WO2002046436A2

WO2002046436A2 - Plasmid vectors

Info

Publication number: WO2002046436A2
Application number: PCT/US2001/046516
Authority: WO
Inventors: Katherine S. Bowdish; Shana Barbas-Frederickson; Martha Wild; John Mcwhirter
Original assignee: Alexion Pharmaceuticals, Inc.
Priority date: 2000-12-08
Filing date: 2001-12-07
Publication date: 2002-06-13
Also published as: AU2002218022A1; WO2002046436A9; WO2002046436A3

Abstract

This disclosure describes novel vectors capable or replication and expression of foreign genetic information in bacteria, such as, for example, cyanobacterium and E. coli. This disclosure also deals with the use of the vectors to introduce foreign genes into bacteria.

Description

NOVEL PLASMID VECTORS

RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application No. 60/254,411 filed December 8, 2000, the disclosure of which is incorporated herein by reference.

BACKGROUND

FIELD OF THE INVENTION

This invention relates to cloning vectors. More specifically the invention relates to plasmids useful in the cloning and expression of foreign genetic information.

BACKGROUND OF THE INVENTION

Plasmids are extrachromosomal genetic elements and are capable of autonomous replication within their hosts. Bacterial plasmids range in size from 1 Kb to 200 Kb or more and encode a variety of useful properties. Plasmid encoded traits include resistance to antibiotics, production of antibiotics, degradation of complex organic molecules, production of bacteriocins, such as colicins, production of enterotoxins, and production of DNA restriction and modification enzymes. Although plasmids have been studied for a number of years in their own right, particularly in terms of their replication, transmissibility, structure and evolution, with the advent of genetic engineering technology the focus of plasmid research has turned to the use of plasmids as vectors for the cloning and expression of foreign genetic information. In its application as a vector, the plasmid should possess one or more of the following properties. The plasmid DNA should be relatively small but capable of having relatively large amounts of foreign DNA incorporated into it. The size of the DNA insert is of concern in vectors based on bacteriophages where packing the nucleic acid into the phage particles can determine an upper limit. The plasmid should be under relaxed replication control. That is, where the replication of the plasmid molecule is not strictly coupled to the replication of the host DNA (stringent control), thereby resulting in multiple copies of plasmid DNA per host cell. The plasmid should express one or more selectable markers, such as the drug resistance markers, mentioned above, to permit the identification of host cells which contain the plasmid and also to provide a positive selection pressure for the maintenance of the plasmid in the host cell. Finally the plasmid should contain a single restriction site for one or more endonucleases in a region of plasmid which is not essential for plasmid replication. It is particularly useful if such a site is located within one of the drug resistance genes thereby permitting the monitoring of successful integration of the foreign DNA segment by insertional inactivation. For example, when a plasmid contains two drug resistance genes and one of the genes contains a single restriction endonuclease site, the foreign DNA when ligated into that site will interrupt the expression of the drug resistance gene, thus converting the phenotype of the host from double drug resistance to single drug resistance. A vector as described above is useful, for example, for cloning genetic information, by which is meant integrating a segment of foreign DNA into the vector and reproducing identical copies of that information by virtue of the replication of the plasmid DNA. The next step in the evolution of vector technology was the construction of so-called expression vectors. These vectors are characterized by their ability not only to replicate the inserted foreign genetic information but also to promote the transcription of the genetic information into mRNA and its subsequent translation into protein. This expression requires a variety of regulatory genetic sequences including but not necessarily limited to promoters, operators, transcription terminators, ribosomal binding sites and protein synthesis initiation and termination codons. These expression elements can be provided with the foreign DNA segment as parts thereof or can be integrated within the vector in a region adjacent to a restriction site so that when a foreign DNA segment is introduced into the vector it falls under the control of those elements to which it is now chemically joined. In a more recent development, hybrid vectors have been constructed which permit the cloning and/or expression of foreign genetic information in more than one host. These biphasic or shuttle vectors are characterized as having separate origins of replication (replicons) to permit replication of the plasmid in the desired host; further, in the case of expression vectors, it may be required to have two sets of regulatory elements, each specific for the intended host. Such duplication of regulatory elements is not always required as it may be possible for a single promoter to be able to function in both of the desired hosts. Regardless of the type of biphasic vector, be it either a cloning or expression vector, it is preferred to have at least two selectable markers, one permitting selection in each of the contemplated hosts. One known vector is pComb3X (a version of which is GenBank as accession No.

AF268281). Due to its structure (illustrated schematically in Fig. 1), pComb3X has drawbacks in certain applications. For example, heavy chain inserts cloned into the vector will have the first four amino acids of FRl (as the human consensus ENQL) encoded by the vector rather than the insert region. If the vector is to be used for cloning non-human sequences, the human FRl amino acids may not be desired. Additionally, it may be preferred to have the Xho I restriction site positioned in front of the + 1 amino acid of the heavy chain FRl rather than replacing amino acid positions +4 and +5. The current vector and corresponding cloning strategy for heavy chains requires amino acid changes to be introduced in the FRl by PCR incorporation of the Xho I site in the antibody genes. Vectors which, due to their structures overcome the drawbacks of pComb3X would be desirable. SUMMARY

This disclosure describes novel vectors capable of replication and expression of foreign genetic information in bacteria, such as, for example, cyanobacterium and E. coli. This disclosure also deals with the use of the vectors to introduce foreign genes into said bacteria. New vectors have been discovered which overcome at least some of the drawbacks of pComb3X. These new vectors include pRL5, pRL5-CAT, pRL5 asc-CAT and pRL5 bis- CAT. BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 schematically illustrates the structure of pComb3X, a useful starting material for making the novel vectors described herein;

Fig. 2 is a flow chart illustrating the method of making pRL5; Fig. 3 is a plasmid map for pRL5; Fig. 4A-E schematically illustrate plasmid pRL5, including the nucleic acid sequence (Seq. ID No. 12), domains corresponding to particular genes, and amino acid sequences encoded by particular genes;

Fig. 5 is a plasmid map for pRL4-CAT; Fig. 6 is a plasmid map for pRL5-CAT;

Fig. 7A-E schematically illustrate plasmid pRL5-CAT, including the nucleic acid sequence (Seq. ID No. 1), domains corresponding to particular genes, and amino acid sequences encoded by particular genes.

Fig. 8 is a plasmid map for pRL5 Asc-CAT; Fig. 9A-E schematically illustrate plasmid pRL5 Asc-CAT, including the single stranded nucleic acid sequence (Seq. ID No. 8), domains corresponding to particular genes, and amino acid sequences encoded by particular genes;

Fig. 10 is a plasmid map of pRL5bsiCAT;

Fig. 11A-E schematically illustrate plasmid pRL5bsiCAT, including the single stranded nucleic acid sequence (Seq. ID No. 10), domains corresponding to particular genes, and amino acid sequences encoded by particular genes; and

Fig. 12 shows the interrelationship between pRL4 and the novel vectors described herein.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS The novel vectors described herein can be prepared using pComb3X as the starting material. A clone expressing chimeric rabbit/human Fab antibody in pComb3X (see Fig. 1), was selected as the starting material for conversion to pRL5. Two reasons for this choice were 1) the human constant regions (C_kappa and CH_j) are already present in the pComb 3X vector, and 2) the antibody insert had a region in front of the Xho I heavy chain cloning site that did not contain sequences encoding the first 4 amino acid consensus EVQL (for VH) as are present in the pComb 3X without an insert. The starting vector with Fab in it can be made by overlap PCR generation of a rabbit/human chimeric Fab library according essentially to the protocols in the Phage Display, A Laboratory Manual, Radir and Barbas, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2000. The pRL5 vector is a modified version of pComb 3X. The new light and heavy chain stuffer regions present in pRL5 1) have a large (approximately 1200bp) size 2) have been designed with early stops so that no significant stuffer protein is being produced, and 3) have either the human Kappa constant region or the human CHI domain for ease of converting single chain variable regions into Fabs.

Fig. 2 is a flow-chart showing the steps involved in making the light chain and then heavy chain region modifications that convert pComb 3X to pRL5. These steps are discussed in detail hereinafter. Those skilled in the art possess knowledge of suitable techniques to accomplish the steps described below without the need for undue experimentation, such techniques being well known to those skilled in the art. Light Chain Cloning Region Modification

A frameshifted lacZ gene fragment was generated by PCR using lacZ (f.s.)-F and BGH Seq-R primers with template pcDNA 3.1 HisB/lacZ plasmid (Invitrogen, Carlsbad, CA). The lacZ gene fragment employed is frameshifted so that the resulting vector does not produce protein product when this "stuffer" is in the LC cloning region. The lac Z(f.s.)-F primer had the following sequence:

5' GAG GAG GAG GAG GAG GAG CTC GAC TGC ACT GGA TGG TGG CGC T 3' (Seq. ID No. 14). The BGHSeq-R primer had the following sequence: 5' CTA GAA GGC ACA GTC GAG GC3' (Seq. ID No. 26). The PCR product was digested with Sac I/Xba I and then inserted into the Sac I/Xba I region of the pComb 3X-rabbit Fab starting plasmid backbone.

The lacZ region cloned contained an Accl site so that the Ace I to Xba I fragment could be removed and a modified human constant region inserted. The modified C_kappa was necessary to 1) remove a native Accl within the domain, and 2) engineer an Accl site at the start of C_kappa. The modified C_kappa was produced by overlap PCR using CK_no Acc-B2 and FlagRscVKl as fragment A, and CK_no Acc-F2 and lead B 5 'GGC CAT GGC TGG TTG GGC A G C 3' (Seq. ID No. 15) as fragment B. FlagRscVKl has the sequence 5' GGG CCC AGG CGG CCG ACT ACA AAG ACG AGC TCG TGM TGA CCC AGA CTC CA 3' (Seq. ID No. 27). CK_noAcc-F2 has the sequence 5' GAG AAA CAC AAA GTA TAT GCC TGC GAA GTC 3' (Seq. ID No. 16) and CK_noAcc-B2 has the sequence 5' GAC TTC GCA GGC ATA TAG TTT GTG TTT CTC 3' (Seq. ID No. 17). The fusion product was then formed by adding the two fragments (which have complementary regions) together for a PCR reaction using the outside primers FlagRscF and lead B. The resulting PCR fragment of modified human Kappa constant region was digested by Accl and Xbal for insertion into the backbone vector as described above.

Heavy Chain Cloning Region Modification

The rabbit VH of the starting pComb 3X-rabbit Fab was replaced by a frameshifted portion of the erythropoietin receptor (epoR). The epoR gene fragment is frameshifted so that the resulting vector does not produce protein product when this "stuffer" is in the HC cloning region. The epoR fragment was PCR generated from pcDNA 3.1 epoR using primers epoR (fs)-F and BGH-Seq R. The epoR(fs)-F primer had the following sequence: 5' GAG GAG GAG GAG GAG CTC GAG CTG ATG AGC CAT GGA AGC TGT G 3' (Seq. ID No. 2). The epoR fragment was digested by Xho I and Apa I for insertion into the Xho I- Apa I digested vector backbone. In the resulting pRL5 vector, schematically shown in Figs. 3 (map) and 4 (Seq. ID.

No. 12), only by cloning in a V_L + V_H (by Sac- Ace and Xho-Apa, respectively) or light chain and Fd portion of the HC (by Sac-Xba and Xho-Spe, respectively) should protein product be produced. As shown in Figs. 4 A - E, the nucleic acid sequence for pRL5 includes domains encoding proteins and/or peptides or portions thereof. More particularly, bp 591- 1451 encode for beta-lactamase (Seq. ID No. 13), bp 2611-2676 encode for Omp A leader (Seq. ID No. 4), bp 3508-3828 encode for the kappa constant region (Seq. ID No. 5), bp 3859-3924 encode for pel B leader (Seq. ID No. 6), bp 4740-5651 encode for CR His6 tag, HA tag, and gene III (Seq. ID No. 7). PRL4-CAT Creation The commercial vector pBC KS (Stratagene, La Jolla, CA) was digested with Ear I to generate a 2243 bp fragment containing the chloramphenicol transferase (CAT) gene and the ColEl, origin. pComb 3X was digested with Ear I to generate a 3171 bp backbone missing the beta-lactamase gene (ampicillin resistance Amp^R) and the Col El, origin. These two fragments were ligated together to create pRL4 CAT. A plasmid map of pRL4 CAT is provided in Fig. 5. pRL5 CAT Creation pRL5 CAT was created from pRL4CAT and pRL5. pRL4CAT was digested with Sfi I to create a 3740 bp backbone containing the CAT gene. pRL5 was digested with Sfi I to produce the 2382 bp insert fragment containing leader and stuffer regions for pRL5. These two fragments were ligated together to form pRL5 CAT. A plasmid map of pRL5 CAT is provided in Fig. 6 and the nucleic acid sequence (Seq. ID No. 1) for pRL5 CAT, domains corresponding to particular genes, and amino acid sequences encoded by particular genes are schematically illustrated in Figs. 7A-E.

As shown in Figs. 7A-E, the nucleic acid sequence for pRL5 CAT includes domains encoding proteins and/or peptides or portions thereof. More particularly, bp 1013-1672 encode for CAT (Seq. ID No. 3), bp 3050-3115 encode for Omp A leader (Seq. ID No. 4), bp 3953-4267 encode for the kappa constant region (Seq. ID No. 5), bp 4298-4363 encode for pel B leader (Seq. ID No. 6), bp 5179-6090 encode for CHI, His6 tag, HA tag, and gene III (Seq. ID No. 7). Creation of pRL5CAT/Asc pRL5 was modified using the Quick Change Mutagenesis Kit (Stratagene, La Jolla, CA). Methods were followed according to the Kit's manual. Briefly, two complementary mutagenic primers were used with pRL5CAT in a PCR reaction with Pfu thermostable polymerase. The method allows for both strands of the double stranded plasmid to be replicated, while incorporating the respective mutagenic primer. Following PCR, the pRL5CAT starting template was removed by restion enzyme digestion (due to its methylation using Dpn I). The strands resulting from PCR were then allowed to anneal and transformed into E. coli. Individual colonies were screened by sequence analysis to identify a clone with the correct incorporation of the Asc I site in place of the Ace I site. The Sac I to Xba I insert region of the mutated plasmid was isolated and ligated into the Sac I - Xba I site of pRL5CAT to create the new pRL5 CAT/Asc.

Primers used were 1) 5' CAT TGT CAG ACA TGG CGC GCC GTG GCT GCA CCA TCT G 3' (Seq. ID No. 18). 2) 5' C AGA TGG TGC AGC CAC GGC GCG CCA TGT CTG ACA ATG 3' (Seq. ID No.19).

A plasmid map of pRL5 CAT/Asc is provided in Fig. 8 and the double stranded nucleic acid sequence (Seq. ID No. 8) for pRL5 CAT/Asc, domains corresponding to particular genes, and amino acid sequences encoded by particular genes are schematically illustrated in Figs. 9A-E. As shown in Figs. 9A-E, the nucleic acid sequence for pRL5 CAT/Asc includes domains encoding proteins and/or peptides or portions thereof. More particularly, bp 1013-1672 encode for CAT (Seq. ID No. 3), bp 3050-3115 encode for Omp A leader (Seq. ID No. 4), bp 3953-4270 encode for the kappa constant region (Seq. ID No. 9), bp 4301-4366 encode for pel B leader (Seq. ID No. 6), bp 5182-6093 encode for CHI, His6 tag, HA tag, and gene III (Seq. ID No. 7). Creation of pRL5bsiCAT pRL5CAT was cut with BspEl and Fse I to delete a small region of about 35 bp that included a BsiW 1 site in the HA tag region of the vector. This region was replaced with the following two complementary oligonucleotides:

5' CCAGCACCATCACCATCACCATGGCGCATACCCGTATGACGTT 3' (Seq. ID No. 20) and

5' CCGGAACGTCATACGGGTATGCGCCATGGTGATGGTGATGGTGCTGGCCGG 3' (Seq. ID No.21) This removed the BsiW I site, but left the coding sequence intact. The altered plasmid, 110-53.3, was then used as a template for PCR reactions to remove the Ace I site and insert a BsiW I site at the junction of the light chain variable stuffer material and the kappa constant region. The oligonucleotides used for this reaction were 5' CAGACTCGTACGGTGGCTGCACCATCTGTCTTCA 3' (Seq. ID No. 22) and 5'GCCACCGTACGAGTCTGACAATGGCAGATCCCAG 3' (Seq. ID No. 23). These were paired respectively with the N-omp primer 5' TATCGCGATTGCAGTGGCACTGGC 3' (Seq. ID No. 24) and the lead B primer 5' GGCCATGGCTGGTTGGGCAGC 3' (Seq. ID No. 25) to generate two PCR fragments. The fragment utilizing N-omp was digested with Sac I and BsiW I, and the fragment utilizing lead B was digested with Xba I and BsiW I. The resulting fragments were treated with ligase in a three way ligation with vector 110-53.3, which was digested with Sac I and Xba I to remove the light chain region.

The resulting clone pRL5bsiCAT was both digested and sequenced in the altered region to determine its identity. A plasmid map of pRL5 bsiCAT is provided in Fig. 10 and the double stranded nucleic acid sequence (Seq. ID No 10) for pRL5bsiCAT, domains corresponding to particular genes, and amino acid sequences encoded by particular genes are schematically illustrated in Figs. UA-E. As shown in Figs. UA-E, the nucleic acid sequence for pRL5bsiCAT includes domains encoding proteins and/or peptides or portions thereof. More particularly, bp 1013-1672 encode for CAT (Seq. ID No. 3), bp 3050-3115 encode for Omp A leader (Seq. ID No. 4), bp 3947-4267 encode for the kappa constant region (Seq. ID No. 11), bp 4298-4363 encode for pel B leader (Seq. ID No. 6), bp 5179-6090 encode for CHI, His6 tag, HA tag, and gene III (Seq. ID No. 7).

Fig. 12 illustrates the general relationship between pRL4 and the various novel vectors described herein. The vectors described herein can be transformed into a host cell using known techniques (e.g., electroporation) and amplified. The vectors described herein can also be digested and have nucleic acid ligated therein. The vector so engineered can be transformed into a host cell using known techniques and amplified or to effect expression of polypeptides encoded thereby. Those skilled in the art will readily envision other uses for the novel vectors described herein.

It is contemplated that single and double stranded versions of the vectors described herein are within the scope of the present invention. It is well within the purview of those skilled in the art to prepare double stranded vectors from the single stranded nucleic acids described herein. It will be understood that various modifications may be made to the embodiments described herein. Therefore, the above description should not be construed as limiting, but merely as exemplifications of preferred embodiments. Those skilled in the art will envision other modifications within the scope and spirit of the claims appended hereto.

Claims

WE CLAIM:

1. A plasmid having a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 1, SEQ. ID. NO: 8, SEQ. ID. NO: 11, and SEQ. ID. NO: 12.

2. A plasmid as in claim 1 having a gene ligated therein.

3. A method comprising: a) transforming a host cell with a plasmid having a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 1, SEQ. ID. NO: 8, SEQ. ID. NO: 11 and SEQ. ID. NO: 12; b) culturing the host cell under conditions which result in amplification of the plasmid.

4. A method comprising: a) ligating a gene into a plasmid having a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 1, SEQ. ID. NO: 8, SEQ. ID. NO: 11, and SEQ. ID. NO: 12; b) transforming a host cell with the plasmid; and c) culturing the host cell under conditions which result in expression of a polypeptide encoded by the gene.