WO2002057417A2 - Angiogenesis gene and modulators - Google Patents

Abstract

The present invention relates to all facets of novel polynucleotides, the polypeptides they encode, and their applications to research, drug discovery, diagnosis, forensics, and therapy. The polynucleotides and polypeptides are expressed in blood vessels, especially newly formed blood vessels, and are therefore useful in variety of ways, including, but not limited to, as molecular markers for blood vessels and blood vessel formation, as drug targets, and for detecting, diagnosing, staging, monitoring, prognosticating, preventing, treating, and/or determining predisposition to diseases and conditions of the vascular system.

Description

ANGIOGENESIS GENE AND MODULATORS

This application claims the benefit of Provisional Application Serial No. 60/255,443, filed December 15, 2000, which is hereby incorporated by reference in its entirety.

DESCRIPTION OF THE DRAWINGS Fig. 1 shows the alignment of the amino acid sequences of mouse E25b (top, SEQ ID NO. 4) with human E25b (bottom, SEQ ID NO. 2).

SEQ ID NOS. 1 and 2 show the nucleotide and amino acid sequences of human E25b (NM_021999). See, also Vidal et al., Nαtwre, 399:776-781, 1999.

SEQ ID ΝOS 3 and 4 show the nucleotide and amino acid sequences of mouse E25b (ΝM_008410). See, also Pittois et al., Gene, 217:141-149, 1998.

DESCRIPTION OF THE INVENTION The present invention relates to all facets of novel polynucleotides, the polypeptides they encode, and their applications to research, drug discovery, diagnosis, forensics, and therapy. The polynucleotides and polypeptides are expressed in blood vessels, especially newly formed blood vessels, and are therefore useful in variety of ways, including, but not limited to, as molecular markers for blood vessels and blood vessel formation, as drug targets, for identifying and validating modulators of angiogenesis, and for detecting, diagnosing, staging, monitoring, prognosticating, preventing, treating, and/or determining predisposition to diseases and conditions of the vascular system.

Angiogenesis, the process of blood vessel formation, is a key event in many physiological processes that underlie normal and diseased tissue function. During ontogeny, angiogenesis is necessary to establish to the network of blood vessels required for normal cell, tissue and organ development and maintenance. In the adult organism, the production of new blood vessels is needed for organ homeostasis, e.g., in the cycling of the female endometrium, for blood vessel maturation during wound healing, and other processes involved in the maintenance of organism integrity. Not all angiogenesis is beneficial. Inappropriate and ectopic expression of angiogenesis can be deleterious to an organism. A number of pathological conditions are associated with the growth of extraneous blood vessels. These include, e.g., diabetic retinopathy, neovascular glaucoma, psoriasis, retrolental fibroplasias, angiofibroma, inflammation, etc. In addition, the increased blood supply associated with cancerous and neoplastic tissue, encourages growth, leading to rapid tumor enlargement and metastasis. Because of the importance of angiogenesis in many physiological processes, its regulation has application in a vast arena of technologies and treatments. For instance, induction of neoangiogenesis has been used for the treatment of ischemic myocardial diseases, and other conditions (e.g., ischemic limb, stroke) produced by the lack of adequate blood supply. See, e.g., Rosengart et al., Circulation, 100(5):468-74, 1999. Where vascularization is undesirable, such as for cancer and the mentioned pathological conditions, inhibition of angiogenesis has been used as a treatment therapy. See, e.g., See, e.g., U.S. Pat. No. 6,024,688 for treating neoplasms using angiogenesis inhibitors.

A number of different factors have been identified which stimulate angiogenesis, e.g., by activating normally quiescent endothelial cells, by acting as a chemoattractant to developing capillaries, by stimulating gene expression, etc. These factors include, e.g. fibroblast growth factors, such as FGF-1 and FGF-2, vascular endothelial growth factor (NEGF), platelet-derived endothelial cell growth factor (PD-ECGF), etc. Inhibition of angiogenesis has been achieved using drugs, such as TΝP-470, monoclonal antibodies, antisense nucleic acids and proteins, such as angiostatin and endostatin. See, e.g., Battegay, J. Mol. Med., 73, 333-346 (1995); Hanahan et al., Cell, 86, 353-364 (1996); Folkman, N. Engl. J. Med., 333, 1757-1763 (1995).

Activity of a polynucleotide or gene in modulating or regulating angiogenesis can be determined according to any effective in vivo or in vitro methods. One useful model to study angiogenesis is based on the observation that, when a reconstituted basement membrane matrix, such as Matrigel®, supplemented with growth factor (e.g., FGF-1), is injected subcutaneously into a host animal, endothelial cells are recruited into the matrix, forming new blood vessels over a period of several days. See, e.g., Passaniti et al., Lab. Invest., 67:519-528, 1992. By sampling the extract at different times, angiogenesis can be temporally dissected, permitting the identification of genes involved in all stages of angiogenesis, including, e.g., migration of endothelial cells into the matrix, commitment of endothelial cells to angiogenesis pathway, cell elongation and formation of sac-like spaces, and establishment of functional capillaries comprising connected, and linear structures containing red blood cells. To stabilize the growth factor and/or slow its release from the matrix, the growth factor can be bound to heparin or another stabilizing agent. The matrix can also be periodically re-infused with growth factor to enhance and extend the angiogenic process. Other useful systems for studying angiogenesis, include, e.g., neovascularization of tumor explants (e.g., U.S. Pat. Nos. 5,192,744; 6,024,688), chicken chorioallantoic membrane (CAM) assay (e.g., Taylor and Folkman, Nature, 297:307-312, 1982; Eliceiri et al., /. CellBiol, 140, 1255-1263, 1998), bovine capillary endothelial (BCE) cell assay (e.g., U.S. Pat. No. 6,024,688; Polverini, P. J. et al., Methods Enzymol, 198: 440-450, 1991), migration assays, HUVEC (human umbilical cord vascular endothelial cell) growth inhibition assay (e.g., U.S. Pat. No. 6,060,449).

The present invention relates to polynucleotides, such as DNAs, RNAs, and fragments thereof, which are related to angiogenesis and the vascular system. One such polynucleotide is E25b, representative of a family of genes and gene products ("E25b gene and polypeptide family") involved in blood vessel growth and maintenance. A full-length nucleotide sequence for mouse E25b (also known as integral membrane protein 2b, "Itm2b") was disclosed Pittois et al. (Gene, 217, 141-149, 1998), and partial sequences for both mouse and human were described in Deleersnijder et al. (/. Biol.Chem, 272:19475-19482, 1996), as well as being available in public DNA databases, such as Genbank. No function for E25b was proposed in the earliest publications. Vidal et al. (Nature, 399, 776-781, 1999) subsequently isolated the human E25b gene and found that a mutation in it was associated with familial British dementia (FBD). None of these references, however, describe E25b as a marker for blood vessels, nor its role in blood vessel physiology and development. SEQ ID NOS 1-4 show the amino acid and nucleotide sequence of human and mouse, E25b, respectively.

E25 is a member of a multigene family which includes at least three different lineages, E25a, E25b, and E25c. See, e.g., Deleersnijder et al. (/. Biol.Chem, 272:19475- 19482, 1996). E25a was suggested by Deleersnijder et al., supra., as a possible marker for chondro-osteogenic differentiation. Sequences related to it were also described in WO99/21984, WO99/51727, U.S. Pat. No. 6,093,800, and U.S. Pat. No. 5,889,170.

According to U.S. Pat. No. 6,093,800, E25a is up-regulated in cancer, including prostate, colon, and breast cancers. No function for E25c has been identified.

The E25b gene and polypeptide family refers to naturally occurring sequences and muteins thereof. Naturally occurring family members include genes, and the polypeptides they encode, which possess E25b angiogenic-associated functions. By the phrase "angiogenic-associated functions/' it is meant, e.g., that the gene is turned on, induced, or up- regulated in cells by FGF-1 or other angiogenic growth factors (e.g., as measured in a Matrigel™ assay at about 15 days after a plug implant of a matrix containing FGF-1, and about one day following re-injection with FGF-1), and/or that the gene and/or its product is associated with new blood vessel formation (e.g., a marker for neovascularization or angiogenesis). Naturally occurring family members can be identified by searching known sequences for homology to human or mouse E25b as shown in SEQ ID NOS 1-4 , by hybridization methods as described below, by PCR using consensus or degenerate primers, or any other method of identifying related sequences. Generally, E25b family members will have at least 50% sequence identity to the human or mouse polypeptide sequences, at least about 70%, at least about 80%, at least about 90%, at least about 95%, 97%, 99%, etc.

Sequence identity between E25b and E25a is only about 41% and between E25b and E25c is only about 43%. Examples of naturally occurring mutations in the E25b gene are described in Vidal et al., Nature, 399, 776-781, 1999.

Human E25b as shown in SEQ ID NO 2 is a 266 amino acid polypeptide, having a transmembrane sequence at about amino acid positions 52-76 (e.g. 57-74), and a single N- linked glycosylation site at position 170. The extracellular portion of the polypeptide is found at the C-terminus, extending from about amino acid positions 75-266, with the N- terminus being intracellarly located. The polypeptide has a calculated molecular weight of about 30,279 daltons. See, Vidal et al., Nature, 399, 776-781, 1999. A mammalian polynucleotide, or fragment thereof, of the present invention is a polynucleotide having a nucleotide sequence obtainable from a natural source. It therefore includes naturally-occurring normal, naturally-occurring mutant, and naturally-occurring polymorphic alleles (e.g., SNPs), differentially-spliced transcripts, etc. By the term "naturally-occurring," it is meant that the polynucleotide is obtainable from a natural source, e.g., animal tissue and cells, body fluids, tissue culture cells, forensic samples. Natural sources include, e.g., living cells obtained from tissues and whole organisms, tumors, cultured cell lines, including primary and immortalized cell lines. Naturally-occurring mutations can include deletions (e.g., a truncated amino- or carboxy-terminus), substitutions, inversions, or additions of nucleotide sequence. These genes can be detected and isolated by polynucleotide hybridization according to methods which one skilled in the art would know, e.g., as discussed below.

A polynucleotide according to the present invention can be obtained from a variety of different sources. It can be obtained from DNA or RNA, such as polyadenylated mRNA or total RNA, e.g., isolated from tissues, cells, or whole organism. The polynucleotide can be obtained directly from DNA or RNA, or from a cDNA library. The polynucleotide can be obtained from a cell or tissue (e.g., from an embryonic or adult tissues) at a particular stage of development, having a desired genotype, phenotype etc.

As explained in more detail below, a polynucleotide sequence of the invention can contain the complete sequence as shown in SEQ ID NOS 1-4, degenerate sequences thereof, anti-sense, muteins thereof, and fragments thereof. A polynucleotide comprising a nucleotide sequence coding without interruption for a polypeptide means that the nucleotide sequence contains an amino acid coding sequence for a polypeptide shown in SEQ ID NOS 2 and 4, with no non-coding nucleotides interrupting or intervening in the coding sequence, e.g., absent intron(s), such as a cDNA.

The present invention also relates genomic DNA from which the polynucleotides of the present invention can be derived. A genomic DNA coding for a human, mouse, or other mammalian polynucleotide, can be obtained routinely, for example, by screening a genomic library (e.g., a YAC library) with a polynucleotide of the present invention. Promoter and other regulatory regions can be identified upstream of coding and expressed RNAs, and assayed routinely for activity, e.g., by joining to a reporter gene (e.g., CAT, GFP, alkaline phosphatase, luciferase, galatosidase). A promoter obtained from a vascular gene of the present invention can be used, e.g., in gene therapy to obtain tissue-specific expression of a heterologous gene (e.g., coding for a therapeutic product or cytotoxin). The promoter, and upstream and down stream regions, can also be used as a probe to identify binding- partners which interact with it, e.g., transcription factors, regulatory factors. A polynucleotide of the present invention can comprise additional polynucleotide sequences, e.g., sequences to enhance expression, detection, uptake, cataloging, tagging, etc. A polynucleotide can include only coding sequence; a coding sequence and additional non- naturally occurring or heterologous coding sequence (e.g., sequences coding for leader, signal, secretory, targeting, enzymatic, fluorescent, antibiotic resistance, and other functional or diagnostic peptides); coding sequences and non-coding sequences, e.g., untranslated sequences at either a 5' or 3' end, or dispersed in the coding sequence, e.g., introns.

A polynucleotide according to the present invention also can comprise an expression control sequence operably linked to a polynucleotide as described above. The phrase "expression control sequence" means a polynucleotide sequence that regulates expression of a polypeptide coded for by a polynucleotide to which it is functionally ("operably") linked. Expression can be regulated at the level of the mRNA or polypeptide. Thus, the expression control sequence includes mRNA-related elements and protein-related elements. Such elements include promoters, enhancers (viral or cellular), ribosome binding sequences, transcriptional terminators, etc. An expression control sequence is operably linked to a nucleotide coding sequence when the expression control sequence is positioned in such a manner to effect or achieve expression of the coding sequence. For example, when a promoter is operably linked 5' to a coding sequence, expression of the coding sequence is driven by the promoter. Expression control sequences can be heterologous or endogenous to the normal gene. The expression control sequences can be of any type, e.g., constitutive, inducible, tissue-specific, etc. An inducible expression control sequence can respond to endogenous or exogenous signals.

A polynucleotide of the present invention can also comprise nucleic acid vector sequences, e.g., for cloning, expression, amplification, selection, etc. Any effective vector can be used. A vector is, e.g., a polynucleotide molecule which can replicate autonomously in a host cell, e.g., containing an origin of replication. Vectors can be useful to perform manipulations, to propagate, and/or obtain large quantities of the recombinant molecule in a desired host. A skilled worker can select a vector depending on the purpose desired, e.g., to propagate the recombinant molecule in bacteria, yeast, insect, or mammalian cells. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, Phagescript, phiX174, pBK Phagemid, pNH8A, pNH16a, pNH18Z, pNH46A (Stratagene); Bluescript KS+II (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: PWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene), pSVK3, PBPN, PMSG, pSNL (Pharmacia), pCR2.1/TOPO, pCRII/TOPO, pCR4/TOPO, pTrcHisB, pCMV6-XL4, etc. However, any other vector, e.g., plasmids, viruses, or parts thereof, may be used as long as they are replicable and viable in the desired host. The vector can also comprise sequences which enable it to replicate in the host whose genome is to be modified.

A polynucleotide in accordance with the present invention can be selected on the basis of polynucleotide hybridization. The ability of two single-stranded polynucleotide preparations to hybridize together is a measure of their nucleotide sequence complementarity, e.g., base-pairing between nucleotides, such as A-T, G-C, etc. The invention thus also relates to polynucleotides, and their complements, which hybridize to a polynucleotide comprising a nucleotide sequence as set forth in SEQ ID ΝOS 1 and 3, and genomic sequences thereof. A nucleotide sequence hybridizing to the latter sequence will have a complementary polynucleotide strand, or act as a template for one in the presence of a polymerase (i.e., an appropriate polynucleotide synthesizing enzyme). The present invention includes both strands of polynucleotide, e.g., a sense strand and an anti-sense strand.

Hybridization conditions can be chosen to select polynucleotides which have a desired amount of nucleotide complementarity with the nucleotide sequences set forth in SEQ ID ΝOS 1 and 3 and genomic sequences thereof. A polynucleotide capable of hybridizing to SEQ ID ΝOS 1 and 3, can possess, e.g., about 70%, 75%, 80%, 85%, 87%, 90%, 92%, 95%, 97%, 99%, or 100% complementarity, between the sequences. The present invention particularly relates to polynucleotide sequences which hybridize to the nucleotide sequences set forth in SEQ ID ΝOS 1 and 3, or genomic sequences thereof, under low or high stringency conditions. Polynucleotides which hybridize to polynucleotides of the present invention can be selected in various ways. Filter-type blots (i.e., matrices containing polynucleotide, such as nitrocellulose), glass chips, and other matrices and substrates comprising polynucleotides (short or long) of interest, can be incubated in a prehybridization solution (e.g., 6X SSC, 0.5% SDS, 100 μg/ml denatured salmon sperm DΝA, 5X Denhardt's solution, and 50% formamide), at 22-68°C, overnight, and then hybridized with a detectable polynucleotide probe under conditions appropriate to achieve the desired stringency. In general, when high homology is desired, a high temperature can be used (e.g., 65 °C). As the homology drops, lower washing temperatures are used. For salt concentrations, the lower the salt concentration, the higher the stringency. The length of the probe is another consideration. Very short probes (e.g., less than 100 base pairs) are washed at lower temperatures, even if the homology is high. With short probes, formamide can be omitted. See, e.g., Current Protocols in Molecular Biology, Chapter 6, Screening of Recombinant Libraries; Sambrook et al., Molecular Cloning, 1989, Chapter 9.

For instance, high stringency conditions can be achieved by incubating the blot overnight (e.g., at least 12 hours) with a long polynucleotide probe in a hybridization solution containing, e.g., about 5X SSC, 0.5% SDS, 100 μg/ml denatured salmon sperm DNA and 50% formamide, at 42°C. Blots can be washed at high stringency conditions that allow, e.g., for less than 5% bp mismatch (e.g., wash twice in 0.1% SSC and 0.1% SDS for 30 min at 65°C), i.e., selecting sequences having 95% or greater sequence identity.

Other non-limiting examples of high stringency conditions includes a final wash at 65°C in aqueous buffer containing 30 mM NaCl and 0.5% SDS. Another example of high stringent conditions is hybridization in 7% SDS, 0.5 M NaPO₄, pH 7, 1 mM EDTA at 50°C, e.g., overnight, followed by one or more washes with a 1% SDS solution at 42°C. Whereas high stringency washes can allow for less than 5% mismatch, reduced or low stringency conditions can permit up to 20% nucleotide mismatch. Hybridization at low stringency can be accomplished as above, but using lower formamide conditions, lower temperatures and/or lower salt concentrations, as well as longer periods of incubation time.

Hybridization can also be based on a calculation of melting temperature (Tm) of the hybrid formed between the probe and its target, as described in Sambrook et al.. Generally, the temperature Tm at which a short oligonucleotide (containing 18 nucleotides or fewer) will melt from its target sequence is given by the following equation: Tm =

(number of A's and T's) x 2°C + (number of C's and G's) x 4°C. For longer molecules, Tm = 81.5 + 16.6 log₁₀[Na⁺] + 0.41(%GC) - 600/N where [Na⁺] is the molar concentration of sodium ions, %GC is the percentage of GC base pairs in the probe, and N is the length. Hybridization can be carried out at several degrees below this temperature to ensure that the probe and target can hybridize. Mismatches can be allowed for by lowering the temperature even further. Stringent conditions can be selected to isolate sequences, and their complements, which have, e.g., at least about 90%, 95%, or 97%, nucleotide complementarity between the probe (e.g., a short polynucleotide of SEQ ID NOS 1 and 3, or genomic sequences thereof) and a target polynucleotide. Hybridization, as discussed above and below, is useful in a variety of applications, including, in gene detection methods, for identifying mutations, for making mutations, to identify homologs in the same and different species, to identify related members of the same gene family, etc.

Alignments can be accomplished by using any effective algorithm. For pairwise alignments of DNA sequences, the methods described by Wilbur-Lipman (e.g., Wilbur and Lipman, Proc. Natl. Acad. Sci., 80:726-730, 1983) or Martinez/Needleman-Wunsch (e.g., Martinez, Nucleic Acid Res., 11 :4629-4634, 1983) can be used. For instance, if the Martinez/Needleman-Wunsch DNA alignment is applied, the minimum match can be set at 9, gap penalty at 1.10, and gap length penalty at 0.33. The results can be calculated as a similarity index, equal to the sum of the matching residues divided by the sum of all residues and gap characters, and then multiplied by 100 to express as a percent. Similarity index for related genes at the nucleotide level in accordance with the present invention can be greater than 70%, 80%, 85%, 90%, 95%, 99%, or more. Pairs of protein sequences can be aligned by the Lipman-Pearson method (e.g., Lipman and Pearson, Science, 227:1435-1441, 1985) with k-tuple set at 2, gap penalty set at 4, and gap length penalty set at 12. Results can be expressed as percent similarity index, where related genes at the amino acid level in accordance with the present invention can be greater than 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more. Various commercial and free sources of alignment programs are available, e.g., MegAlign by DNA Star, BLAST (National Center for Biotechnology Information), etc.

Another aspect of the present invention relates to methods and processes for detecting vascular tissue in a sample using a polynucleotide in accordance with the present invention. Such a polynucleotide can also be referred to as a "probe." The term "polynucleotide probe" has its customary meaning in the art, e.g., a polynucleotide which is effective to identify (e.g., by hybridization), when used in an appropriate process, the presence of a target polynucleotide to which it is designed. Identification can involve simply determining presence or absence, or it can be quantitative, e.g., in assessing amounts of a gene or gene transcript present in a sample. Probes can be useful in a variety of ways, such as for diagnostic purposes, to identify homologs, and to detect, quantitate, or isolate a polynucleotide of the present invention in a test sample. Assays can be utilized which permit quantification and/or presence/absence detection of a target nucleic acid in a sample. Any suitable assay format can be used, including, but not limited to, e.g., Southern blot analysis, Northern blot analysis, polymerase chain reaction ("PCR") (e.g., Saiki et al., Science, 241:53, 1988; U.S. Pat. Nos. 4,683,195, 4,683,202, and 6,040,166; PCR Protocols: A Guide to Methods and Applications, Innis et al., eds., Academic Press, New York, 1990), reverse transcriptase polymerase chain reaction ("RT- PCR"), anchored PCR, rapid amplification of cDNA ends ("RACE") (e.g., Schaefer in Gene Cloning and Analysis: Current Innovations, Pages 99-1 15, 1997), ligase chain reaction ("LCR") (EP 320 308), one-sided PCR (Ohara et al., Proc. Natl. Acad. Set, 86:5673-5677, 1989), indexing methods (e.g., U.S. Pat. No. 5,508,169), in situ hybridization, differential display (e.g., Liang et al., Nucl. Acid. Res., 21 :3269-3275, 1993; U.S. Pat. Nos. 5,262,31 1, 5,599,672 and 5,965,409; WO97/18454; Prashar and Weissman, Proc. Natl. Acad. ScL, 93:659-663, and U.S. Pat. No. 712,126; Welsh et al., Nucleic Acid Res., 20:4965-4970, 1992, and U.S. Pat. No. 5,487,985) and other RNA fingerprinting techniques, nucleic acid sequence based amplification ("NASBA") and other transcription based amplification systems (e.g., U.S. Pat. Nos. 5,409,818 and 5,554,527; WO 88/10315; 5,716,785), polynucleotide arrays (e.g., U.S. Pat. Nos. 5,143,854, 5,424,186; 5,700,637, 5,874,219, and 6,054,270; PCT WO 92/10092; PCT WO 90/15070), Qbeta Replicase (PCT/US87/00880), Strand Displacement Amplification ("SDA"), Repair Chain Reaction ("RCR"), nuclease protection assays, Rapid- Scan™, etc. Additional useful methods include, but are not limited to, e.g., template-based amplification methods, competitive PCR (e.g., U.S. Pat. No. 5,747,251), redox-based assays (e.g., U.S. Pat. No. 5,871,918), Taqman-based assays (e.g., Holland et al., Proc. Natl. Acad, ScL, 88:7276-7280, 1991 ; U.S. Pat. Nos. 5,210,015 and 5,994,063), real-time fluorescence- based monitoring (e.g., U.S. Pat. 5,928,907), molecular energy transfer labels (e.g., U.S. Pat. Nos. 5,348,853, 5,532,129, 5,565,322, 6,030,787, and 6,117,635; Tyagi and Kramer, Nature Biotech., 14:303-309, 1996). These and other methods can be carried out conventionally, e.g., as described in the mentioned publications. Many of such methods may require that the polynucleotide is labeled, or comprises a particular nucleotide type. The present invention includes such modified polynucleotides that are necessary to carry out such methods. Thus, polynucleotides can be DNA, RNA, DNA:RNA hybrids, PNA, etc., and can comprise any modification or substituent which is effective to achieve detection.

Detection can be desirable for a variety of different purposes, including research, diagnostic, and forensic. For diagnostic purposes, it may be desirable to identify the presence or quantity of a polynucleotide sequence in a sample, where the sample is obtained from tissue, cells, body fluids, etc. In a preferred method as described in more detail below, the present invention relates to a method of detecting a polynucleotide comprising, contacting a target polynucleotide in a test sample with a polynucleotide probe under conditions effective to achieve hybridization between the target and probe; and detecting hybridization.

Any test sample in which it is desired to identify a polynucleotide or polypeptide thereof can be used, including, e.g., blood, urine, saliva, stool, swabs comprising tissue, biopsied tissue, tissue sections, etc. Tissues can be of any type or stage, e.g., normal, benign, cancer, abnormal, suspect, etc.

Detection can be accomplished in combination with polynucleotide probes for other genes, e.g., genes which are selectively expressed in other tissues and cells, such as brain, heart, kidney, spleen, thymus, liver, stomach, small intestine, colon, muscle, lung, testis, placenta, pituitary, thyroid, skin, adrenal gland, pancreas, salivary gland, uterus, ovary, prostate gland, peripheral blood cells (T-cells, lymphocytes, etc.), embryo, breast, fat, adult and embryonic stem cells, specific cell-types, such as neurons, fibroblasts, myocytes, mesenchymal cells, etc.

Polynucleotides can also be used to test for mutations, e.g., using mismatch DNA repair technology as described in U.S. Pat. No. 5,683,877; U.S. Pat. No. 5,656,430; Wu et al., Proc. Natl. Acad. Sc , 89:8779-8783, 1992.

A polynucleotide of the present invention can comprise any continuous nucleotide sequence of SEQ ID NOS 1 and 3, or a complement thereto. These polynucleotides can be of any desired size, e.g., about 7-200 nucleotides, 8-100, 7-50, 10-25, 14-16, at least about 8, at least about 10, at least about 15, at least about 25, etc. The polynucleotides can have non-naturally-occurring nucleotides, e.g., inosine, AZT, 3TC, etc. The polynucleotides can have 100% sequence identity or complementarity to a sequence of SEQ ID NOS 1 and 3, or it can have mismatches or nucleotide substitutions, e.g., 1, 2, 3, 4, or 5 substitutions.

In accordance with the present invention, a polynucleotide can be present in a kit, where the kit includes, e.g., one or more polynucleotides, a desired buffer (e.g., phosphate, tris, etc.), detection compositions, RNA or cDNA from different tissues to be used as controls, libraries, etc. The polynucleotide can be labeled or unlabeled, with radioactive or non-radioactive labels as known in the art. Kits can comprise one or more pairs of polynucleotides for amplifying nucleic acids expressed in vascular tissue. Useful polynucleotide probes of the present invention include, e.g., TGGTGCATGTGCTTTGGACTAG (SEQ ID NO 5); AGGCAAATAGGTTCCAGCCTTG (SEQ ID NO 6). These include both sense (forward) and anti-sense (reverse) orientations. For instance, in PCR-based methods, a pair of primers are typically used, one having a sense sequence and the other having an antisense sequence.

Another aspect of the present invention is a nucleotide sequence that is specific to, or for, a selective polynucleotide. The phrase "specific sequence" to, or for, a polynucleotide, has a functional meaning that the polynucleotide can be used to identify the presence of a gene in a sample. It is specific in the sense that it can be used to detect polynucleotides above background noise ("non-specific binding"). A specific sequence is a defined order of nucleotides which occurs in the polynucleotide, e.g., in the nucleotide sequences of SEQ ID NOS 1 -4, but usually rarely or infrequently in other polynucleotides, preferably not in a mammalian polynucleotide, such as human, rat, mouse, etc. Specific nucleotide sequences include SEQ ID NOS. 5 and 6, or complements thereto. Such sequences can be used as probes in any of the methods described herein or incorporated by reference. Both sense and antisense nucleotide sequences are included. A specific polynucleotide according to the present invention can be determined routinely. A polynucleotide comprising such a specific sequence can be used as a hybridization probe to identify the presence of, e.g., human or mouse polynucleotide, in a sample comprising a mixture of polynucleotides, e.g., on a Northern blot. Hybridization can be performed under high stringent conditions (see, above) to select polynucleotides (and their complements which can contain the coding sequence) having at least 95% identity (i.e., complementarity) to the probe, but less stringent conditions can also be used. A specific polynucleotide sequence can also be fused in-frame, at either its s' or 3' end, to various nucleotide sequences as mentioned throughout the patent, including coding sequences for enzymes, detectable markers, GFP, etc, expression control sequences, etc.

A polynucleotide probe, especially one which is specific to a polynucleotide of the present invention, can be used in gene detection and hybridization methods as already described. In one embodiment, a specific polynucleotide probe can be used to detect whether a vascular tissue is present in a target sample. Starting from the polynucleotide, a specific polynucleotide probe can be designed which hybridizes (if hybridization is the basis of the assay) under the hybridization conditions to the polynucleotide, whereby the presence of the polynucleotide can be determined.

Probes which are specific for polynucleotides of the present invention can also be prepared using involve transcription-based systems, e.g., incorporating an RNA polymerase promoter into a polynucleotide of the present invention, and then transcribing anti-sense RNA using the polynucleotide as a template. See, e.g., U.S. Pat. No. 5,545,522. Along these lines, the present invention relates to methods of detecting vascular tissue tissue in a sample comprising nucleic acid, comprising one or more the following steps in any effective order, e.g., contacting said sample with a polynucleotide probe under conditions effective for said probe to hybridize specifically to nucleic acid in said sample, and detecting the presence or absence of probe hybridized to nucleic acid in said sample, wherein said probe is a polynucleotide which is E25b, a polynucleotide having about 70%, 80%, 90%, 95%, 99%, or more sequence identity thereto, or effective fragments thereof, and said polynucleotide is expressed in said vascular tissue. Contacting the sample with probe can be carried out by any effective means in any effective environment. It can be accomplished in a solid, liquid, frozen, gaseous, amorphous, solidified, coagulated, colloid, etc., mixtures thereof, matrix. For instance, a probe in an aqueous medium can be contacted with a sample which is also in an aqueous medium, or which is affixed to a solid matrix, or vice- versa. Generally, as used herein, the term "effective conditions" means, e.g., a milieu in which the desired effect is achieved. Such a milieu, includes, e.g., appropriate buffers, oxidizing agents, reducing agents, pH, co-factors, temperature, ion concentrations, suitable age and/or stage of cell (such as, in particular part of the cell cycle, or at a particular stage where particular genes are being expressed) where cells are being used, culture conditions (including substrate, oxygen, carbon dioxide, etc.). When hybridization is the chosen means of achieving detection, the probe and sample can be combined such that the resulting conditions are functional for said probe to hybridize specifically to nucleic acid in said sample. The phrase "hybridize specifically" indicates that the hybridization between single- stranded polynucleotides is based on nucleotide sequence complementarity. The effective conditions are selected such that the probe hybridizes to a preselected and/or definite target nucleic acid in the sample. For instance, if detection of a gene set forth in SEQ ID NOS 1-4 is desired, a probe can be selected which can hybridize to such target gene under high stringent conditions, without significant hybridization to other genes in the sample. To detect homologs of a gene set forth in SEQ ID NOS 1-4, the effective hybridization conditions can be less stringent, and/or the probe can comprise codon degeneracy, such that a homolog is detected in the sample.

As already mentioned, the method can be carried out by any effective process, e.g., by Northern blot analysis, polymerase chain reaction (PCR), reverse transcriptase PCR, RACE PCR, in situ hybridization, etc., as indicated above. When PCR based techniques are used, two or more probes are generally used. One probe can be specific for a defined sequence which is characteristic of a polynucleotide (e.g., SEQ ID NOS 5 and 6), but the other probe can be specific for the polynucleotide, or specific for a more general sequence, e.g., a sequence such as polyA which is characteristic of mRNA, a sequence which is specific for a promoter, ribosome binding site, or other transcriptional features, a consensus sequence (e.g., representing a functional domain). For the former aspects, 5' and 3' probes (e.g., polyA, Kozak, etc.) are preferred which are capable of specifically hybridizing to the ends of transcripts. When PCR is utilized, the probes can also be referred to as "primers" in that they can prime a DNA polymerase reaction.

A polynucleotide according to the present invention can comprise, e.g., DNA, RNA, synthetic polynucleotide, peptide polynucleotide, modified nucleotides, and mixtures thereof. A polynucleotide can be single-, or double-stranded, triplex, e.g., dsDNA, DNA:RNA, etc. Nucleotides comprising a polynucleotide can be joined via various known linkages, e.g., ester, sulfamate, sulfamide, phosphorothioate, phosphoramidate, methylphosphonate, carbamate, etc., depending on the desired purpose, e.g., resistance to nucleases, such as RNAse H, improved in vivo stability, etc. See, e.g., U.S. Pat. No. 5,378,825. Any desired nucleotide or nucleotide analog can be incorporated, e.g., 6-mercaptoguanine, 8-oxo-guanine, 8-oxo-guanine.

Various modifications can be made to the polynucleotides, such as attaching detectable markers (avidin, biotin, radioactive elements, fluorescent tags and dyes, energy transfer labels, energy-emitting labels, binding partners, etc.) or moieties which improve hybridization, detection, and/or stability. The polynucleotides can also be attached to solid supports, e.g., nitrocellulose, magnetic or paramagnetic microspheres (e.g., as described in U.S. Pat. No. 5,41 1,863; U.S. Pat. No. 5,543,289; for instance, comprising ferromagnetic, supermagnetic, paramagnetic, superparamagnetic, iron oxide and polysaccharide), nylon, agarose, diazotized cellulose, latex solid microspheres, polyacrylamides, etc., according to a desired method. See, e.g., U.S. Pat. Nos. 5,470,967; 5,476,925; 5,478,893.

Polynucleotide according to the present invention can be labeled according to any desired method. The polynucleotide can be labeled using radioactive tracers such as P, S, ³H, or ^l4C, to mention some commonly used tracers. The radioactive labeling can be carried out according to any method, such as, for example, terminal labeling at the 3' or 5' end using a radiolabeled nucleotide, polynucleotide kinase (with or without dephosphorylation with a phosphatase) or a ligase (depending on the end to be labeled). A non-radioactive labeling can also be used, combining a polynucleotide of the present invention with residues having immunological properties (antigens, haptens), a specific affinity for certain reagents

(ligands), properties enabling detectable enzyme reactions to be completed (enzymes or coenzymes, enzyme substrates, or other substances involved in an enzymatic reaction), or characteristic physical properties, such as fluorescence or the emission or absoφtion of light at a desired wavelength, etc. Mutated polynucleotide sequences of the present invention are useful for various purposes, e.g., to create mutations of the polypeptides they encode, to identify functional regions of genomic DNA (e.g., regulatatory regions upstream of the start of transcription), to produce probes for screening libraries, etc. Mutagenesis can be carried out routinely according to any effective method, e.g., oligonucleotide-directed (Smith, M., Ann. Rev. Genet.19:423-463, 1985), degenerate oligonucleotide-directed (Hill et al., Method

Enzymology, 155:558-568, 1987), region-specific (Myers et al., Science, 229:242-246, 1985), linker-scanning (McKnight and Kingsbury, Science, 217:316-324, 1982), directed using PCR, etc. Desired sequences can also be produced by the assembly of target sequences using mutually priming oligonucleotides (Uhlmann, Gene, 71 :29-40, 1988).

A mammalian polypeptide of the present invention is a full-length mammalian polypeptide having an amino acid sequence which is obtainable from a natural source, and which optionally has one or more of the mentioned biological activities. It can have sequences as shown in SEQ ID NOS 1-4, having an open-reading frame that begins with an initiation codon and ends with a stop codon. It includes naturally-occurring normal, naturally-occurring mutant, and naturally-occurring polymorphisms, including single nucleotide polymorphisms (SNP), differentially-spliced transcripts, etc., sequences. Natural sources include, e.g., living cells, e.g., obtained from tissues or whole organisms, cultured cell lines, including primary and immortalized cell lines, biopsied tissues, etc., as described above.

The present invention also relates to fragments of a mammalian polypeptide. The fragments are preferably "biologically active." By "biologically active," it is meant that the polypeptide fragment possesses an activity in a living system or with components of a living system. Biological activities include, e.g., protein-specific immunogenic activity.

A "protein-specific immunogenic activity" means, e.g., that a polypeptide derived from the protein elicits an immunological response that is selective for the protein. This immunological response can include one or more cellular and/or humoral components, e.g., the stimulation of antibodies, T-cells, macrophages, B-cells, dendritic cells, etc. The phrase "an antibody specific for a polypeptide sequence" has a related meaning, indicating that the antibody selectively recognizes a defined amino acid sequence. Immunological responses can be measured routinely. Fragments can be prepared according to any desired method, including, chemical synthesis, genetic engineering, cleavage products, etc. A biologically-fragment includes, e.g., polypeptide which have had amino acid sequences removed or modified at either the carboxy- or amino-terminus of the protein.

Polypeptides of the present invention, e.g., having an amino acid sequence as shown in SEQ ID NOS 2 and 4, can be analyzed by any suitable methods to identify other structural and/or functional domains in the polypeptide, including membrane spanning regions, hydrophobic regions. For example, a mammalian polypeptide can be analyzed by methods disclosed in, e.g., Kyte and Doolittle, / Mol. Bio.,157Λ05, 1982; EMBL Protein Predict; Rost and Sander, Proteins, 19:55-72, 1994.

As mentioned, polypeptides of the present invention can comprise various amino acid sequences (e.g., a full-length sequence, i.e., having a start and stop codon as shown in SEQ ID NOS 1-4, a mature amino acid sequence (i.e., where the polypeptide is produced as a precursor which is processed into a mature polypeptide, or fragments thereof). A fragment of a polypeptide of the present invention can be selected to have a specific biological activity. The measurement of these activities is described below. A useful fragment can comprise, or consist essentially of, e.g., about nine contiguous amino acids, about 10, 15, 20, 30, 40, etc. contiguous amino acids of SEQ ID NOS 2 and 4.

Other homologs of polypeptides of the present invention can be obtained from mammalian and non-mammalian sources according to various methods. For example, hybridization with a polynucleotide (e.g., SEQ ID NOS 5 and 6) can be employed to select homologs, e.g., as described in Sambrook et al., Molecular Cloning, Chapter 11, 1989. Such homologs can have varying amounts of nucleotide and amino acid sequence identity and similarity to such polypeptide. Mammalian organisms include, e.g., mouse, rats, monkeys, pigs, cows, etc. Non-mammalian organisms include, e.g., vertebrates, invertebrates, zebra fish, chicken, Drosophila, C. elegans, Xenopus, yeast such as S. pombe, S. cerevisiae, roundworms, prokaryotes, plants, Arabidopsis, artemia, viruses, etc. The degree of sequence identity human and mouse E25b polypeptide is about 95%. See, e.g., Fig. 1 for alignment.

The invention also relates to polypeptide-specific amino acid sequences, e.g., a defined amino acid sequence which is found in the particular sequences of SEQ ID NOS 2 and 4 and which can serve as a selective marker for such polypeptide. This usually means that the defined sequence is not found in any other naturally-occurring polypeptide.

However, such absolute specificity is not necessary for it to serve its marker function. The degree of selectivity that is required can depend upon the nature of the target sample. For instance, if it is desired to detect vascular tissue in brain tissue, it may be irrelevant that the amino acid sequence is present in other tissues, such as bone, as long as it is not expressed in constituents present in the brain. Specific and/or conserved amino acid sequences can be found routinely, e.g., by searching a gene/protein database using the BLAST set of computer programs. A polypeptide-specific amino acid sequence or motif can be useful to produce peptides as antigens to generate an immune response specific for it. Antibodies obtained by such immunization can be used as a specific probe for a mammalian polypeptide for diagnostic purposes, e.g., to identify the presence of vascular tissues.

A polypeptide of the present invention can also have 100% or less amino acid sequence identity to an amino acid sequence as set forth in SEQ ID NOS 2 and 4. For the purposes of the following discussion: Sequence identity means that the same nucleotide or amino acid which is found in the sequence set forth in SEQ ID NOS 2 and 4 is found at the corresponding position of the compared sequence(s). A polypeptide having less than 100% sequence identity to the amino acid sequences set forth in SEQ ID NOS 2 and 4 can contain various substitutions from the naturally-occurring sequence, including homologous and non-homologous amino acid substitutions. See below for examples of homologous amino acid substitution. The sum of the identical and homologous residues divided by the total number of residues in the sequence over which the polypeptide is compared is equal to the percent sequence similarity. For purposes of calculating sequence identity and similarity, the compared sequences can be aligned and calculated according to any desired method, algorithm, computer program, etc., including, e.g., BLAST. A polypeptide having less than 100% amino acid sequence identity to the amino acid sequence of SEQ ID NOS 2 and 4 can have about 99%, 98%, 97%, 95%, 90%, 90%, 87% 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, sequence identity or similarity.

The present invention also relates to polypeptide muteins. By the "mutein," it is meant any polypeptide which has an amino acid sequence which differs in amino acid sequence from an amino acid sequence obtainable from a natural source (a fragment of a mammalian polypeptide of the present invention does not differ in amino acid sequence from a naturally-occurring polypeptide although it differs in amino acid number). Thus, polypeptide muteins comprise amino acid substitutions, insertions, and deletions, including non-naturally occurring amino acids. Muteins to a polypeptide sequence of the invention can also be prepared based on homology searching from gene data banks, e.g., Genbank, EMBL. Sequence homology searching can be accomplished using various methods, including algorithms described in the BLAST family of computer programs, the Smith- Waterman algorithm, etc. A mutein(s) can be introduced into a sequence by identifying and aligning amino acids within a domain which are identical and/or homologous between polypeptides and then modifying an amino acid based on such alignment. When a conserved or homologous amino acid is replaced by a non- homologous amino acid, such replacement or substitution can be expected to reduce, decrease, eliminate, or increase a biological activity. For instance, where alignment reveals identical amino acids conserved between two or more domains, elimination or substitution of the amino acid(s) would be expected to affect its biological activity. The effects of such mutations on activity can be determined by various assays described below and as a skilled worker would know.

Amino acid substitution can be made by replacing one homologous amino acid for another. Homologous amino acids can be defined based on the size of the side chain and degree of polarization, including, small nonpolar: cysteine, proline, alanine, threonine; small polar: serine, glycine, aspartate, asparagine; large polar: glutamate, glutamine, lysine, arginine; intermediate polarity: tyrosine, histidine, tryptophan; large nonpolar: phenylalanine, methionine, leucine, isoleucine, valine. Homologous acids can also be grouped as follows: uncharged polar R groups, glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine; acidic amino acids (negatively charged), aspartic acid and glutamic acid; basic amino acids (positively charged), lysine, arginine, histidine. Homologous amino acids also include those described by Dayhoff in the Atlas of Protein Sequence and Structure 5, 1978, and by Argos in EMBO J., 8, 779-785, 1989.

A mammalian polypeptide of the present invention, fragments, or substituted polypeptides thereof, can also comprise various modifications, where such modifications include lipid modification, methylation, phosphorylation, glycosylation, covalent modifications (e.g., of an R-group of an amino acid), amino acid substitution, amino acid deletion, or amino acid addition. Modifications to the polypeptide can be accomplished according to various methods, including recombinant, synthetic, chemical, etc.

Polypeptides of the present invention (e.g., full-length, fragments thereof, mutations thereof) can be used in various ways, e.g., in assays, as immunogens for antibodies as described below, as biologically-active, as inhibitors, etc. A polypeptide of the present invention, a derivative thereof, or a fragment thereof, can be combined with one or more structural domains, functional domains, detectable domains, antigenic domains, and/or a desired polypeptide of interest, in an arrangement which does not occur in nature, i.e., not naturally-occurring. A polypeptide comprising such features is a chimeric or fusion polypeptide. Such a chimeric polypeptide can be prepared according to various methods, including, chemical, synthetic, quasi-synthetic, and/or recombinant methods. A chimeric polynucleotide coding for a chimeric polypeptide can contain the various domains or desired polypeptides in a continuous (e.g., with multiple N-terminal domains to stabilize or enhance activity) or interrupted open reading frame, e.g., containing introns, splice sites, enhancers, etc. The chimeric polynucleotide can be produced according to various methods. See, e.g., U.S. Pat. No. 5,439,819. A domain or desired polypeptide can possess any desired property, including, a biological function such as signaling, growth promoting, cellular targeting (e.g., signal sequence, targeting sequence, such as targeting to the endoplasmic reticulum or nucleus), etc., a structural function such as hydrophobic, hydrophilic, membrane-spanning, etc., receptor-ligand functions, and/or detectable functions, e.g., combined with enzyme, fluorescent polypeptide, green fluorescent protein, (Chalfie et al., Science, 263:802, 1994; Cheng et al., Nature Biotechnology, 14:606, 1996; Levy et al., Nature Biotechnology, 14:610, 1996), etc. In addition, a polypeptide, or a part of it, can be used as a selectable marker when introduced into a host cell. For example, a polynucleotide coding for an amino acid sequence according to the present invention can be fused in-frame to a desired coding sequence and act as a tag for purification, selection, or marking purposes. The region of fusion can encode a cleavage site to facilitate expression, isolation, purification, etc.

A polypeptide according to the present invention can be produced in an expression system, e.g., in vivo, in vitro, cell-free, recombinant, cell fusion, etc., according to the present invention. Modifications to the polypeptide imparted by such systems include glycosylation, amino acid substitution (e.g., by differing codon usage), polypeptide processing such as digestion, cleavage, endopeptidase or exopeptidase activity, attachment of chemical moieties, including sugars, lipids, phosphates, etc. A polynucleotide according to the present invention can be expressed in a variety of different systems, in vitro and in vivo, according to the desired purpose. For example, a polynucleotide can be inserted into an expression vector, introduced into a desired host, and cultured under conditions effective to achieve expression of a polypeptide coded for by the polynucleotide. Effective conditions include any culture conditions which are suitable for achieving production of the polypeptide by the host cell, including effective temperatures, pH, medium, additives to the media in which the host cell is cultured (e.g., additives which amplify or induce expression such as butyrate, or methotrexate if the coding polynucleotide is adjacent to a dhfr gene), cycloheximide, cell densities, culture dishes, etc. A polynucleotide can be introduced into the cell by any effective method including, e.g., naked DNA, calcium phosphate precipitation, electroporation, injection, DEAE-Dextran mediated transfection, fusion with liposomes, association with agents which enhance its uptake into cells, viral transfection. A cell into which a polynucleotide of the present invention has been introduced is a transformed host cell. The polynucleotide can be extrachromosomal or integrated into a chromosome(s) of the host cell. It can be stable or transient. An expression vector is selected for its compatibility with the host cell. Host cells include, mammalian cells, e.g., COS, CV1, BHK, CHO, HeLa, LTK, NIH 3T3, 293, endothelial, epithelial, muscle, embryonic and adult stem cells, ectodermal, mesenchymal, endodermal, neoplastic, blood, bovine CPAE (CCL-209), bovine FBHE (CRL-1395), human HUV-EC-C (CRL-1730), mouse SVEC4-10EHR1 (CRL-2161), mouse MSI (CRL-2279), mouse MSI VEGF (CRL- 2460), insect cells, such as Sf9 (S. frugipeda) and Drosophila, bacteria, such as E. coli, Streptococcus, bacillus, yeast, such as Sacharomyces, S. cerevisiae, fungal cells, plant cells, embryonic or adult stem cells (e.g., mammalian, such as mouse or human).

Expression control sequences are similarly selected for host compatibility and a desired purpose, e.g., high copy number, high amounts, induction, amplification, controlled expression. Other sequences which can be employed include enhancers such as from SV40, CMV, RSV, inducible promoters, cell-type specific elements, or sequences which allow selective or specific cell expression. Promoters that can be used to drive its expression, include, e.g., the endogenous promoter, promoters active in endothelial or angiogenic- forming cells, MMTV, SV40, tip, lac, tac, or T7 promoters for bacterial hosts; or alpha factor, alcohol oxidase, or PGH promoters for yeast. RNA promoters can be used to produced RNA transcripts, such as T7 or SP6. See, e.g., Melton et al., Polynucleotide Res., 12(18):7035-7056, 1984; Dunn and Studier. /. Mol. Bio., 166:477-435, 1984; U.S. Pat. No. 5,891,636; Studier et al., Gene Expression Technology, Methods in Enzymology, 85:60-89, 1987.

When a polynucleotide is expressed as a heterologous gene in a transfected cell line, the gene is introduced into a cell as described above, under effective conditions in which the gene is expressed. The term "heterologous" means that the gene has been introduced into the cell line by the "hand-of-man." Introduction of a gene into a cell line is discussed above. The transfected (or transformed) cell expressing the gene can be lysed or the cell line can be used intact.

For expression and other purposes, a polynucleotide can contain codons found in a naturally-occurring gene, transcript, or cDNA, for example, e.g., as set forth in SEQ ID NOS 1 -4, or it can contain degenerate codons coding for the same amino acid sequences. For instance, it may be desirable to change the codons in the sequence to optimize the sequence for expression in a desired host.

A polypeptide according to the present invention can be recovered from natural sources, transformed host cells (culture medium or cells) according to the usual methods, including, detergent extraction (e.g., non-ionic detergent, Triton X-100, CHAPS, octylglucoside, Igepal CA-630), ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography, lectin chromatography, gel electrophoresis. Protein refolding steps can be used, as necessary, in completing the configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for purification steps. Another approach is express the polypeptide recombinantly with an affinity tag (Flag epitope, HA epitope, myc epitope, 6xHis, maltose binding protein, chitinase, etc) and then purify by anti-tag antibody-conjugated affinity chromatography.

Antisense polynucleotide (e.g., RNA) can also be prepared from a polynucleotide according to the present invention, preferably an anti-sense to a sequence of SEQ ID NOS 1 and 3. Antisense polynucleotide can be used in various ways, such as to regulate or modulate expression of the polypeptides they encode, e.g., inhibit their expression, for in situ hybridization, for therapeutic purposes, for making targeted mutations (in vivo, triplex, etc.) etc. For guidance on administering and designing anti-sense, see, e.g., U.S. Pat. Nos. 6,153,595, 6,133,246, 6,117,847, 6,096,722, 6,087,343, 6,040,296, 6,005,095, 5,998,383, 5,994,230, 5,891,725, 5,885,970, and 5,840,708. An antisense polynucleotides can be operably linked to an expression control sequence. A total length of about 35 bp can be used in cell culture with cationic liposomes to facilitate cellular uptake, but for in vivo use, preferably shorter oligonucleotides are administered, e.g. 25 nucleotides.

Antisense polynucleotides can comprise modified, nonnaturally-occurring nucleotides and linkages between the nucleotides (e.g., modification of the phosphate-sugar backbone; methyl phosphonate, phosphorothioate, or phosphorodithioate linkages; and 2'-O-methyl ribose sugar units), e.g., to enhance in vivo or in vitro stability, to confer nuclease resistance, to modulate uptake, to modulate cellular distribution and compartmentalization, etc. Any effective nucleotide or modification can be used, including those already mentioned, as known in the art, etc., e.g., disclosed in U.S. Pat. Nos. 6,133,438; 6,127,533; 6,124,445; 6,121,437; 5,218,103 (e.g., nucleoside thiophosphoramidites); 4,973,679; Sproat et al., "2'-O- Methyloligoribonucleotides: synthesis and applications," Oligonucleotides and Analogs A Practical Approach, Eckstein (ed.), IRL Press, Oxford, 1991 , 49-86; Iribarren et al., "2'O- Alkyl Oligoribonucleotides as Antisense Probes ' Proc. Natl. Acad. Sci. USA, 1990, 87, 7747-7751; Cotton et al., "2'-O-methyl, 2'-O-ethyl oligoribonucleotides and phosphorothioate oligodeoxyribonucleotides as inhibitors of the in vitro U7 snRNP-dependent mRNA processing event," Nucl. Acids Res., 1991, 19, 2629-2635. The present invention also relates to specific-binding partners, such as antibodies, aptamers, and polynucleotide sequences that specifically recognize a polynucleotide or polypeptide of the present invention. A specific-binding partner is a molecule, which through chemical or physical forces, selectively binds or attaches to a polynucleotide. tide. Specific binding partners generally are referred to in pairs, e.g., antigen and antibody, ligand and receptor. The same general definitions, compositions, and methods which are described for antibodies, applies to other classes of specific-binding partners, as well.

An antibody specific for a polypeptide means that the antibody recognizes a defined sequence of amino acids within or including the polypeptide, e.g., the sequence of SEQ ID NO 2 and 4. Thus, a specific antibody will generally bind with higher affinity to an amino acid sequence of a defined than to a different epitope(s), e.g., as detected and/or measured by an immunoblot assay or other conventional immunoassay. Thus, an antibody which is specific for an epitope of a polypeptide is useful to detect the presence of the epitope in a sample, e.g., a sample of tissue containing human polypeptide product, distinguishing it from samples in which the epitope is absent. Such antibodies are useful as described in Santa Cruz Biotechnology, Inc., Research Product Catalog, and can be formulated accordingly. Antibodies, e.g., polyclonal, monoclonal, recombinant, chimeric, humanized, single- chain, Fab, and fragments thereof, can be prepared according to any desired method. See, also, screening recombinant immunoglobulin libraries (e.g., Orlandi et al., Proc. Natl. Acad. Sci., 86:3833-3837, 1989; Huse et al., Science, 256:1275-1281, 1989); in vitro stimulation of lymphocyte populations; Winter and Milstein, Nature, 349: 293-299, 1991. For example, for the production of monoclonal antibodies, a polypeptide according to SEQ ID NOS 2 and 4 can be administered to mice, goats, rabbits, chickens, etc., subcutaneously and/or intraperitoneally, with or without adjuvant, in an amount effective to elicit an immune response. The antibodies can be IgM, IgG, subtypes, IgG2a, IgGl, etc. Antibodies, and immune responses, can also be generated by administering naked DNA See, e.g., U.S. Pat. Nos. 5,703,055; 5,589,466; 5,580,859. Antibodies can be used from any source, including, goat, rabbit, mouse, chicken (e.g., IgY; see, Duan, WO/029444 for methods of making antibodies in avian hosts, and harvesting the antibodies from the eggs)

Polypeptides of SEQ ID NOS 1-4, or fragments thereof, for use in the induction of antibodies do not need to have biological activity; however, they must have immunogenic activity, either alone or in combination with a carrier. Peptides for use in the induction of specific antibodies may have an amino sequence consisting of at least five amino acids, preferably at least 10 amino acids. Short stretches of amino acids, e.g., five amino acids, can be fused with those of another protein such as keyhole limpet hemocyanin, or another useful carrier, and the chimeric molecule used for antibody production. Regions of the polypeptides useful in making antibodies can be selected empirically, or, e.g., an amino acid sequence, as deduced from the cDNA, can be analyzed to determine regions of high immunogenicity. Analysis to select appropriate epitopes is described, e.g., by Ausubel FM et al (1989, Current Protocols in Molecular Biology, Vol 2. John Wiley & Sons).

Particular antibodies are useful for the diagnosis of prepathologic conditions, and chronic or acute diseases which are characterized by differences in the amount or distribution of the polypeptides. Diagnostic tests for the polypeptides include methods utilizing the antibody and a label to detect polypeptide in human (or mouse, etc, if using mouse, etc.) body fluids, tissues or extracts of such tissues.

The polypeptides and antibodies of the present invention may be used with or without modification. Frequently, the polypeptides and antibodies will be labeled by joining them, either covalently or noncovalently, with a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and have been reported extensively in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like. Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.

Antibodies and other specific-binding partners which bind polypeptide can be used in various ways, including as therapeutic, diagnostic, and commercial research tools, e.g., to quantitate the levels of polypeptide in animals, tissues, cells, etc., to identify the cellular localization and/or distribution of it, to purify it, or a polypeptide comprising a part of it, to modulate the function of it, in Western blots, ELISA, dot blot, immunoprecipitation, RIA, FACS analysis, etc. The present invention relates to such assays, compositions and kits for performing them, etc. Utilizing these and other methods, an antibody according to the present invention can be used to detect polypeptide or fragments thereof in various samples, including tissue, cells, body fluid, blood, urine, cerebrospinal fluid. In addition, ligands which bind to a polypeptide according to the present invention, or a derivative thereof, can also be prepared, e.g., using synthetic peptide libraries or aptamers (e.g., Pitrung et al., U.S. Pat. No. 5,143,854; Geysen et al., J. Immunol. Methods, 102:259-274, 1987; Scott et al., Science, 249:386, 1990; Blackwell et al., Science, 250:1104, 1990; Tuerk et al., 1990, Science, 249: 505). The present invention thus relates to methods of detecting vascular tissue in a sample, comprising one or more of the following steps in any effective order, e.g., contacting said sample with a specific-binding partner, such as an antibody which is specific for E25b or a family member thereof, under conditions effective for said specific-binding partner to specifically-bind to said protein, wherein said protein is expressed in said vascular tissue, and detecting the presence or absence of specific binding partner specifically-bound to said protein in said sample. As mentioned for nucleic acid-based assays, the method can be accomplished in any effective format, including in solid, liquid, tissue sections, glass slides, etc., matrices, using any effective processes and means of detection as described above.

Specific-binding partners can also be used in methods of in vivo imaging using, e.g., MRI, SPECT, planar scintillation imaging. The phrase "in vivo imaging" refers to any method which allows the detection of a specific-binding partner located in a subject's body. Radionuclides, paramagnetic isotopes can be utilized. A radionuclide can be bound to a specific-binding partner either directly or indirectly using a functional group. Intermediary functional groups include, e.g., EDTA and DPTA. Examples of suitable metallic ions include, 99-Tc, 123-1, 131-1, 111-In, 97-Ru, 67-Cu, 67-Ga, 125-1, 68-Ga, 72-As, 89-Zr, 201- Tl. Elements useful in MRI include, 157-Gd, 55-Mn, 162-Dy, 52-Cr, 56-Fe.

Specific-binding partners can also be isolated from natural sources. Many polypeptide and polynucleotides interact with other molecules that are found naturally in cells and tissues. Such interactions can be involved in regulating or modulating activity, e.g., as transcription factors, protein regulatory subunits, etc. Various methods can be utilized to isolated specific-binding partners, e.g., mobility shift DNA binding assays, methylation and uracil interference assays, DNAse I footprint analysis, UV cross-linking, interaction trap/two- hybrid system, affinity purification of proteins binding to GST fusions (Blanar and Rutter, Science, 256:1014-1018, 1992), phage-based expression cloning, etc. The present invention also relates to electronic forms of polynucleotides, polypeptides, etc., of the present invention, including computer-readable medium (e.g., magnetic, optical, etc., stored in any suitable format, such as flat files or hierarchical files) which comprise such sequences, or fragments thereof, e-commerce-related means, etc. Along these lines, the present invention relates to methods of retrieving gene and polypeptide sequences expressed in vascular tissue from a computer-readable medium, comprising, one or more of the following steps in any effective order, e.g., selecting a gene expression profile, e.g., a profile that specifies that said gene is expressed in vascular tissue, and retrieving these gene sequences, where the gene sequences consist of human and mouse E25b.

A "gene expression profile" means the list of tissues, cells, etc., in which a defined gene is expressed (i.e, transcribed and/or translated). The profile can be a list of the tissues in which the gene is expressed, but can include additional information as well, including level of expression (e.g., a quantity as compared or normalized to a control gene), and information on temporal (e.g., at what point in the cell-cycle or developmental program) and spatial expression. By the phrase "selecting a gene expression profile," it is meant that a user decides what type of gene expression pattern he is interested in retrieving, e.g., he may require that the gene is expressed in a tissue, or he may require that the gene is not expressed in blood, but must be expressed in vascular tissue. Any pattern of expression preferences may be selected. The selecting can be performed by any effective method. In general, "selecting" refers to the process in which a user forms a query that is used to search a database of gene expression profiles. The step of retrieving involves searching for results in a database that correspond to the query set forth in the selecting step. Any suitable algorithm can be utilized to perform the search query, including algorithms that look for matches, or that perform optimization between query and data. The database is information that has been stored in an appropriate storage medium, having a suitable computer-readable format. Once results are retrieved, they can be displayed in any suitable format, such as HTML. For instance, the user may be interested in identifying genes that are expressed in vascular tissue. He may not care whether small amounts of expression occur in other tissues, as long as such genes are not expressed in peripheral blood lymphocytes. A query is formed by the user to retrieve the set of genes from the database having the desired gene expression profile. Once the query is inputted into the system, a search algorithm is used to interrogate the database, and retrieve results.

In addition to the uses mentioned above, polynucleotides and polypeptides of the present invention can be utilized and applied in any useful process. The polynucleotides, and the polypeptides encoded thereby, can be used for additional functional studies, e.g., in creating transgenic cells, tissues, and animals in which the gene is augmented or knocked- out. Thus, the present invention also relates to a transgenic animal, e.g., a non-human-mammal, such as a mouse, comprising a polynucleotide of the present invention, or in which a polynucleotide present in the genomic DNA has been functionally-disrupted, targeted, or otherwise modified. Transgenic animals can be prepared according to known methods, including, e.g., by pronuclear injection of recombinant genes into pronuclei of 1-cell embryos, incorporating an artificial yeast chromosome into embryonic stem cells, gene targeting methods, embryonic stem cell methodology. See, e.g., U.S. Patent Nos. 4,736,866; 4,873,191; 4,873,316; 5,082,779; 5,304,489; 5,174,986; 5,175,384; 5,175,385; 5,221,778; Gordon et al., Proc. Natl. Acad. Sci., 77:7380-7384, 1980; Palmiter et al., Cell, 41 :343-345, 1985; Palmiter et al., Ann. Rev. Genet., 20:465-499, 1986; Askew et al., Mol. Cell. Bio., 13:4115-4124, 1993; Games et al. Nature, 373:523-527, 1995; Valancius and Smithies, Mol. Cell. Bio., 11:1402-1408, 1991; Stacey et al., Mol. Cell. Bio., 14:1009-1016, 1994; Hasty et al., Nature, 350:243-246, 1995; Rubinstein et al., Nucl. Acid Res., 21:2613-2617,1993. For guidance on recombinase excision systems, see, e.g., U.S. Pat. Nos. 5,626,159, 5,527,695, and 5,434,066. See also, Orban, P.C., et al., "Tissue-and Site-Specific DNA Recombination in Transgenic Mice", Proc. Natl. Acad. Sci. USA, 89:6861-6865 (1992); O'Gorman, S., et al., "Recombinase-Mediated Gene Activation and Site-Specific Integration in Mammalian

Cells", Science, 251:1351-1355 (1991); Sauer, B., et al., "Cre-stimulated recombination at loxP-Containing DNA sequences placed into the mammalian genome", Polynucleotides Research, 17(1):147-161 (1989). A polynucleotide according to the present invention can be introduced into any non-human mammal, including a mouse (Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1986), pig (Hammer et al., Nature, 315:343-345, 1985), sheep (Hammer et al., Nature, 315:343-345, 1985), cattle, rat, or primate. See also, e.g., Church, 1987, Trends in Biotech. 5:13-19; Clark et al., Trends in Biotech. 5:20-24, 1987); and DePamphilis et al., BioTechniques, 6:662-680, 1988. Polynucleotides, polypeptides, and specific-binding partners thereto, can be utilized in therapeutic applications, especially to treat diseases and conditions of the blood vessels. Useful methods include, but are not limited to, immunotherapy (e.g., using specific-binding partners to polypeptides), vaccination (e.g., using a polypeptide or a naked DNA encoding such polypeptide), protein or polypeptide replacement therapy, gene therapy (e.g., germ-line correction, antisense), etc.

Various immunotherapeutic approaches can be used. For instance, unlabeled antibody that specifically recognizes a vascular antigen, such as E25b, can be used to stimulate the body to destroy or attack the cancer, to cause down-regulation, to produce complement-mediated lysis, to inhibit cell growth, etc., of target cells which display the antigen, e.g., analogously to how c-erbB-2 antibodies are used to treat breast cancer. In addition, antibody can be labeled or conjugated to enhance its deleterious effect, e.g., with radionuclides and other energy emitting entitities, toxins, such as ricin, exotoxin A (ETA), and diphtheria, cytotoxic or cytostatic agents, immunomodulators, chemotherapeutic agents, etc. See, e.g., U.S. Pat. No. 6,107,090.

The antibody can be conjugated to a second molecule, such as a cytotoxic agent, and used for targeting the second molecule to an E25b protein positive cell (Nitetta, E. S. et al., 1993, Immunotoxin therapy, in DeVita, Jr., V. T. et al., eds, Cancer: Principles and Practice of Oncology, 4th ed., J. B. Lippincott Co., Philadelphia, 2624-2636). Examples of cytotoxic agents include, but are not limited to, antimetabolites, alkylating agents, anthracyclines, antibiotics, anti-mitotic agents, radioisotopes and chemotherapeutic agents. Further examples of cytotoxic agents include, but are not limited to ricin, doxorubicin, daunorubicin, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxy anthracin dione, actinomycin D, 1 -dehydrotestosterone, diptheria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, elongation factor-2 and glucocorticoid. Techniques for conjugating therapeutic agents to antibodies are well known (see, e.g., Arnon et al.; Reisfeld et al., 1985; Hellsfrom et al.; Robinson et al., 1987; Thorpe, 1985; and Thorpe et al., 1982).

In addition to immunotherapy, polynucleotides and polypeptides can be used as targets for non-immuno therapeutic applications, e.g., using compounds which interfere with function, expression (e.g., antisense as a therapeutic agent), assembly, etc. Delivery of therapeutic agents can be achieved according to any effective method, including, liposomes, viruses, plasmid vectors, bacterial delivery systems, orally, systemically, etc.

The present invention also relates to detecting the presence and/or extent of blood vessels in a sample. The detected blood vessels can be established or pre-existing vessels, newly formed vessels, vessels in the process of forming, or combinations thereof. A blood vessel includes any biological structure that conducts blood, including arteries, veins, capillaries, microvessels, vessel lumen, endothelial-lined sinuses, etc. These methods are useful for a variety of purposes. In cancer, for instance, the extent of vascularization can be an important factor in determining the clinical behavior of neoplastic cells. See, e.g., Weidner et al., N Engl. J. Med., 324:1-8, 1991. Thus, an angiogenic index can be useful for the diagnosis, prognosis, treatment, etc., of cancer and other neoplasms. Detection of vessels can also be utilized for the diagnosis, prognosis, treatment, of any diseases or conditions associated with vessel growth and production, to assess agents which modulate angiogenesis, to assess angiogenic gene therapy, etc.

An example of a method of detecting the presence or extent of blood vessels in a sample is determining an angiogenic index of a tissue or cell sample comprising, e.g., assessing the amounts of a mammalian E25b (or any member of the E25b family) nucleic acid (such as an mRNA) or polypeptide in the sample, whereby the amount of E25b or E25b family nucleic acid or polypeptide is indicative of the angiogenic index of the tissue or cell sample. By the phrase "angiogenic index," it is meant the extent or degree of vascularity of the tissue, e.g., the number or amount of blood vessels in the sample of interest.

Amounts of nucleic acid or polypeptide can be assessed (e.g., determined, detected, etc.) by any suitable method. For instance, if nucleic acid is to be assessed, e.g., an mRNA corresponding to E25b, the methods for detecting it, assessing its presence and/or amount, can be determined by any the methods mentioned above, e.g., nucleic acid based detection methods, such as Northern blot analysis, RT-PCR, RACE, differential display, NASBA and other transcription based amplification systems, polynucleotide arrays, etc. If RT- PCR is employed, cDNA can be prepared from the mRNA extracted from a sample of interest. Once the cDNA is obtained, PCR can be employed using oligonucleotide primer pairs that are specific for E25b, or for any member of its family. The specific probes can be of a single sequence, or they can be a combination of different sequences, e.g., based on a consensus sequence to detect E25b family members. A polynucleotide array can also be used to assess E25b, e.g., where the RNA of the sample of interest is labeled (e.g., using a transcription based amplification method, such as U.S. Pat. No. 5,716,785) and then hybridized to a probe fixed to a solid substrate. There is no limitation on how detection is performed.

Polypeptide detection can also be carried out by any available method, e.g., by Western blots, ELISA, dot blot, immunoprecipitation, RIA, immunohistochemistry, etc. For instance, a tissue section can be prepared and labeled with an E25b antibody (indirect or direct), visualized with a microscope, and then the number of vessels in a particular field of view counted, where staining with antibody is used to identify and count the vessels.

Amount of E25b polypeptide can be quantitated without visualization, e.g., by preparing a lysate of a sample of interest, and then determining by ELISA or Western the amount of polypeptide per quantity of tissue. Again, there is no limitation on how detection is performed.

In addition to assessing the angiogenic index using E25b antibody, other methods of determining tissue vascularity can be applied. Tissue vascularity is typically determined by assessing the number and density of vesssels present in a given sample. For example, micro vessel density (MVD) can be estimated by counting the number of endothelial clusters in a high-power microscopic field, or detecting a marker specific for microvascular endothelium or other markers of growing or established blood vessels, such as CD31 (also known as platelet-endothelial cell adhesion molecule or PECAM). A CD31 antibody can be employed in conventional immunohistological methods to immunostain tissue sections as described by, e.g., Penfold et al., Br. J. Oral andMaxill. Surg., 34: 37-41; U.S. Pat. No. 6,017,949; Delias et al., Gyn. Oncol, 67:27-33, 1997; and others.

In addition to E25b, or a family member thereof, other genes and their corresponding products can be detected. For instance, it may be desired to detect a gene which is expressed ubiquitously in the sample. A ubiquitously expressed gene, or product thereof, is, e.g., present in all cell types, e.g., in about the same amount, e.g., beta-actin. Similarly, a gene or polypeptide that is expressed selectively in the tissue or cell of interest can be detected. A selective gene or polypeptide is characteristic of the tissue or cell-type in which it is made. This can mean that it is expressed only in the tissue or cell, and in no other tissue- or cell- type, or it can mean that it is expressed preferentially, differentially, and more abundantly (e.g., at least 5-fold, 10-fold, etc., or more) when compared to other types. The expression of the ubiquitous or selective gene or gene product can be used as a control or reference marker to compare to the E25b expression. Typically, expression of the gene can be assessed by detecting mRNA produced from it.

Other markers for blood vessels and angiogenesis can also be detected in combination with E25b (simultaneously, sequentially, etc.), such as angiogenesis-related genes or polypeptides. By the phrase "angiogenesis-related," it is meant that it is associated with blood vessels and therefore indicative of their presence. There are a number of different genes and gene products that are angiogenesis-related, e.g., Vezfl (e.g., Xiang et al., Dev. Bio., 206:123-141, 1999), VEGF, VEGF receptors (such as KDR/Flk-1), angiopoietin, Tie-1 and Tie-2 (e.g., Sato et al., Nature, 376:70-74, 1995), PECAM-1 or CD31 (e.g., DAKO, Glostrup. Denmark), CD34, factor VHI-related antigen (e.g., Brustmann et al., Gyn. Oncol., 67:20-26, 1997).

Angiogenesis can also be assessed by characterizing a mammalian E25b gene, or any member of the E25b gene family, in a sample of interest. The step of "characterizing" refers to any method, means, etc., of assessing or describing the status of the E25b gene. This includes determining its genomic structure (e.g., to identify mutations in the coding and non- coding regions founds in the introns and 5' and 3' untranslated regions), measuring its expression levels (e.g., by measuring amounts of E25b mRNA or polypeptide in a sample), and determining the transcripts that arise from the E25b gene (e.g., looking for the different splice- variants of E25b). For instance, characterizing includes determining the presence of mutations in E25b, such as those disclosed in Vidal et al., supra.

The present invention also relates to methods of identifying modulators of a member of a mammalian E25b gene or polypeptide family in a cell population capable of forming blood vessels, comprising, one or more of the following steps in any effective order, e.g., contacting the cell population with a test agent under conditions effective for said test agent to modulate the mammalian E25b gene or polypeptide in said cell population, and determining whether said test agent modulates the gene or polypeptide. These methods are useful, e.g., for drug discovery in identifying and confirming the angiogenic activity of agents, for identifying molecules in the normal pathway of angiogenesis, etc.

Any cell population capable of forming blood vessels can be utilized. Useful models, included those mentioned above, e.g., in vivo Matrigel®-type assays, tumor neovascularization assays, CAM assays, BCE assays, migration assays, HUVEC growth inhibition assays, animal models (e.g., tumor growth in athymic mice), models involving hybrid cell and electronic-based components, etc. Cells can include, e.g., endothelial, epithelial, muscle, embryonic and adult stem cells, ectodermal, mesenchymal, endodermal, neoplastic, blood, bovine CPAE (CCL-209), bovine FBHE (CRL-1395), human HUV-EC-C (CRL-1730), mouse SVEC4-10EHR1 (CRL-2161), mouse MSI (CRL-2279), mouse MSI VEGF (CRL-2460), etc. The phrase "capable of forming blood vessels" does not indicate a particular cell-type, but simply that the cells in the population are able under appropriate conditions to form blood vessels. In some circumstances, the population may be heterogeneous, comprising more than one cell-type, only some which actually differentiate into blood vessels, but others which are necessary to initiate, maintain, etc., the process of vessel formation.

The cell population can be contacted with the test agent in any manner and under any conditions suitable for it to exert an effect on the cells, and to modulate the E25b gene or polypeptide. The means by which the test agent is delivered to the cells may depend upon the type of test agent, e.g., its chemical nature, and the nature of the cell population. Generally, a test agent must have access to the cell population, so it must be delivered in a form (or pro- form) that the population can experience physiologically, i.e., to put in contact with the cells. For instance, if the intent is for the agent to enter the cell, if necessary, it can be associated with any means that facilitate or enhance cell penetrance, e.g., associated with antibodies or other reagents specific for cell-surface antigens, liposomes, lipids, chelating agents, targeting moieties, etc. Cells can also be treated, manipulated, etc., to enhance delivery, e.g., by electroporation, pressure variation, etc. A purpose of administering or delivering the test agents to cells capable of forming blood vessels is to determine whether they modulate a member of the E25b gene or polypeptide family. By the phrase "modulate/' it is meant that the gene or polypeptide effects the polypeptide or gene in some way. Modulation includes effects on transcription, RNA splicing, RNA editing, transcript stability and turnover, translation, polypeptide activity, and, in general, any process involved in the expression and production of the gene and gene product. The modulatory activity can be in any direction, and in any amount, including, up, down, enhance, increase, stimulate, activate, induce, turn on, turn off, decrease, block, inhibit, suppress, prevent, etc.

Any type of test agent can be used, comprising any material, such as chemical compounds, biomolecules, such as polypeptides (including polypeptide fragments and mimics of E25b), lipids, nucleic acids, carbohydrates, antibodies, etc. Test agents include, e.g., protamine (Taylor et al., Nature, 297:307, 1982), heparins, steroids, such as tetrahydrocortisol, which lack gluco- and mineral-corticoid activity (e.g., Folkman et al., Science 221 :719, 1983 and U.S. Pat. Nos. 5,001,116 and 4,994,443), angiostatins (e.g., WO 95/292420), triazines (e.g., U.S. Pat. No. 6,150,362), thrombospondins, endostatins, platelet factor 4, fumagillin-derivate AGH 1470, alpha-interferon, quinazolinones (e.g., U.S. Pat. No. 6,090,814), substituted dibenzothiophenes (e.g., U.S. Pat. No. 6,022,307), deoxytetracyclines, cytokines, chemokines, FGFs, etc.

Whether the test agent modulates an E25b gene or polypeptide can be determined by any suitable method. These methods include, detecting gene transcription, detecting E25b mRNA, detecting E25b polypeptide and activity thereof. The detection methods includes those mentioned herein, e.g., PCR, RT-PCR, Northern blot, ELISA, Western, RIA, etc. In addition to detecting E25b nucleic acid and polypeptide, further downstream targets can be used to assess the effects of modulators, including, the presence or absence of neoangiogenesis (e.g., using any of the mentioned test systems, such as CAM, BCE, in vivo Matrigel®-type assays) as modulated by a test agent,

The present invention also relates to methods of regulating angiogenesis in a system comprising cells, comprising administering to the system an effective amount of a modulator of a mammalian E25b gene family or polypeptide family under conditions effective for the modulator to modulate the gene or polypeptide, whereby angiogenesis is regulated. A system comprising cells can be an in vivo system, such as a heart or limb present in a patient (e.g., angiogenic therapy to treat myocardial infarction), isolated organs, tissues, or cells, in vitro assays systems (CAM, BCE, etc), animal models (e.g., in vivo, subcutaneous, chronically ischemic lower limb in a rabbit model, cancer models), hosts in need of treatment (e.g., hosts suffering from angiogenesis related diseases, such as cancer, ischemic syndromes, arterial obstructive disease, to promote collateral circulation, to promote vessel growth into bioengineered tissues, etc.

A modulator useful in such method are those mentioned already, e.g., nucleic acid (such as an anti-sense to an E25b gene to disrupt transcription or translation of the gene), antibodies (e.g., to inhibit E25b activity on the cell surface, such as an antibody specific-for the extracellular domain of E25b). Antibodies and other agents which target E25b polypeptide can be conjugated to a cytotoxic or cytostatic agent, such as those mentioned already. A modulator can also be an E25b gene, itself, e.g., when it is desired to deliver the E25b polypeptide to cells analogously to gene therapy methods. A complete gene, or a coding sequence operably linked to an expression control sequence (i.e., an expressible E25b gene) can be used to produce polypeptide in the target cells.

By the phrase "regulating angiogenesis," it is meant that angiogenesis is effected in a desired way by the modulator. This includes, inhibiting, blocking, reducing, stimulating, inducing, etc., the formation of blood vessels. For instance, in cancer, where the growth of new blood vessels is undesirable, modulators of E25b can be used to inhibit their formation, thereby treating the cancer. Such inhibitory modulators include, e.g., antibodies to the extracellular regions of E25b, and, antisense RNA to inhibit translation of E25b mRNA into polypeptide (for guidance on administering and designing anti-sense, see, e.g., U.S. Pat. Nos. 6,153,595, 6,133,246, 6,1 17,847, 6,096,722, 6,087,343, 6,040,296, 6,005,095, 5,998,383, 5,994,230, 5,891,725, 5,885,970, and 5,840,708). On the other hand, angiogenesis can be stimulated to treat ischemic syndromes and arterial obstructive disease, to promote collateral circulation, and to promote vessel growth into bioengineered tissues, etc., by administering the E25b gene or polypeptide to a target cell population.

A polynucleotide, probe, polypeptide, antibody, specific-binding partner, etc., according to the present invention can be isolated. The term "isolated" means that the material is in a form in which it is not found in its original environment or in nature, e.g., more concentrated, more purified, separated from component, etc. An isolated polynucleotide includes, e.g., a polynucleotide having the sequenced separated from the chromosomal DNA found in a living animal, e.g., as the complete gene, a transcript, or a cDNA. This polynucleotide can be part of a vector or inserted into a chromosome (by specific gene-targeting or by random integration at a position other than its normal position) and still be isolated in that it is not in a form that is found in its natural environment. A polynucleotide, polypeptide, etc., of the present invention can also be substantially purified. By substantially purified, it is meant that polynucleotide or polypeptide is separated and is essentially free from other polynucleotides or polypeptides, i.e., the polynucleotide or polypeptide is the primary and active constituent. A polynucleotide can also be a recombinant molecule. By "recombinant," it is meant that the polynucleotide is an arrangement or form which does not occur in nature. For instance, a recombinant molecule comprising a promoter sequence would not encompass the naturally-occurring gene, but would include the promoter operably linked to a coding sequence not associated with it in nature, e.g., a reporter gene, or a truncation of the normal coding sequence. The term "marker" is used herein to indicate a means for detecting or labeling a target. A marker can be a polynucleotide (usually referred to as a "probe"), polypeptide (e.g., an antibody conjugated to a detectable label), PNA, or any effective material.

For other aspects of the polynucleotides, reference is made to standard textbooks of molecular biology. See, e.g., Hames et al., Polynucleotide Hybridization, IL Press, 1985; Davis et al., Basic Methods in Molecular Biology, Elsevir Sciences Publishing, Inc., New York, 1986; Sambrook et al., Molecular Cloning, CSH Press, 1989; Howe, Gene Cloning and Manipulation, Cambridge University Press, 1995; Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., 1994-1998. The preceding description, utilize the present invention to its fullest extent. The preceding preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limiting the remainder of the disclosure in any way whatsoever. The entire disclosure of all applications, patents and publications, cited above and in the figures are hereby incorporated by reference in their entirety.

Claims

CLAIMS:

1. A method of determining the angiogenic index of a tissue or cell sample, comprising: assessing the amounts of mammalian E25b mRNA or polypeptide in the sample, whereby the amount of E25b is indicative of the angiogenic index.

2. A method of claim 1 , wherein the angiogenic index is assessed by polymerase chain reaction using a pair of polynucleotide primers specific for E25b gene.

3. A method of claim 1 , wherein the angiogenic index is assessed by detecting E25b polypeptide using an antibody specific for it.

4. A method of claim 1 , further comprising assessing the amounts of a mRNA or polypeptide which is expressed ubiquitously in the sample.

5. A method of claim 1 , wherein the mRNA or polypeptide is beta-actin.

6. A method of claim 1 , further comprising assessing amounts of a mRNA or polypeptide which is expressed selectively in the sample.

7. A method of assessing angiogenesis in a sample, comprising, characterizing a mammalian E25b gene in the sample.

8. A method of claim 7, wherein characterizing is measuring the amounts of E25b mRNA present in the sample;.

9. A method of claim 7, wherein characterizing is determining the transcripts which arise from the E25b gene;

10. A method of identifying a modulator of a mammalian E25b gene in a cell population capable of forming blood vessels, comprising: contacting the cell population with a test agent under conditions effective for said test agent to modulate the mammalian E25b gene in said cell population, and determining whether said test agent modulates the gene.

11. A method of claim 10, wherein said determining is detecting E25b mRNA or polypeptide.

12. A method of claim 10, wherein said determining is detecting the presence or absence of neoangiogenesis.

13. A method of claim 10, wherein said cell population comprises endothelial cells.

14. A method of identifying a modulator of a mammalian E25b polypeptide in a cell population capable of forming blood vessels, comprising: contacting the cell population with a test agent under conditions effective for said test agent to modulate the activity of the mammalian E25b polypeptide, and determining whether said test agent modulates the polypeptide.

15. A method of claim 14, wherein said determining is detecting the presence or absence of neoangiogenesis.

16. A method of claim 14, wherein said cell population comprises endothelial cells.

17. A method of regulating angiogenesis in a system comprising cells, comprising: administering to said system an effective amount of a modulator of mammalian E25b polypeptide under conditions effective for the modulator to modulate said polypeptide, whereby angiogenesis is regulated.

18. A method of claim 17, wherein the mammalian E25b is a human polypeptide.

19. A method of claim 17, wherein the human polypeptide is set forth in SEQ ID NO 2.

20. A method of claim 17, wherein the modulator is an antibody specific- for the extracellular domain of E25b;

21. A method of claim 17, wherein the antibody is conjugated to a cytotoxic or cytostatic agent.

22. A method of claim 17, wherein the modulator is an expressible mammalian E25 gene.

23. A method of claim 17, wherein regulating angiogenesis is inhibiting or stimulating angiogenesis.

24. A method of regulating angiogenesis in a system comprising cells, comprising: administering to said system an effective amount of a modulator of mammalian E25b gene under conditions effective for the modulator to modulate said gene, whereby angiogenesis is regulated.

25. A method of claim 24 wherein the mammalian E25b gene is a human gene.

26. A method of claim 24, wherein the modulator is an antisense polynucleotide to the mammalian E25b gene which is effective to inhibit translation of the gene.

27. A method of claim 24, wherein regulating angiogenesis is inhibiting angiogenesis or stimulating angiogenesis.

28. A method of retrieving genes expressed during angiogenesis from a computer- readable medium, comprising: selecting a gene expression profile that specifies that said gene is expressed during angiogenesis, and retrieving angiogenesis-expressed gene sequences, where the gene sequences consist of mammalian E25b.