WO2002038732A2 - Human testis specific serine/threonine kinase - Google Patents

Human testis specific serine/threonine kinase Download PDF

Info

Publication number
WO2002038732A2
WO2002038732A2 PCT/US2001/046803 US0146803W WO0238732A2 WO 2002038732 A2 WO2002038732 A2 WO 2002038732A2 US 0146803 W US0146803 W US 0146803W WO 0238732 A2 WO0238732 A2 WO 0238732A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
tssk
amino acid
acid sequence
human
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2001/046803
Other languages
English (en)
French (fr)
Other versions
WO2002038732A3 (en
Inventor
John C. Herr
Pablo Visconti
Zhonglin Hao
Gregory S. Kopf
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
UVA Licensing and Ventures Group
University of Virginia UVA
Original Assignee
University of Virginia UVA
University of Virginia Patent Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2002542049A priority Critical patent/JP2004513631A/ja
Priority to DE60142984T priority patent/DE60142984D1/de
Priority to IL15580101A priority patent/IL155801A0/xx
Priority to US10/416,477 priority patent/US7129057B2/en
Priority to AU3769902A priority patent/AU3769902A/xx
Priority to IL15580001A priority patent/IL155800A0/xx
Priority to AT01986508T priority patent/ATE479771T1/de
Priority to EP01986508A priority patent/EP1339866B1/en
Application filed by University of Virginia UVA, University of Virginia Patent Foundation filed Critical University of Virginia UVA
Priority to AU2002237699A priority patent/AU2002237699B9/en
Publication of WO2002038732A2 publication Critical patent/WO2002038732A2/en
Publication of WO2002038732A3 publication Critical patent/WO2002038732A3/en
Priority to IL155800A priority patent/IL155800A/en
Priority to IL155801A priority patent/IL155801A/en
Priority to US10/438,339 priority patent/US6946275B2/en
Anticipated expiration legal-status Critical
Priority to AU2003204266A priority patent/AU2003204266B2/en
Priority to AU2006202059A priority patent/AU2006202059C1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/16Masculine contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/18Feminine contraceptives
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C12Q1/485Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving kinase
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/91Transferases (2.)
    • G01N2333/912Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G01N2333/91205Phosphotransferases in general
    • G01N2333/9121Phosphotransferases in general with an alcohol group as acceptor (2.7.1), e.g. general tyrosine, serine or threonine kinases
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value

Definitions

  • tssk genes, their respective encoded proteins and antibodies against those proteins.
  • the present invention also encompasses the use of the tssk kinases as targets for identifying inhibitors of tssk kinase activity.
  • spermatogenesis the process in which functional spenn cells are produced in the testis, involves specific interaction between the developing germ cells and their supporting Sertoli cells as well as hormonal regulation by the androgen- producing Leydig cells.
  • the general organization of spermatogenesis is essentially the same in all mammals and can be divided into three distinct phases: 1) The initial phase is the proliferative or spermatogonial phase during which spermatogonia undergo mitotic division and generate a pool of spermatocytes; 2) the meiotic phase, that yields the haploid spermatids; and 3) spermiogenesis whereby each round spermatid differentiates into a spermatozoon.
  • Mammalian spermiogenesis the postmeiotic phase of spermatogenesis, is characterized by dramatic morphological changes that occur in the haploid spermatid. Some of these changes include the formation of the acrosome and its contents, the condensation and reorganization of the chromatin, the elongation and species-specific reshaping of the cell, and the assembly of the flagellum. These events result from changes in both gene transcription and protein translation that occurs during this developmental period. Some of the proteins translated in the haploid spermatid will remain in the morphologically mature sperm after it leaves the testis. Taking this into consideration, proteins that are synthesized during spermatogenesis might be necessary for spermatid differentiation and/or for sperm function during fertilization.
  • the present invention relates to signaling events in mammalian sperm that regulate the functions of this highly differentiated cell. More particularly the invention relates to signal transduction that modulates the acquisition of sperm fertilizing capacity. After ejaculation, sperm are able to move actively but lack fertilizing competence. They acquire the ability to fertilize in the female genital tract in a time-dependent process called capacitation. Capacitation has been demonstrated to be accompanied by the protein phosphorylation of several proteins on both serine/threonine and tyrosine residues, and that protein tyrosine phosphorylation is regulated downstream by a cAMP/PKA pathway that involves the crosstalk between these two signaling pathways. With the exception of PKA, the other kinase(s) involved in the regulation of capacitation are still unknown.
  • testis-specific kinases are the recently described mouse genes, tssk 1, 2 and 3 (Bielke et al., 1994, Gene 139, 235-9; Kueng et al, 1997, J Cell Biol 139, 1851-9; Zuercher et al, 2000, Mech Dev 93, 175-7).
  • the function of the tssk kinase family is unknown. However, since the members of this family are expressed postmeiotically during spermiogenesis, it is hypothesized that they have a role in germ cell differentiation, or later on in sperm function. Therefore, it is anticipated that compounds that interfere with the function of this kinase family could be utilized as contraceptive agents.
  • the tssk kinase family is used as a target for the development of novel drugs.
  • the sperm- specific tssk gene products will be used to screen for specific inhibitors of tssk kinase activity and these inhibitors will be used either alone or in conjunction with other contraceptive agents to prevent unintended pregnancies.
  • the unique sequence of the members of the tssk kinase family supports the likelihood of finding specific inhibitors for their activity.
  • the present invention is directed to the human sperm-specific tssk kinase gene family and their corresponding proteins. More particularly, the present invention is directed to the human tsskl, tssk2 and tssk 3 kinases and the use of those kinases to identify agonists or antagonists of tssk kinase activity.
  • the present invention also encompasses antibodies raised against the human tsskl, tssk2 and tssk 3 kinases and the use of these antibodies as diagnostic tools.
  • Fig. 1 Comparison between the amino acid sequences of human tssk 1, human tssk 2, and human tssk 3. As seen in Fig. 1 the amino acid sequences between the three proteins diverge near the carboxy terminus.
  • nucleic acid As used herein, “nucleic acid,” “DNA,” and similar terms also include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone.
  • nucleic acid analogs i.e. analogs having other than a phosphodiester backbone.
  • peptide nucleic acids which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.
  • peptide encompasses a sequence of 3 or more amino acids wherein the amino acids are naturally occurring or synthetic (non-naturally occurring) amino acids.
  • Peptide mimetics include peptides having one or more of the following modifications:
  • N-terminus is derivatized to a —NRRi group, to a -- NRC(O)R group, to a -NRC(O)OR group, to a --NRS(O) 2 R group, to a ⁇ NHC(O)NHR group where R and R ⁇ are hydrogen or C ⁇ .C4 alkyl with the proviso that R and Rj are not both hydrogen;
  • Naturally occurring amino acid residues in peptides are abbreviated as recommended by the IUPAC-J-UB Biochemical Nomenclature Commission as follows: Phenylalanine is Phe or F; Leucine is Leu or L; Isoleucine is He or I; Methionine is Met or M; Norleucine is Nle; Naline is Nat or N; Serine is Ser or S; Proline is Pro or P; Threonine is Thr or T; Alanine is Ala or A; Tyrosine is Tyr or Y; Histidine is His or H; Glutamine is Gin or Q; Asparagine is Asn or ⁇ ; Lysine is Lys or K; Aspartic Acid is Asp or D; Glutamic Acid is Glu or E; Cysteine is Cys or C; Tryptophan is Trp or W; Arginine is Arg or R; Glycine is Gly or G, and X is any amino acid.
  • Other naturally occurring amino acids include, by way of example, 4-hydroxyproline,
  • Synthetic or non-naturally occurring amino acids refer to amino acids which do not naturally occur in vivo but which, nevertheless, can be incorporated into the peptide structures described herein.
  • the resulting "synthetic peptide" contain amino acids other than the 20 naturally occurring, genetically encoded amino acids at one, two, or more positions of the peptides. For instance, naphthylalanine can be substituted for trytophan to facilitate synthesis.
  • Other synthetic amino acids that can be substituted into peptides include L-hydroxypropyl, L-3 ,4-dihydroxyphenylalanyl, alpha-amino acids such as L-alpha-hydroxylysyl and D-alpha-methylalanyl, L-alpha.-methylalanyl, beta.-amino acids, and isoquinolyl.
  • D amino acids and non-naturally occurring synthetic amino acids can also be incorporated into the peptides.
  • Other derivatives include replacement of the naturally occurring side chains of the 20 genetically encoded amino acids (or any L or D amino acid) with other side chains.
  • conservative amino acid substitution are defined herein as exchanges within one of the following five groups: I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, Gly; II. Polar, negatively charged residues and their amides:
  • the term "purified” and like terms relate to the isolation of a molecule or compound in a form that is substantially free of contaminants normally associated with the molecule or compound in a native or natural environment.
  • biologically active fragments or “bioactive fragment” of an tssk polypeptide encompasses natural or synthetic portions of the full-length protein that are capable of specific binding to their natural ligand.
  • operably linked refers to a juxtaposition wherein the components are configured so as to perform their usual function.
  • control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • non-native promoter refers to any promoter that has been operably linked to a coding sequence wherein the coding sequence and the promoter are not naturally associated (i.e. a recombinant promoter/coding sequence construct).
  • a transgenic cell is any cell that comprises a nucleic acid sequence that has been introduced into the cell in a manner that allows expression of the a gene encoded by the introduced nucleic acid sequence.
  • the present invention is directed to a family of kinases (the tssk kinase family) that are expressed exclusively in germ cells of humans and mice.
  • the mouse homologs of the human tssk genes were previously described and were found to be expressed postmeiotically in male germ cells. (Bielke et al., 1994, Gene 139, 235-9; Kueng et al., 1997 , J Cell Biol 139, 1851-9)
  • Kueng et al. (1997) found that mouse tssk 1 and 2 bind and phosphorylate a protein of 54 Kda, that represents the tssk substrate.
  • This tssk substrate has been designated tsks.
  • the tsks protein is also testis-specific and its developmental expression suggests that it is postmeiotically expressed in germ cell.
  • the mouse cDNA sequence of the tssk substrate was previously reported (Kueng et al, 1997) and was used to search the EST data base.
  • a human EST homologue AL041339 was found and used to generate sense and antisense primers for obtaining the full length clone by 5' and 3' RACE using human testis marathon ready cDNA (Clontech, Inc.).
  • the full length nucleotide sequence of human tsks is provided as SEQ ID NO: 7 and the deduced protein sequences is provided as SEQ ID NO: 8.
  • one aspect of the present invention is directed to the isolation of the human tssk homologs and their use in isolating contraceptive agents.
  • RNA transcripts expressed in the male germ cell lineage might ultimately be important in sperm function; however, it is also possible that such transcripts function during testicular spermatogenesis.
  • tssk3b a unique testis-specific mouse tssk gene is provided.
  • the nucleic acid sequence and amino acid sequence of tssk3b is provided as SEQ ID NO 9 and SEQ ID NO: 10, respectively.
  • the human homologue of tssk3b has also been cloned (and designated human tssk3) and exhibits 98 % homology to the putative mouse protein at the protein level.
  • the nucleotide sequence and amino acid sequence of human tssk3 is provided as SEQ ID NO 3 and SEQ ID NO: 6, respectively.
  • mouse protein kinase was described and identified as a testis-specific serine kinase 3 (mouse tssk3) (Zuercher et al, 2000, Mech Dev 93, 175-7), a member of a small family of testis- specific protein kinases (Bielke et al., 1994, Gene 139, 235-9; Kueng et al., 1997, J CellBiol l39, 1851-9).
  • mouse tssk3 both the human tssk3 and the mouse tssk3b cDNAs cloned and described in the present application demonstrate differences with mouse tssk3 in several amino acids.
  • mice tssk 1 and 2 amino acid sequences were obtained.
  • the 3' end and 5' end of the coding region of these genomic mouse genes were then used to design sense and antisense primers, respectively, and used to isolate the human homologs using PCR technology (see Example 2).
  • the amplified cDNA fragments were cloned using the TOPO TA cloning kit (Invitrogen) and sequenced.
  • An amplified human tsskl gene was approximately 1.3 kb in size and the isolated human tssk 2 gene was approximately 1.2 kb in size.
  • the nucleic acid sequence and amino acid sequence of human tsskl is provided as SEQ ID NO: 1 and SEQ ID NO: 4, respectively.
  • the nucleic acid sequence and amino acid sequence of human tssk2 is provided as SEQ ID NO: 2 and SEQ ID NO: 5, respectively.
  • a purified polypeptide comprising the amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 9, or an amino acid sequence that differs from SEQ ID NO: 1 or SEQ ID NO: 3 by one or more conservative amino acid substitutions. More preferably the purified polypeptide comprises an amino acid sequence that differs from SEQ ID NO: 1 or SEQ ID NO: 3 by less than 5 conservative amino acid substitutions, and more preferably by 2 or less conservative amino acid substitutions.
  • the purified polypeptide comprises the amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6. These polypeptides may include additional amino acid sequences to assist in the purification of recombinantly produced polypeptides.
  • the purified polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 and a peptide tag, wherein the peptide tag is linked to the tssk peptide sequence.
  • Suitable expression vectors for expressing such fusion proteins and suitable peptide tags are known to those skilled in the art and commercially available.
  • the tag comprises a His tag (see Example 4).
  • the purified polypeptide comprises the amino acid sequence of SEQ ID NO: 8 or the amino acid sequence of SEQ ID NO: 8 linked to a peptide tag.
  • the present invention is directed to a purified polypeptide that comprises a portion of a tssk polypeptide. More particularly the tssk polypeptide portion consists of natural or synthetic portions of a full-length polypeptide selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 9 that are capable of specific binding to their natural ligand.
  • the human tssk fragment retains its ability to bind to tsks.
  • the present invention also encompasses nucleic acid sequences that encode human tssk.
  • a nucleic acid sequence is provided comprising the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 10 or fragments thereof.
  • a purified nucleic acid sequence is provided, selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
  • the present invention also includes nucleic acids that hybridize under stringent or highly stringent conditions (as defined herein) to all or a portion of the nucleotide sequence represented by SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 10, or their complements.
  • the hybridizing portion of the hybridizing nucleic acids is typically at least 15 (e.g., 20, 25, 30, or 50) nucleotides in length.
  • Hybridizing nucleic acids of the type described herein can be used, for example, as a cloning probe, a primer (e.g., a PCR primer), or a diagnostic probe to detect the expression of the human tssk gene.
  • Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a nucleic acid duplex dissociates into its component single stranded DNAs. This melting temperature is used to define the required stringency conditions. Typically a 1% mismatch results in a 1°C decrease in the-Tm, and the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if two sequences having > 95% identity, the final wash temperature is decreased from the Tm by 5°C). In practice, the change in Tm can be between 0.5°C and 1.5°C per 1% mismatch.
  • the present invention is directed to the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and nucleic acid sequences that hybridize to those sequences (or their complement) under stringent or highly stringent conditions.
  • highly stringent conditions are defined as conducting the hybridization and wash conditions at no lower than -5°C Tm.
  • Stringent conditions are defined as involve hybridizing at 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, and washing in 0.2x SSC/0.1% SDS at 68°C .
  • Moderately stringent conditions include hybridizing at 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS and washing in 3x SSC/0.1 % SDS at 42°C. Additional guidance regarding such conditions is readily available in the art, for example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.) at Unit 2.10.
  • the present invention is also directed to recombinant human tssk gene constructs.
  • the recombinant gene construct comprises a non- native promoter operably linked to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7 and SEQ ID NO: 10.
  • the recombinant gene construct comprises a non- native promoter operably linked to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
  • the non-native promoter is preferably a strong constitutive promoter that allows for expression in a predetermined host cell.
  • a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 10 are inserted into a eukaryotic or prokaryotic expression vector in a manner that operably links the gene sequences to the appropriate regulatory sequences, and human tssk is expressed in the appropriate eukaryotic or prokaryotic cells host cell.
  • Suitable eukaryotic host cells and vectors are known to those skilled in the art.
  • the baculovirus system is also suitable for producing transgenic cells and synthesizing the tssk genes of the present invention.
  • transgenic cell lines that contain recombinant genes that express human tssk and fragments of the human tssk coding sequence.
  • a transgenic cell is any cell that comprises an exogenously introduced nucleic acid sequence. More preferably the introduced nucleic acid is sufficiently stable in the transgenic cell (i.e. incorporated into the cell's genome, or present in a high copy plasmid) to be passed on to progeny cells.
  • the transgenic cell is a human cell and comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7 and SEQ ID NO: 10.
  • the nucleic acid sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
  • the present invention also includes non-human transgenic organisms wherein one or more of the cells of the transgenic organism comprise a recombinant gene that expresses the human tssk.
  • the present invention also encompasses a method for producing human tssk. The method comprises the steps of introducing a nucleic acid sequence comprising sequences encoding the human tssk into a host cell, and culturing the host cell under conditions that allow for expression of the introduced human tssk gene.
  • the promoter is a conditional or inducible promoter, alternatively the promoter may be a tissue specific or temporal restricted promoter (i.e. operably linked genes are only expressed in a specific tissue or at a specific time).
  • the synthesized tssk can be purified using standard techniques and used in high throughput sceeens to identify inhibitors of tssk activity.
  • the recombinantly produced tssk polypeptides, or fragments thereof are used to generate antibodies against the tssk polypeptides.
  • the recombinanatly produced tssks are also used to obtain crystal structures. Such structures would allow for crystallography analysis that would lead to the design of specific drugs to inhibit tssk function.
  • the nucleic acid sequences encoding the sperm-specific kinase are inserted into a suitable expression vector in a manner that operably links the gene sequences to the appropriate regulatory sequences for expression in the preselected host cell.
  • suitable host cells, vectors and methods of introducing the DNA constructs into cells are known to those skilled in the art.
  • nucleic acid sequences encoding the sperm-specific kinase may be added to a cell or cells in vitro or in vivo using delivery mechanisms such as liposomes, viral based vectors, or microinjection.
  • compositions comprising a peptide having the sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 or an antigenic fragment thereof.
  • the antigenic fragment consists of the sequence of SEQ ID NO: 4 of SEQ ID NO: 6.
  • Another embodiment of the present invention is directed to the isolated antibodies that are generated against human tssk or fragments thereof.
  • Antibodies to human tssk may be generated using methods that are well known in the art.
  • an antibody is provided that specifically binds to a polypeptide selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5,
  • antibodies are provided that bind to a polypeptide selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.
  • the antibody is a monoclonal antibody.
  • the antibodies may be used with or without modification, and may be labeled by joining them, either covalently or non-covalently, with a reporter molecule.
  • the antibodies can be formulated with standard carriers and optionally labeled to prepare therapeutic or diagnostic compositions.
  • the present invention also provides a method for detecting the presence of human tssk.
  • the method comprises the steps of contacting a sample with a labeled antibody that specifically binds to human tssk, removing unbound and non-specific bond material and detecting the presence of the labeled antibody.
  • the labeled compound comprises an antibody that is labeled directly or indirectly (i.e. via a labeled secondary antibody).
  • the tssk antibodies of the present invention can be used to confirm the expression of tssk as well as its cellular location, or in assays to monitor patients being treated with human soluble tssk or inhibitors.
  • the tssk kinase family is used as a target for the development of novel drugs.
  • Progress in the field of small molecule library generation using combinatorial chemistry methods coupled to high-throughput screening has accelerated the search for ideal cell-permeable inhibitors.
  • structural-based design using crystallographic methods has improved the ability to characterize in detail ligand-protein interaction sites that can be exploited for ligand design.
  • the present invention provides methods of screening for agents, small molecules, or proteins that interact with polypeptides comprising the sequence of tsskl, tssk2, tssk3 or bioactive fragments thereof.
  • biologically active fragments or “bioactive fragment” of tsskl, tssk2, tssk3 encompasses natural or synthetic portions of the native peptides that are capable of specific binding to at least one of the natural ligands of the respective native tsskl, tssk2, tssk3 polypeptide, including tsks.
  • the invention encompasses both in vivo and in vitro assays to screen small molecules, compounds, recombinant proteins, peptides, nucleic acids, antibodies etc. which bind to or modulate the activity of tsskl, tssk2, tssk3 and are thus useful as therapeutics or diagnostic markers for fertility.
  • tssk polypeptides selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 9, are used to isolate ligands that bind to tssk under physiological conditions.
  • the method comprises the steps of contacting the tssk polypeptides with a mixture of "compounds under physiological conditions, removing unbound and non-specifically bound material, and isolating the compounds that remain bound to the tssk polypeptides.
  • the tssk polypeptides will be bound to a solid support, using standard techniques, to allow for rapid screening of compounds.
  • the solid support can be selected from any surface that has been used to immobilize biological compounds and includes but is not limited to polystyrene, agarose, silica or nitrocellulose.
  • the solid surface comprises functionalized silica or agarose beads. Screening for such compounds can be accomplished using libraries of pharmaceutical agents and standard techniques known to the skilled practitioner.
  • Ligands that bind to the tssk polypeptides can then be further analyzed for agonists and antagonists activity through the use of an in vitro kinase assay as described in Example 7.
  • Inhibitors of tssk kinase activity have potential use as agents that prevent maturation/capacitation of sperm.
  • Such inhibitors can be formulated as pharmaceutical compositions and administered to a subject to block spermatogenesis and provide a means for contraception.
  • specific inhibitors of the human tssk kinase activity are identified through the use of an in vitro kinase assay that is capable to detecting phosphorylation events.
  • the method of identifying inhibitors of tssk kinase activity comprises combining a labeled source of phosphate with one or more of the human tssk polypeptides in the presence of one or more potential inhibitory compounds.
  • the tssk proteins have the property to become autophosphorylated. Therefore by comparing the rate of autophosphorylation that occurs in the presence and absence of the candidate inhibitory compound, specific inhibitory compounds can be identified.
  • a tssk substrate is provided and the assay is based on measuring the rate of phosphorylation of said substrate in the presence and absence of the candidate inhibitory compounds.
  • Preferably large numbers of compounds will screened using high through put techniques to identify tssk specific inhibitory compounds.
  • specific inhibitors of the tssk kinase activity are identified by providing an in vitro kinase assay composition, wherein the composition comprises a labeled source of phosphate, a tssk substrate and a tssk kinase selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 9.
  • the rate of tssk substrate phosphorylation will be determined under controlled conditions in the absence of any inhibitory compounds, and then the identical conditions will be used to measure the rate of phosphorylation of the tssk substrate when the assay is run in the presence of one or more potential inhibitory compounds.
  • Those compounds that decrease the activity of the tssk kinase will be identified and tested to determine if the inhibitory effect is specific to the tssk kinase.
  • the method for identifying human tssk inhibitors comprises the steps of providing a labeled source of phosphate, a tssk substrate and a tssk kinase selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, contacting that composition with one or more potential inhibitory compounds and measuring the rate of phosphorylation.
  • the labeled source of phosphate is [ ⁇ 32P] ATP and the tssk substrate comprises an amino acid sequence of SEQ ID NO: 8.
  • the kinase assay can also be conducted with two or more of the human tssk kinases present to confirm the activity of the inhibitor to all three kinases.
  • RT-PCR Reverse transcription-polymerase chain reaction
  • This PCR fragment recognized a 1020 bp transcript in male germ cells by northern blot analysis.
  • a full length cDNA was cloned from a mouse mixed germ cell cDNA library.
  • This cDNA has an open reading frame of 804 bases encoding a protein of 268 amino acids. Tissue expression analysis revealed that this protein kinase is developmentally expressed in mouse testicular germ cells and is not present in brain, ovary , kidney, liver or early embryonic cells.
  • This novel putative serine/threonine protein kinase (SEQ ID NO: 9) is almost identical to tssk3 (Zuercher et al, 2000, Mech Dev 93, 175-7), a recently described mouse testis-specific protein kinase, with the exception of several base pair deletions that result in a shift in the coding region and an alteration of 22 amino acids (residues 109 to 131).
  • the human homologue of this novel protein kinase (SEQ ID NO: 6) was subsequently cloned and displayed expression exclusively in the testis.
  • Fluorescence in situ hybridization using both the human and mouse cDNA clones revealed syntenic localization on chromosomes lp34-35 and 4E, respectively. Due to the homology with tssk3 this novel protein kinase is named tssk3b.
  • Purified populations of pachytene spermatocytes, round spermatids, and condensing spermatids were prepared from decapsulated testes of adult mice (CD- 1 ; Charles Rivers) by sequential dissociation with collagenase and trypsin-DNase 1 (Bellve et al, 1977; Romrell et al, 1976). The cells were separated into discrete populations by sedimentation velocity at unit gravity in 2-4 % BSA gradients in enriched Krebs Ringer Bicarbonate Medium (EKRB) (Bellve et al, 1977; Romrell et al., 1976).
  • EKRB enriched Krebs Ringer Bicarbonate Medium
  • the pachytene spermatocyte and round spermatid populations were each at least 85 % pure, while the condensing spermatid population was -40-50 % pure (contaminated primarily with anucleated residual bodies and some round spermatids ).
  • RNA from somatic tissues, testis of mice of defined ages, and isolated spermatogenic cells of adult mice was isolated by homogenizing the cells in 5 M guanidium isothiocyanate, 25 mM sodium citrate, pH 7.2, 0.5 % Sarkosyl, and 0.1 M 2-mercaptoethanol (Chirgwin et al., 1979). Lysates were centrifuged over cushions of 5.7 M CsCl, 0.1 M EDTA at 114,000 x g at 20°C overnight. Pellets were resuspended and extracted with phenol xhloroform, and the RNA was precipitated with ethanol.
  • the appropriate DNA probe was generated by PCR, radiolabeled with 32p-dCTP by the random-primed method and incubated with the blots (1 x 10 6 cpm/ml) in 50% formamide, 5X Denhartdt's, 0.1% SDS, 100 ⁇ g/ml Torula RNA, 5X SSPE with 10 % dextran sulfate and hybridized at 42°C overnight. Blots were washed in 2X SSPE, 0.1 % SDS and then in 0.1XSSPE, 0.1% SDS, both for 2x10 min at room temperature. After washing, the filters were air-dried and exposed to film at - 70°C with intensifying screens. Northern blots of human tissues were acquired from Clontech and hybridization was performed as described above.
  • RT -PCR Reverse transcription-polymerase chain reaction
  • degenerate primers were used to target conserved regions of tyrosine kinases: for the reverse transcription step, a degenerate antisense 20-mer corresponding to the coding subregion J-X common to the subfamily of tyrosine kinases with the addition of a 5' Eco RI consensus site for subcloning after three random nucleotides (CGTGGATCCA(A/T)AGGACCA(C/G)AC(A/G)TC; SEQ ID NO: 11); (2) For the PCR step the same primer was used together with a degenerate sense 20-mer corresponding to the subregion Nib common to the subfamily of tyrosine kinases, also a consensus site for Eco RI was introduced after four random nucleotides ATTCGGATCCAC(A/C)G(A/C/T/G)GA(C/T)(C/T)T; SEQ ID NO: 12.
  • the cDNA was subcloned into a TOPO TA cloning vector according to the manufacturers instructions (In Vitrogen), the Eco RI subcloning consensus sites were not used. Minipreps from 35 positive colonies were prepared using a Qiagen kit and then sequenced using a T7 primer.
  • the amplified cDNA fragment was cloned and sequenced using the TOPO TA cloning kit (Invitrogen).
  • the 5' end of the cDNA sequence obtained following 5' RACE was used to design a sense primer S3 (GCAGGTGAGAATGTTCTAACGCTG; SEQ ID NO: 17); an antisense primer A4 (TCTCCCCCTACTTTATTGGAGAGC; SEQ ID NO: 18) was based on the 3' end of Al 553938.
  • S3 sense primer S3
  • an antisense primer A4 TCTCCCCCTACTTTATTGGAGAGC
  • SEQ ID NO: 18 was based on the 3' end of Al 553938.
  • These two primers were then used to amplify the full length human tssk3b homologue from the same library using the conditions described above.
  • the amplified 1.058 kb fragment was excised, cloned and sequenced using the University of Virginia sequencing facility.
  • Fluorescence in situ hybridization (FISH) and detection of immunofluorescence were carried out as previously described (Bell et al., 1995, Cytogenet. Cell Genet, 70: 263-267).
  • the 1 kb, mouse cDNA clone, as well as the corresponding 1 kb human homologue, were biotinylated by nick translation in a reaction containing 1 ⁇ g DNA, 20 ⁇ M each of dA TP , dCTP and dGTP (Perkin Elmer), 1 ⁇ M dTTP (Perkin Elmer), 25 mM Tris-HCl, pH 7.5,5 mM MgC12 (Sigma), 10 mM B-mercaptoethanol (Sigma), 10 ⁇ M biotin-16-dUTP (Boehringher Mannheim), 2 units DNA polymerase I/DNase I (GIBCO, BRL), and H 2 O to a total volume of 50 ⁇ l.
  • Probes were denatured and hybridized to metaphase spreads from human peripheral lymphocytes and mouse embryonic fibroblasts, respectively.
  • the hybridized probe was detected with fluorescein-labeled avidin and the signal amplified by the addition of anti-avidin antibody (Oncor) and a second layer of fluorescein-labeled avidin.
  • the chromosome preparations were counterstained with DAPI and observed with a Zeiss Axiophot epiflourescence microscope equipped with a cooled CCD camera (Photometries, Arlington, AZ) operated by a Macintosh computer workstation. Digitized images of DAPI staining and FITC signals were captured, pseudocolored, and merged using Oncor version 1.6 software.
  • the expression pattern of murine tssk-3b was investigated by northern blot analysis of total RNA from different mouse tissues using a tssk-3b specific probe corresponding to the full length transcript of tssk 3b.
  • This probe recognized a single transcript of approximately 1 kb exclusively in the mixed mouse germ cell population prepared as described in Methods. At high exposures it is also possible to distinguish a 1.35 kb transcript also exclusively in germ cells, this transcript was not observed when the mouse germ cell library was screened and could represent a splicing alternative of tssk 3b.
  • To further analyze the expression pattern of tssk-3b in the testis a northern blot with RNA obtained from purified germ cells of the adult testis was probed.
  • tssk-3b mRNA was found to be expressed postmeiotically in round and condensing spermatids but not in the meiotic pachytene spermatocytes.
  • Mouse testes differentiate at d 11-12 of embryonic development and are populated by primordial germ cells. The first spermatogenic wave is initiated a few days after birth and spermatogonia differentiate to early spermatids before puberty. The differentiation to mature sperm is testosterone dependent and occurs after puberty.
  • tssk-3b is expressed postmeiotically, total testis RNA was prepared from mice of different postnatal ages (1,3, 7, 10, 15, 20, 24, 30 and adult) and analyzed by northern blot analysis. Transcription of tssk-3b began between 20 and 24 days after birth confirming a postmeiotic expression of this mRNA.
  • a human EST from germ cell tumor was identified by a BLAST search of the databases, and used in conjunction with 3' and 5' RACE to clone the full length human homologue (SEQ ID NO: 3) from an adapted ligated human testis cDNA library (Clontech) as described in Methods.
  • SEQ ID NO: 3 the full length human homologue from an adapted ligated human testis cDNA library
  • a tissue northern blot (Clontech) was probed with a C terminal 400 bp fragment of the human tssk3 cDNA.
  • 1 kb and 1.35 kb RNA transcripts were expressed exclusively in the testis. Similar to the mouse case, the 1.35 kb fragment could represent an alternative spliced transcript.
  • mice tssk 3b and the human homologue tssk 3 of these novel ser/thr kinases have the highest homology (98 %) between each other, followed by mouse tssk3 (92 %) mouse tsskl and mouse tssk 2 (56 %) suggesting that this kinase belongs to the same subfamily of novel ser/thr kinases.
  • tssk 3 and tssk 3b have a very high homology (92%), the difference between these two sequences is restricted to a stretch of 22 aminoacids (residues 109 to 131 ).
  • tssk 3b The chromosomal location of tssk 3b has also been mapped by fluorescence in situ hybridization (FISH) using the full length human cDNA probe. Fluorescent signals were detected on chromosome 1 in all 20 metaphase spreads scored. Among a total of 109 signals observed, 49 ( 45% ) were on 1 p. All chromosome-specific signals were localized to 1 p34.1-34.3. The distribution of signals was as follows: 1 chromatid (6 cells), two chromatids (14 cells) and three chromatids (5 cells). The mouse tssk 3b cDNA homologue mapped to the syntenic region in chromosome 4, band E.
  • FISH fluorescence in situ hybridization
  • mice tssk 1 and 2 amino acid sequences were obtained. These genes mapped to chromosome 5 and 22 respectively and are intronless. The sequences corresponding to the 3' end and 5' end of the coding region were used to design sense and antisense primers respectively.
  • the antisense primers were used in 5' RACE and the sense primer in 3' RACE using human testis marathon ready cDNA (Clontech, Inc.) as the template in order to ultimately obtain a full length sequence of both human kinase homologs.
  • the amplified cDNA fragments were cloned using the TOPO TA cloning kit (Invitrogen) and sequenced.
  • TOPO TA cloning kit Invitrogen
  • the 5' end of the cDNA sequences obtained following 5' RACE were used to design a 5' sense primer.
  • the 3' end of the cDNA sequences obtained following 3' RACE were used to design antisense primers.
  • the amplified sequences 1.3 kb (tsskl) and of 1.2 kb (tssk 2) were subcloned and sequenced.
  • the translated human homologues ofthe three members of the tssk kinase family are provided as SEQ ID NOS: 1-3, respectively.
  • Antibodies made against tssk kinases and against the tssk substrate will be used to analyze for the presence of these kinases in other tissues.
  • Clontech protein MedleysTM of different tissues such as brain, heart, kidney, liver, lung, ovary, placenta, skeletal muscle and spleen will be tested by western blot using the anti tssk and anti tssk substrate antibodies. Since mRNAs coding for tssk 1, 2 and 3 are only present in the testis, a similar protein distribution is expected.
  • human homologues of tssk kinases have more than 80 % homology when compared with their mouse counterparts, it is expected that antisera against the human recombinant tssk kinases recognize the mouse homologues as well.
  • the antibodies made against the human tssk kinases will be also tested in mouse tissues.
  • Rats and rabbits will be used for production of antibodies. Protocol as described by Mandal et al. (1999) will be followed for this purpose.
  • Antibody titers will be monitored by ELISA and specificity of the antibody will be checked by SDS- PAGE and Western blotting analysis.
  • the specific antibodies against the soluble enzyme will be used in immunofluorescence experiments and immunoelectromicroscopy of human testicular tissue and human sperm. In addition, if the antibodies recognize the mouse antigens, the localization will be explored by immunofluorescence in mouse germ cells and sperm.
  • Sperm will be treated in the appropriate experimental conditions, fixed in suspension with a solution of 3 % (w/v) paraformaldehyde-0.05 % (v/v) glutaraldehyde in PBS for 1 h, washed in PBS at 37 C, and then permeabilized with 0.1 % (v/v) Triton X-100 in PBS at 37 C for 10 min.
  • the sperm will then be washed in PBS and incubated overnight with serial dilutions (5, 10, 50 and 100) of the appropriate antibody as previously described (Nisconti et al, 1996). After washing the sperm with PBS, they will be incubated with FITC-coupled goat anti mouse IgG and then attached to poly-lysine-coated microscope slides. Following 3 X washes with PBS, the slides will be mounted with fluoromont and fluorescence will be assessed. Testicular samples obtained from testicular biopsies will be processed as previosly described (Westbrook et al, 2000).
  • E coli's relatively simple, easy- to scale-up Open reading frames of TSSK1, 2, 3 will be amplified and fused with his tag in pET28b vector ( ⁇ ovagen). The plasmid will be transformed into BL21 DE3 or other appropriate host strain. Recombinant protein production will be induced by addition of IPTG to ImM final in the cultural medium. Recombinant protein will be purified from E coli lysate using ⁇ i- ⁇ TA column under native condition. To facilitate crystal formation, highly purified protein is optimal. To purify the protein preparation from above, preparative electrophoresis using PrepCell (BIO-RAD) will be employed. Kinase assay will be conducted before proceeding to crystallography.
  • tssk 1, 2 and 3 as well as for the tssk substrate will be made.
  • the coding region of each of these proteins will be subcloned in the pET28b expression vector that contains at the C-terminus 6 residues of His-tag.
  • the constructs will be made using complete ORF. primers that are designed to create an ⁇ del site at the 5' end and an Xhol site at the 3' end. The amplified products will be ligated into the ⁇ del-Xhol sites of pET28b expression vector.
  • TSSK 2 protein was successfully expressed in E. coli and purified. To express tssk 2, the open reading frame was subcloned into a pET28b expression vector carrying a His-tag. Recombinant protein was produced following induction with IPTG. Bacterially expressed and partially purified tssk2 was further purified by preparative gel electrophoresis using a PrepCell from Biorad. The fractions were collected and analyzed by SDS-PAGE. TSSK substrate was expressed and purified similarly. These purified proteins were used to produce rat polyclonal antibodies using standard techniques.
  • Tssk 2 interacts with tsks in a yeast two-hybrid system
  • tssk 2 To demonstrate protein-protein interaction between tssk 2 and tsks a two yeast hybrid system was utilized.
  • a bait gene tssk 2 was first transformed into the reporter strain as a fusion to the GAL4 DNA binding domain (DNA-BD).
  • Western blots were performed to confirm expression of fusion proteins in yeast. Interaction between tssk 2 and tsks was observed to promote transcription of the Histidine (HIS) gene and allow for the growth of yeast in His-free medium.
  • HIS Histidine
  • Crystals will be obtained at 21°C by equilibrating sitting drops.
  • the crystals will be transferred to a similarly buffered solution through three solutions with intermediate concentrations of these reagents.
  • Cu K ⁇ radiation from rotating anode X-ray generators will be used. Final structure will be established after preliminary refinement, model improvement and further improvement.
  • a kinase assay for the tssk family is advantageous from different points of view.
  • an kinase assay will allow for the characterization of the kinetic properties of these enzymes such as the Km for ATP, divalent cation and substrate.
  • a kinase assay will confirm the folding of the recombinant proteins.
  • tssk kinase activity will follow general characteristics of kinase assays such as presence of substrate, [ ⁇ 32P]ATP, Mg 2+ and/or Mn 2+ and phosphatases inhibitors.
  • a source of tssk kinase must be provided.
  • the tssk kinase will be generated by recombinantly expressing these proteins and purifying the expressed kinase.
  • ORFs of the respective human tssk kinases will be subcloned in a pCMN-HA epitope-tagged mammalian expression vector (Clontech cat # K6003-1).
  • the ORF of the tssk substrate will be subcloned in a pCMN-Myc mammalian expression vector (Clontech, same as above).
  • Each of the three HA- kinases will be coexpressed with the cMyc-tssk substrate in three separate COS cell lines for each of the respective human tssks. Coexpression will be validated performing immunofluorescence with the respective antitag antibodies.
  • Antibodies against HA and Myc are available from Clontech. Since anti c-Myc is a mouse monoclonal and anti HA is a rabbit polyclonal, it will be possible to analyze whether both the kinase and the substrate were coexpressed in the same cells.
  • Proteins will be then extracted with 1 % Triton and immunoprecipitation will be performed using anti HA-tag antibodies.
  • anti tssk-kinase / anti-tssk substrate antibodies could be used to immunoprecipitate the tssk kinases and tssk substrate.
  • the antibodies will be linked to a solid support such as a sepharose bead to assist in the isolation of the target ligand.
  • the pellet After precipitation with Protein A sepharose, the pellet will be assayed for kinase activity using different concentrations of ATP (10 ⁇ M, 100 ⁇ M and 1 mM), Mg 2+ or Mn 2+ (100 ⁇ M , 1 mM and 10 mM) and 1 ⁇ Ci of [ ⁇ 32P] ATP.
  • the phosphorylated protein will be evaluated following SDS-PAGE separation and autoradiography.
  • the evaluation of kinase activity after immunoprecipitation is a frequently used method that allow for specific measurement of the activity of one particular kinase (Coso et al, 1995, Cell 81, 1137-46; Moos et al., 1995, Biol Reprod 53, 692-9).
  • tssk 2 and tsks were used to produce rat polyclonal antibodies. Antisera against recombinant human tssk 1, 2 and 3 as well as to the human tssk substrate will be employed to define their tissue distribution and subcellular localization at the protein level.
  • the rat anti-tssk and anti-tsks antibodies recognized the recombinant protein and also proteins in sperm and testes with the predicted MW, suggesting that at least one member of the tssk family and their substrate (tsks) are present in sperm. These antibodies were then used to study the intracellular localization of these proteins in capacitated human sperm.
  • Tssk 2 was observed to localized to the equatorial segment of human sperm. Tsks also localized to the equatorial segment. Nevertheless anti-tsks antibody also recognize proteins present in the anterior head and in the tail. Immunolocalization of these molecules suggests that tssk 2 and tsks are present in similar region of the sperm at least in a fraction of the human sperm population. Control experiments were performed using rat pre immune serum of the respective antibody. Both Western blots and immunofluorescence were negative. Although the antibody against tssk 2 was produced against tssk 2, we can not discard that this antibody recognized other members of the tssk family since their sequences have high homology. However, discrimination between the three tssk isoenzymes, may be possible by generating antibodies against the C-terminal domain that is different between tssk 1 and 2 and is not present in tssk 3.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Analytical Chemistry (AREA)
  • Reproductive Health (AREA)
  • Endocrinology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Steroid Compounds (AREA)
PCT/US2001/046803 2000-11-09 2001-11-09 Human testis specific serine/threonine kinase Ceased WO2002038732A2 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
EP01986508A EP1339866B1 (en) 2000-11-09 2001-11-09 Human testis specific serine/threonine kinase
DE60142984T DE60142984D1 (de) 2000-11-09 2001-11-09 Menschliche hodenspezifische serin/threonin-kinase
AU2002237699A AU2002237699B9 (en) 2000-11-09 2001-11-09 Human testis specific serine/threonine kinase
US10/416,477 US7129057B2 (en) 2000-11-09 2001-11-09 Human testis specific serine/threonine kinase 3
AU3769902A AU3769902A (en) 2000-11-09 2001-11-09 Human testis specific serine/threonine kinase
IL15580001A IL155800A0 (en) 2000-11-09 2001-11-09 Nucleic acid sequences encoding human testis specific kinases
AT01986508T ATE479771T1 (de) 2000-11-09 2001-11-09 Menschliche hodenspezifische serin/threonin- kinase
JP2002542049A JP2004513631A (ja) 2000-11-09 2001-11-09 ヒト精巣特異的セリン/スレオニンキナーゼ
IL15580101A IL155801A0 (en) 2000-11-09 2001-11-09 A nucleic acid sequence encoding human testis specific kinases
IL155800A IL155800A (en) 2000-11-09 2003-05-08 Nucleic acid sequences encoding human testis specific kinases
IL155801A IL155801A (en) 2000-11-09 2003-05-08 Nucleic acid sequence encoding human testis specific kinases
US10/438,339 US6946275B2 (en) 2000-11-09 2003-05-09 Human testis specific serine/threonine kinase 1 and 2
AU2003204266A AU2003204266B2 (en) 2000-11-09 2003-05-20 Human testis specific serine/threonine kinase
AU2006202059A AU2006202059C1 (en) 2000-11-09 2006-05-16 Human Testis Specific Serine/Threonine Kinase

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US24693900P 2000-11-09 2000-11-09
US60/246,939 2000-11-09
US26492101P 2001-01-30 2001-01-30
US60/264,921 2001-01-30

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/438,339 Continuation US6946275B2 (en) 2000-11-09 2003-05-09 Human testis specific serine/threonine kinase 1 and 2

Publications (2)

Publication Number Publication Date
WO2002038732A2 true WO2002038732A2 (en) 2002-05-16
WO2002038732A3 WO2002038732A3 (en) 2002-12-05

Family

ID=26938336

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/046803 Ceased WO2002038732A2 (en) 2000-11-09 2001-11-09 Human testis specific serine/threonine kinase

Country Status (8)

Country Link
US (2) US7129057B2 (https=)
EP (1) EP1339866B1 (https=)
JP (5) JP2004513631A (https=)
AT (2) ATE477332T1 (https=)
AU (4) AU2002237699B9 (https=)
DE (2) DE60142804D1 (https=)
IL (4) IL155801A0 (https=)
WO (1) WO2002038732A2 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014788A3 (en) * 2003-08-07 2005-10-13 Univ Virginia Tssk4: a human testis specific serine/threonine kinase
CN115976033A (zh) * 2022-12-14 2023-04-18 西南大学 瓜实蝇tssk1和tssk3基因及其应用

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004508013A (ja) * 2000-05-12 2004-03-18 メルク パテント ゲゼルシャフト ミット ベシュレンクテル ハフトング 新規セリン−トレオニン・キナーゼ−3
US20080274117A1 (en) * 2004-09-30 2008-11-06 Herr John C Validation of Tssk Family Members and Tsks as Male Contraceptive Targets
JP2008067649A (ja) * 2006-09-14 2008-03-27 Osaka Univ 妊孕性診断キット、変異検出方法、ポリヌクレオチド、及びポリペプチド

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2383244A1 (en) * 1999-05-28 2000-12-07 Sugen, Inc. Protein kinases
EP1242584A2 (en) * 1999-12-23 2002-09-25 Incyte Genomics, Inc. Human kinases
US20040048249A1 (en) * 2000-01-21 2004-03-11 Tang Y. Tom Novel nucleic acids and secreted polypeptides
CA2399776A1 (en) * 2000-02-03 2001-08-09 Hyseq, Inc. Novel nucleic acids and polypeptides
CA2409686A1 (en) * 2000-05-05 2001-11-08 Merck Patent Gesellschaft Mit Beschraenkter Haftung Serine-threonine kinase
US6482935B1 (en) * 2000-05-24 2002-11-19 Applera Corporation Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof
WO2002068649A2 (en) * 2001-01-31 2002-09-06 Curagen Corporation Proteins and nucleic acids encoding same
US20030211093A1 (en) * 2001-07-20 2003-11-13 Henry Yue Human kinases

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BIELKE ET AL., GENE, vol. 139, 1994, pages 235 - 9
KUENG ET AL., J CELL BIOL, vol. 139, 1997, pages 1851 - 9
ZUERCHER ET AL., MECH DEV, vol. 93, 2000, pages 175 - 7

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014788A3 (en) * 2003-08-07 2005-10-13 Univ Virginia Tssk4: a human testis specific serine/threonine kinase
JP2007501614A (ja) * 2003-08-07 2007-02-01 ユニバーシティ オブ バージニア パテント ファウンデーション Tssk4:ヒト精巣特異的セリン/トレオニンキナーゼ
CN115976033A (zh) * 2022-12-14 2023-04-18 西南大学 瓜实蝇tssk1和tssk3基因及其应用
CN115976033B (zh) * 2022-12-14 2024-05-17 西南大学 瓜实蝇tssk1和tssk3基因及其应用

Also Published As

Publication number Publication date
EP1339866A4 (en) 2006-10-25
DE60142804D1 (de) 2010-09-23
IL155801A0 (en) 2003-12-23
US6946275B2 (en) 2005-09-20
JP2009148281A (ja) 2009-07-09
AU3769902A (en) 2002-05-21
US20030211563A1 (en) 2003-11-13
ATE477332T1 (de) 2010-08-15
JP2010029197A (ja) 2010-02-12
AU2003204266B2 (en) 2006-06-15
JP2004135653A (ja) 2004-05-13
AU2002237699B9 (en) 2006-06-29
EP1339866B1 (en) 2010-09-01
IL155800A (en) 2009-09-01
US7129057B2 (en) 2006-10-31
IL155800A0 (en) 2003-12-23
AU2006202059A1 (en) 2006-06-15
IL155801A (en) 2009-12-24
WO2002038732A3 (en) 2002-12-05
EP1339866A2 (en) 2003-09-03
AU2006202059C1 (en) 2009-06-11
AU2006202059B2 (en) 2009-01-08
AU2002237699B2 (en) 2006-05-25
US20040030112A1 (en) 2004-02-12
JP2007306930A (ja) 2007-11-29
JP2004513631A (ja) 2004-05-13
AU2006202059A2 (en) 2006-06-15
ATE479771T1 (de) 2010-09-15
DE60142984D1 (de) 2010-10-14

Similar Documents

Publication Publication Date Title
Broccoli et al. Human telomeres contain two distinct Myb–related proteins, TRF1 and TRF2
Schmandt et al. Cloning and characterization of mPAL, a novel Shc SH2 domain-binding protein expressed in proliferating cells
JP2010029197A (ja) ヒト精巣特異的セリン/スレオニンキナーゼ
CA2270911A1 (en) Mammalian chk1 effector cell-cycle checkpoint protein kinase materials and methods
AU2002237699A1 (en) Human testis specific serine/threonine kinase
Osada et al. Subcellular localization and protein interaction of the human LIMK2 gene expressing alternative transcripts with tissue-specific regulation
EP1443117B1 (en) Human testis specific serine/threonine kinase
US20020064849A1 (en) Human soluble testicular adenylyl cyclase
US6824971B1 (en) Methods of inhibiting or enhancing the TGFβ-SMAD signaling pathway
AU2006218336B2 (en) Human testis specific serine/threonine kinase
US20050032146A1 (en) Tssk4: a human testis specific serine/threonine kinase
EP0803571B1 (en) TAB1 protein and DNA coding therefor
US7381543B2 (en) TAB1 protein and DNA coding therefore
CA2365020C (en) Ganp proteins
JP2002523429A (ja) Grip、grb2ファミリーメンバー関連ヒトアダプター蛋白質
WO1998048020A2 (en) Mammalian ubiquitin-isopeptidases that control cell proliferation
US20080274117A1 (en) Validation of Tssk Family Members and Tsks as Male Contraceptive Targets
JP2001503994A (ja) チロシンリン酸化切断溝関連タンパク質(pstpip)
EP1162460A1 (en) Mammalian Suv39h2 proteins and isolated DNA molecules encoding them
US20030045699A1 (en) Membrane receptors for steroids and sterols
Nayak A segment of mouse 16 contains a cluster of genes expressed in the developing brain and reproductive system
IL130953A (en) TYROSINE PHOSPHORYLATED CLEAVAGE FURROW- ASSOCIATED PROTEINS (PSTPIPs)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 155800

Country of ref document: IL

Ref document number: 155801

Country of ref document: IL

Ref document number: 2002542049

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 10438339

Country of ref document: US

Ref document number: 10416477

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2002237699

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2001986508

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2001986508

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642