serve to obtain an essentially homogeneous recombinant protein of a DNA sequence according to the invention.

In addition to bacterial cell cultures for isolating the gene product, transformed yeast cells can also be used. In this case, the translated protein can be secreted, so that protein purification is simplified. Secreted recombinant protein from a yeast host cell can be obtained by methods as described in Urdal et al. (J. Chromato. 296: 171 (1994)) and form part of the disclosure of the present invention.

Nucleic acid sequences according to the invention, in particular DNA sequences according to the invention, and / or gene products according to the invention can be used as medicaments or for the production of a medicament (claim 17). These can be administered as such (for example buccally, intravenously, orally, parenterally, nasally, subcutaneously) or in combination with other active ingredients, auxiliaries or additives typical of drugs. Nucleic acid according to the invention can be injected as naked nucleic acid, in particular intravenously, or can be administered to the patient using vectors. These vectors can be plasmids as such, but also viral vectors, in particular retroviral or adenoviral vectors, or also liposomes which can have naked DNA according to the invention or a plasmid which contains DNA according to the invention.

The use of sequences according to the invention, in particular the nucleotide or amino acid sequences of 15B3, 15B3-1 or 15B3-2 or their variants, and protein proteins according to the invention Heteromeric and reagents according to the invention derived therefrom (oligonucleotides, antibodies, peptides) are thus suitable for the production of a medicament for therapeutic purposes, ie for the treatment of diseases. The therapeutic use for the treatment or for the manufacture of a medicament for the treatment of diseases or pathophysiological conditions, which are based, for example, on incorrectly controlled regulation of the homeostasis of cell death and proliferation events, is very particularly preferred (claim 18). Through the use according to the invention, cell death processes, for example cascades which lead to apoptosis or processes which lead to necrosis, can be expressed in all cell types which express 15B3, 15B3-1 and / or 15B3-2 and or a native variant thereof, in particular in neural ones Cells are influenced, for example by modulating cell-cell interactions.

The native proteins 15B3, 15B3-1 and 15B3-2 according to the invention are, according to the invention, part of the ras-MAPK signal transduction pathway, typically as a modulator thereof, the faulty control of which is the cause of a large number of diseases. In this respect, the aforementioned proteins according to the invention are found in particular as components in the following cellular processes and have cellular functions in: signal transduction, cell differentiation, growth, plasticity, regeneration. Accordingly, by Infunktionalität of a protein according to the invention, for example. 1563 _^ or by infunktionelle expression or overexpression thereof a pathophysiological state are triggered which, for example with a dysregulation. Of cell differentiation, cell growth, cell plasticity or cell regeneration associated. Depending on the molecular mechanism of the pathophysiological disorder, the administration of functional protein according to the invention or at least a higher expression of the same or an inhibition of the cellularly overexpressed or the expressed infunctional protein may be desired. The use of 15B3, 15B3-1 and / or 15B3-2 is very particularly preferred in connection with their function in neuronal cell death, excitation and neurogenesis. In particular, the pathophysiology of cerebral ischemia is associated with an increased transcription of 15B3 according to the invention, which is why its use for the treatment of this pathophysiology is very particularly preferred. From these findings according to the invention, the use of sequences according to the invention (nucleotide and amino acid sequences) and corresponding derivatives (for example peptides, oligos or antibodies) for the production of a medicament for the treatment of tumor diseases and neurological diseases, in particular ischemic conditions (stroke), results. , multiple sclerosis, neurodegenerative diseases, such as, for example, Parkinson's disease, amyotrophic lateral sclerosis, heredodegenerative ataxias, neuropathies, Huntington's disease, epilepsy and Alzheimer's disease, viral infectious diseases, for example hepatitis infections (claim 19).

Another object of the present invention is related to the therapeutic use of sequences according to the invention, namely the use of a nucleic acid sequence or protein sequence according to the invention, in particular the nucleotide sequence or amino acid sequence of protein 15B3, 15B3-1 or 15B3-2 or a variant - as defined above - Of these, in particular a fragment, for gene therapy in mammals, for example in humans, or also such gene therapy processes. Gene therapy encompasses all forms of therapy which either introduce sequences according to the invention according to one of claims 1 to 4 into the body or parts thereof, for example individual tissues, or the expression of invented affect sequences according to the invention. For this purpose, all modifications familiar to the person skilled in the art can be used in the context of gene therapy, for example oligonucleotides, for example antisense or hybrid RNA-DNA oligonucleotides, with any modifications which contain sequences according to the invention. Viral constructs containing a sequence according to the invention (this includes all variants, such as fragments, isoforms, alleles, derivatives) can also be used. Corresponding naked DNA sequences according to the invention are also considered in the context of gene therapy. Nucleic acid pieces with enzymatic activity (eg ribozymes) can also be used for gene therapy purposes.

In addition to therapeutic applications, diagnostic uses of nucleic acids or polypeptides according to the invention, protein heteromers according to the invention and reagents according to the invention (oligonucleotides, antibodies, peptides) derived therefrom are also possible, for example for the diagnosis of human diseases or of genetic predispositions, for example. also in the context of pregnancy examinations. These diseases or predispositions are, in particular, those mentioned above in connection with therapeutic applications. These diagnostic methods can be designed as in vivo, but typically ex vivo methods. Ex vivo will serve a typical application of a diagnostic method according to the invention for the qualitative and / or quantitative detection of a nucleic acid according to the invention in a biological sample. Such a method preferably comprises the following steps: (a) incubation of a biological sample with a known amount of nucleic acid according to the invention or a known amount of oligonucleotides which are suitable as primers for an amplification of the nucleic acid according to the invention, (b) after the nucleic acid according to the invention by specific hybridization or PCR amplification, (c) comparison of the amount of hybridizing nucleic acid or of nucleic acid obtained by PCR amplification with a quantity standard.

The invention also relates to a method for the qualitative and / or quantitative detection of a protein heteromer or a protein according to the invention in a biological sample, which comprises the following steps: (a) Incubation of a biological sample with an antibody which is specific to the protein heteromer or to the invention Protein / polypeptide is directed, (b) detection of the antibody / antigen complex, (c) comparison of the amounts of the antibody / antigen complex with a quantity standard. As a standard, a biological sample is usually taken from a healthy organism. In particular for diagnostic purposes, the property of the 15B3, 15B3-1 and / or 15B3-2 gene can be used here, that after characteristic pathophysiological stimuli, such as e.g. cerebral ischemia, the mRNA amount of 15B3, 15B3-1 and / or 15B3-2 in

Cells change, e.g. increases. In this way, according to the invention, e.g. a course assessment (prognosis) of changes in expression rates according to the invention

^• Proteins of associated diseases (such as stroke), the assessment of therapeutic success, the grading of a disease. Finally, the treatment according to the invention can be used to monitor the treatment of the diseases mentioned above.

Sequences according to the invention can be used in methods for determining polymorphisms thereof, for example in humans. The polymorphisms of sequences according to the invention which are determined in this way are not only subject to the disclosure of the present gene invention, but can also be used as a prognostic marker for the diagnosis or for the diagnosis of a predisposition to diseases which are associated with a sequence by means of infunctional expression according to the invention, by expression of sequence sequences according to the invention and / or their overexpression. In addition, sequences according to the invention permit research into human hereditary diseases, both monogenic and polygenic diseases.

In addition to therapeutic and / or diagnostic uses in the field of human and / or veterinary medicine, the use of nucleic acids or polypeptides according to the invention is also suitable for scientific use. In particular, the sequences according to the invention allow, in a manner known to the person skilled in the art, for example to identify sequences related to single or multi-cell organisms via cDNA libraries or to localize sequences related to the human genome. The nucleotide sequences according to the invention, in particular the sequences of 15B3, 15B3-1 and / or 15B3-2, can thus be used to generate genes for mRNAs which code for these nucleic acids or their functional equivalents, homologs or derivatives, for example in murine and in to isolate, map and correlate the human genome with common methods using homology screening and markers for human hereditary diseases. This enables the gene to be identified as the cause of certain hereditary diseases, which considerably simplifies their diagnosis and enables new therapeutic approaches.

With the help of nucleic acids according to the invention, hereditary diseases can be diagnosed, which is why they are used as markers. For example. there will be a correlation of the chromosomal locus of protein 15B3 in humans (chromosome 9) result in certain hereditary diseases, from which a diagnostic method according to the invention for hereditary diseases arises. The same applies to the proteins according to the invention.

In particular, a test system is disclosed according to the invention for scientific use, which is based on amino acid and / or nucleotide sequences according to the invention. In this context, the cDNA, the genomic DNA, the regulatory elements of the nucleic acid sequences according to the invention, and also the polypeptide, as well as partial fragments thereof, can be used in recombinant or non-recombinant form to develop a test system. Such a test system according to the invention is particularly suitable for measuring the activity of the promoter or of the protein in the presence of the test substance. These are preferably simple measurement methods (colorimetric, luminometric, based on fluorescence or radioactive) which allow the rapid measurement of a large number of test substances (Böhm, Klebe, Kubinyi, 1996, active ingredient design, Spektrum-Verlag, Heidelberg). The test systems described allow chemical libraries to be searched for substances which have inhibitory or activating effects on proteins according to the invention. The identification of such substances is the first step on the way to the identification of new drugs that specifically affect 15B3, 15B3-1 or 15B3-2-associated signal transduction. In particular, simple test systems are conceivable that use the activity of the LLR domain from 15B3, 15B3-1 or 15B3-2.

An inhibition of the biological activity of protein according to the invention, in particular of proteins according to FIGS. 9, 11 or 13, typically the biological activity in combination. Connection with apoptosis, as is desired, for example, in the case of stroke, septic shock, GvHD, degenerative diseases, in particular neurodegenerative diseases, acute hepatitis or other indications disclosed herein, can also be achieved by the fact that oligonucleotides which code for an antisense strand of the native sequences of the proteins 15B3, 15B3-1 or 15B3-2 or another native protein with a domain rich in leucine, to be introduced into the affected cells. This blocks the translation of the native mRNA of, for example, 15B3 or 15B3-1 or 15B3-2 in the appropriately transformed cells, which, as a result, preferably increases the survivability of the transfected cell or has a modulating effect on cell growth, cell plasticity, cell proliferation. In this case too, the method described above can be used with the aid of recombinant viruses.

The possibly pathologically increased cell apoptosis or cell proliferation in the case of diseases which are based on a corresponding incorrect control of sequences according to the invention (for example in the aforementioned indications) can also be treated by ribozyme methods. For this purpose ribozymes are used which can cut a target mRNA. In the present case, ribozymes are therefore disclosed and represent an object of the present invention which can cleave native 15B3 (or 15B3-1 or -15B3-2) mRNA or the mRNA of proteins containing domains rich in leucine. Ribozymes according to the invention must be able to interact with the target mRNA according to the invention, for example via base pairing, and then cleave the mRNA in order to block the translation of 15B3, for example. The ribozymes according to the invention are introduced into the target cells via suitable vectors (in particular plasmids, modified animal viruses, in particular retroviruses), the vectors, in addition to possibly other sequences, having a cDNA sequence for a ribozyme according to the invention).

In addition to the abovementioned possibilities for modulating the biological function of gene products according to the invention, in particular the gene products according to FIGS. 9, 11 or 13, typically modulating the function of gene products according to the invention in apoptotic or necrotic or proliferative signal transduction, this is also possible with the aid of a further object of the present invention , A chemical compound according to the invention will in particular modulate the intracellular function of the proteins 15B3, 15B3-1 and / or 15B3-2, typically inhibit (claim 20) or influence the biological function at the level of the underlying DNA sequences according to the invention. Compounds according to the invention will typically bind specifically to a protein with an amino acid sequence according to FIGS. 9, 11 or 13 or to a nucleic acid sequence according to FIGS. 8, 10 or 12 and thereby a pharmacological, in particular neuroprotective or immunomodulating, anti-apoptotic or anti-proliferative Effect.

Chemical compounds are therefore disclosed according to the invention, preferably an organic chemical compound with a molecular weight of <5000, in particular <3000, in particular <1500, which is typically well tolerated physiologically and can preferably pass the blood-brain barrier 21). Possibly. it will be part of a composition with at least one further active ingredient and preferably auxiliaries and / or additives and can be used as a medicament. The organic molecule will be particularly preferred if the binding constant for the Binding to a protein according to the invention, in particular to the leucine-rich domain of a protein according to the invention, is at least 10 ⁷ mol ^-1 . The compound according to the invention will preferably be such that it can pass through the cell membrane, be it by diffusion or via (intra) membranous transport proteins (claim 22), if appropriate after appropriate modification, for example with a coupled AS sequence. Also preferred are those compounds which inhibit or enhance the interaction of 15B3 or 15B3-1 or 15B3-2 with binding partners, in particular for the transduction of an apoptotic or necrotic signal. In particular, such compounds occupy positions on the surface of proteins according to the invention or cause a local conformational change in the proteins according to the invention, so that the binding of a native binding partner to a protein according to the invention is prevented.

Structural analyzes of the protein according to the invention can be used to specifically find compounds according to the invention which have a specific binding affinity (rational drug design (Böhm, Klebe, Kubinyi, 1996, active ingredient design, Spektrum Verlag, Heidelberg)). Here, the structure or a partial structure, derivative, allele, isoform or part of one of one of the proteins shown in FIGS. 9, 11 or 13 is determined by means of NMR or X-ray crystallography methods or, if such a high-resolution structure is not available, with the help of structure prediction algorithms creates a structural model of a protein according to the invention, and uses this (s) to identify compounds with the support of molecular modeling programs for which a high affinity for the protein according to the invention can be predicted. These substances are then synthesized and tested in suitable test procedures for their binding capacity and their therapeutic usability.

In another preferred embodiment of the present invention, the compound according to the invention is an antibody, preferably an antibody directed against a protein according to the invention, for example 15B3, 15B3-1 or 15B3-2, or also against the underlying mRNA, which retransplanted ex vivo Host cells or by gene therapeutic in vivo methods is introduced into host cells and is not secreted there as "intrabody", but can exert its effect intracellularly. By means of such “intrabodies” according to the invention, the cells can be protected against a misdirected apoptotic reaction, for example by overexpression of a protein according to the invention. Such a procedure will typically be considered for cells of those tissues which show apoptotic behavior that is exaggerated in the patient's physiology, that is to say, for example, in cells of the pancreas, keratinocytes, connective tissue cells, immune cells, neurons or muscle cells. In addition to the antibodies or intrabodies, cells modified in this way with "intrabodies" according to the invention are also part of the present invention.

A compound according to the invention with the function of blocking the biological function of native 15B3, 15B3-1 or 15B3-2 according to FIGS. 9, 11 or 13 or corresponding native alleles or native splice variants, for example the apoptotic function, can be used as a medicament , All the aforementioned variants are included as compounds here, for example, organic chemical compounds, antibodies, anti-sense oligonucleotides, ribozymes. In particular, a compound according to the invention (for producing a nes drug) for the treatment of diseases for which at least tw. a pathological hyperapoptotic or hyper necrotic or inflammatory reaction is causal or symptomatic. An inhibitor according to the invention (for example an antibody with an inhibitory effect (in particular an intrabody), a ribozyme, anti-sense RNA, dominant-negative mutants or one of the aforementioned inhibitory organic chemical compounds) can inhibit the cellular function of a native protein 15B3, 15B3 according to the invention -1 or 15B3-2 or its native variants, for example the a-poptotic, necrotic or proliferative reaction, are used as medicaments and very particularly in the treatment of the following diseases or in the manufacture of a medicament for the treatment of the following diseases: tumor diseases , Autoimmune diseases, especially diabetes, psoriasis, multiple sclerosis, rheumatoid arthritis or asthma, viral infectious diseases (e.g. HIV), degenerative diseases, especially neurodegenerative diseases, e.g. Alzheimer's or Parkinson's disease, epilepsy or muscular dystrophies, GvHD (e.g., liver disease) , Kidney or Heart), ischemic infarction or acute hepatitis. The above-mentioned, for example, apoptosis-inhibiting substances according to the invention can also be part of a pharmaceutical composition which can contain further pharmaceutical excipients and / or additives in order to stabilize such compositions for therapeutic administration, for example to stabilize the biological availability and / or to improve pharmacodynamics.

The present invention furthermore relates to methods (“screening methods”) for identifying pharmaceutically active compounds, in particular with inhibitory properties with regard to triggering or Transmission of signals which are related to apoptotic reactions triggered by physiologically occurring sequences according to the invention (claim 23). Methods according to the invention provide that (a) cells with an expression vector according to claim 5, in particular an expression vector which codes for the polypeptide 15B3, 15B3-1 or 15B3-2, and optionally at least one expression vector which is for at least one reporter Gene are encoded, transfected, and (b) a parameter suitable for observing the 15B3-mediated function, for example apoptosis, in particular the activation of caspase-3 after addition of a test compound compared to the control without addition of a test compound for the (a) the host cell system obtained is measured. For this purpose, according to the method according to the invention, several parallel tests with increasing concentrations of the test substance are preferably carried out in order to be able to determine the ID ₅₀ value of the test substance in the case of pharmaceutical activity, for example the apoptosis-inhibiting effect.

In particular, in a preferred embodiment of the present invention, “high-throughput screening assays” (HTS) for identifying inhibitors of 15B3 are disclosed. The use of (all known) components of the ras signal transduction path in the context of the method according to the invention for identifying inhibitors, in particular for identifying small organic compounds, is very particularly preferred. Systems with the “Scintillation Proximity Assay” (SPA) are preferably available (Amersham Life Science, MAP kinase SPA (see McDonald et al., 1999, Anal Biochem, 268, 318-29)) describes an assay set-up for the Raf / MEK / ERK cascade that can identify inhibitors of the entire cascade. tion of the present invention. The MAP cascade is reconstituted in vitro, with the individual components as GST fusion proteins (E. coli expressed) or, in the case of cRAF1, with the baculovirus system (claim 25). The first element of the cascade (MAP-KKK) must be constantly activated in order to be able to reliably test inhibitors. Typically this is achieved by coexpression of src in the baculovirus system. This ensures a ras-analog activation of cRaf. After transfection of 15B3, 15B3-1, 15B3-2 or other variants according to the invention, a modulation of the cascade is brought about, which is used in order to be able to measure an influence on this modulation in an HTS by adding substances to be tested.

After identification of high-affinity, selective substances by the aforementioned method according to the invention, these are tested for their use as medicaments for epilepsy, stroke and other neurological, immunological or proliferative diseases (tumor diseases). In addition, the binding sites of the identified and pharmacologically active substances to the gene products according to the invention, in particular 15B3, 15B3-1 or 15B3-2, can be determined with the aid of the two-hybrid system or other assays, ie that those responsible for the interaction Amino acids are limited (claim 24). In this way, substances can also be found with which the interaction between polypeptides according to the invention and any native intracellular interaction partners thereof can be influenced, in particular inhibited. In this way, a method for finding substances with specific binding affinity for the protein according to the invention is disclosed according to the invention. Due to the pharmacological importance of 15B3, 15B3-1 and 15B3-2 or their native variants for numerous diseases, for example in neurodegenerative or proliferative diseases, pharmaceutically active substances identified according to the method according to the invention have a wide range of uses. In addition to the inhibition of an interaction with one or more other molecules, for example protein kinases located downstream in the signal transduction pathway, or adapters, in particular an influence on the transcription or the transcript amount of proteins according to the invention in the cell can also be the cause of pharmaceutical effectiveness. The suppression of the rapid up-regulation of transcripts of DNA sequences according to the invention after pathological processes by compounds according to the invention should be mentioned as examples, since 15B3, 15B3-1 and 15B3-2 are subject to very rapid regulation through transcriptional activation. A target for a pharmaceutically active compound is therefore preferably the regulation of transcription, for example by specific binding of the substances to a regulator region (for example promoter or enhancer sequences) of a gene product according to the invention, binding to one or more transcription factors of a gene product according to the invention (with the result of an activation or inhibition of the transcription factor) or a regulation of the expression (transcription or translation) of such a transcription factor itself.

In addition to the transcriptional regulation, ie regulation of the amount of mRNA of a gene according to the invention in the cell, a pharmaceutically active compound according to the invention can also intervene in other control processes of the cell which, for example, affect the expression rate of a protein according to the invention. can flow (eg translation, splicing processes, native derivatization of gene product according to the invention, for example phosphorylation, or regulation of the degradation of gene product according to the invention.

The present invention further relates to methods for identifying cellular interaction partners of polypeptides according to the invention, in particular the proteins 15B3, 15B3-1 or 15B3-2 or their natively occurring variants (isoforms, alleles, splice forms, fragments) (claim 27) , In this way, proteins can be identified as interaction partners which have specific binding affinities for the protein according to the invention, or for the identification of nucleic acids which code for proteins which have specific binding affinities for the protein according to the invention. Such a method according to the invention or the use of polypeptides according to the invention, nucleic acid sequences according to the invention and / or nucleic acid constructs according to the invention for carrying out such methods is preferably carried out with the aid of a "yeast-two-hybrid" screening (y2h "screens") alone or in combination with other biochemical Procedures performed (Fields and Song, 1989, Nature, 340, 245-6). Such screens can also be found in Van Aelst et al. (1993, Proc Natl Acad Sei U S A, 90, 6213-7) and Vojtek et al. (1993, Cell, 74, 205-14). Typically, mammal systems can also be used to carry out a method according to the invention instead of yeast systems, for example as in Luo et al. (1997, Biotechniques, 22, 350-2).

For a y2h screen, the open reading frame of 15B3, 15B3-1, 15B3-2 or a native variant is cloaked, for example, in a so-called bait vector "in-frame" with the GAL4 binding domain. (e.g. pGBTIO, from Clontech). A so-called “prey library” in a yeast strain can thus preferably be searched for interacting proteins according to the customary protocol. Kinase-negative mutants are preferably used for this, since these often interact more stably with any phosphorylation targets. Serine / threonine kinases in a metabolic pathway can be caused by Adapter molecules are brought into close proximity in order to be able to carry out specific phosphorylations better (Chang et al., 1998, Science, 281, 1860-3), (Yasuda et al., 1999, Mol Cell Biol, 19, 7245-54, ( Whitmarsh and Davis, 1998, Trends Biochem Sei, 23, 481-5), Whitmarsh et al., 1998, Science, 281, 1671-4) It is therefore also possible according to the invention, via two steps in the yeast-two-hybrid system to encounter phosphorylation targets by first cloning an adapter protein and using this to determine the specific target protein (“target”) as “bait”. In addition, so-called mapping experts can also be used with y2h systems imente to identify specific interaction domains.

According to the invention, interaction partners can also

Immunoprecipitations from cells transfected with 15B3-, 15B3-1- or 15B3-2- (or their native variants) are used to purify proteins that bind to them, and subsequently using protein sequencing methods (eg MALDI-TOF, ESI-tandem-MALDI) identify the associated genes.

Another object of the present invention is therefore the use of the two-hybrid system or other biochemical methods for the identification of interaction domains of 15B3, 15B3-1 or 15B3-2 or natively occurring variants thereof and the use of these interaction domains (Fragments of the native sequences) for pharmacotherapeutic intervention.

The polypeptides according to the invention, in particular natively occurring forms or also non-native, artificially generated variants whose biological function is to be investigated, can be used according to the invention in an apoptosis assay or in a method for examining the function and / or effectiveness of polypeptides according to the invention are used for induction, transduction or inhibition of cell death signals. The involvement of 15B3, 15B3-1, 15B3-2 or the aforementioned variants in apoptotic cascades can be examined by transfecting expression constructs with 15B3, 15B3-1 or 15B3-2 or variants in eukaryotic cells, and then examining the induction of apoptosis can. This can be done, for example, by staining with annexin (from Röche Diagnostics), through antibodies that recognize the active form of caspase-3 (from New England Biolabs), or by ELISAs that recognize DNA histone fragments (cell death elisa, Röche Diagnostics). This induction of apoptosis may be cell type-specific, which is why several cell lines and primary cells are preferably investigated according to the invention. The induction of apoptosis can also be stimulus-specific. Therefore, in a method according to the invention, preferably several stress situations are taken as a basis, for example heat shock, hypoxia conditions, cytokine treatments (for example 11-1, 11-6, TNF-alpha, H ₂ O ₂ treatment). Typical cell types for such a method according to the invention are customary cell lines, for example Cos cells, HEK cells, PC12 cells, THP-1 cells, or primary cells, such as neurons, astrocytes, as well as others in - Mortalized and primary cell lines as needed. The present invention further relates to the use of nucleic acids according to the invention, nucleic acid constructs or gene products according to the invention for carrying out a proliferation assay. For example. The involvement of 15B3, 15B3-1, 15B3-2 and native or non-native variants thereof in the growth of cells, in the passage of the cell cycle or in tumorigenic transformation can be examined by using expression constructs with 15B3, 15B3-1 or 15B3-2 or equivalent Variants are transfected into eukaryotic cells and then, for example, the induction of tumorigenicity is examined, for example with the aid of a soft agar test (Housey, et al., 1988, Adv Exp Med Biol, 234, 127-40). Common cell lines such as Cos cells, HEK cells, PC12 cells, THP-1 cells, and primary cells such as neurons, astrocytes, as well as other immortalized and primary cell lines as required, are considered as preferred cell types. In particular, with the aid of such a method according to the invention, the function of gene products according to the invention on the ras signal transmission path and the interaction of gene products according to the invention with other components of the ras signal transmission path can be investigated, in particular with regard to proliferative or apoptotic processes.

Another object of the present invention is the use of a DNA sequence according to one of claims 1 to 4 or a gene product according to one of claims 8 to 10 as a suicide gene / protein for the in vivo or ex vivo transformation of host cells (claim 29). In particular with regard to the biological function of protein according to the invention in the signal transduction of apoptotic and / or necrotic signals, cell death can be triggered in a targeted manner in host cells. This is preferred the use of a DNA sequence according to the invention or a protein according to the invention be designed such that the suicide gene is operably linked to a promoter, the transcription being repressed and being activated only when necessary (claim 30). In particular, the transfected cell can be specifically switched off after transplantation of patient cells ex vivo or in vivo as part of a gene therapy.

The present invention is explained in more detail by the following figures.

FIG. 1 shows an RMDD scheme (restriction-mediated differential display). A description is given in embodiment 1.

The result of a 15B3 LightCycler verification is shown in FIG. As explained in exemplary embodiment 1, the upregulation of 15B3 was measured 2 hours after an experimental stroke (MCAO, 90 min occlusion), specifically in the contralateral and in the ipsolateral area. The expression (on the y axis) is normalized against the expression of the standard gene product cyclophilin, ie plotted as a relative expression.

FIG. 3 shows the 15B3 tissue expression in various mouse tissues (heart, spleen, brain, lung, liver, skeletal muscle, kidney, testis) or after various phases of mouse embryonic development. The result was determined using a quantitative PCR with 15B3 primers on a cDNA set from Fa. Clontech obtained, ie the gene presented, 15B3, is ubiquitously expressed in humans and mice. The expression rate against the individual tissues is plotted.

FIG. 4 shows a homology comparison at the protein level of the proteins 15B3, 15B3-1 and 15B3-2 with the aid of the Clustal program (Megalign, Lasergene, Madison, WI). The amino acids which are identical in each case are shaded with a dark background. Overall, the high degree of amino acid conservation in the three gene products is striking. The lines drawn above or below the sequence represent those areas (a total of 4, approximately between (1) AS 234 and 254, (2) 45 and 63, (3) 24 and 43 and (4) 184 and 203 ( Numbering according to the sequence of 15B3-2), which are referred to as transmembrane domains, lines with arrows (10 in total) mark regions which are leucine-rich regions ("leucine-rich repeats" (LRR)). Interaction modules are known in proteins with various functions, for example the human and murine toll-like receptor 6 (TLR6) contains an extracellular LRR domain in addition to the transmembrane domains (Takeuchi et al., 1999).

FIG. 5 shows a phylogenetic family tree of the proteins with "leucine-rich-repeat" domains. The Megalign program was used to determine the family tree. The 15B3 family represents a new subset within the proteins containing LRR domains.

FIG. 6 shows a protein structure prediction for protein 15B3 according to the invention with the aid of the Protean program (DNAStar, Lasergene, Madison, WI). The 4 putative transmembrane domains are clearly visible. Figure 7: Ras-MAPK cascade. Putative interactions of 15B3 within the Ras signal transduction path are shown. 15B3 has modulatory functions here.

Figure 8 represents the human 15B3 nucleic acid sequence (SEQ ID 1).

Figure 9 depicts the amino acid sequence of human 15B3 protein (SEQ ID 2) running from the N to the C terminus.

Figure 10 represents the human nucleotide sequence of human 15B3-1 (Seq ID 3).

FIG. 11 shows the amino acid sequence of the human protein 15B3-1 (Seq ID 4), namely continuously from the N- to the C-terminus.

Figure 12 depicts the nucleotide sequence of protein 15B3-2 (Seq ID 5).

Figure 13 shows the amino acid sequence of protein 15B3-2 (Seq ID 6), running from the N to the C terminus.

The present invention is explained in more detail by the following exemplary embodiments:

embodiments

From example 1:

The subject matter of the present invention, a hitherto not defined in full length and accordingly hitherto in its A protein that was not characterized, including the underlying DNA sequence, was cloned due to differential regulation in the central nervous system. After focal cerebral ischemia in the brain of mice in the ischemic hemisphere, the RNA products of the 15B3 gene were increasingly expressed and could be cloned using a differential cloning system (restriction-mediated differential display, RMDD). The thread model (middle cerebral artery occlusion, MCAO) was used to induce focal cerebral ischemia, a valid model for stroke disease in humans. This experimental system was used according to the invention to identify genes which, in addition to other functions, are also of pathophysiological importance for events after cerebral ischemia. In detail, the experimental procedure was as follows, and molecular targets for new drugs in neurodegenerative diseases can be represented.

(a) Establishing the suture model in mice 3-month-old mice were used to induce focal cerebral ischemia in c57 / bl6 mice. After induction of inhalation (70% N20, 30% 02, 0.8-1% halothane), a 5-0 Prolenefaden (Ethicon), which was coated with 0.1% poly-L-lysine, was coated over the A External carotid artery into the internal carotid artery up to the exit of the cerebral media. advanced. The correct position of the thread is indicated by a drop in the laser Doppler signal (from Perimed) to 10-20% of the output signal. After performing this operation and, if necessary, determining additional physiological parameters (blood pressure, pulse, blood gases, blood glucose), the mice awake from anesthesia. After certain occlusion times, the mice are again anesthetized. pulled, and the thread pulled back. This causes tissue reperfusion. After certain reperfusion times, the mice are killed by a broken neck, and the brain is immediately prepared and frozen on dry ice.

In the present case, no reperfusions were carried out, but only an occlusion of 90 min or 24 h.

(b) Preparation of brain mRNA

For this purpose, the mRNA preparation kit from Invitrogen

(Fasttrack) used. Reference is made to the standard preparation method described, which is part of the disclosure of the present patent application.

(c) Implementation of the RMDD protocol (see also Fig. 1)

The procedure was carried out according to the methods described in the publications EP 0 743 367 A2 and US 5,876,932, with the exception that 2 μg of polyA-RNA were used for the first strand synthesis. After first-strand, second-strand synthesis and Mbol restriction had been carried out, ligation with adapters was carried out. ^' Two successive PCR reactions with subsets of primer combinations followed. The PCR reactions were then loaded onto a denaturing gel and blotted onto a nylon membrane (GATC). The biotin-labeled bands were visualized using a common streptavidin-peroxidase reaction. PCR samples from the ischemic and contralateral hemisphere were applied to the gel (24 h MCAO right and left and 90 min MCAO right and left). Bands of different intensities in the right or left hemisphere were cut out and the corresponding PCR product was reamplified. Amplified products obtained were in the TOPO TA vector pcDNA 2.1 (Fa. Invitrogen) cloned and sequenced with T7 and M13rev primers (ABI 3700 capillary electrophoresis sequencer). Sequences obtained are compared with the EMBL database.

(d) Cloning 15B3

After carrying out the above-described process steps, a sequence was identified which appeared to be upregulated on the ischemic side after 90 min. A "light cycler" analysis confirmed rapid regulation after MCAO (90 min MCAO and 2 h reperfusion) (see also FIG. 2).

This sequence showed strong homology to the SUR-8 etc. genes. The isolated 3 'PCR fragment was used to hybridize a mouse brain bank. Several clones were found that contained parts of the sequence from this sequence (Seql). These were compared with ESTs from the EMBL database, and the sequences Seql assembled. A mouse sample from the 5 'region was used to search a human fetal brain bank in lambdaZapII (Stratagene) ("screening"). An illustration of the preparation of the human cDNA library used is shown in FIG. 1. The human clones obtained were sequenced and compared with human ESTs from the EMBL database and the human mRNA of the KIAA1437 protein AB037858.

The nucleotide and protein sequences of the 15B3-related clones 15B3-.1 and 15B3-2 yielded a database search of the EMBL, nrdb and swissprot databases (with the BLAST 2 program, described by Altschul et al. (1997, Nucleic Acids Res, 25, 3389-402) This publication is fully part of the present disclosure, and further human ESTs were determined using the EMBL database, so that for 15B3-2 the ORF could be averaged. These sequences are shown as sequences Seq ID 5, 6 in FIGS. 10 to 13.

(e) Production of the human cDNA library With the cDNA synthesis kit from Stratagene, corresponding cDNA libraries were produced starting from 2 μg human fetal brain mRNA (Clontech) and 5 μg mRNA from adult mouse brain. The procedure was essentially according to the manufacturer's instructions. According to the manufacturer's instructions, an oligotT primer was used to synthesize the first strand cDNA. The cloning-compatible (Eco-Rl / Xhol) double-stranded cDNA fragments were size-selected (according to the manufacturer's instructions / Stratagene) and ligated into the plasmid vector pBluescript SKII (Stratagene). The ligation was transformed by electroporation into E. coli (DH10B, Gibco) and amplified on LB ampicillin agar plates. The plasmid DNA was isolated by means of alkaline lysis and ion exchange chromatography (QIAfilter kit, from Qiagen).

The complexity of single clones was 4 million for the fetal human brain cDNA library. From each cDNA library 24 individual clones were randomly analyzed for insert sizes, which showed a size distribution from 800 bp up to 4.5 kb, the average length of the cDNA inserts for the human Bajik was approximately 1.2 kb.

Embodiment 2 Carrying out a reporter gene assay

The sequence obtained from 15B3 was used to obtain information about the classification of the protein in its function as E- element of signal transduction cascades, in particular the ras / MapK cascade. For this purpose, the open reading frame of the gene was cloned into a common expression vector (eg pCMV-tag, from Stratagene). This construct was transfected together with other constructs into eukaryotic cells (eg using the calcium phosphate method, see Ausubel et al., Current Protocols in Molecular Biology, New York, 1997). These were typically reporter constructs, for example a luciferase gene, under the control of a minimal promoter with several SRE elements, the binding sequence for the ELK transcription factor. Extracts from the cells were then subjected to a measurement in a luminometer (for example from Bertold). An increase in the luciferase value was assessed as influencing the signal transduction pathway, which results in the activation of a specific transcription factor (ELK). Combinations with other expression constructs (eg for other genes, eg MAP kinases) could provide information about the exact position of 15B3 in signal cascades.

Possibly. these reporter assays have also been carried out with other systems, e.g. lacZ or chloramphenicol transferase (CAT assays), the assay being based on the same principle as described above.

Example 3:

Tissue expression studies of 15B3

To examine the tissue expression of 15B3, a quantitative PCR was carried out using the LightCycler (Röche Diagnostics, Mannheim). CDNA samples from 8 murine tissues were used, which were already standardized in terms of quantity on 4 different housekeeping genes (from Clontech). Plasmid xxl5B3, which contained an amplified fragment of the murine 15B3 CDNA, was used as a control. A standard protocol (annealling temp 60 ° C) was chosen as the PCR program. In all tissue samples there was amplification of a product with a melting point of 89 ° C, which coincided with the control PCR. The amplification is visible in the LightCycler from cycle 25. The following primers were used: seq_15B3.1 GAGCTGCCAAGAAAGGGGGAGACT (in exon 2) seq_15B3.2 CAGAAAACACAAATGGACGGAGAG (in exon 2)

The quantitative analysis (FIG. 3) shows a relatively ubiquitous tissue distribution with a focus on the heart, lungs, liver and brain. 15B3 expression is also detectable in the testis, muscle, kidney and spleen as well as during embryonic development.

A homology search (BLAST) with the human 15B3 sequence identified human ESTs (expressed sequence tags) from the 3 'untranslated region of the gene. There are clones from aorta, bone, brain, CNS, colon, eye, genital organs, heart, kidney, lungs, lymphatic system, pancreas, prostate, stomach, testis, uterus, embryo, breast tissue, muscle, nervous tumor, ovary, Uterus, which suggest a broad distribution of tissue. This coincides with the quantitative PCR data obtained.

Design example:

Studies on and characterization of the protein sequence of 15B3 There is an open reading frame for the human protein sequence, which codes for a protein with 811 amino acids (94.2 kD molecular weight; isoelectric point at pH 7.9).

(a) Determination of protein domains

The computer program T pred was used to determine transmembrane domains. It predicts with high probability 4 transmembrane domains for the N-terminus of protein 15B3 (see FIG. 6). A "score" above 500 indicates the significance of potential transmembrane segments, for the protein 15B3 the "score" for all four potential domains is very high (1361, 1965, 757, 2592).

4 strong transmembrane helices, total score: 6675 from to length score orientation 1 26 45 (20) 1361 i-o

2 124 144 (21) 1965 o-i

3,267,287 (21) 757 OK

4,320,341 (22) 2,592 o-i

Furthermore, Kyte-Doolittle hydrophobicity plot was created. The result of this plot indicates four hydrophobic areas (index> -3) in the N-terminus, which correspond to the sequence given above (AS: 26-45, 124-144, 267-287, 320-341), this supports the Hypothesis that these are transmembrane regions.

Using the Kyte-Doolittle hydrophobicity plot, it was found according to the invention that there is a hydrophilic region for AS 350-435, while the subsequent C-terminus has a larger hydrophobic region. Using the program HMMPFAM, it was further determined according to the invention that this region (AS 461-803) represents a characteristic leucine-rich repeats area (LRR). Furthermore, the PSORTII program was used to characterize the sequence according to the invention in more detail. In this way, two signal sequences were identified in the protein sequence. The last 4 amino acids of the 15B3-C terminus, DKEQ, show significant similarity to a Motif, KKXX, similar to "ER Membrane Retention Signal". Another sequence at position 695 as of protein 15B3 was identified as a peroxisomal targeting signal (KIEKIPTQL). The results of the aforementioned experiments allow the conclusion that a protein according to the invention is localized in the endoplasmic reticulum.

(b) Sequence comparisons of the 15B3 protein

Sequence comparisons of the 15B3 sequence were carried out with EMBL, nrdb and swissprot databases. This resulted in agreement with the following human sequences: (i) BAA92675 and (ii) BAA91549.

The protein sequence comparison between the protein 15B3 and BAA92675 according to the invention showed 100% identity at the protein level. For the clone BAA92675, the authors state that the start codon was not identified. However, by determining the open reading frame of the 4.7 kb nucleotide sequence of 15B3, we were able to determine that the second AS of the annotated BAA92675 protein sequence is very likely the start codon of 15B3. No longer ORF could be identified that matched the translated protein. Also, no other ORFs with a different reading frame could be shown. The nucleotide sequence of clone BAA92675 shows a nucleotide exchange in position 2748bp (C instead of T) and in position 3891 bp (A instead of G). However, the errors in the nucleotide sequence do not result in an amino acid exchange at the protein level.

(c) Classification of 15B3, homologous proteins

A database search (BLAST 2 (Altschul, et al., 1997, Nucleic Acids Res, 25, 3389-402)) of the EMBL, nrdb and swissprot databases revealed relatives of this protein.

15B3 shows the strongest homologies to two annotated protein sequences:

-58.8% identity on 670 AS to BAA9131 -58.8% identity on 803 AS to Q92627. The LRR binding domain in the C-terminus and the four potential transmembrane domains in the N-terminus are preserved (FIG. 4).

The annotated protein sequence of 476 AA from clone Q92627 did not show a complete ORF. The start codon was determined and the ORF on 804 AS was completed by translating the 5 'genomic sequences found. There is also a certain homology to 15B3 in the N-terminal sequences. The protein sequence also has four potential conserved transmembrane segments, 10 leucine-rich repeats and a motif similar to "ER membrane retention signal".

The protein sequence of clone BAA9131 starts with a start codon, however, based on the sequence comparisons to 15B3 and Q92627, it is assumed that the ORF in the N-terminus is incomplete. The protein sequence shows strong conservation to the potential transmembrane segments (3 and 4, Fig. 6) and also has 10 leucine-rich repeats. Due to the conservation at the protein level, especially within the potential transmembrane domains and the LRR domains, it can be assumed that 15B3 with BAA9131 and Q92627 belong to a common gene family and define a new subgroup (FIG. 5). For this reason, BAA9131 was renamed to 15B3-1 and Q92627 to 15B3-2.

With the help of a database search, sequence similarities to proteins from other species or organisms such as humans, mice, rats, Drosophila melanogaster, C.elegans, S. cerevisiae, E. coli:

(1) H. sapiens: PID: gl504042 - similar to yeast adenylate cyclase (69% / 148 aa)

(2) M. muscle: PID: g3252981 - Ras-binding protein SUR-8 (35% / 141 aa)

(3) R. norvegicus: PID: gl657758 - densin-180 (30% / 112 aa)

(4) D. melanogaster: PIR: S60461 - S60461 gene flightless-I protein - fruit fly (34% / 141)

(5) C. elegans: PID: g3168891 - contains similarity to repeated leucine-rich (29% / 145 aa)

(6) S. cerevisiae: PID: gl006714 - ORF YJL005w (34% / 114 aa)

(7) E. coli: PID: gl788752 - cell division protein involved in FtsZ ring (34% / 123 aa)

15B3 of Sur-8 (Li W., et al., Genes Dev. 2000 Apr 15; 14 (8): 895-900), Soc-2 (Proc. Natl ,

Acad. SciUSA Vol. 95, pp. 6903-6908, June 1998), Rsu-1 (Tsuda et al., Genomics. 1993 Nov; 18 (2): 461-2), Densin-180 (Apperson et al., J Neurosci. 1996 Nov 1, 16 (21): 6839-52), Scribble

(Nature 403 (6770): 676-680 (2000) and the adenylate cyclase from yeast (X). There are different groups of homologous sequences that form different subsets of the LLR proteins, as shown in FIG. 5 in a phylogenetic tree. The proteins adenylyl cyclase from Saccharomyces cerevisiae and Sur-8, egl-15 and Rsu-1 have an important function in the Ras / Erk signal cascade. The Ξoc genes identified in C.elegans (egl-15, sem-5, soc-1 and soc-2), suppressors of the receptor tyrosine phosphatase clr-1, influence the FGF signal cascade. Soc-2, a protein with an 18 tandem LRR domain, suppresses the activated form of the EGL-15 FGF receptor (fibroblast growth factor). The FGF signal cascade is also said to have an activating effect on the Ras cascade. The human form Shoc-2, is localized to chromosome 10q25 in humans, a region that is associated with certain bones and cancer.

The other subgroups of the LLR proteins are the LAP proteins, which have both an LLR domain in the N-terminus and a PDZ domain in the carboxy terminus. The LAP proteins include the C. elgans protein Let-413, the Sophosila protein Scribble, the vertebrate proteins Densin-180, Erbin and the human Scribble. Interestingly, the LAP proteins have a common expression pattern along the cell membrane.

Based on the yield rate of the resulting phylogenetic tree (FIG. 5), it can be assumed that 15B3 cannot be assigned to the previously known LLR subgroups.

(d) Genomic structure of 15B3 in humans A database search based on the knowledge according to the invention with the BLAST 2 program (Altschul, et al., 1997, Nucleic Acids Res, 25, 3389-402)) in the EMBL database yielded additional human genomic sequence information. The clone AL136108, consisting of 36 composite contigs, contains large areas of the 15B3 cDNA. Sequence comparisons between the genomic nucleotide sequence indicate that the human cDNA clone is encoded by at least two exons. The 3 'area is completely preserved. 15B3 is located on chromosome 9 in humans (position: 9q22.32-31.3; http: // www.sanger.ac.uk/cgi-bin/humace/searcher. Cgi).

(e) LRR domain of the proteins according to the invention

Because of the conservation of the LLR domain at 15B3, it has an LLR domain that is typical of proteins involved in interacting with Ras. The Ras associated LRR domain of S. Cerevisiae adenylyl cyclase belongs to a small subgroup that has a specific 23-AS consensus unit (PXXaXXLXXLXXLXLNXLXXa, a is an aliphatic, X any amino acid). Other members of this subgroup, such as RSU1 and SUR-8, are two putative scaffold proteins that have a modulating effect on the Ras-dependent signal cascade. Both have in common the formation of a ternary complex with Ras and Raf and the resulting activation of Ras-MAP kinase signal transduction. It is also known, for example, from the prior art that the activation of Ras and the Raf / Erk cascade (Raf, Mek; Erk2) also has an essential role for the oxygen-glucose deficiency tolerance in neurons. During the oxygen-glucose deficiency preconditioning in neurons, a signal cascade is started, which is activated by the vation of the NMDA receptors is triggered by Ca2 + inflow and production of NO. NO is a mediator of Ras activation using NMDA receptor stimulation. The ischemic tolerance is achieved by activating the NMDA glutamate receptors.

The proteins according to the invention contain a tandem leucine repeat-rich domain (LRR) in the C-terminus. These LRRs in the protein according to the invention are protein-protein interaction domains consisting of 20-28 amino acids with a core consensus of leucines and asparagines (LXXLXLXXN). In the 15B3 protein, this domain typically consists of 10 leucine rich repeats (FIG. 4).

Summary of experimental data

The experimental data according to the present invention show that the identified proteins play a crucial role in the regulation of focal cerebral ischemia, a stroke model.

Proteins 15B3, 15B3-1 and 15B3-2 were used to identify drug target sequences using a method for cloning differentially regulated genes (RMDD) in the ischemic hemisphere of mice after focal cerebral ischemia. The regulation of gene expression plays a crucial role in the course and extent of neuronal damage in cerebral ischemia (Koistinaho and Hokfelt, 1997, Neuroreport, 8, i-viii; Schneider et al., 1999, Nat. Med., 5, 554-9). So-called “immediate early genes” in particular play a role here (Atkins et al., 1996, Stroke, 27, 1682-1687), such as cox-2, (Nogawa, et al., 1997, J. Neurosci., 17 , 2746-2755). The Animal model of focal cerebral ischemia represents a valid model for human ischemic stroke. In order to induce focal cerebral ischemia, the so-called thread model was used, in which a coated nylon thread was advanced through the internal carotid artery to the outlet of the cerebral artery and induces an ischemic stroke (Clark et al., 1997, Neurol. Res., 19, 641-648).

15B3 expression was observed in three time courses after focal cerebral ischemia: on the one hand in transient ischemia after two reperfusion times (90 min ischemia, 2 h and 6 h reperfusion), and on the other hand in permanent ischemia of 24 h (Fig. 2). RNA was obtained from the two hemispheres of 3-4 brains without a brain stem and cerebellum (Fasttrack kit, Invitrogen). A quantitative PCR was carried out using the LightCycler ™ system (Röche Diagnostics, Mannheim). The cDNA content of the samples was normalized for the expression of cyclophilin and S20 (Schneider, et al., 1995, Proc Natl Acad Sei U S A, 92, 4447-51). Primers used for the amplification of cyclophilin were: cyc5 ACCCCACCGTGTTCTTCGAC acyc300 CATTTGCCATGGACAAGATG and for the amplification of mouse 15B3: seq_15B3.1 GAGCTGCCAAGAAAGGGGGAGACT (in Exon 2) seq_15B3 2AT CAGGAAConAg (in Exon 2) a 'End of mouse cDNA is).

The result shows a clear upregulation by a factor of 2-3 of 15B3-RNA on the ischemic (left) hemisphere 2h after the ischemic event (middle cerebral artery occlusion of 90 min and 2 h reperfusion, i.e. in one Acute neurodegeneration model (Fig. 2); the error bars show standard deviations, these result from measurements with 3-fold serial diluted cDNA samples and thus reflect the reliability of the measurement results). After 24 hours (in a permanent model), however, no difference could be determined. Proteins according to the invention, for example 15B3, play an important role in intracellular signal transduction processes, which is why they are also involved in pathological processes (for example stroke).

Claims

claims

1. DNA sequence, characterized in that it contains a sequence region for a polypeptide with an amino acid sequence from AS 312 to AS 711 (15B3), AS 180 to AS 579 (15B3-1) or AS 306 to AS 705 (15B3 -2) (numbering according to FIG. 4), including all functionally homologous derivatives, fragments or alleles, or DNA sequences hybridizing therewith.

2. DNA sequence according to claim 1, characterized in that it contains a sequence region which codes for a polypeptide with an amino acid sequence according to Figure 9, 11 or 13, including all functionally homologous derivatives, fragments or alleles, or DNA sequences hybridizing therewith.

3. DNA sequence according to claim 1 or 2, characterized in that it codes for a polypeptide according to Figure 9, 11 or 13, including all function-homologous derivatives, fragments or alleles, or with this hybridizing DNA sequences.

4. DNA sequence according to one of the preceding claims, characterized in that it contains the (c) DNA sequence indicated in Figure 8, 10 or 12.

Expression vector, characterized in that it contains a DNA sequence according to one of Claims 1 to 4.

6. Host cell, characterized in that it is transformed with an expression vector according to claim 5.

7. Host cell according to claim 6, characterized in that it is a mammalian cell, in particular a human cell.

8. Purified gene product, characterized in that it is encoded by a DNA sequence according to one of claims 1 to 4.

9. Purified gene product according to claim 8, characterized in that it is a polypeptide.

10. Purified gene product according to claim 8 or 9, characterized in that it contains the amino acid sequence shown in Figure 9, 11 or 13, including all functional homologous alleles, fragments or derivatives.

11. Transgenic animals, characterized in that they are genetically modified in such a way that they change (specifically) a quantity of at least one amino acid sequence according to claim 9 or 10 or a specific one compared to a native sequence (according to FIGS. 9, 11 or 13) contain modified amino acid sequence according to claim 9 or 10 or that at least one amino acid sequence according to claim 9 or parts thereof is missing or changed.

12. Antibody, characterized in that it recognizes an epitope on a gene product according to one of claims 8 to 10.

13. Antibody according to claim 12, characterized in that it is monoclonal.

14. Antibody according to one of claims 12 or 13, characterized in that it is directed against a sequence section on the cytoplasmic domain as an epitope.

15. A method for the expression of gene products according to one of claims 8 to 10, characterized in that host cells are transformed with an expression vector according to claim 5.

16. A method for isolating gene products according to one of claims 8 to 10, characterized in that host cells according to claim 6 or 7 are cultivated under suitable conditions which promote expression and the gene product is subsequently purified from the culture.

17. DNA sequence according to one of claims 1 to 4 or a gene product according to one of claims 8 to 10 as a medicament.

18. Use of a DNA sequence according to one of claims 1 to 4 or of a gene product according to one of claims 8 to 10 for the treatment (or for the manufacture of a medicament for the treatment) of diseases which are based on incorrectly controlled cell death and / or cell proliferation events based.

19. Use of a DNA sequence according to one of claims 1 to 4 or a gene product according to one of claims 8 to 10 for the treatment (or for the manufacture of a medicament for the treatment) of tumor diseases and neurological diseases, in particular stroke, multiple sclerosis, Parkinson's disease, amyotrophic latex sclerosis, heredodegenerative ataxias, Huntington's disease, neuropathies and epilepsy.

20. Compound, characterized in that it modulates, in particular inhibits, the intracellular function of the 15B3, 15B3-1 and / or 15B3-2 protein.

21. A compound according to claim 20 or 21, characterized in that it is an organic chemical compound with a molecular weight of preferably <3000.

22. A compound according to any one of claims 19 to 21, characterized in that it passes through the cell membrane by diffusion or via membrane transport proteins.

23. A method for identifying pharmaceutically active compounds according to any one of claims 19 to 22, characterized in that

(a) a suitable host cell system with an expression vector according to claim 5, in particular an expression vector which is suitable for the protein 15B3, 15B3-1 or

15B3-2, and if appropriate at least one expression vector which codes for at least one reporter gene, is transfected, and

(b) a function mediated for the observation of the 15B3, 15B3-1 and / or 15B3-2, in particular a parameter suitable for the observation of apoptosis, cell growth, cell proliferation and / or cell plasticity after adding a test compound in comparison as a control without adding a test compound for the host cell system obtained in (a) is measured in a suitable test system.

24. The method according to claim 23, characterized in that (c) the binding site of the pharmaceutically active compound on a protein according to the invention is determined by a suitable biochemical or structural biological method.

25. The method according to claim 23 or 24, characterized in that a parameter according to (b) is measured within an assay setup for the Raf / MEK / ERK cascade.

26. Use of a compound according to claims 19 to 22 for the treatment of (or for the manufacture of a medicament for the treatment of) neurodegenerative diseases, in particular Alzheimer's disease and Parkinson's disease, muscular dystrophy, viral infectious diseases, tumor diseases and autoimmune diseases or cerebral ischemia ,

27. A method for identifying a cellular interaction partner of the 15B3, 15B3-1 and / or 15B3-2 protein or a native alien, fragment or derivative, using a so-called "yeast-two-hybrid" system.

28. Use of a DNA sequence according to one of claims 1 to 4 or of a gene product according to one of claims 8 to 10 for the identification of further proteins involved in the signal transduction mediated by the protein 15B3, 15B3-1 and / or 15B3-2.

29. Use of a DNA sequence according to one of claims 1 to 4 or a gene product according to one of claims 8 to 10 as a suicide gene / protein for the in vivo or ex vivo transformation of host cells.

30. Use of a DNA sequence according to claim 29, wherein the suicide gene is operably linked to a promoter, wherein the transcription is repressed and is only activated when necessary.