WO2002036816A2

WO2002036816A2 - Method of determining susceptibility to diseases

Info

Publication number: WO2002036816A2
Application number: PCT/GB2001/004865
Authority: WO
Inventors: Simon Jeremy Dowell; Michael John Sheehan
Original assignee: Glaxo Group Limited
Priority date: 2000-11-03
Filing date: 2001-11-02
Publication date: 2002-05-10
Also published as: AU2002210761A1; WO2002036816A3

Abstract

The present invention relates to polymorphisms in the adenosine 2a (A2a) human receptor gene, and to the use of such polymorphisms in the prognosis, diagnosis and treatment of diseases associated with said receptor eg. asthma, chronic obstructive pulmonary disease (COPD), motor dyskinesia disorders (such as Parkinson's disease) or diseases associated with dysregulation of the immune system.

Description

Method of determining susceptibility to diseases

Adenosine is a purine nucleoside capable of affecting a number of diverse physiological processes via the activation of cell-surface adenosine receptors. Adenosine receptors belong to the G-protein coupled receptor superfamily of which many have conserved amino acid residues in the transmembrane regions. To date, molecular cloning and pharmacological and functional analysis has identified four receptor subtypes - A1 , A2a, A2b and A3.

The cDNA sequence of the human adenosine A2a gene has been identified and by the synthesis of degenerate oligonucleotides and the amplification of the cDNA by use of novel PCR products were compared to cDNA libraries which established the amino acid sequence (Genbank accession number S46950) (Furlong et al., (1992), Brain Research. Molecular Brain Research. 15(1-2), 62-66). This sequence has later been confirmed by an independent group (MacCollin et al., (1994), Genomics. 20(2), 332-333). Subsequently, however, two other human A2a cDNA sequences have been reported (Genbank X68486 and 97370). These both vary from the first reported sequence by a one base pair substitution of adenine by guanine at nucleotide position 1174. This substitution results in a change in the amino acid sequence from an arginine (R) residue to a glycine (G) residue at position 392, which is in the C- terminal tail of the receptor.

The sequence of the A2a receptor has also been reported in a longer and a shorter form, the shorter form omitting the 3 amino acids Met-Pro-lle present in the longer form at the N-terminus.

The amino acid sequence of the A2a receptor (longer sequence) wherein glycine is present at residue number 392, is shown in Figure 1 (the 392G polymorph), and the nucleotide sequence of the A2a receptor gene encoding the 392G polymorph is shown in Figure 2. In the shorter A2a receptor amino acid sequence the corresponding position for the polymorphism is 389 (and in the corresponding nucleotide sequence the position for the polymorphism is 1165). It has been proposed that sequence variations such as these could arise either through artefacts introduced during the preparation of the cDNA or through gene polymorphisms (i.e. natural variations in nucleotide sequences found in the general population). These sequence variants of the human adenosine A2a receptor have previously been investigated and in all of the 40 unrelated individuals tested, glycine was found at position 392 for the longer sequence. From this finding it was concluded that the presence of arginine was either an artefact of the original cDNA or that it represented a relatively infrequent polymorphism and that it was likely that glycine is the correct amino acid for this position (Le et al., (1996), Biochem. & Biophys. Res. Comm. 223(2), 461-467).

If the glycine/arginine sequence variants are genuine polymorphs, this would represent a substitution of a small uncharged amino acid for a large and positively charged residue. The side-chain of glycine (along with cysteine and proline) displays unique properties that can have a major role in the way the receptor folds. Glycine has a single hydrogen atom as its side-chain and this allows it to fit into very small spaces, enabling it to produce a conformational change in the protein folding. This could cause major changes in the pharmacological behaviour or ligand binding properties of the receptor.

Surprisingly, we have determined that these sequence variants represent genuine polymorphisms and furthermore have discovered that the arginine variant is expressed at much higher levels than the glycine variant. This finding is not only indicative that the presence of the infrequent arginine variant is a predicted marker for the onset of diseases associated with the functional hyperactivity of the human A2a receptor, but also that treatment of said diseases by A2a antagonists and inverse agonists would be more effective against the arginine receptor variation. Thus, it is indicative that A2a antagonists and inverse agonists are likely to be effective at lower doses which may result in a higher therapeutic index in human subjects having this particular polymorphism. Conversely, this finding is indicative that the presence of the more frequent glycine variant is a predicted marker for the onset of diseases associated with the functional reduced activity of the human A2a receptor, and also that treatment of said diseases by A2a agonists would be more effective against the glycine receptor variation. Thus, it is indicative that A2a agonists are likely to be effective at lower doses which may result in a lower therapeutic index in human subjects having this particular polymorphism. Examples of disease states which are associated with reduced activity of A2a receptors and which may be treated by A2a agonists include diseases of the respiratory tract such as adult respiratory distress syndrome (ARDS), bronchitis (including chronic bronchitis), cystic fibrosis, asthma (including allergen-induced asthmatic reactions), chronic obstructive pulmonary disease (COPD), emphysema, rhinitis and septic shock. Other relevant disease states include diseases of the gastrointestinal tract such as intestinal inflammatory diseases including inflammatory bowel disease (e.g. Crohn's disease or ulcerative colitis), Helicobacter-pylori induced gastritis and intestinal inflammatory diseases secondary to radiation exposure or allergen exposure, and non-steroidal anti-inflammatory drug-induced gastropathy. Diseases such as psoriasis, allergic dermatitis and hypersensitivity reactions and diseases of the central nervous system which have an inflammatory component eg Alzheimer's disease and multiple sclerosis may also be associated with A2a receptors. Further examples include cardiac conditions such as peripheral vascular disease, post-ischaemic reperfusion injury, idiopathic hypereosinophilic syndrome, auto-immune diseases such as rheumatoid arthritis and diabetes and metastasis. Of particular interest in treatment by A2a agonists are respiratory disorders eg. asthma or COPD.

Examples of disease states which are associated with hyperactivity of A2a receptors and which may be treated by A2a inverse agonists or antagonists include motor dyskinesia disorders such as Parkinson's disease or diseases associated with dysregulation of the immune system.

A2a agonists useful for treatment of respiratory disorders eg. asthma or COPD have been described in WO 98/28319, WO 99/38877, WO 99/41267 (Glaxo Group Limited) and WO 00/23457 and WO01/60835 (Pfizer). More specifically agonists of particular interest include the following:

(2R,3R,4S,5R)-2-[6-Amino-2-(1S-hydroxymethyl-2-phenyl-ethylamino)-purin- 9-yl]-5-(2-ethyl-2H-tetrazol-5-yl)-tetrahydro-furan-3,4-diol; (2R,3S,4R,5R)-2-(2-Ethyl-2H-tetrazol-5-yl)-5-{2-[2-(1-methyl-1 H-imidazol-4-yl)- ethylamino]-6-phenethylamino-purin-9-yl}-tetrahydro-furan-3,4-diol;

(2R,3R,4S,5R)-2-[6-(2,2-Diphenyl-ethylamino)-2-(pyrrolidin-3R-ylamino)-purin-9-yl]- 5-(2-ethyl-2H-tetrazol-5-yl)-tetrahydro-furan-3,4-diol;

(2S,3S,4R,5R)-2-(3-Ethyl-isoxazol-5-yl)-5-[6-(1-ethyl-propylamino)-2-(2-piperidin-1- yI-ethylamino)-purin-9-yl]-tetrahydro-furan-3,4-diol; (2R,3R,4S,5S)-2-{6-(1-Ethyl-propylamino)-2-[2-(1-methyl-1 H-imidazol-4-yl)- ethylamino]-purin-9-yl}-5-(3-hydroxymethyl-isoxazol-5-yl)-tetrahydro-furan-3,4-diol; (2R,3R,4S,5S)-2-(3-Ethyl-isoxazol-5-yl)-5-[6-phenethylamino-2-(2-piperidin-1-yl- ethylamino)-purin-9-yl]-tetrahydro-furan-3,4-diol; (2S,3S,4R,5R)-2-(3-Ethyl-isoxazol-5-yl)-5-{6-(1-ethyl-propylamino)-2-[2-(1- methyl-1H-imidazol-4-yl)-ethylamino]-purin-9-yl}-tetrahydro-furan-3,4-diol; (2R,3R,4S,5S)-2-{6-(2,2-Diphenyl-ethylamino)-2-[2-(pyridin-2-ylamino)-ethylamino]- purin-9-yl}-5-(3-ethyl-isoxazol-5-yl)-tetrahydro-furan-3,4-diol; (2R,3R,4S,5S)-2-[6-(2,2-Diphenyl-ethylamino)-2-(1S-hydroxymethyl-2-phenyl- ethylamino)-purin-9-yl]-5-(3-ethyl-isoxazol-5-yl)-tetrahydro-furan-3,4-diol;

(2R,3R,4S,5S)-2-[6-(2,2-Diphenyl-ethylamino)-2-(2-morpholin-4-yl-ethylamino)-purin- 9-yl]-5-(3-ethyl-isoxazol-5-yl)-tetrahydro-furan-3,4-diol; and

(2R,3R,4S,5S)-2-[6-Amino-2-(1S-hydroxymethyl-2-phenyl-ethylamino)-purin-9-yl]-5- (3-ethyl-[1 ,2,4]oxadiazol-5-yl)-tetrahydro-furan-3,4-diol; and salts and solvates thereof.

Of particular interest is the A2a agonist (2R,3R,4S,5R)-2-[6-Amino-2-(1S- hydroxymethyl-2-phenyl-ethylamino)-purin-9-yl]-5-(2-ethyl-2H-tetrazol-5-yl)- tetrahydro-furan-3,4-diol, especially the maleate salt thereof.

The sequence of the A2a receptor, a method of cloning it and screens employing the receptor to identify binding substances have been previously described eg. in UK patent application GB-A-2264948.

Thus, according to the present invention we provide a method of determining susceptibility of a human subject to a disease associated with A2a receptor functional hyperactivity or reduced A2a receptor activity which comprises: (a) obtaining a nucleic acid sample from a human subject; and

(b) detecting whether a polymorphism of the A2a receptor gene exists; wherein the presence of said polymorphism indicates susceptibility.

Typically, nucleic acid may be obtained from a blood sample taken from a human subject, via standard molecular biology techniques (eg. phenol/chloroform extraction). The relevant portion containing the A2a gene may then be isolated using PCR amplification, followed by sequencing to detect whether a polymorphism is present.

In one preferred embodiment of the present invention the method described herein is one wherein the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) indicates susceptibility to a disease associated with reduced A2a receptor activity.

Preferably, the disease associated with reduced A2a receptor activity is a respiratory disorder such as asthma or COPD. In another preferred embodiment of the present invention the method described herein is one wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene

(shorter sequence) indicates susceptibility to a disease associated with A2a receptor functional hyperactivity. Preferably, the disease associated with A2a receptor functional hyperactivity is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

As a further aspect of the present invention we provide a method of determining susceptibility of a human subject to a disease associated with A2a receptor functional hyperactivity or reduced A2a receptor activity which comprises:

(a) obtaining a protein sample from a human subject; and

(b) detecting whether a polymorphism of the A2a receptor exists; wherein the presence of said polymorphism indicates susceptibility.

Typically, protein may be obtained from a blood sample taken from a human subject, via standard molecular biology techniques. The relevant portion containing the A2a receptor may then be isolated using standard cleavage techniques, followed by sequencing to detect whether a polymorphism is present.

In one preferred embodiment of the present invention the method described herein is one wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at^" position 389 on the amino acid sequence of the A2a receptor (shorter sequence) indicates susceptibility to a disease associated with reduced A2a receptor activity.

Preferably, the disease associated with reduced A2a receptor activity is a respiratory disorder such as asthma or COPD. In another preferred embodiment of the present invention the method described herein is one wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) indicates susceptibility to a disease associated with A2a receptor functional hyperactivity. Preferably, the disease associated with A2a receptor functional hyperactivity is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

As a further aspect of the present invention we provide a method of treating an A2a receptor associated disease in a human subject which comprises:

(a) obtaining a nucleic acid sample from a human subject;

(b) detecting whether a polymorphism of the A2a receptor gene exists;

(c) administering an effective amount of an A2a agonist, inverse agonist or antagonist to said subject. In one preferred embodiment of the present invention the method described herein is one wherein the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject in step (b) and an agonist is administered in step (c). Preferably, the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

In another preferred embodiment of the present invention the method described herein is one wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject in step (b) and an inverse agonist or antagonist is administered in step (c).

Preferably, the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system. As a further aspect of the present invention we provide a method of treating an A2a receptor associated disease in a human subject which comprises:

(a) obtaining a protein sample from a human subject;

(b) detecting whether a polymorphism of the A2a receptor exists;

(c) administering an effective amount of an A2a agonist, inverse agonist - or antagonist to said subject.

In one preferred embodiment of the present invention the method described herein is one wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject in step (b) and an agonist is administered in step (c). Preferably, the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

In another preferred embodiment of the present invention the method described herein is one wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject in step (b) and an inverse agonist or antagonist is administered in step

(c).

Preferably, the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

As a further aspect of the present invention we provide the use of an A2a agonist, inverse agonist or antagonist in the preparation of a medicament for treating an A2a receptor associated disease in a human subject wherein the presence of a polymorphism of the A2a receptor gene has been detected in said subject.

In one preferred embodiment of the present invention the use described herein is of an A2a agonist wherein the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject. Preferably, the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

In another preferred embodiment of the present invention the use described herein is of an A2a inverse agonist or antagonist wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject.

As a further aspect of the present invention we provide the use of an A2a agonist, inverse agonist or antagonist in the preparation of a medicament for treating an A2a receptor associated disease in a human subject wherein the presence of a polymorphism of the A2a receptor has been detected in said subject.

In one preferred embodiment of the present invention the use described herein is of an A2a agonist wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject.

Preferably, the A2a receptor associated disease is a respiratory disorder such as asthma or COPD. In another preferred embodiment of the present invention the use described herein is of an A2a inverse agonist or antagonist wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject. Preferably, the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

As a further aspect of the present invention we provide a patient pack comprising an A2a agonist, inverse agonist or antagonist and instructions for administration of said agonist, inverse agonist or antagonist to a human subject detected with a polymorphism of the A2a receptor gene.

In one preferred embodiment of the present invention the patient pack described herein is one containing an A2a agonist wherein the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject.

In another preferred embodiment of the present invention the patient pack described herein is one containing an A2a inverse agonist or antagonist wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject.

As a further aspect of the present invention we provide a patient pack comprising an A2a agonist, inverse agonist or antagonist and instructions for administration of said agonist, inverse agonist or antagonist to a human subject detected with a polymorphism of the A2a receptor. In one preferred embodiment of the present invention the patient pack described herein is one containing an A2a agonist wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject. .^' In another preferred embodiment of the present invention the patient pack described herein is one containing an A2a inverse agonist or antagonist wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject.

As a further aspect of the present invention we provide the use of a nucleotide sequence of a human A2a receptor gene polymorphism to identify compounds that affect expression of the human A2a receptor.

In one preferred embodiment of the present invention the use described herein is one wherein said polymorphism is characterised by the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence).

As a further aspect of the present invention we provide the use of an amino acid sequence of a human A2a receptor polymorphism to identify compounds that affect expression of the human A2a receptor.

In one preferred embodiment of the present invention the use described herein is one wherein said polymorphism is characterised by the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence). As a further aspect of the present invention we provide a method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) which comprises administering an effective amount of an A2a agonist. Preferably, the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

As a further aspect of the present invention we provide a method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) which comprises administering an effective amount of an A2a antagonist.

Preferably, the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system. As a further aspect of the present invention we provide a method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) which comprises administering an effective amount of an A2a agonist.

Preferably, the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

As a further aspect of the present invention we provide a method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) which comprises administering an effective amount of an A2a antagonist. Preferably, the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

As a further aspect of the present invention we provide the use of an A2a agonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence).

Preferably, the A2a receptor associated disease is a respiratory disorder such as asthma or COPD. As a further aspect of the present invention we provide the use of an A2a antagonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence). Preferably, the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

As a further aspect of the present invention we provide the use of an A2a agonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence).

As a further aspect of the present invention we provide the use of an A2a antagonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence).

Preferably, the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system. It will be appreciated that affecting expression of the A2a receptor includes repression or enhancement of expression of the A2a receptor. Detection of alterations in expression may typically be achieved by measuring expression levels of a reporter gene (eg. β-galactosidase) under the control of the promoter of the A2a receptor gene, when transfected into host cells in the presence or absence of test compounds. Typical test compounds may include polynucleotides or any other suitable molecule capable of binding to the promoter via triplex strand formation. Examples

It will be understood that reference in the following Examples to 392R and 392G refers to the arginine and glycine polymorphs, respectively. Experimental

Yeast Transformations

An overnight culture of MMY11 yeast was grown in 5mls of YEPD medium on a shaking incubator at 30^°C. The following morning, 50mls of a 1 in 100 dilution of the overnight culture was grown for a further 4-8 hours. The cells were harvested by centrifuging at 4000rpm, washed in sterile water and reharvested. The cells were resuspended in 1ml Li-AcTE and 50μl was added per Eppendorf tube. 1μg DNA (i.e. plasmids prepared by cloning with polymorphic variants of the A2a receptor gene and G- protein) was added to the cells along with 5μg boiled salmon sperm ssDNA. After mixing with 300μl LiAc/PEG/TE, they were incubated at 30°C for 10mins. The mixtures were heat shocked at 42^°C for 20 minutes and 50μl of each were plated on WAUL agar plates and incubated at 30°C for 48 hours (Brown A.J. et al., (2000), Yeast. 16(1), 11-22).

Western Blotting

Yeast sample preparation: Three transformants of each strain of yeast were grown overnight in selective media. The following morning, they were diluted down to OD 0.25 and 50mls were grown for a further 4 hours. Glass beads (425-600 microns) and 10ml Tris-HCI pH7.4 with inhibitors (complete proteinase inhibitor mini tablet, Boehringer Mannheim) were cooled on ice. 5 x 10⁸ cells were harvested and 0.25ml of the cold Tris + inhibitors and glass beads were added. The yeast were lysed on a Vibrax (Scotlab) for 10minutes and 250μl 2x SDS-sample buffer (4% SDS, 20mM DTT, 120mM Tris-HCI pH 7.4, 20% glycerol, water) was added to each and heated at 70°C for 10 minutes. Samples were microfuged and 200μl of the supernatant was added to 20μl bromophenol blue.

CHO sample preparation: 15μl membrane (10μg) was boiled for 5 minutes with 15μl sample buffer (50mM Tris-HCI, 2%SDS, 0.1% bromophenol blue, 10%v/v glycerol, 5% v/v mercaptoethanol)

20μl of each sample were run on a 4-20% gradient gel for 90 minutes. The protein bands were transferred to nitrocellulose using a 5L Anachem tank at 1Amp for 1 hour. The blot was then immersed in Ponceau S (0.2% Ponceau S in 3%TCA) and. washed with distilled water several times. Using 20% Marvel, the blot was washed for δminutes on a rotating platform and washed twice in wash buffer (5% Marvel with 0.1% Tween, made up in PBS). 5μl of IgG A2a antibody was added to blot in 10mls of wash buffer and incubated overnight at 4°C. After reaching room temperature, the blot was washed 4 times over 30 minutes on a rotating platform. 10μl of the secondary antibody (anti-rabbit horseradish peroxidase) was added in 10ml wash buffer and incubated for 2 hours whilst rotating. The blot was washed and developed using electrochemiluminescence (ECL). Site-Directed Mutagenesis (SDM)

Two complementary oligonucleotide primers of 30 base pairs long were designed with the desired mutation:

CCATGAGCTCAAGGGAGTGTGCCCAGAGC (sense); and

GCTCTGGGCACACTCC CTTGAGCTCAT (antisense).

Reaction mixtures incorporating the 392R variant plasmid p416-TEF-A2a or pCIN3-A2a (prepared by cloning the polymorph encoding 392R into each plasmid) were subjected to the polymerase chain reaction (PCR). 50μl reactions were used (10X reaction buffer, 4ng plasmid, 125ng of each primer, 1μl dNTPs at 2.5mM, 1μl Pfu polymerase and water). An initial denaturation period (95^° C for 30 seconds) was ' followed by 16 cycles of denaturation (95^' C for 30 seconds) annealing (50°C for 1 minute) and extension (68^°C for 18 minutes). Following 16 cycles, there was a final extension period (68°C for 30 minutes) before cooling to 4°C. Dpn1 was added and incubated at 37°C for 1 hour and the reaction products transformed into DH5α.

E. coli Transformations

100μl of competent DH5α cells and 2μl DNA were mixed and left on ice for 30 minutes. They were placed in a water bath for 90 seconds at 42C and then on ice for 90 seconds. After the addition of 800μl L broth, they were incubated at 37C for 90 minutes, microfuged and plated onto L-Amp agar plates, then incubated at 37 C overnight.

Subcloning into A2a yeast and CHQ vectors

The A2a gene was excised from the product of the SDM using EcoR1 and Sail restriction enzymes and subcloned into yeast vectors: Funk p416-TEF and p416-GPD and into the CHO vector pCIN 3. This ensured that no mutation could have been introduced into the vector. The A2a gene was excised with EcoR1 and Sail for the yeast vectors and Bam H1 for the CHO vector (20 units of each). The A2a plasmid and the two vectors were digested in separate 30μl reactions using 1X BSA, EcoR1 buffer or Buffer B, EcoR1 , Sail or Bam H1 , and water. Calf intestine alkaline phosphatase (10U) was added to the vector digestions and incubated for 30 minutes at 37^°C. Reaction mixtures were run through a 1% agarose gel with ethidium bromide and examined under UV light. The A2a gene and vectors were identified, cut out and the appropriate combinations were ligated. Following transformation into E- coli and miniprepping (Qiagen kit), the plasmids were re-digested and run on an agar gel to ensure ligations were successful. Successful plasmids were maxiprepped (Qiagen kit) ready for transformation.

CHO transfections

. For transfection, cells were 50% confluent. Following 1 wash in serum-free medium, the volume was reduced to 1 ml. A solution of 300μl DOTAP and 950μl HEPES buffered saline was mixed. 800ng linearised DNA (Ssp1 digest) was added to 42μl of the HEPES/DOTAP mix and left at room temperature for 15 minutes. 50μl was added to the cells and left for 4 hours. 3ml of media was added. Next morning, 1ml EDTA was added for 5 minutes and the cells agitated with a pipette to mix in with the medium. The cells (1 ml) were transferred into 50ml media (DMEM/F12 (1 :1) (Gibco-BRL stock powder, 15.6g/lifre NaHCO3 1.125g/litre), Glutamine (300mg/litre) G418 1g/litre, Hygromycin 500mg/l, 100ml foetal calf serum (FCS), Adenosine Deaminase (ADA)1 U/ml) and transferred into a 175cm² flask, then incubated at 37C. β-qalactosidase Assay

Overnight cultures of yeast were grown in 5ml media at 30C to saturation. Compounds were diluted across 96 well plates to a final well volume of 30μl. 90μl of yeast (OD 0.08) plus FDG (20uM final well concentration) diluted in buffer was added to each well. Final highest DMSO concentration was 0.1%. Plates were incubated for 18 hours at 30^°C and read on a Victor Wallac Plate reader (emission 485nm excitation 535nm). cAMP Response-Element Secreted Placental Alkaline Phosphatase (CRE-SPAP) Hygromycin Reporter Gene Assay (CHO cells)

The CRE-SPAP reporter gene assay uses CHO (Chinese hamster ovary) cells which have been transfected with pCIN3-hA2a constructs containing genes for antibiotic resistance (G418 and hygromycin) and six tandem cyclic AMP response elements which promote transcription of the SPAP reporter gene. By ligand activation of the receptor, the levels of cAMP increase inside the cells. This increase promotes SPAP production and on the addition of a substrate, the amount of coloured product can be quantified.

Two days before the assay, cells were washed with PBS and given quiescence medium (DMEM/F12 (1 :1) (Gibco-BRL stock powder, 15.6g/litre) NaHCO₃ (1.125g/litre), glutamine (300mg/litre) BSA (1mg/ml) made up to 1 litre with water plus ADA (1 U/m!)). Assay plates were pre-warmed and confluent cells removed from the flasks with Versene. Cells were spun down for 5 minutes at 250g and resuspended in 35ml assay medium (DMEM/F12 (1 :1) (Gibco-BRL stock powder, 15.6g/litre) NaHCO₃ (1.125g/litre) Glutamine (300mg/!itre) made up to 1 litre with water plus ADA (1 U/ml) and Indomethacin (3x10-6M)). 60μl cell suspension was aliquotted into each well of the 96-well plate (NUNC) and left for one hour at 37C. 10μl drug was added to each well and incubated for 5 hours. 100μl 1 M diethanolamine buffer with PNPP substrate ((p- Nitrophenyl phosphate, disodium, hexahydrate): 1 M diethanolamine [105.4g/l], 0.28M NaCI [16.36g/l], 0.5mM MgCI₂ [0.102g/l]; pH to 9.5 with 6.5M HCI) was added to each well and left for 5 minutes. 50μl of 4M sodium hydroxide was added to each well to stop the reaction. The absorbance at 405nm was measured on a Victor Wallac plate reader. A2a CHO Membrane Preparation

Two triple flasks of each cell line (i.e. cells transformed with either plasmids containing the genes encoding either 392R or 392G polymorphs) were grown until confluent (1 week) in growth media (1 litre DMEM/F12, glutamine (665mg) hygromycin 10ml, G418 1g, foetal calf serum 100ml and ADA (1 U/ml)). Cells were harvested with Versene and each cell line diluted into 1 litre of growth media. 100mls was put into each small roller bottle (1750cm) and incubated at 37 C for 3 days at 0.2 rpm. Cells were harvested with Versene (50mls per bottle) and collected. Cells were spun at 500g for 10 minutes in 50ml Falcon tubes (20 of each) and the supernatant discarded. 100mls 50mM HEPES buffer pH 7.4 (50mM HEPES + 10mM MgCI₂) plus 2 protease inhibitor tablets was made up and 5mls added to each tube. Using the Ultra-turrax (lKA~labortechnik), cells were homogenised and collected into one tube. Following a repeat centrifugation (20minutes) to remove the cell debris, the supernatant was spun at 20,000g for 30 minutes and the resulting pellets re- suspended in 10mls of RPM6. Membranes were stored frozen at -70C.

Competition Binding on CHO Membranes

A 1 :5 concentration response curve was constructed in 96- well plates. NECA was added at 1e-4M to define non-specific binding (NSB). Drugs, radioligand ([³H]- ZM241385) and membranes were diluted in RPM6. 50μl drug, 50μl ligand and 100μl membranes were added to the wells and incubated at room temperature for 1 hour. The membrane suspension was filtered and counted on a Packard Microbeta scintillation counter. Adenosine agonists NECA, IB-MECA were obtained from Research Biochemicals International and the antagonist ZM241385 (both cold ligand and radioligand) were obtained from Tocris. Other compounds were synthesised according to known techniques and procedures.

Example 1 : Expression studies of the A2a variants

(a) Yeast Studies

Yeast offers a simple and rapid readout for A2a receptors, which can be coupled to the yeast mating pathway via a chimeric G-protein and can produce a robust functional assay system for compound screening. The A2a receptor couples via the endogenous yeast Gα, Gpa Agonist stimulation of the pheromone response pathway induces the FUS1-H1S1 reporter gene in hisl far 1 cells via a MAP kinase cascade and enables agonist-dependent cell growth in histidine-free medium. By the deletion of the STE2 gene (which encodes for the alpha-mating pheromone receptor) and deletion of SST2 (which has a negative feedback effect on cell growth) the assay sensitivity was increased. Agonist-dependent induction of FUS1-lacZ (which encodes for the enzyme beta-galactosidase) via the same pathway enabled the cleavage of ^• the substrate fluorescein di-β-D-galactopyranoside (FDG, Molecular Probes) to fluorescein. The number of fluorescent counts detected is therefore indicative of agonist activation of the receptor. The G-proteins and receptor were introduced via plasmids from DH5α hosts. The receptor plasmid was also included a gene for the production of uracil and the G-protein plasmid a gene for tryptophan. The Saccharomyces cerevisiae used (MMY 11) had deleted uracil and tryptophan genes. This enabled the selection of transformants incorporating the appropriate plasmids. For both variants of the adenosine A2a receptor (392R and 392G), two expression constructs were created. One included a promoter of moderate strength (P416-TEF) and one of a high strength (p416-GPD) (Mumberg et al., (1995) Gene. 156(1), 119-22). These were transformed into MMY11 yeast with Gpa1. The pharmacology of the sequence variants was first characterised using the yeast FDG assay for β-galactosidase activity. A range of adenosine receptor agonists were tested: NECA is non-selective, GR79236 is A1 selective, IB-MECA is A3 selective and Compound X, GR163819 and CGS21680 are A2a selective agonists. In addition, the response to NECA was antagonised by an A2a-selective antagonist, ZM241385, full details of these compounds are described in Table 1. The results for this experiment are shown in Figures 3-6.

The values obtained in this analysis were equated to effective concentration ratios (ECRs) and these are shown in Table 2. It can be observed that the rank order of ECRs for the agonistic adenosine compounds tested was the same for each variant. The A2a selective antagonist ZM241385 was able to right-shift the concentration-response curves of NECA in a concentration-dependent manner. From these data a pK_B value was calculated using the Lew-Angus method of Schild analysis (Lew et al., (1995), Trends in Pharmacological Sciences., 16(10), 328-37). The pK_B for both variants was 9.0.

Variants expressed under the influence of the moderate strength TEF promoter in MMY11 yeast with the Gpa1 G-protein were compared in their responses to NECA. These results are shown in Figure 7, which demonstrate a decrease in constitutive activity in the absence of added agonist with 392G when compared to 392R. In addition, there was a trend towards a decrease in agonist potency and a reduced maximum response. Although this was observed in subsequent experiments (n=14) the trend was not statistically significant (data not shown). The same experiment was carried out comparing 8 transformants of each sequence variant under the influence of the strong GPD promoter and the results may be seen in Figures 8-9.

The values obtained for Figures 8-9 were equated to a total fluorescence 5 value indicating constitutive expression activity for the 8 transformants of each sequence variant and the results are shown in Figure 10. With the GPD promoter, 392G was consistently found to be less constitutively active than 392R. The data were statistically analysed using the Student's unpaired t-test. The mean of the basal levels (constitutive activity) of 392G was highly significantly less than the mean of 1.0 392R (p<0.01).

(b) Western Blotting

The receptor expression level of the two sequence variants was examined using Western blotting with an adenosine A2a receptor antibody and the results of the Western blot are shown in Figure 11. The negative control is yeast expressing the

15 G-protein only. 2 transformants of each variant under the TEF and GPD promoters were examined. The final three columns represent positive controls consisting of 392R with three different promoter strengths. (ADH is weak, TEF is intermediate, GPD very strong).

The A2a receptor expression levels (detected at approximately 45kDa) were 0 found to be greater in 392R than in 392G under the influence of both promoters used in the yeast studies.

(c) Chinese Hamster Ovary (CHO) cell studies

The pharmacological properties of the two receptor variants were assessed in a mammalian cell line using the CRE-SPAP reporter assay. Four adenosine agonists 5 (NECA, Compound X, IB-MECA and GR79236) were tested on each cell line to examine reproducibility and pharmacological characteristics and the results are shown in Figures 12-15. The responses of both cell lines to these agonists was as expected for the A2a receptor with respect to the order of potency of the standards, and proved to be reproducible and consistent. The response using 392G was poor,

30 as the window was consistently smaller with a decrease in minimum absorbance when compared to 392R. As shown in Table 3, the mean pEC50 value for NECA was highly significantly more potent in 392G than 392R. (p≤ 0.01 ; Student's t-test).

In both CHO and yeast functional assays the 392G variant consistently showed a decrease in signal and also produced a decrease in the constitutive activity which proved to be highly significant in yeast. These observations are all indicative of a decrease in receptor expression level for 392G.

Further evidence for this hypothesis comes from Western blotting, where the

392G variant had a lower expression level than 392R in yeast. Although functional and binding data could be obtained for the variants expressed in CHO, the receptor could not be detected with Western blotting. It is likely that the expression level was too low for detection with ECL. A decrease in expression level would directly account for the decreased response in both the functional and binding assays, decreased constitutive activity and the trend towards higher EC50 values observed in both systems. With fewer receptors present in the 392G variant, a higher concentration of drug would be needed to achieve the same response as for 392R.

Why the substitution of arginine for glycine at position 392 should increase receptor expression is presently unknown. However, we can offer the following by way of explanation without being limited by theory. The receptor may fold differently from that with glycine, because of the substantial differences in size and charge of the residue. Such a change may increase the expression level directly or indirectly.

The arginine variant may stabilise the receptor and reduce the receptor turnover rate by decreasing the susceptibility of the receptor to degradation. It may improve the translocation of the receptor to the membrane. Alternatively, the difference could arise at the level of the mRNA rather than the protein. For the adenosine A1 receptor, differences in the mRNA sequences can affect the stability of the mRNA and hence the level of expression for the receptor.

Example 2: Competition Binding Using [³H]-ZM241385 on CHO membranes

Competition binding was measured using the agonistic adenosine compounds in competition with [³H]-ZM241385 on CHO membranes and the results are shown in

Figures 16-17. On 392R membranes, binding was detected that could be displaced by all of the ligands tested. With 392G, no significant displaceable binding was observed.

The fact that no such displaceable binding was observed for 392G is further indicative of a decrease in receptor expression level for 392G.

Brief Description of the Drawings

Figure 1 : Amino acid sequence of the 392G polymorph of the A2a receptor

(glycine (underlined) is present as residue 392).

Figure 2: Nucleotide sequence of the A2a receptor gene encoding the 392G polymorph (guanine (underlined) is present as residue 1174). Figures 3-6: Characterisation of variant expression in yeast cells transformed by the moderate strength TEF plasmid in the presence of the agonistic adenosine compounds (Figure 3 (392G) and Figure 4 (392R)) and the A2a antagonist ZM241385 (Figure 5 (392G) and Figure 6 (392R)). Figure 7: Graph demonstrating the concentration response of non- selective adenosine standard NECA on multiple transformants of yeast transformed by the TEF plasmid with the moderate strength promoter containing 392G (fine lines) and 392R (thick lines) variants.

Figures 8 and 9: Graph demonstrating the concentration response of non-selective adenosine standard NECA on multiple transformants of yeast transformed by the GPD plasmid with the strong promoter containing 392G (Figure 8) and 392R (Figure 9) variants.

Figure 10: A bar chart showing the constitutive activities (in absence of agonist) for the 8 transformants of each variant tested in Figures 10 and 11. Figure 11: A Western blot demonstrating the expression levels of the sequence variants of the A2a receptor.

Figures 12-15: Graphs demonstrating the effect of the selective adenosine agonists on Chinese Hamster Ovary (CHO) cell line expression for 392R (Figure 12) and 392G (Figure 13) and the effect of the non-selective agonist NECA on Chinese Hamster Ovary (CHO) cell line expression for 392R (Figure 14) and 392G (Figure

15).

Figures 16-17: Graph demonstrating the competition binding results for radiolabelled [³H]-ZM241385 on 392R (Figure 16) and 392G (Figure 17). Description of the Sequences in the Sequence Listing: SEQ ID No 1 : Nucleotide sequence of the amino acid sequence shown in SEQ ID

No. 3. SEQ ID No 2: Nucleotide sequence of the amino acid sequence shown in SEQ

ID No. 4 SEQ ID No 3: Amino acid sequence of the 392G polmorph of the human A2a receptor (longer sequence)

SEQ ID No 4: Amino acid sequence of the 392R polmorph of the human A2a receptor (longer sequence) SEQ ID No 5: Nucleotide sequence of the amino acid sequence shown in SEQ ID No. 7. SEQ ID No 6: Nucleotide sequence of the amino acid sequence shown in SEQ

ID No. 8.

SEQ ID No 7: Amino acid sequence of the 389G polmorph of the human A2a receptor (shorter sequence)

SEQ ID No 8: Amino acid sequence of the 389R polmorph of the human A2a receptor (shorter sequence) Throughout the specification and the claims which follow, unless the context requires otherwise, the word 'comprise', and variations such as 'comprises' and 'comprising', will be understood to imply the inclusion of a stated integer or step or group of integers but not to the exclusion of any other integer or step or group of integers or steps.

The patent applications described in this application are herein incorporated by reference. Table 1

Details of the adenosine agonist and antagonist compounds used in the Examples in addition to the selectivity and activity of such compounds.

Table 2

Comparison of effective concentration ratios (ECR) (relative to NECA) for adenosine agonists on 392R and 392G with 95% confidence intervals (Cl) (n=3) based on analysis of the results in Figure 3A.

Table 3

Mean pEC50 values with 95% confidence limits for NECA on CHO cell lines (n=12) obained from the experiments of Figure 8B.

SEQUENCE LISTING

<110> Glaxo Group Limited

<120> Method of determining susceptibility to diseases

<130> PG4295

<160> 8

<170> FastSEQ for Windows Version 4.0

<210> 1 <211> 1239 <212> DNA <213> human

<400> 1 atgcccatca tgggctcctc ggtgtacatc acggtggagc tggccattgc tgtgctggcc 60 atcctgggca atgtgctggt gtgctgggcc gtgtggctca acagcaacct gcagaacgtc 120 accaactact ttgtggtgtc actggcggcg gccgacatcg cagtgggtgt gctcgccatc 180 ccctttgcca tcaccatcag caccgggttc tgcgctgcct gccacggctg cctcttcatt 240 gcctgcttcg tcctggtcct cacgcagagc tccatcttca gtctcctggc catcgccatt 300 gaccgctaca ttgccatccg catcccgctc cggtacaatg gcttggtgac cggcacgagg 360 gctaagggca tcattgccat ctgctgggtg ctgtcgtttg ccatcggcct gactcccatg 420 ctaggttgga acaactgcgg tcagccaaag gagggcaaga accactccca gggctgcggg 480 gagggccaag tggcctgtct ctttgaggat gtggtcccca tgaactacat ggtgtacttc 540 aacttctt.tg cctgtgtgct ggtgcccctg ctgctcatgc tgggtgtcta tttgcggatc 600 ttcctggcgg cgcgacgaca gctgaagcag atggagagcc agcctctgcc gggggagcgg 660 gcacggtcca cactgcagaa ggaggtccat gctgccaagt cactggccat cattgtgggg 720 ctctttgccc tctgctggct gcccctacac atcatcaact gcttcacttt cttctgcccc 780 gactgcagcc acgcccctct ctggctcatg tacctggcca tcgtcctctc ccacaccaat 840 tcggttgtga atcccttcat ctacgcctac cgtatccgcg agttccgcca gaccttccgc 900 aagatcattc gcagccacgt cctgaggcag caagaacctt tcaaggcagc tggcaccagt 960 gcccgggtct tggcagctca tggcagtgac ggagagcagg tcagcctccg tctcaacggc 1020 cacccgccag gagtgtgggc caacggcagt gctccccacc ctgagcggag gcccaatggc 1080 tatgccctgg ggctggtgag tggagggagt gcccaagagt cccaggggaa cacgggcctc 1140 ccagacgtgg agctccttag ccatgagctc aagggagtgt gcccagagcc ccctggccta 1200 gatgaccccc tggcccagga tggagcagga gtgtcctga 1239

<210> 2 <211> 1239 <212> DNA <213> human

<400> 2 atgcccatca tgggctcctc ggtgtacatc acggtggagc tggccattgc tgtgctggcc 60 atcctgggca atgtgctggt gtgctgggcc gtgtggctca acagcaacct gcagaacgtc 120 accaactact ttgtggtgtc actggcggcg gccgacatcg cagtgggtgt gctcgccatc 180 ccctttgcca tcaccatcag caccgggttc tgcgctgcct gccacggctg cctcttcatt 240 gcctgcttcg tcctggtcct cacgcagagc tccatcttca gtctcctggc catcgccatt 300 gaccgctaca ttgccatccg catcccgctc cggtacaatg gcttggtgac cggcacgagg 360 gctaagggca tcattgccat ctgctgggtg ctgtcgtttg ccatcggcct gactcccatg 420 ctaggttgga acaactgcgg tcagccaaag gagggcaaga accactccca gggctgcggg 480 gagggccaag tggcctgtct ctttgaggat gtggtcccca tgaactacat ggtgtacttc 540 aacttctttg cctgtgtgct ggtgcccctg ctgctcatgc tgggtgtcta tttgcggatc 600 ttcctggcgg cgcgacgaca gctgaagcag atggagagcc agcctctgcc ggggagcgg 660 gcacggtcca cactgcagaa ggaggtccat gctgccaagt cactggccat cattgtgggg 720 ctctttgccc tctgctggct gcccctacac atcatcaact gcttcacttt cttctgcccc 780 gactgcagcc acgcccctct ctggctcatg tacctggcca tcgtcctctc ccacaccaat 840 tcggttgtga atcccttcat ctacgcctac cgtatccgcg agttccgcca gaccttccgc 900 aagatcattc gcagccacgt cctgaggcag caagaacctt tcaaggcagc tggcaccagt 960 gcccgggtct tggcagctca tggcagtgac ggagagcagg tcagcctccg tctcaacggc 1020 cacccgccag gagtgtgggc caacggcagt gctccccacc ctgagcggag gcccaatggc 1080 tatgccctgg ggctggtgag tggagggag gcccaagagt cccaggggaa cacgggcctc 1140 ccagacgtgg agctccttag ccatgagctc aagagagtgt gcccagagcc ccctggccta 1200 gatgaccccc tggcccagga tggagcagga gtgtcctga 1239

<210> 3 <211> 412 <212> PRT <213> human

<400> 3

Met Pro lie Met Gly Ser Ser Val Tyr lie Thr Val Glu Leu Ala lie

1 5 10 15

Ala Val Leu Ala He Leu Gly Asn Val Leu Val Cys Trp Ala Val Trp

20 25 30

Leu Asn Ser Asn Leu Gin Asn Val Thr Asn Tyr Phe Val Val Ser Leu

35 40 45

Ala Ala Ala Asp He Ala Val Gly Val Leu Ala He Pro Phe Ala He

50 55 60

Thr He Ser Thr Gly Phe Cys Ala Ala Cys His Gly Cys Leu Phe He 65 70 75 80

Ala Cys Phe Val Leu Val Leu Thr Gin Ser Ser He Phe Ser Leu Leu

85 90 95

Ala He Ala He Asp Arg Tyr He Ala He Arg He Pro Leu Arg Tyr

100 105 110

Asn Gly Leu Val Thr Gly Thr Arg Ala Lys Gly He He Ala He Cys

115 120 125

Trp Val Leu Ser Phe Ala He Gly Leu Thr Pro Met Leu Gly Trp Asn

130 135 140

Asn Cys Gly Gin Pro Lys Glu Gly Lys Asn His Ser Gin Gly Cys Gly 145 150 155 160

Glu Gly Gin Val Ala Cys Leu Phe Glu Asp Val Val Pro Met Asn Tyr

165 170 175

Met Val Tyr Phe Asn Phe Phe Ala Cys Val Leu Val Pro Leu Leu Leu

180 185 190

Met Leu Gly Val Tyr Leu Arg He Phe Leu Ala Ala Arg Arg Gin Leu

195 200 205

Lys Gin Met Glu Ser Gin Pro Leu Pro Gly Glu Arg Ala Arg Ser Thr

210 215 220

Leu Gin Lys Glu Val His Ala Ala Lys Ser Leu Ala He He Val Gly 225 230 235 240

Leu Phe Ala Leu Cys Trp Leu Pro Leu His He He Asn Cys Phe Thr

245 250 255

Phe Phe Cys Pro Asp Cys Ser His Ala Pro Leu Trp Leu Met Tyr Leu

260 265 270

Ala He Val Leu Ser His Thr Asn Ser Val Val Asn Pro Phe He Tyr

275 280 285

Ala Tyr Arg He Arg Glu Phe Arg Gin Thr Phe Arg Lys He He Arg

290 295 300

Ser His Val Leu Arg Gin Gin Glu Pro Phe Lys Ala Ala Gly Thr Ser 305 310 315 320

Ala Arg Val Leu Ala Ala His Gly Ser Asp Gly Glu Gin Val Ser Leu

325 330 335

Arg Leu Asn Gly His Pro Pro Gly Val Trp Ala Asn Gly Ser Ala Pro

340 345 350

His Pro Glu Arg Arg Pro Asn Gly Tyr Ala Leu Gly Leu Val Ser Gly

355 360 365

Gly Ser Ala Gin Glu Ser Gin Gly Asn Thr Gly Leu Pro Asp Val Glu

370 375 380

Leu Leu Ser His Glu Leu Lys Gly Val Cys Pro Glu Pro Pro Gly Leu 385 390 395 400

Asp Asp Pro Leu Ala Gin Asp Gly Ala Gly Val Ser 405 410 <210> 4 <211> 412 <212> PRT <213> human

<400> 4

Met Pro He Met Gly Ser Ser Val Tyr He Thr Val Glu^' Leu Ala He

1 5 10 15

Ala Val Leu Ala He Leu Gly Asn Val Leu Val Cys Trp Ala Val Trp

20 25 30

Leu Asn Ser Asn Leu Gin Asn Val Thr Asn Tyr Phe Val Val Ser Leu

35 40 45

Ala Ala Ala Asp He Ala Val Gly Val Leu Ala He Pro Phe Ala He

50 55 60

Thr He Ser Thr Gly Phe Cys Ala Ala Cys His Gly Cys Leu Phe He 65 70 75 80

Ala Cys Phe Val Leu Val Leu Thr Gin Ser Ser He Phe Ser Leu Leu

85 90 95

Ala He Ala He Asp Arg Tyr He Ala He Arg He Pro Leu Arg Tyr

100 105 110

Asn Gly Leu Val Thr Gly Thr Arg Ala Lys Gly He He Ala He Cys

115 120 125

Trp Val Leu Ser Phe Ala He Gly Leu Thr Pro Met Leu Gly Trp Asn

130 135 140

Asn Cys Gly Gin Pro Lys Glu Gly Lys Asn His Ser Gin Gly Cys Gly 145 150 155 160

Glu Gly Gin Val Ala Cys Leu Phe Glu Asp Val Val Pro Met Asn Tyr

165 170 175

Met Val Tyr Phe Asn Phe Phe Ala Cys Val Leu Val Pro Leu Leu Leu

180 185 190

Met Leu Gly Val Tyr Leu Arg He Phe Leu Ala Ala Arg Arg Gin Leu

195 200 205

Lys Gin Met Glu Ser Gin Pro Leu Pro Gly Glu Arg Ala Arg Ser Thr

210 215 220

Leu Gin Lys Glu Val His Ala Ala Lys Ser Leu Ala He He Val Gly 225 230 235 240

Leu Phe Ala Leu Cys Trp Leu Pro Leu His He He Asn Cys Phe Thr

245 250 255

Phe Phe Cys Pro Asp Cys Ser His Ala Pro Leu Trp Leu Met Tyr Leu

260 265 270

Ala He Val Leu Ser His Thr Asn Ser Val Val Asn Pro Phe He Tyr

275 280 285

Ala Tyr Arg He Arg Glu Phe Arg Gin Thr Phe Arg Lys He He Arg

290 295 300

Ser His Val Leu Arg Gin Gin Glu Pro Phe Lys Ala Ala Gly Thr Ser 305 310 315 320

Ala Arg Val Leu Ala Ala His Gly Ser Asp Gly Glu Gin Val Ser Leu

325 330 335

Arg Leu Asn Gly His Pro Pro Gly Val Trp Ala Asn Gly Ser Ala Pro

340 345 350

His Pro Glu Arg Arg Pro Asn Gly Tyr Ala Leu Gly Leu Val Ser Gly

355 360 365

Gly Ser Ala Gin Glu Ser Gin Gly Asn Thr Gly Leu Pro Asp Val Glu

370 375 380

Leu Leu Ser His Glu Leu Lys Arg Val Cys Pro Glu Pro Pro Gly Leu 385 390 395 400

Asp Asp Pro Leu Ala Gin Asp Gly Ala Gly Val Ser 405 410

<210> 5 <211> 1230 <2Ϊ2 > DNA <213 > human

<400> 5 atgggctcct cggtgtacat cacggtggag ctggccattg ctgtgctggc catcctgggc 60 aatgtgctgg tgtgctgggc cgtgtggctc aacagcaacc tgcagaacgt caccaactac 120 tttgtggtgt cactggcggc ggccgacatc gcagtgggtg tgctcgccat cccctttgcc 180 atcaccatca gcaccgggtt ctgcgctgcc tgccacggct gcctcttcat tgcctgcttc 240 gtcctggtcc tcacgcagag ctccatcttc agtctcctgg ccatcgccat tgaccgctac 300 attgccatcc gcatcccgct ccggtacaat ggcttggtga ccggcacgag ggctaagggc 360 atcattgcca tctgctgggt gctgtcgttt gccatcggcc tgactcccat gctaggttgg 420 aacaactgcg gtcagccaaa ggagggcaag aaccactccc agggctgcgg ggagggccaa 480 gtggcctgtc tctttgagga tgtggtcccc atgaactaca tggtgtactt caacttcttt 540 gcctgtgtgc tggtgcccct gctgctcatg ctgggtgtct atttgcggat cttcctggcg 600 gcgcgacgac agctgaagca gatggagagc cagcctctgc cgggggagcg ggcacggtcc 660 acactgcaga aggaggtcca tgctgccaag tcactggcca tcattgtggg gctctttgcc 720 ctctgctggc tgcccctaca catcatcaac tgcttcactt tcttctgccc cgactgcagc 780 cacgcccctc tctggctcat gtacctggcc atcgtcctct cccacaccaa ttcggttgtg 840 aatcccttca tctacgccta ccgtatccgc gagttccgcc agaccttccg caagatcatt 900 cgcagccacg tcctgaggca gcaagaacct ttcaaggcag ctggcaccag tgcccgggtc 960 ttggcagctc atggcagtga cggagagcag gtcagcctcc gtctcaacgg ccacccgcca 1020 ggagtgtggg ccaacggcag tgctccccac cctgagcgga ggcccaatgg ctatgccctg 1080 gggctggtga gtggagggag tgcccaagag tcccagggga acacgggcct cccagacgtg 1140 gagctcctta gccatgagct caagggagtg tgcccagagc cccctggcct agatgacccc 1200 ctggcccagg atggagcagg agtgtcctga 1230

<210> 6 <211> 1230 <212> DNA <213> human

<400> 6 atgggctcct cggtgtacat cacggtggag ctggccattg ctgtgctggc catcctgggc 60 aatgtgctgg tgtgctgggc cgtgtggctc aacagcaacc tgcagaacgt caccaactac 120

.tttgtggtgt cactggcggc ggccgacatc gcagtgggtg tgctcgccat cccctttgcc 180 atcaccatca gcaccgggtt ctgcgctgcc tgccacggct gcctcttcat tgcctgcttc 240 gtcctggtcc tcacgcagag ctccatcttc agtctcctgg ccatcgccat tgaccgctac 300 attgccatcc gcatcccgct ccggtacaat ggcttggtga ccggcacgag ggctaagggc 360 atcattgcca tctgctgggt gctgtcgttt gccatcggcc tgactcccat gctaggttgg 420 aacaactgcg gtcagccaaa ggagggcaag aaccactccc agggctgcgg ggagggccaa 480 gtggcctgtc tctttgagga tgtggtcccc atgaactaca tggtgtactt caacttcttt 540 gcctgtgtgc tggtgcccct gctgctcatg ctgggtgtct atttgcggat cttcctggcg 600 gcgcgacgac agctgaagca gatggagagc cagcctctgc cgggggagcg ggcacggtcc 660 acactgcaga aggaggtcca tgctgccaag tcactggcca tcattgtggg gctctttgcc 720 ctctgctggc tgcccctaca catcatcaac tgcttcactt tcttctgccc cgactgcagc 780 cacgcccctc tctggctcat gtacctggcc atcgtcctct cccacaccaa ttcggttgtg 840 aatcccttca tctacgccta ccgtatccgc gagttccgcc agaccttccg caagatcatt 900 cgcagccacg tcctgaggca gcaagaacct ttcaaggcag ctggcaccag tgcccgggtc 960 ttggcagctc atggcagtga cggagagcag gtcagcctcc gtctcaacgg ccacccgcca 1020 ggagtgtggg ccaacggcag tgctccccac cctgagcgga ggcccaatgg ctatgccctg 1080 gggctggtga gtggagggag tgcccaagag tcccagggga acacgggcct cccagacgtg 1140 gagctcctta gccatgagct caagagagtg tgcccagagc cccctggcct agatgacccc 1200 ctggcccagg atggagcagg agtgtcctga 1230

<210> 7 <211> 409 <212> PRT <213> human

<400> 7

Met Gly Ser Ser Val Tyr He Thr Val Glu Leu Ala He Ala Val Leu

1 5 10 15

Ala He Leu Gly Asn Val Leu Val Cys Trp Ala Val Trp Leu Asn Ser As-n Leu Gin Asn Val Thr Asn Tyr Phe Val Val Ser Leu Ala Ala Ala

35 40 45

Asp He Ala Val Gly Val Leu Ala lie Pro Phe Ala He Thr He Ser

50 55 60

Thr Gly Phe Cys Ala Ala Cys His Gly Cys Leu Phe He Ala Cys Phe 65 70 75 80

Val Leu Val Leu Thr Gin Ser Ser He Phe Ser Leu Leu Ala He Ala

85 90 95

He Asp Arg Tyr He Ala He Arg He Pro Leu Arg Tyr Asn Gly Leu

100 105 110

Val Thr Gly Thr Arg Ala Lys Gly He He Ala He Cys Trp Val Leu

115 120 125

Ser Phe Ala He Gly Leu Thr Pro Met Leu Gly Trp Asn Asn Cys Gly

130 135 140

Gin Pro Lys Glu Gly Lys Asn His Ser Gin Gly Cys Gly Glu Gly Gin 145 150 155 160

Val Ala Cys Leu Phe Glu Asp Val Val Pro Met Asn Tyr Met Val Tyr

165 170 175

Phe Asn Phe Phe Ala Cys Val Leu Val Pro Leu Leu Leu Met Leu Gly

180 185 190

Val Tyr Leu Arg He Phe Leu Ala Ala Arg Arg Gin Leu Lys Gin Met

195 200 205

Glu Ser Gin Pro Leu Pro Gly Glu Arg Ala Arg Ser Thr Leu Gin Lys

210 215 220

Glu Val His Ala Ala Lys Ser Leu Ala He He Val Gly Leu Phe Ala 225 230 235 240

Leu Cys Trp Leu Pro Leu His He He Asn Cys Phe Thr Phe Phe Cys

245 250 255

Pro Asp Cys Ser His Ala Pro Leu Trp Leu Met Tyr Leu Ala He Val

260 265 270

Leu Ser His Thr Asn Ser Val Val Asn Pro Phe He Tyr Ala Tyr Arg

275 280 285

He Arg Glu Phe Arg Gin Thr Phe Arg Lys He He Arg Ser His Val

290 . 295 300

Leu Arg Gin Gin Glu Pro Phe Lys Ala Ala Gly Thr Ser Ala Arg Val 305 310 315 320

Leu Ala Ala His Gly Ser Asp Gly Glu Gin Val Ser Leu Arg Leu Asn

325 330 335

Gly His Pro Pro Gly Val Trp Ala Asn Gly Ser Ala Pro His Pro Glu

340 345 350

Arg Arg Pro Asn Gly Tyr Ala Leu Gly Leu Val Ser Gly Gly Ser Ala

355 360 365

Gin Glu Ser Gin Gly Asn Thr Gly Leu Pro Asp Val Glu Leu Leu Ser

370 375 380

His Glu Leu Lys Gly Val Cys Pro Glu Pro Pro Gly Leu Asp Asp Pro 385 390 395 400

Leu Ala Gin Asp Gly Ala Gly Val Ser 405

<210> 8 <211> 409 <212> PRT <213> human

<400> 8

Met Gly Ser Ser Val Tyr He Thr Val Glu Leu Ala He Ala Val Leu

1 5 10 15

Ala He Leu Gly Asn Val Leu Val Cys Trp Ala Val Trp Leu Asn Ser

.20 25 30

Asn Leu Gin Asn Val Thr Asn Tyr Phe Val Val Ser Leu Ala Ala Ala

35 40 45

Asp He Ala Val Gly Val Leu Ala He Pro Phe Ala He Thr He Ser 50 55 60 Thr Gly Phe Cys Ala Ala Cys His Gly Cys Leu Phe He Ala Cys Phe 65 70 75 80

Val Leu Val Leu Thr Gin Ser Ser lie Phe Ser Leu Leu Ala He Ala

85 90 95

He Asp Arg Tyr He Ala He Arg He Pro Leu Arg Tyr Asn Gly Leu

100 105 110

Val Thr Gly Thr Arg Ala Lys Gly He He Ala He Cys Trp Val Leu

115 120 125

Ser Phe Ala He Gly Leu Thr Pro Met Leu Gly Trp Asn Asn Cys Gly

130 135 140

Gin Pro Lys Glu Gly Lys Asn His Ser Gin Gly Cys Gly Glu Gly Gin 145 150 155 160

Val Ala Cys Leu Phe Glu Asp Val Val Pro Met Asn Tyr Met Val Tyr

165 170 175

Phe Asn Phe Phe Ala Cys Val Leu Val Pro Leu Leu Leu Met Leu Gly

180 185 190

Val Tyr Leu Arg He Phe Leu Ala Ala Arg Arg Gin Leu Lys Gin Met

195 200 205

Glu Ser Gin Pro Leu Pro Gly Glu Arg Ala Arg Ser Thr Leu Gin Lys

210 215 220

Glu Val His Ala Ala Lys Ser Leu Ala He He Val Gly Leu Phe Ala 225 230 235 240

Leu Cys Trp Leu Pro Leu His He He Asn Cys Phe Thr Phe Phe Cys

245 250 255

Pro Asp Cys Ser His Ala Pro Leu Trp Leu Met Tyr Leu Ala He Val

260 265 270

Leu Ser His Thr Asn Ser Val Val Asn Pro Phe He Tyr Ala Tyr Arg

275 280 285

He Arg Glu Phe Arg Gin Thr Phe Arg Lys He He Arg Ser His Val

290 295 300

Leu Arg Gin Gin Glu Pro Phe Lys Ala Ala Gly Thr Ser Ala Arg Val 305 310 315 320

Leu Ala Ala His Gly Ser Asp Gly Glu Gin Val Ser Leu Arg Leu Asn

325 330 335

Gly His Pro Pro Gly Val Trp Ala Asn Gly Ser Ala Pro His Pro Glu

340 345 350

Arg Arg Pro Asn Gly Tyr Ala Leu Gly Leu Val Ser Gly Gly Ser Ala

355 360 365

Gin Glu Ser Gin Gly Asn Thr Gly Leu Pro Asp Val Glu Leu Leu Ser

370 375 380

His Glu Leu Lys Arg Val Cys Pro Glu Pro Pro Gly Leu Asp Asp Pro 385 390 395 400

Leu Ala Gin Asp Gly Ala Gly Val Ser 405

Claims

1. A method of determining susceptibility of a human subject to a disease associated with A2a receptor functional hyperactivity or reduced A2a receptor activity which comprises: (a) obtaining a nucleic acid sample from a human subject; and

2. A method according to claim 1 wherein the presence of guanine at position

1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) indicates susceptibility to a disease associated with reduced A2a receptor activity.

3. A method according to claim 1 or claim 2 wherein said disease associated with reduced A2a receptor activity is a respiratory disorder such as asthma or COPD.

4. A method according to claim 1 wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) indicates susceptibility to a disease associated with A2a receptor functional hyperactivity.

5. A method according to claim 1 or claim 4 wherein said disease associated with A2a receptor functional hyperactivity is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

6. A method of determining susceptibility of a human subject to a disease associated with A2a receptor functional hyperactivity or reduced A2a receptor activity which comprises:

(a) obtaining a protein sample from a human subject; and

7. A method according to claim 6 wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) indicates susceptibility to a disease associated with reduced A2a receptor activity.

8. ' A method according to claim 6 or claim 7 wherein said disease associated with reduced A2a receptor dctivity is a respiratory disorder such as asthma or COPD.

9. A method according to claim 6 wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) indicates susceptibility to a disease associated with A2a receptor functional hyperactivity.

10. A method according to claim 6 or claim 9 wherein said disease associated with A2a receptor functional hyperactivity is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

11. A method of treating an A2a receptor associated disease in a human subject which comprises: (a) obtaining a nucleic acid sample from a human subject;

(b) detecting whether a polymorphism of the A2a receptor gene exists;

(c) administering an effective amount of an A2a agonist, inverse agonist or antagonist to said subject.

12. A method according to claim 11 wherein the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the

A2a receptor gene (shorter sequence) has been detected in said subject in step (b) and an agonist is administered in step (c).

13. A method according to claim 11 or claim 12 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

14. A method according to claim 11 wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject in step (b) and an antagonist or inverse agonist is administered in step (c).

15. A method according to claim 11 or claim 14 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

16. A method of treating an A2a receptor associated disease in a human subject which comprises:

(a) obtaining a protein sample from a human subject; (b) detecting whether a polymorphism of the A2a receptor exists; (c) administering an effective amount of an A2a agonist, inverse agonist or antagonist to said subject.

17. A method according to claim 16 wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject in step (b) and an agonist is administered in step (c).

18. A method according to claim 16 or claim 17 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

19. A method according to claim 16 wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject in step (b) and an inverse agonist or antagonist is administered in step (c).

20. A method according to claim 16 or claim 19 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

21. Use of an A2a agonist, inverse agonist or antagonist in the preparation of a medicament for treating an A2a receptor associated disease in a human subject wherein the presence of a polymorphism of the A2a receptor gene has been detected in said subject.

22. Use according to claim 21 of an A2a agonist wherein the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position

1165 on the A2a receptor gene (shorter sequence) has been detected in said subject.

23. Use according to claim 21 or claim 22 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

24. Use according to claim 21 of an A2a inverse agonist or antagonist wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject.

25. Use according to claim 21 or claim 24 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

26. Use of an A2a agonist, inverse agonist or antagonist in the preparation of a medicament for treating an A2a receptor associated disease in a human subject wherein the presence of a polymorphism of the A2a receptor has been detected in said subject.

27. Use according to claim 26 of an A2a agonist wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject.

28. Use according to claim 26 or claim 27 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

29. Use according to claim 26 of an A2a inverse agonist or antagonist wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject.

30. Use according to claim 26 or claim 29 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

31. A patient pack comprising an A2a agonist, inverse agonist or antagonist and instructions for administration of said agonist, inverse agonist or antagonist to a human subject detected with a polymorphism of the A2a receptor gene.

32. A patient pack according to claim 31 containing an A2a agonist wherein the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject.

33. A patient pack according to claim 31 containing an A2a inverse agonist or antagonist wherein the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) has been detected in said subject.

34. A patient pack comprising an A2a agonist, inverse agonist or antagonist and instructions for administration of said agonist, inverse agonist or antagonist to a human subject detected with a polymorphism of the A2a receptor.

35. A patient pack according to claim 34 containing an A2a agonist wherein the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject.

36. A patient pack according to claim 34 containing an A2a inverse agonist or antagonist wherein the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) has been detected in said subject.

37. Use of a nucleotide sequence of a human A2a receptor gene polymorphism to identify compounds that affect expression of the human A2a receptor.

38. Use according to claim 37 wherein said polymorphism is characterised by the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence).

39. Use of an amino acid sequence of a human A2a receptor polymorphism to identify compounds that affect expression of the human A2a receptor.

40. Use according to claim 39 wherein said polymorphism is characterised by the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence).

41. A method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) which comprises administering an effective amount of an A2a agonist.

42. A method according to claim 41 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

43. A method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of adenine at position

1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence) which comprises administering an effective amount of an A2a antagonist.

44. A method according to claim 43 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

45. A method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) which comprises administering an effective amount of an A2a agonist.

46. A method according to claim 45 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

47. A method of treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence) which comprises administering an effective amount of an A2a antagonist.

48. A method according to claim 47 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

49. Use of an A2a agonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of guanine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence).

50. Use according to claim 49 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

51. Use of an A2a antagonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of adenine at position 1174 on the A2a receptor gene (longer sequence) or at position 1165 on the A2a receptor gene (shorter sequence).

52. Use according to claim 51 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.

53. Use of an A2a agonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of glycine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence).

54. Use according to claim 53 wherein the A2a receptor associated disease is a respiratory disorder such as asthma or COPD.

55. Use of an A2a antagonist in the manufacture of a medicament for treating an A2a receptor associated disease in a human subject having a polymorphism characterised by the presence of arginine at position 392 on the amino acid sequence of the A2a receptor (longer sequence) or at position 389 on the amino acid sequence of the A2a receptor (shorter sequence).

56. Use according to claim 55 wherein the A2a receptor associated disease is a motor dyskinesia disorder such as Parkinson's disease or a disease associated with dysregulation of the immune system.