CN113151447A - Capture probe and kit for primary atopic disease related gene and application thereof - Google Patents

Capture probe and kit for primary atopic disease related gene and application thereof Download PDF

Info

Publication number
CN113151447A
CN113151447A CN202110504283.3A CN202110504283A CN113151447A CN 113151447 A CN113151447 A CN 113151447A CN 202110504283 A CN202110504283 A CN 202110504283A CN 113151447 A CN113151447 A CN 113151447A
Authority
CN
China
Prior art keywords
artificial sequence
dna
primary
gene
buffer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110504283.3A
Other languages
Chinese (zh)
Inventor
夏宇
朱晓娜
沈杰
杨军
史丽娜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Childrens Hospital
Original Assignee
Shenzhen Childrens Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Childrens Hospital filed Critical Shenzhen Childrens Hospital
Priority to CN202110504283.3A priority Critical patent/CN113151447A/en
Publication of CN113151447A publication Critical patent/CN113151447A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a capture probe and a kit for primary atopic disease related genes and application thereof. The primary atopic disease related gene captured by the capture probe is selected from two or more of FLG, CDSN, DSG1, DSP, SPINK5, PLCG2, ADGRE2, TPSAB1, FOXP3, IL2RA, TGFBR1, TGFBR2, WAS, MALT1, CARD11, WIPF1, ARPC1B, DOCK8, CARMIL2, ERBIN, ZNF341, RAIL, RAG2, DCLRE1C, ADA, IL7RA, CHD7, LIG4, ZAP70, STAT3, STAT1, STAT5B, JAK1, IL4RA, IL6ST, IL6R and PGM 3. The capture probe effectively improves the diagnosis efficiency of the primary atopic disease and can provide a diagnosis basis for treatment. Can accurately and rapidly detect the mutation sites of the primary atopic diseases.

Description

Capture probe and kit for primary atopic disease related gene and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to a capture probe and a kit for primary atopic disease related genes and application thereof.
Background
Primary Atopic Diseases (PADs) are inherited diseases caused by single gene variations. In addition to the defects in the generally recognized immune tolerance mechanisms, defects in genes involved in the regulation of the skin barrier, mast cell function, TCR signaling and cytoskeleton, cytokine signaling pathways, may be manifested as PADs. However, due to the different penetrance of genes, the different clinical phenotypes can appear under the interaction between genes and environment. The 37 PADs related genes mainly include FLG, CDSN, DSG1, DSP, SPINK5, PLCG2, ADGRE2, TPSAB1, FOXP3, IL2RA, TGFBR1, TGFBR2, WAS, MALT1, CARD11, WIPF1, ARPC1B, DOCK8, CARMIL2, ERBIN, ZNF341, RAG1, RAG2, DCLRE1C, ADA, IL7RA, CHD7, LIG4, ZAP70, STAT3, STATl, STAT5B, JAK1, IL4RA, IL6ST, IL6R, PGM 3.
The FLG gene encodes Filaggrin (FLG). FLG protein is synthesized by keratinocytes, can be decomposed to generate a large amount of natural moisturizing factors to participate in skin barriers, and can cause atopic dermatitis, ichthyosis vulgaris and the like due to the reduction of the expression of the FLG protein caused by FLG gene mutation.
The CDSN gene, the DSP gene and the DSG1 gene encode three desmosomal proteins, and the skin resists mechanical stress by desmosomal anchoring composed of desmosomal proteins. These gene mutations can cause severe atopic dermatitis, IgE elevation, and various allergies.
The SPINK5 gene encodes a serine protease inhibitor LEKTl, LEKT1 targeted at kallikrein 5(kallikreins 5, KLK 5). Kallikrein is one of the most important epidermal cell proteases, which, together with their inhibitory molecules, maintain the desquamation process of the epidermis and play an important role in the skin barrier. The homozygous SPINK5 gene mutation causes Nethron syndrome due to the dysregulation of epidermal protease activity, and patients show allergy (severe allergic dermatitis, pollen allergy, food allergy, etc.) accompanied by congenital ichthyosis erythroderma and bamboo joint-like hair.
The PLCG2 gene encodes phospholipase C gamma 2(PLC gamma 2), a signaling molecule expressed in B cells, natural killer cells and mast cells. The PLCG2 gene deletion can cause cold related urticaria by exposing phospholipase C (PLC) phosphorylation sites, and can be accompanied with asthma, allergic rhinitis and other manifestations, mastocytosis and IgE increase.
The ADGRE2 gene encodes adhesion G protein coupling receptor E2 gene, and the missense mutation of the gene is shown in that local erythema and pruritus urticaria are induced by exercise, towel rubbing and the like.
The TPSAB1 gene encodes alpha trypsin, and this increased copy number of the gene causes hereditary hypertryptaemia, manifested by elevated tryptase levels, increased mast cell activity, and urticaria under vibrational stimulation.
The FOXP3 gene encodes the transcription factor FOXP3, and FOXP3 is one of the key transcription factors that control Treg cell development and function. The Treg cell reduction or lack caused by the Foxp3 gene variation causes the X-linked recessive inherited multiple endocrine adenopathy enteropathy with immune disorder syndrome (IPEX). In addition to the manifestations of autoimmune diseases, IPEX is associated with severe atopic dermatitis, hyper IgE and eosinophilia.
The IL2RA gene encodes the alpha chain of IL-2 receptor (IL2RA, CD25), and the binding of CD25 of Treg cells to IL-2 causes IL-2R of effector T cells to lack ligand and to die, so the function deletion mutation of IL2RA gene and STAT5B gene weakens the Treg inhibition effect, and similar to IPEX, the gene shows immune dysregulation and atopic diseases.
The STAT1 gene, STAT3 gene, and STAT5B gene encode members of the signaling and activator of transcription (STAT) protein family, respectively. STAT1GOFTh17 cells are inhibited, causing Chronic Mucocutaneous Candidiasis (CMC), characterized by recurrent or persistent candida infections of the nail, skin, oral and genital mucosa. STAT3 gene mutations are the major cause of autosomal dominant high IgE syndrome (HIES). STAT3 gene deletion mutation causes phosphorylation and transcription inhibition, IL-4 secretion is increased, IgE is greatly secreted, Th17 secretion is reduced, and clinical manifestations are chronic eczematoid dermatitis, recurrent staphylococcus-like skin abscess, recurrent bacterial lung infection, and connective tissue abnormality including head and face deformity, joint overactivity, aneurysm formation, etc. STAT5B mutation causes IL-2 gene transcription to be inhibited, which can cause short stature and serious immune disorder.
The TGFBR1 gene and TGFBR2 gene encode TGF beta receptor, and the gene mutation causes Loeys-Dietz syndrome of autosomal dominant inheritance, which is manifested by aortic aneurysm and systemic arterial tortuosity, overlength, uvula or cleft palate, recurrent respiratory tract infection, eczema and food allergy.
Defects in actin cytoskeleton-related genes (DOCK8, WAS, CARMIL2, WIPF1, ARPC1B) cause obstruction of immune synapse formation and thus inhibit T cell signaling. Mutation of the DOCK8 gene causes autosomal recessive inheritance hyper IgE syndrome (HIES), and clinical manifestations of recurrent infection, allergic diseases, eczema, food allergy and hypereosinophilia. The mutation of the WAS gene causes Wiskott-Aldrich syndrome, the protein coded by the WIPF1 gene is combined with frequently mutated Wiskott-Aldrich syndrome protein regions in the Wiskott-Aldrich syndrome, and the weakening of the interaction between the two proteins can cause the disease and is shown as repeated severe eczema, and the homozygous mutation of the ARPC1B gene causes WAS-similar phenotype. The deficiency of the scaffold protein CARMIL2 is manifested by atopic dermatitis, allergic asthma, food allergy and other phenotypes. In addition to PADs, the above gene defects cause actin synthesis disorders, and a decrease in the differentiation and proliferation ability of T lymphocytes, accompanied by combined immunodeficiency and autoimmunity.
The CARD11 gene encodes the CARD11 protein, and MALT1 encodes MALT1 protein. The CARD11 protein and MALT1 protein are important molecules in a T cell receptor signaling pathway, mutation of the CARD11 gene and MALT1 gene prevents CBM (CARD11-BCL10-MALT1) complex formation, NF-kappa B activation is blocked, and T cell activation is influenced. Children with mutations in the CARD11 gene and the MALT1 gene have severe atopic diseases including allergic rhinitis, food allergy, atopic dermatitis, eosinophilic esophagitis, etc., and patients often incorporate combined immunodeficiency due to impaired T cell function, manifested by recurrent bacterial and candida infections (lung, skin and gastrointestinal tract), periodontal disease (aphtha, cheilitis, gingivitis) and dysplasia.
IL6R gene encodes IL-6R alpha, IL6ST gene encodes transmembrane receptor gp130, gp130 and IL-6R alpha together form IL-6R, and deletion type variation of IL-6R and IL6ST genes enables STAT3 phosphorylation to be blocked to cause HIES, and the HIES is also expressed as repeated bacterial infection, connective tissue abnormality and IgE increase.
The IL4RA gene encodes the receptor of interleukin 4(IL-4), and this gene has acquired functional mutation to differentiate Th2 and produce IgE, which may be manifested as a series of allergic diseases.
The JAK1 gene encodes human tyrosine kinase protein (JAK1), and the gain-of-function variation of JAK1 gene promotes IL-4 activation and IgE increase, and is manifested by obvious eosinophilia, severe atopic dermatitis and growth and development disorder.
The erbbin gene encodes erbb2 interacting protein, a leucine-rich repeat and a member of the PDZ domain (LAP) family, and the encoded protein contains 17 leucine-rich repeats and a PDZ domain. It binds to the non-phosphorylated form of the ERBB2 protein and modulates the function and localization of ERBB 2. It has also been shown to affect the Ras signaling pathway by disrupting the Ras-Raf interaction.
ZNF341 gene is transcription factor in nucleus, activates STAT3 promoter, and mutation of ZNF341 makes STAT3 not normally activated to cause STAT3DNSimilar HIES, marked IgE elevation, recurrent infections and connective tissue abnormalities, but connective tissue abnormalities are less marked than STAT3 variation.
RAG1 and RAG2 are essential for TCR rearrangement, RAG1, RAG2 gene mutations completely or partially lose their encoded recombinase activity, and VDJ rearrangement is unbalanced. The Omenn syndrome of autosomal recessive inheritance caused by RAgl and RAG2 gene mutation is shown as T-B-NK + severe combined immunodeficiency, accompanied with eczema, erythroderma, alopecia, hepatosplenomegaly and other manifestations, and can be seen as eosinophilia and IgE level increase.
Adenosine Deaminase (ADA) deficiency causes the accumulation of deoxyadenosine triphosphate, thereby inhibiting the ribonucleotide reductase essential for DNA synthesis, causing autosomal recessive inherited T-B-NK-severe combined immunodeficiency, which is manifested by recurrent opportunistic infection, candidiasis, lymphoid tissue deficiency or hypoplasia, accompanied by asthma, sinusitis and IgE increase, and part of the disease can have bone abnormality, alveolar proteinosis and the like.
ZAP70 gene mutations abolish ZAP70 protein expression, TCR signaling dysfunction, manifested by combined immunodeficiency, recurrent infection, diarrhea and hepatosplenomegaly, with cutaneous erythema-like and eczematoid changes.
IL7RA gene encodes IL-7 receptor, IL-7 promotes thymocyte maturation, and IL7RA gene mutation makes IL-7 receptor unable to transduce signal for stimulating thymocyte maturation to cause T cell developmental maturation disorder-B+NK+The combined immunodeficiency of the invention can cause otitis media, thrush, diarrhea, recurrent infection and opportunistic infection, and can be accompanied by the changes of dermatitis herpetiformis such as skin, hair and nails.
CHD7 gene chromatin helicase DNA binding protein 7, which encodes a protein comprising several helicase family domains, two transcripts are currently available, and mutations in this gene have been found in some patients with CHARGE syndrome.
The Artemis-DNA-PK is involved in T, B cell differentiation, and related gene defects comprise LIG4 gene and DCLRE1C gene, so that T cells and B cells are inhibited in differentiation to cause T-B-NK+Severe combined immunodeficiency. The DCLRE1C gene codes the Omenn syndrome caused by Artermis, the LIG4 gene codes DNA ligase IV, and the skin manifestations of microcephaly, psoriasis, telangiectasia and the like exist.
Phosphoglutathionase (PGM3) is a key downstream mediator of hexosamine biosynthesis and is critical for the production of Uridine Diphosphate (UDP) N-acetylglucosamine (GlcNAc). Mannoprotein N-acetylglucosamine transferase (MGAT) binds UDP-GlcNAc to N-glycans, limiting T cell activation and expression of GLUT 1. PGM3LOFDecrease of UDP-G1cNAc and N-glycan, promotion of Th2 differentiation, atopic diseases (eczema, asthma, multisystem allergy, etc.) and increase of IgE, and partial skeletal abnormality (scoliosis, brachypodium, etc.) is observed, often accompanied with nervous system expression (ataxia, dystonia, dysarthria, etc.).
Disclosure of Invention
The invention provides a capture probe of a primary atopic disease related gene, which is selected from two or more of FLG, CDSN, DSG1, DSP, SPINK5, PLCG2, ADGRE2, TPSAB1, FOXP3, IL2RA, TGFBR1, TGFBR2, WAS, MALT1, CARD11, WIPF1, ARPC1B, DOCK8, MIL2, ERBIN, ZNF341, RAG1, RAG2, LRDCE 1C, ADA, IL7RA, CHD7, LIG4, ZAP70, STAT3, STAT1, STAT5B, JAK1, IL4RA, IL6ST, IL6R and PGM 3.
Optionally, the capture probe is according to the above 1) or 2);
1) consists of two or more probes shown by SEQ ID No.1 to SEQ ID No.394 in a sequence table;
2) consisting of two or more of the derivatives of each probe of 1);
the derivative of each probe is the probe which is obtained by substituting and/or deleting and/or adding one or more nucleotides to each probe in the step 1) and has the same function.
The substitution and/or deletion and/or addition of several nucleotides may be a substitution and/or deletion and/or addition of two to ten nucleotides, for example, a substitution and/or deletion and/or addition of two, three, four, five, six, seven, eight, nine, or ten nucleotides.
In the above capture probe, each of the probes may be labeled with biotin.
The invention also provides a primary atopic disease related gene capturing kit, which comprises the capturing probe.
Optionally, according to the above kit, the kit further comprises at least one of the following separately packaged components:
2) an enrichment buffer BL comprising human cot-1DNA, salmon sperm DNA, primers for blocking the linker sequence;
3) enrichment buffer HY comprising NaCl, sodium citrate, BSA and Tween 20;
4) library enrichment binding buffer solutions including NaCl, EDTA and Tris-HCl buffer solutions;
5) wash buffer WB1, including SDS and trisodium citrate buffer;
6) washing buffer WB2, comprising SDS and 10-fold dilution of the trisodium citrate buffer;
7) wash buffer WB3, including SDS and 2-fold dilution of the trisodium citrate buffer;
8) a library enrichment eluent which is NaOH aqueous solution;
9) a neutralization buffer NE which is a Tris-HCl buffer;
10) the PCR reaction solution comprises a primer for PCR amplification.
Optionally, the primers for blocking the adaptor sequence in the enrichment buffer BL are primer 1 and primer 2, the sequence of primer 1 is SEQ ID No.397, and the sequence of primer 2 is SEQ ID No. 398.
Alternatively, the enrichment buffer BL described above is composed of 30% -45% (v/v) (e.g., 30% -35%, 35% -45%, 30%, 35%, 40%, 45%) human cot-1DNA, 5% -25% (v/v) (e.g., 5% -15%, 15% -25%, 5%, 10%, 15%, 20%, 25%) salmon sperm DNA, 0.2-1nmol/μ l (e.g., 0.2nmol/μ l, 0.3nmol/μ l, 0.5nmol/μ l, 0.6nmol/μ l, 1nmol/μ l) primer 1, 0.2-1nmol/μ l (e.g., 0.2nmol/μ l, 0.3nmol/μ l, 0.5nmol/μ l, 0.6nmol/μ l, 1nmol/μ l) primer 2, and water.
Alternatively, the enrichment buffer HY consists of 1-1.5M (e.g., 1.0-1.25M, 1M, 1.25M, 1.5M) NaCl, 0.1-0.3M (e.g., 0.1-0.15M, 0.15-0.3M, 0.1M, 0.125M, 0.15M, 0.3M) sodium citrate, 0.08-0.12g/100mL (e.g., 0.08, 0.1, 0.12) BSA, 5% -9% (v/v) (e.g., 5-7%, 7-9%, 5%, 6%, 7%, 8%, 9%) Tween20, and water.
Alternatively, the library enrichment binding buffer consists of 1M NaCl, 1mM EDTA and 10mM Tris-HCl buffer, pH 7.5.
Alternatively, the washing buffer WB1 is SDS solution A (e.g., 0.05-0.1%, 0.1-0.2%, 0.05%, 0.1%, 0.2%) at 0.05-0.2% by mass/volume (g: mL); the 0.05-0.2% SDS solution A has SDS as solute and has a concentration of 0.05-0.2% (e.g., 0.05-0.1%, 0.1-0.2%, 0.05%, 0.1%, 0.2%) and a solvent of trisodium citrate buffer SSC.
Optionally, the washing buffer WB2 is SDS solution B with the mass-volume ratio of 0.05-0.2%; the SDS solution B has a solute of SDS, a concentration of 0.05-0.2% (e.g., 0.05%, 0.06%, 0.1%, 0.15%, 0.2%) and a solvent of 0.1 XSSC.
Optionally, the washing buffer WB3 is SDS solution C with a mass/volume ratio of 0.05-2% (e.g., 0.05%, 0.08, 0.1%, 0.15%, 0.2%); the SDS solution C has a solute of SDS, a concentration of 0.05 to 2% and a solvent of 0.5 XSSC.
Alternatively, the library enrichment eluate is a 0.1M aqueous NaOH solution.
Alternatively, the neutralization buffer NE is a 1M aqueous Tris-HCl solution at a pH of 7.5.
Optionally, the primers for PCR amplification in the PCR reaction solution are primer 3 and primer 4, the sequence of primer 3 is SEQ ID No.399, the sequence of primer 4 is SEQ ID No.400, and the last nucleotide of both primer 3 and primer 4 is thio-modified.
The application of the capture probe and the kit in the preparation of products for capturing the primary atopic disease related genes in the sample to be detected is the protection scope of the invention.
The application of the capture probe and the kit in the preparation of the primary atopic disease related gene product in the sample to be tested is also within the protection scope of the invention.
The application of the capture probe and the kit in the preparation of products for detecting or predicting whether a person to be detected has primary atopic diseases is also within the protection scope of the invention.
The invention also provides a method for capturing the primary atopic disease related gene in the sample to be tested, which comprises the following steps:
capturing the genome DNA of a sample to be detected by using the capture probe to obtain a capture fragment; so as to capture the primary atopic disease related gene in the sample to be tested.
The invention also provides a method for sequencing the primary atopic disease related gene or gene mutation site in a sample to be tested, which comprises the following steps:
1) capturing the genome DNA of a sample to be detected by using the capture probe to obtain a capture fragment;
2) amplifying the capture fragment by using the PCR reaction solution in the kit to obtain a sequencing library;
3) and sequencing the sequencing library to obtain a sequencing result of the primary atopic disease related gene or the gene mutation site in the sample to be detected.
The primary atopic disease related gene may be selected from two or more of FLG, CDSN, DSG1, DSP, SPINK5, PLCG2, ADGRE2, TPSAB1, FOXP3, IL2RA, TGFBR1, TGFBR2, WAS, MALT1, CARD11, WIPF1, ARPCIB, DOCK8, CARMIL2, ERBIN, ZNF341, RAGl, RAG2, DCLRE1C, ADA, IL7RA, CHD7, LIG4, jp 70, STAT3, STAT1, STAT5B, JAK1, IL4RA, IL6ST, IL6R, PGM 3.
The clinical phenotype of the primary atopic disease may be selected from one or more of allergic dermatitis, urticaria, autoimmune diseases, combined immunodeficiency disease, hyper IgE syndrome, Omenn syndrome or skeletal abnormalities.
The invention relates to a probe group capable of rapidly and accurately capturing a gene sequence related to primary atopic diseases, which effectively improves the diagnosis efficiency of the primary atopic diseases and can provide a diagnosis basis for treatment. Can accurately and rapidly detect the mutation sites of the primary atopic diseases.
Drawings
FIG. 1 is a sequence chart of Sanger's number 2021-01-01STAT3 gene c.1144C > T heterozygous mutation Sanger.
FIG. 2 is a sequence diagram of Sanger's No. 2021-01-01 father STAT3 gene c.1144C > T no mutation Sanger.
FIG. 3 is a sequence chart of Sanger's NO. 2021-01-01 mother STAT3 gene c.1144C > T mutation-free Sanger.
FIG. 4 is sequence chart of C.575delA heterozygous deletion mutant Sanger of infant number 2021-01-02LIG 4.
FIG. 5 is sequence chart of Sanger's number 2021-01-02 father LIG4 gene c.575delA heterozygous deletion mutation Sanger.
FIG. 6 is sequence chart of Sanger's no deletion mutation C.575delA gene of mother LIG4 with infant number 2021-01-02.
FIG. 7 is the sequence chart of Sanger's heterozygous mutation Sanger with number 2021-01-02LIG4 gene c 833G > T.
FIG. 8 is the sequence chart of Sanger's heterozygous mutation Sanger with mother LIG4 gene c 833G > T in infant number 2021-01-02.
FIG. 9 is sequence chart of Sanger's no mutation Sanger's sequence number 2021-01-02 father LIG4 gene c 833G > T.
FIG. 10 is a sequence chart of Sanger's homozygous mutant Sanger with the child number 2021-01-03RAG2 gene c.193G > T.
FIG. 11 is a sequence chart of Sanger's heterozygous mutation Sanger's sequence with accession number 2021-01-03 and the gene c.193G > T of father RAG 2.
FIG. 12 is a sequence chart of Sanger's heterozygous mutation C.193G > T at mother RAG2 gene c.193G of infant patient number 2021-01-03.
Wherein the positions indicated by the arrows in FIGS. 1-12 are mutation sites.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 Primary atopic disease-related Gene Capture Probe set, kit preparation
Design and preparation of primary atopic disease related gene capture probe
A120 bp probe sequence was designed for the non-repetitive region in each region based on the whole exon sequence of the primary atopic disease related gene, and each sequence was designed to move along the gene position. The designed probes are synthesized in large quantities by using an in-situ synthesis technology. The 37 relevant genes of the primary atopic disease are FLG, CDSN, DSG1, DSP, SPINK5, PLCG2, ADGRE2, TPSABl, FOXP3, IL2RA, TGFBR1, TGFBR2, WAS, MALT1, CARD11, WIPF1, ARPCIB, DOCK8, CARMIL2, ERBIN, ZNF341, RAG1, RAG2, DCLRE1C, ADA, IL7RA, CHD7, LIG4, ZAP70, STAT3, STAT1, STAT5B, JAK1, IL4RA, STAT 6ST, IL6R, PGM 3.
A large number of probes with biotin labels are amplified by utilizing a PCR method, and the specific method is as follows:
the above synthesized probe was added to ddH in a total volume of 1.2ml2In O, 5. mu.l of the DNA was used as a DNA template, and PCR amplification was carried out in three tubes using a common PCR primer (5 '-end sequence GACTACATGGGACAT (SEQ ID No.395), 3' -end sequence GGAACCTACGACGTA (SEQ ID No.396)), wherein the primer GACTACATGGGACAT was a biotin-labeled primer.
The PCR amplification system: DNA template, 5. mu.l; forward primer (25 μ M), 2 μ l; reverse primer (25. mu.M), 2. mu.l; MgCl2(50mM), 4. mu.l; 10X Platinum Taq buffer (from Life Technologies), 5. mu.l; dNTPs (10 mM each), 4. mu.l; platinum Taq (5U/. mu.l, from Life Technologies), 1. mu.l; h2O, 27. mu.l; the total volume was 50. mu.l.
PCR amplification conditions: 30s at 98 ℃; (98 ℃, 30s, 60 ℃, 25s, 72 ℃, 45s)35 cycles; 72 ℃ for 5 min.
After the PCR product was purified using MinElute PCR purification kit (purchased from Qiagen, cat # 28006), 5500ng of the purified product was taken and bound to MyOne avidin magnetic beads (purchased from Invitrogen, cat # 65002). Then adding alkaline NaOH to denature and elute the complementary strand without biotin; the whole magnetic beads were then washed with a 100 ℃ formamide liquid to separate the probes from the magnetic beads. Precipitating with ethanol to obtain biotin-labeled probe as capture probe.
The nucleotide sequences of the biotin-labeled probes are respectively shown in SEQ ID No.1-394, and the 5' end of each probe is labeled with a biotin group.
Preparation and use method of primary atopic disease related gene capture kit
A. Preparation of primary atopic disease related gene capturing kit
The primary atopic disease related gene capturing kit is a kit for carrying out molecular genetic detection by detecting the mutation of the whole genome of the primary atopic disease related gene, and the kit (specification 16 persons/box) comprises the following components: the above one "obtained biotin-labeled probe set (160. mu.L), enrichment buffer BL (208. mu.L), enrichment buffer HY (800. mu.L), library enrichment binding buffer (3.2mL), washing buffer WB1(9mL), washing buffer WB2(45mL), washing buffer WB3(45mL), library enrichment eluate (1.2mL), neutralization buffer NE (500. mu.L), and PCR reaction solution (800. mu.L).
1) Biotin-labeled probe set
The biotin-labeled probe consists of the probes shown in SEQ ID No.1-394, and the 5' end of each single-stranded DNA molecule is labeled with biotin.
2) Enrichment buffer BL
Enrichment buffer BL consists of 35% (v/v) human cot-1DNA (Invitrogen Cat: 15279011), 15% (v/v) salmon sperm DNA (Invitrogen Cat: 15634017), 0.5 nmol/. mu.l primer 1, 0.5 nmol/. mu.l primer 2, and water.
Wherein the primer sequences are as follows:
primer 1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGATCT (SEQ ID No.397)
Primer 2: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGC (SEQ ID No. 398).
3) Enrichment buffer HY
The enrichment buffer HY consisted of 1.25M NaCl, 0.125M sodium citrate, 0.1g/100mLBSA, 5% (v/v) Tween20 and water.
4) Library enrichment binding buffer
The library enrichment binding buffer solution consists of 1M NaCl, 1mM EDTA and Tris-HCl buffer solution with pH7.5 and 10 mM;
the Tris-HCl buffer solution with the pH value of 7.5 and the concentration of 10mM consists of a solvent and a solute, wherein the solvent is water, the solute is Tris (hydroxymethyl) aminomethane (Tris), the concentration of Tris is 10M, and the pH value of HCl is adjusted to 7.5.
5) Wash buffer WB1
The washing buffer WB1 was 0.1% (mass to volume ratio g: mL) SDS solution A; the solute in the 0.1 percent SDS solution A is SDS, the concentration is 0.1 percent, and the solvent is trisodium citrate buffer SSC;
the trisodium citrate buffer SSC consists of 175g/L NaCl, 88g/L trisodium citrate and water; the buffer pH was 7.4.
6) Wash buffer WB2
The washing buffer WB2 was 0.1% (mass to volume ratio g: mL) SDS solution B; the solute in the 0.1% SDS solution B is SDS, the concentration is 0.1%, the solvent is 0.1 XSSC;
0.1 XSSC is a solvent obtained by diluting the trisodium citrate buffer SSC by 10 times; the buffer pH was 7.4.
7) Wash buffer WB3
Washing buffer WB3 was 0.1% (mass to volume ratio g: mL) sDS solution C; the solute in the 0.1% SDS solution C is SDS, and the solvent is 0.5 XSSC;
0.5 XSSC is a solvent obtained by diluting the trisodium citrate buffer SSC by 2 times; the buffer pH was 7.4.
8) Library enrichment eluent
The library enrichment eluent is 0.1M NaOH aqueous solution;
9) neutralization buffer NE
The neutralization buffer NE is a Tris-HCl aqueous solution with the pH value of 7.5 and the concentration of 1M;
the pH value is 7.5, the concentration of the aqueous solution is 1M Tris-HCl, the aqueous solution consists of a solvent and a solute, the solvent is water, the solute is Tris (hydroxymethyl) aminomethane (Tris), the concentration of the Tris is 1M, and the HCl is used for adjusting the pH value to 7.5;
10) PCR reaction solution
The PCR reaction solution consisted of 0.05U/. mu.l Phusion Hot Start II DNA Polymerase (Fermentas, cat. EP090B011) and PCR mix buffer. Wherein the PCR mix buffer is prepared from 0.2mM dATP, 0.2mM dTTP, 0.2mM dCTP, 0.2mM dGTP, 5% (v/v) DMSO, 2.5pmol primer 3, 2.5pmol primer 4, 4mM MgCl2, 500mM KCl, 0.8% (v/v) Nonidet P40. The last nucleotide of the primer 3 and the last nucleotide of the primer 4 both have sulfo modification, and the sequences are as follows:
primer 3: AATGATACGGCGACCACCGA G (SEQ ID No.399)
Primer 4: CAAGCAGAAGACGGCATACG A (SEQ ID No.400)
Indicates a thio modification.
B. Establishment of primary atopic disease related gene capturing kit detection method
1. Sample library preparation:
extracting the genome DNA of the peripheral blood or tissue of a person to be detected as a sample; after the genome DNA is fragmented to a fragment of 100-300bp, the NGS Fast DNAlibrary Prep Set for Illumina kit (cargo number: CW2585M) which is properly invented as a reagent is adopted for library construction to obtain a DNA gene library; the method mainly comprises the following steps: DNA extraction and breaking, end filling, joint adding, PCR enrichment and purification.
2. Enrichment hybridization of samples
(1) Preparing a hybridization solution: 250ng of DNA genome library, 10. mu.l of enrichment buffer BL and 5. mu.l of biotin-labeled probe set are mixed, shaken and centrifuged, and then 37. mu.l of preheated enrichment buffer HY (preheated at 65 ℃ and shaken well before use to resuspend the precipitate) is added. The total volume was 100. mu.l, centrifuged to perform PCR at 95 ℃ for 10 minutes and 65 ℃ for over 22 hours.
Note: the volume of the buffer HY was adjusted according to the volume of the library prepared, and the adjustment ratio was HY buffer volume to total volume/1.8.
(2) And (3) purification: the buffer used for this step, except for WB2, was left at room temperature.
1) A 1.5ml centrifuge tube was taken and 50 μ l MyOne magnetic beads (purchased from Invitrogen, cat #: 65002) Violently shaking for at least 5 seconds, centrifuging for a short time to collect liquid on the tube wall, placing the centrifugal tube on a magnetic frame, standing for 1 minute, and then discarding the supernatant;
2) taking down the centrifugal tube, adding 50 mu l of 1X library enrichment binding buffer solution, violently shaking for at least 5 seconds, centrifuging for a short time to collect liquid on the tube wall, placing the centrifugal tube on a magnetic frame for 1 minute, keeping the centrifugal tube on the magnetic frame, and removing supernatant; repeating the step 3 times;
3) resuspending the precipitate with 100. mu.l of 2X library enrichment binding buffer, shaking vigorously for at least 5 seconds, adding all the overnight hybridized liquids, shaking uniformly, and turning over for 30min on a turning over instrument;
4) taking down the collecting pipe from the turnover instrument, shaking and centrifuging, standing on a magnetic frame for 1min, and discarding liquid;
5) adding 500 μ l of WB1, shaking, mixing, and turning over for 15 min;
6) taking down the collecting pipe from the turnover instrument, shaking and centrifuging, standing on a magnetic frame for 1min, and discarding liquid;
7) adding 500 mu lWB3, shaking, mixing, incubating at 66 deg.C and 850rpm for 10min, shaking, centrifuging, standing on magnetic frame for 1min, and discarding liquid;
8) repeating the step (7) for three times, standing at room temperature for 2min, shaking for centrifugation, standing on a magnetic frame for 1min, and removing the supernatant;
9) add 500. mu. lWB2, shake and centrifuge, and discard the supernatant.
10) Adding 17.5 mul of library enrichment eluent, immediately covering the cover after the addition, shaking and uniformly mixing, and turning over the instrument for 15 mm;
11) after shaking and centrifugation, the mixture was placed on a magnetic stand and allowed to stand for 1min, the supernatant was transferred to a clean 0.2ml tube, 12.5. mu.l of neutralization buffer NE was added, and shaking and centrifugation were carried out to obtain 30. mu.l of template DNA.
3. Sample PCR amplification
(1) PCR reaction system
Mu.l of template DNA obtained after the capture of the probe was added to 30. mu.l of PCR reaction solution, and 40. mu.l of water was added to 100. mu.l of the total system.
(2) PCR cycling conditions
Pre-denaturation at 98 ℃ for 30 seconds; 15 cycles: 25 seconds at 98 ℃ and 30 seconds at 65 ℃ and 30 seconds at 72 ℃ for 30 seconds; 5 minutes at 72 ℃; 4-1 h;
(3) and (3) PCR product purification: purifying by DNA purification recovery kit (CMpure) (purchased from Kangkang as reagent, product number CW2508), eluting the final product with 17.5 μ l library enrichment eluent preheated at 65 ℃ for two times, and finally obtaining 35 μ l capture product;
note: the concentration of the product obtained by different purification methods may vary. The number of PCR cycles can be appropriately adjusted according to the purification method.
(4) The captured product was subjected to 1% agarose gel electrophoresis and NanoDrop for concentration determination and quantitative PCR.
4. Sequencing the capture product obtained by the method through Illumina HiSeq2000 to obtain sequencing data, analyzing the sequencing data, and determining whether to capture the primary atopic disease related gene or determining a specific gene mutation site.
The analysis performed above to determine whether the primary atopic disease related gene was captured or to determine the specific gene mutation site analysis is as follows:
1) SNP analysis procedure
Acquiring an original short sequence by Illumina HiSeq 2000; removing joints, low-quality data and the like in sequencing data; positioning the short sequence to the corresponding position of human genome data by using SOAPaligner software, please refer to: http: (ii)/soap.genetics.org.cn/soap aligner, html; counting sequencing result information, the number of short sequences, the coverage size of a target area, the average sequencing depth and the like; the SOAPsnp is used to find the genotype of the site in the target region, please refer to: http: html, soap, genomics, org, cn, soap sn; filtering SNPs with low quality values (quality value ≦ 20) and low coverage (depth ≦ 10); annotating the SNP by using CCDS, a human genome database and dbSNP information, and determining the gene, coordinate, mRNA locus, amino acid change, SNP function (missense mutation/nonsense mutation/variable shearing locus), SIFT prediction SNP influence protein function prediction and the like of the mutation locus;
2) InDel analysis procedure
The linker-removed sequences and low-quality sequencing data were aligned to the human genome using a Burrows-Wheeler Aligner (BWA), see: http: net/bwa shtml; finding out the information of insertions/deletions (InDel) contained in the sequence by using the GATK software; the InDel is annotated by using CCDS, a human genome database and dbSNP information, and the gene, the coordinate, the mRNA site, the change of the coding region sequence, the influence on the amino acid and the InDel function (amino acid insertion/amino acid deletion/frame shift mutation) of the mutation site are determined.
Example 2 application of the kit
The present invention will be described in further detail by way of the following embodiments
The kit of the embodiment 1 of the invention is used for detecting 3 samples, and the result proves that the average sequencing depth of the target region with the target pathogenic disease is 300X and is far higher than the general genetic disease diagnosis requirement (generally 100X). The specific detection experiments and results are as follows:
1. the number of the infant patients is 2021-01-01, the male patient is 3 years old and 8 months old, the detection sample is whole blood, the kit of the embodiment 1 of the invention is used for detection, and the detection result is shown in Table 1 and indicates that the gene STAT3 has mutation. At chr 17: 404
81661 position mutation, namely exon13 missense mutation c.1144C > T, as shown in Table 1, the disease phenotype is autosomal dominant hyper IgE syndrome. The reference genome version is GRCh37/hg 19; homozygous/heterozygous: homozygous means the mutation site is homozygous, and heterozygous means the mutation site is heterozygous.
TABLE 1 test results of infant No. 2021-01-01
Figure BDA0003055723560000081
The parents of the children had no variation as shown in FIGS. 1, 2 and 3 by a generation of Sanger sequencing analysis. The detection result shows that the tested person detects 1 heterozygous mutation of STAT3 gene, the mutation is reported in literature, parents do not detect the mutation, the mutation is spontaneous mutation, and the tested person is prompted to be autosomal dominant hyper-IgE syndrome, so that the application of the kit disclosed by the invention can effectively improve the diagnosis efficiency of primary atopic diseases, and can provide a diagnosis basis for treatment.
2. The number of the infant is 2021-01-02, the woman is 5 months old, a detection sample is whole blood, the detection is carried out by using the kit, the detection result is shown in table 2, mutation occurs at the positions of chr13-108862784 and chr13-108863041-108863042, namely missense mutation c.833G & gtT and deletion c.575delA occur to exon2, and the disease phenotype is DNA ligase 4 deficiency.
TABLE 2 detection results of infant No. 2021-01-02
Figure BDA0003055723560000082
Through the first-generation Sanger sequencing family analysis, the c.833G & gtT mutation of the infant patient is from the mother, and the c.575delA deletion mutation is from the father. As shown in fig. 4, 5, 6, 7, 8 and 9.
3. The number of the children patients is 2021-01-03, the male patient is 2 months, the detection sample is whole blood, the kit is used for detection, the detection result is shown in table 3, mutation occurs at the chr11-36615526 position, namely homozygous mutation c.193G is larger than T occurs in exon2, and the disease phenotype is severe combined immunodeficiency.
TABLE 3 detection result of infant No. 2021-01-03
Figure BDA0003055723560000083
Figure BDA0003055723560000091
The c.193g > T mutation in the infant patient was found to be from its parent, as shown in figures 10, 11 and 12, respectively, by a generation of Sanger sequencing family analysis.
The above 3 patients can accurately and rapidly detect the mutation site of the primary atopic disease by using the kit shown in the embodiment 1 of the present invention. Therefore, the probe set and the kit for detecting the pathogenic gene of the primary immunodeficiency disease can provide accurate and rapid detection data basis for establishing diagnosis as early as possible and taking correct and reasonable intervention and treatment measures on the infant patient.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
SEQUENCE LISTING
<110> Shenzhen city children hospital
<120> capture probe and kit for primary atopic disease related gene and application thereof
<130> 210367
<160> 400
<170> PatentIn version 3.5
<210> 1
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
tcttatttta aaagtgcttc aaatccttca ataaggttct gaaagcttgt ccgattggat 60
ggttggaatt cccagcattt cctcataagt tgataaacct gtaaaaagaa agaagtaaca 120
<210> 2
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
acagttaggt gggcacggca ggcgttttcc ttcttttaac gtattcacaa gtcttgtgac 60
tgtcatctgg ccatgggttg ggcctatcat tttcaggaac aactatataa aataaaatca 120
<210> 3
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
gaaaagtagg acttacagcc atgggactag aatctgaatc acagtaagtc agcagctcat 60
gcagagtgac tccaaaagac cagacgtcag aggcaatata aaatttagat tgcattaaac 120
<210> 4
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
caaaacacag ggctgtcccg gtcatccttg acggtgtaat actccttatc ggtttcaatt 60
gctttggtta aaccgaagtc tccaattttc acttggtgtt cactctcaac aaggacattt 120
<210> 5
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
gcatatttta gctgctgttt gaggtttatt ttgttcttat tctttggaag atattcctta 60
aggcttcccg aaggcagaaa ttccatgatg agcttaatac catttcctcc tgtttagaaa 120
<210> 6
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
cgtcttctgt gcagattcct ttgtacttca caatgttctc atgatagagg ttccttaaga 60
tctcgatttc ctttttcaga tcagctatgt ggttacctcc actctcaggc ttcagagatt 120
<210> 7
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
gcagcaagca gcacgggtgt aacttacctc tcccaagtca cggatcctct ttaggaagcg 60
cttttcaaaa tgtgtggggt ccacttcagt tgctggtttt ttttctgaaa caatatctgg 120
<210> 8
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
catgatggct cggaagaaag gcctctgatt ggggtcatag ttcatgcagc gggtcatgag 60
gtcagccagc tccttacatg atggtgtcac tggcctgcac cggctttcat agaatctctc 120
<210> 9
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
ctcaatcagc gtcttgtctt tcaaggggat ctcgccattg tagcagattt cccagagcgt 60
ggttccaaag ctccacttgt cagcagccac actcaggttc ttggagtcct caacacactc 120
<210> 10
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
gacacacctt gcctagacag caccgtaatg gggatgccgg ggtcactgag cttgatgaat 60
gggccacact cactgtcgat gccctcacgg gccaggagga ggtttttagt acacacattt 120
<210> 11
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
ggacattctc accaagtagc tcagggcact ggccagctgt ttggcaactt tgaatttcca 60
tggtgtggta aggacatcgc ttttccggtg catgaagaga tccagaggac ccccttccac 120
<210> 12
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
cctttgaaag agaacacact tactctccac gtcgcggaca cagacgccat agaggtacac 60
gatgtgtttg tgggagacct gtctcatcat gctggctgcc tcgaagaagg cctgtgggcg 120
<210> 13
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
tgccagggaa atatccctgt ggctggggtc taagactttg aggatcactt ttatcttctt 60
ctcttcagaa gttccttcgt catccttgta atccatcagg gtcccagaat agatgtgtgt 120
<210> 14
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
caccctgcag ccgtgactca cctgcaccag atccttcttg aggatccgat cgaaactcag 60
ctggctcatg gggtagacgg gctgccactc ctgggctttc ttagtagcca ccagcaggtt 120
<210> 15
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
ctcggggctt gggctggcag cagcgtttta gcatgaagct gatgttatcc gtgcgcagga 60
tctgcttctt gaggtggctc atgaggtctc ccaagctggg gaagctgcgg tccgaaccgt 120
<210> 16
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
gcaggtgacg gtcatgagga tgttgtcaaa gtcggtgcag ctccacctca gcacgtacat 60
cccctcctcg cttccttctt gccgcaattt attgatggcg tattctgtac tagagggaga 120
<210> 17
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
cagattggac catgacagcc attctgtatg ttgtggacga tcaacggggg ggccacgtcg 60
gtgcagaggt aatgatgggc atctgctgtg agccggaagt agccatctac cagggacaca 120
<210> 18
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
cattttcttg ttgtcctgct tgttaatgct gaccacagac tcctttatta caatgtgagt 60
gatttcaggg aagtaagaaa aattgttcca ctcttcccgg atcttgtttt tctcctcatc 120
<210> 19
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
tcatgcgtgg acacgctgct gtcacaaatg gtcttgttgt taaattcctt taggaaatcc 60
ttgaaaacat tatttatccg catcctggtg agaaggttcc tctgtctgat ggacttattc 120
<210> 20
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
ctgatgtcct tgggcagttc tggcaactgc atcttcttca tcatggcata gtgtgagatg 60
gccaggacag ccatccctag acactcgttc tcaatatcat gtccatcctg ctcggtcttg 120
<210> 21
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
ctgagcaaac agatactcca gtgagctggc atcaaggaga ggggttgcat ctggaatctt 60
ttttttctcg tagccatttt tctgcttctt tggagaatga cgccacactg actgctcatt 120
<210> 22
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
gtacttccca tacctcatcc ggtagtggag ccggagggac atcttgtcat caacggtgat 60
ggtgcgattt ggagcatacc agagcttggt gttctcgtca tacagggcaa agaggttgtg 120
<210> 23
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
ggcatgcctg tgcagccctg atgcacagtt cctctgctgt gtactctcca ctgcccagcc 60
ggaggggctc cctgtccgac agatagaaga tcacttccac ccctggctca ggggcctcca 120
<210> 24
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
aagccagata ttttcctttt ttaaaaatat gcaaatctac atacctgcat ttattcagct 60
gtccagtgtt ctccaagaag caaactggat tttcttctct actttccaaa gctacttcag 120
<210> 25
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
atcattacag gtcatgtagc atttaccaca gttgatacac atttcttcat caatcatagc 60
cacaacttgc tctacgttgc tcaattcacc aaatgttcca aggtactgca gtgcttttcc 120
<210> 26
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
ttcaccaact tatgccaatt ctcttgtttt agatgttaaa tcacacttac gttgtctgga 60
aagtcagcct ttagttcagt gacactttga caccaatatg cagccgtttt ctcactgatg 120
<210> 27
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
gaaagttttg gtgagggcaa aaccccatcc agcttcaaaa gctcttcgaa tcattgatgt 60
gctggtggct ggagttgcgc tagcaagacc aaaaggattt ataaacttca atccggccat 120
<210> 28
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
tctgctaccg tgactaagat ggaagcgttt ttggggtcgc ggtccggact ttgggcgggg 60
ggtccggccc caggacagtt ttaccgcatt ccgtccactc ccgattcctt catggatccg 120
<210> 29
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
gaaccccatg gtgaccggga cctcagtcct cggcgttaag ttcgagggcg gagtggtgat 60
tgccgcagac atgctgggat cctacggctc cttggctcgt ttccgcaaca tctctcgcat 120
<210> 30
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
ggattgatga ggagcttctg ggagatggac acagctatag tcctagagct attcattcat 60
ggctgaccag ggccatgtac agccggcgct cgaagatgaa ccctttgtgg aacaccatgg 120
<210> 31
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
tgttagcttc ctcggttatg tggacatgct tggtgtagcc tatgaagccc cttcgctggc 60
cactggttat ggtgcatact tggctcaggt aagtagtaag tctagaggtg ggggaaaggg 120
<210> 32
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
cccccaatct ccctagcctc tgctgcgaga agttctggag aagcagccag tgctaagcca 60
gaccgaggcc cgcgacttag tagaacgctg catgcgagtg ctgtactacc gagatgcccg 120
<210> 33
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
ggcattattg aatgctctgc tttcttccag tttcaaatcg ccactgtcac cgaaaaaggt 60
gttgaaatag agggaccatt gtctacagag accaactggg atattgccca catgatcagg 120
<210> 34
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
gtacagctat ttttaggaat tgatcccttt atgcttcaca attttattat tctgtcttcc 60
ttttttagtg gctttgaatg aaatacagat gcattatcca gaactgaagt tgccctactt 120
<210> 35
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
ttactcatag taatagtatc tctgtgactg actaaatccc agttgtttcg atatatcact 60
agaatggcca cataaacctg ggtccttatt aatatacgtt gcataatacc ttggatgatc 120
<210> 36
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
tcggtaaatt ctcttttctg gtagactcat aatatgcttg agccaacttg aataccatca 60
gaagaaactc agtgaagtca attttcttgt tgtggtctat atccaagtga tccatgaaga 120
<210> 37
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
tcttaccttc aggatttgcc gaaattcctt ttccagaagt tccttcagct cttttttact 60
caatgtgtca gtgtttttat ctttttttga atattgcttg aaaagattaa ttatggcaaa 120
<210> 38
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
aagcatgctg gccgtcggct gcgcgctgct ggctgccctg ctggccgcgc cgggagcggc 60
gctggcccca aggcgctgcc ctgcgcaggg taagggcttc gggcgcacct ggagggctgg 120
<210> 39
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
aggtggcgag aggcgtgctg accagtctgc caggagacag cgtgactctg acctgcccgg 60
gggtagagcc ggaagacaat gccactgttc actgggtgct caggaagccg gctgcaggct 120
<210> 40
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 40
gctttccttt cagttccccc cgaggagccc cagctctcct gcttccggaa gagccccctc 60
agcaatgttg tttgtgagtg gggtcctcgg agcaccccat ccctgacgac aaaggctgtg 120
<210> 41
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 41
tcagaacagt ccggccgaag acttccagga gccgtgccag tattcccagg agtcccagaa 60
gttctcctgc cagttagcag tcccggaggg agacagctct ttctacatag tgtccatgtg 120
<210> 42
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 42
tgcagcctga tccgcctgcc aacatcacag tcactgccgt ggccagaaac ccccgctggc 60
tcagtgtcac ctggcaagac ccccactcct ggaactcatc tttctacaga ctacggtttg 120
<210> 43
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 43
tcaggtcaag gacctccagc atcactgtgt catccacgac gcctggagcg gcctgaggca 60
cgtggtgcag cttcgtgccc aggaggagtt cgggcaaggc gagtggagcg agtggagccc 120
<210> 44
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 44
acaggactcc agggcccatg aatcactaat aatgagcctt tcttctgtcc gcagaatcca 60
ggagtcctcc agctgagaac gaggtgtcca cccccatgca ggtgagctcc tgttcttgta 120
<210> 45
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 45
tctgcagaaa caggctgatg gtgaggaatg tctcttttag gcacttacta ctaataaaga 60
cgatgataat attctcttca gagattctgc aaatgcgaca agcctcccag gtaaggactg 120
<210> 46
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 46
ctctatcttc aatttttttt ttaacctagt gcaagattct tcttcagtac cactgcccac 60
attcctggtt gctggaggga gcctggcctt cggaacgctc ctctgcattg ccattgttct 120
<210> 47
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 47
gttcaagaag acgtggaagc tgcgggctct gaaggaaggc aagacaagca tgcatccgcc 60
gtactctttg gggcagctgg tcccggagag gcctcgaccc accccagtgc ttgttcctct 120
<210> 48
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 48
tgagtgatgg tgatgttcac agtctctgaa gacacatttt tactcccaaa aagccccctg 60
cagaagtagg agccgctgtc tttgagtgtg gcttttggaa tgtagaagtc agaattatga 120
<210> 49
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 49
aaaatagtcg tgccagctga ccgggtgttg ataaagtaga atagaaatat gtcaaattgt 60
ggactgttag ttgttaagtg gttctggaga gtgtgaaaat ctgtggcttc cagcactgct 120
<210> 50
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 50
tggtcgataa catcttagta ttatcatgga aaagttttga tcttatagac ccctcaacac 60
ccaaaagtcg taatcagttc tactcaagta agatttaaat atatatctat attttctggt 120
<210> 51
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 51
aatctgaatc tggaccctgc tgaaaactgc cgtgatttct cataacactc tcctgcccct 60
tcagaagtga aaactggctg atagtttccc aaatgaataa ttttcgttaa tgttaatcgt 120
<210> 52
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 52
cgttaatgtt aatcgtgtga tgttgttgag ctagaatgtt gactcaactg attcgtgagg 60
ggagatcttg caccagatat ggaaccagga cttccaccga aatcttagct ctggaagttg 120
<210> 53
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 53
gatgttgttg agctagaatg ttgactcaac tgattcgtga ggggagatct tgcaccagat 60
atggaaccag gacttccacc gaaatcttag ctctggaagt tgattttttt cgtgggagtt 120
<210> 54
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 54
gatgttgttg agctagaatg ttgactcaac tgattcgtga ggggagatct tgcaccagat 60
atggaaccag gacttccacc gaaatcttag ctctggaagt tgattttttt cgtgggagtt 120
<210> 55
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 55
gatgttgttg agctagaatg ttgactcaac tgattcgtga ggggagatct tgcaccagat 60
atggaaccag gacttccacc gaaatcttag ctctggaagt tgattttttt cgtgggagtt 120
<210> 56
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 56
tgtcttgcta tgctgcccag gctggtctca aactcctggc ctcaagagat gctcccgcct 60
tggtctccta gggagctggg gttataggcc tgagccaccg tgccaggcct gatgcgctct 120
<210> 57
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 57
ctgatgcgct cttttccgtg gttacgttct accagtgtga cctccatccc ttctccctct 60
tcacttcctt ctttctttcc ttccttgcat aaacattgaa tgtacggatc cctttttggt 120
<210> 58
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 58
ctttccttcc ttgcataaac attgaatgta cggatccctt tttggtgttt ttagacactt 60
ctcaggaaac gtacgcattg atttgcacct tgtgtgtcca cctgtaaaca tcaaattagt 120
<210> 59
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 59
aggccaaatt cagggtatca ttcatagcaa tcccaaagaa actaactctt aaagaggcca 60
attagtaacg cacaggtaaa actttgctaa gtatgattct ctgcctggga cctcattcat 120
<210> 60
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 60
tgattctctg cctgggacct cattcatcct tctgttcctg acattgcctc atgggtttgg 60
ctgccccgtt ttgaagttac ccaaagatta ttctgccatg gcctctgttt tttagaaatt 120
<210> 61
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 61
gttacccaaa gattattctg ccatggcctc tgttttttag aaattcaaga ctgaaggctc 60
agtagaaggg ggttagctta gaggattgag ccaagggtaa aatgatttct gggtagcagc 120
<210> 62
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 62
tgagccaagg gtaaaatgat ttctgggtag cagcccagag ttcttgaagg atgtttatta 60
ggcaacgtga acgggagaat cagcagtcag aagcggctga gaaaggaacc acgcagacaa 120
<210> 63
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 63
gggagaatca gcagtcagaa gcggctgaga aaggaaccac gcagacaatg tccagttgta 60
tagggtagag tgtgtgtgtt gtgtatttac gttagtgctg gggctttcct tgggactcct 120
<210> 64
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 64
tggagagagt tccataccat tcatgcttta atgaacacat atacatgaaa ataagatgga 60
gagttctagt ggttttgccc ttcctcttca acggcgaaat tgctatttag aagtgggtag 120
<210> 65
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 65
gccactgccc cgtgtcctgt gatgtgactt cagagcttcc aaaacgcagg caagcacaac 60
ggatgtctcc tgggcgacca tttagcacct ttgatttcac ttgggcttca tgacttctgt 120
<210> 66
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 66
cttcatgact tctgttgtct gttcccggct tcttaccaag aaattcttgt tcttttggtt 60
ttctagattg ttcttctact cttcctcctg tagtggtgta acaaagtcac ggtcatatgt 120
<210> 67
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 67
acttactgtc tccgctgcca ggtgagccca ctcaggagga ggacgctgat cagcaggaaa 60
acacagccgg ccactgtcaa tagagagagg gagttcagca aagggccctg ggcttggcat 120
<210> 68
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 68
acaaagccag tgccccactc acctgctacc tggtactctg ttgtaaatat ggacgtctcc 60
atggttgcag ccatttctgt ctgtatttga aaatctgtga aaaagagata aagagagaca 120
<210> 69
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 69
acctgttgtt gtgacgaggc aggaagtctc actctcagga cggccttcgg ggcttgcctg 60
aggcttctct tcacctgggg gagagagtaa gtgatgctgg tggagctaaa cacaggagtc 120
<210> 70
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 70
cctgtatccc tggacgcact gataataaac catctgcccc accacgaaat gataaattct 60
ctctgtggct tcattttccc atggtggagg ttccctgcag tgacctggaa gatggaagga 120
<210> 71
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 71
gctgcattgg actttgcatt tctgtggttt tcctttcttt ctgttcttca ggttgaggtg 60
tcacttgttt cgttgtgttc cgagtggcta gaaaatatag atggaatgat gcagataatt 120
<210> 72
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 72
cacagaaggg acacttacca gagcttgtgc attgacattg gttgtcccag gacgagtggc 60
tagagtttcc tgtacagagc atatagagtg acccgctttt tattctgcgg aaacctctct 120
<210> 73
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 73
ccgggggcac ccacaggccc ttacctgcct ggcagccagg caccatgatg aacgtgagca 60
gtccccacat cagcaggtat gaatccatct tcctgaccct tgggaccagc cggggcagtg 120
<210> 74
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 74
gcagtgaagc ggaggtcttt ctctgcagaa ggcccagttg ccgtcagcct ctttttggca 60
tcgcgccgga ggatgtggga tgggaagatc ggtccgcctg ggctgtcacc cttgtgggtc 120
<210> 75
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 75
atgggaagat cggtccgcct gggctgtcac ccttgtgggt ccatccagtc tctatcggag 60
tcaggagttg ctctctttaa gtattgggct ggcgtgttca gccaggaaac tgcctagcac 120
<210> 76
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 76
tttcaaacca ggtttttttt ttcaagttca attgctggag gtgtgggctg gggttgatga 60
gaaggattga acttcattta tgaatccttt cttcagctac gcccataaaa ggagagggag 120
<210> 77
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 77
agggttaagt tagaacagag aagccagcca cctgccaaga aggtctgaag aacccagaag 60
cgacattagc aaggggttcg tttcacggaa tccaaaggtc tgtttcgtca atcatggcca 120
<210> 78
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 78
aggcgccttt ggcatgcact gcagcgtgtt tgtgtttaat ctcaggggtt ctggggcaca 60
gcaaaggctc tctggggacc ctaggctaag aatcttttgg aatgtggagc aaaaaaaaaa 120
<210> 79
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 79
tacttttgga aaattacctt tttatctctt taagagatac ttggtacatt ttgatatttt 60
catttgcaga tatgtagaaa tttattcaga tttaggagaa gagttcactg gcatatttag 120
<210> 80
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 80
gtatgcacct gtgatccagc tagtcaggag gctgaggcag gaagatcgct tgatcccagg 60
agttaaagga tacagggagt catgatggca ccaccgcatt ctagcctgag tgacagagtg 120
<210> 81
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 81
tgtagttttg ttttgtcttt attgatagaa tgtaatgggc ctttgggatc ttaagtacta 60
cttatgttac ctttgttatt cagatgctga acttaagcag tgaaataata gaaactaaag 120
<210> 82
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 82
agtctcggtg aactgttcta gctctcttca gttttcccag tggtttatac tttggctccg 60
tactttggga agaccggcat aaaggcttta agctgaaatg aatcagaata tttgattttt 120
<210> 83
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 83
aaatacaaaa aggcagagaa ataagatttg aagacgtcct acccctttcg aaggcctcac 60
tgccaactgc ctcctcctgg cagattccgg gaagccttta ggatgatcta caacatacca 120
<210> 84
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 84
gtcccacaac cagtgactac tcacatttcg acaactttat ccatagttgt gccaactgga 60
atgacatttg gatatgcgtt cacaggacag aggtagctca agaaatcttt aatctagaaa 120
<210> 85
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 85
catccattac taagttgata atgagaacac aaagactttt atgcccttct gcaaatggac 60
agactagaac ccaatgtaat tattagtatc ccaccaaact gaaagaggca gaaacccaag 120
<210> 86
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 86
cagaacactg agcgataagg gttatgagta tatgggatcc tcttacctca ctgtaggagg 60
agtgaaaaga aaaacaagct ctgtatgaac tctctccagt cctaaaggga agtgaaaaca 120
<210> 87
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 87
tttctgctcc tttctccaaa ccacatggtg gatggcttaa tgctgattat gtggagtgga 60
attctatttc tggaagtaat tccacagggt aatttgctcc actgaaaata ttcctctgcc 120
<210> 88
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 88
ggaatcactt gcacacgtac cttgggatgc cggcatgcat ggatctgagt gttgcggtct 60
gttgtgagat gatgaaggat ctcaggcatg ttcctaaaca tgtctagctt attcacatga 120
<210> 89
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 89
aacagtcacc atacctggac tcctaattct tcactaaggt tggtgaacag atattcatag 60
ccataagccg ctttgcagtt cagccacaca acatggtacg ggctccgagt gatccagctt 120
<210> 90
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 90
cccagatgat aaccctgttc ctccaggcag acttacccga cttggaattt ggtaaaatct 60
tggatcacag aacgtagtat ccaaatatac actttggatg tctttgactc tgaaaagaaa 120
<210> 91
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 91
cggagtgcag aagctccatt ctagcagctt ctccttgcgc caatctgaag tctcctgtgt 60
acaggacagt tccattattg ccctgaaata aaaacctgaa aaagaaatat atcccagtga 120
<210> 92
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 92
aatatgtgtc tacatataat aaaatgacaa aataaatgac ccccttacat aactgatccc 60
ggacagtgac cagctggtaa gagagtcaca acaatctctt ccttctaaaa agaaaataaa 120
<210> 93
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 93
atttaatatt tagttacctc tcctgatgct tcatccacta aagatatctg ggtaggagtc 60
tcgatttcaa tagatatcta taaaaataaa ataagagacc atgtatatag cagtttttca 120
<210> 94
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 94
agttattaaa aaaataaaac ttacaattcg tttcttccaa aatctgtatt tcgggctcgt 60
taacaacaac tccttagtca caggtgaaca gtatagataa accttcaagc tgaaaggaaa 120
<210> 95
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 95
aaataaatta cctgcactcc aaccttcttt tcaaggtagg ggctcttaat cctttcatgt 60
gatctaaaaa caaaagaaca aaaactcatg aatatgtttt tccagaggat tccttagccc 120
<210> 96
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 96
cctcactcac ctttgtggca gtgggacagg aagtaggcgc gggccctcag gttctcccta 60
tcgaagcggt ctatggagat agttggatac tcggccatct gcccctcgaa agaactcata 120
<210> 97
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 97
ttagaaagaa aacagagttc atagagaaag ttacaaaata gattttctta atacctgaaa 60
cttggtaaaa agctgtggta ttaaactgtg gtgatgtcat taggggagcc ctctacccaa 120
<210> 98
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 98
ccctctaccc aaacagaaag gaaggctcaa cagagcacag gtgtttgttg taaatggaaa 60
aataaatccg tcttattttc atactgcagc aagttaacac tatcgaaagc attacagatt 120
<210> 99
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 99
taaactagat aattaatgta ggatgcaaaa gatagggcct catagtatat attaaaaata 60
ttatataatt agcatgacta ctactgctgc tgctaactac tactactact attattgctt 120
<210> 100
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 100
ctactactat tattgctttg ttggtgctgt tagtgatcat ttttagtgat tgcccacaaa 60
aggaacaata ctggatatga ggaaattgat ataatttatc ttttcaagca tactgtgggc 120
<210> 101
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 101
tctctgcagc attcctgggg gtggccacag aggcctggaa cttgacacac aaggccttca 60
ctttttcaaa ggtcattatt tcaccattgg tcaggaagaa cttgttccca acttgtttgc 120
<210> 102
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 102
caaacttcaa gctgcctgga gagtaagaga aaaagcttac actttttgat acgtgccatt 60
tctgtttgca gagcttttct ttctgaggca gccaggctac tatcaccatc tagaaaatta 120
<210> 103
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 103
tttccagggt ctcctttttg gccctttggt cctggtgacc cagaaggccc tggatttcct 60
ggaggcccca actttccagg ggggccctgt aagcctctga gcccttggcc tgttggaaga 120
<210> 104
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 104
gagagctaca ggcaatcact gcagggcagg tcttttgggc atcctcacag gtcacagttt 60
ctgagtaaga cgctgccacc atactcagga gaaggagagg gagtgatgga aacagggaca 120
<210> 105
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 105
taagacgctg ccaccatact caggagaagg agagggagtg atggaaacag ggacatggtc 60
ctcaccttgg tgtgagaaaa ctcagggaag gttaatctca gttaatgaac acatatttac 120
<210> 106
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 106
tggggtgtgt ttggtcccat cttttcctct gccacaacac caccatgatg atcaccataa 60
catcatattt attggccctt tatcaagcta tgtacatggt gagacaggtc aggacaggcc 120
<210> 107
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 107
ttcctctgcc acaacaccac catgatgatc accataacat catatttatt ggccctttat 60
caagctatgt acatggtgag acaggtcagg acaggcctcc atttgtctca ggggcaaagc 120
<210> 108
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 108
tgatggggct ccagttaagg caatgaaggc tttgccacac catagagggc tcaagggaag 60
ggtcctaaaa gaccagccct gagcagcctg gtgggaacag cctcttggcc ttctgcccag 120
<210> 109
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 109
aggctttgcc acaccataga gggctcaagg gaagggtcct aaaagaccag ccctgagcag 60
cctggtggga acagcctctt ggccttctgc ccagctcctg gctgaagctg tgatctgtgt 120
<210> 110
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 110
gcctcttggc cttctgccca gctcctggct gaagctgtga tctgtgtagc tgtgactgca 60
gggcttgaga atggcggagg gcttaggcag tttggacagg gtgaatcggg attagcgtgt 120
<210> 111
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 111
ctgaagctgt gatctgtgta gctgtgactg cagggcttga gaatggcgga gggcttaggc 60
agtttggaca gggtgaatcg ggattagcgt gtaaacccag ccacctccct gaaaaacagt 120
<210> 112
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 112
tgcctccgct ctcacccctc agggacctca gtgctctgta taggtatttt ctcttttcct 60
tttcaaaata acattttttt ctttcctttt aattttctta ttataaaagc aatgatcctg 120
<210> 113
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 113
ggaaaggcag ggttcagtac tcactagacc taaatggcac cctgctggga ctctcaggca 60
tggtctcact cactttctct ctacttgatg tctcactggg cactcccaga tttgggacct 120
<210> 114
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 114
tataggcctg gttcagcccc cacattgtac agatgggccc agagagggga aaagcccagc 60
caaggggagc ccctttttag aatttcccta aggcctaatg gggatctagg tggatggctc 120
<210> 115
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 115
ctctctcctt acctggaatc ccgtatagag aagcggctac acagatggat atcctctctt 60
caccgaggct cctggaatgg tggcatcagc cccccaggca gcccactgtg gctccttgca 120
<210> 116
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 116
ggaggctggg aaggacagtg gaagctgata aacagctcag cagcatgttc tgagaaacaa 60
gagggcaagg agagagcaga gaacacactt tgccttctct ttggtattga gtaatatcaa 120
<210> 117
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 117
ccagaagttt atgaatgctc ataatgcatt aaaaacctct gggtttacca tgaaccctca 60
ggcaagctta ggggacccat taggcataga ggactctctg gaaagccaag attcaatgga 120
<210> 118
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 118
gccaagattc aatggaattt taagtagggc aaccacttat gagttggttt ttgcaattga 60
gtttccctct gggttgcatt gagggcttct cctagcaccc tttactgctg tgtatggggc 120
<210> 119
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 119
agaaactgat gagctgattg cttgaggctt ttagtgagtt ccgaaaagca acaggaaaaa 60
tcagttatct gaaagctcag taactcagaa caggagtaac tgcaggggac cagagatgag 120
<210> 120
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 120
gagctgattg cttgaggctt ttagtgagtt ccgaaaagca acaggaaaaa tcagttatct 60
gaaagctcag taactcagaa caggagtaac tgcaggggac cagagatgag caaagatctg 120
<210> 121
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 121
agctcagtaa ctcagaacag gagtaactgc aggggaccag agatgagcaa agatctgtgt 60
gtgttgggga gctgtcatgt aaatcaaagc caaggttgtc aaagaacagc cagtgaggcc 120
<210> 122
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 122
tgttggggag ctgtcatgta aatcaaagcc aaggttgtca aagaacagcc agtgaggcca 60
ggaaagaaat tggtcttgtg gttttcattt ttttccccct tgattgatta tattttgtat 120
<210> 123
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 123
atttttttcc cccttgattg attatatttt gtattgagat atgataagtg ccttctattt 60
catttttgaa taattcttca tttttataat tttacatatc ttggcttgct atataagatt 120
<210> 124
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 124
caactttgag aaaatcagtc cttttttatg tttaaattat gtatctattg taaccttcag 60
agtttaggag gtcatctgct gtcatggatt tttcaataat gaatttagaa tacacctgtt 120
<210> 125
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 125
ttcagagttt aggaggtcat ctgctgtcat ggatttttca ataatgaatt tagaatacac 60
ctgttagcta cagttagtta ttaaatcttc tgataatata tgtttactta gctatcagaa 120
<210> 126
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 126
ttatttttac tttttcattt caagaaattt agagtttcca aatttagagc ttctgcatac 60
agtcttaaag ccacagaggc ttgtaaaaat ataggttagc ttgatgtcta aaaatatatt 120
<210> 127
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 127
catgtcttac tgaaacattt tgccagactt tctccaaatg aaacctgaat caatttttct 60
aaatctaggt ttcatagagt cctctcctct gcaatgtgtt attctttcta taatgatcag 120
<210> 128
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 128
ttatggggca ggggtaagca agtttttaaa tcatttgtgt gctctggctc ttttgataga 60
agaaagcaac acaaaagctc caaagggccc cctaaccctc ttgtggctcc agttatttgg 120
<210> 129
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 129
tttgtgtgct ctggctcttt tgatagaaga aagcaacaca aaagctccaa agggccccct 60
aaccctcttg tggctccagt tatttggaaa ctatgatctg catccttagg aatctgggat 120
<210> 130
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 130
catccttagg aatctgggat ttgccagttg ctggcaatgt agagcaggca tggaatttta 60
tatgctagtg agtcataatg atatgttagt gttaattagt tttttcttcc tttgatttta 120
<210> 131
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 131
tgatatgtta gtgttaatta gttttttctt cctttgattt tattggccat aattgctact 60
cttcatacac agtatatcaa agagcttgat aatttagttg tcaaaagtgc atcggcgaca 120
<210> 132
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 132
aaagagcttg ataatttagt tgtcaaaagt gcatcggcga cattatcttt aattgtatgt 60
atttggtgct tcttcaggga ttgaactcag tatctttcat taaaaaacac agcagttttc 120
<210> 133
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 133
tgtttttttg gaaatgagtg ggccactaag ccacactttc ccttcatcct gcttaatcct 60
tccagcatgt ctctgcacta ataaacagct aaattcacat aatcatccta tttactgaag 120
<210> 134
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 134
gaactatttt gaatgcatgt gactaagagc atgatttata gcacaacctt tccaataatc 60
ccttaatcag atcacatttt gataaaccct gggaacatct ggctgcagga atttcaatat 120
<210> 135
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 135
ccttaatcag atcacatttt gataaaccct gggaacatct ggctgcagga atttcaatat 60
gtagaaacgc tgcctatggt tttttgccct tactgttgag actgcaatat cctagaccct 120
<210> 136
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 136
tatactccag ggaaattcac cacactgaat cgagcatttg tgtgtgtatg tgtgaagtat 60
atactgggac ttcagaagtg caatgtattt ttctcctgtg aaacctgaat ctacaagttt 120
<210> 137
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 137
gcattacatc aaacagagtt caaattccac acagataaga ggcaggatat ataagcgcca 60
gtggtagttg ggaggaataa accattattt ggatgcaggt ggtttttgat tgcaaatatg 120
<210> 138
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 138
gtaatctaca taaatatacc tcagaaatca tttttggtga ttattttttg ttttgtagaa 60
ttgcacttca gtttattttc ttacaaataa ccttacattt tgtttaatgg cttccaagag 120
<210> 139
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 139
tacaaataac cttacatttt gtttaatggc ttccaagagc cttttttttt tttgtatttc 60
agagaaaatt caggtaccag gatgcaatgg atttatttga ttcaggggac ctgtgtttcc 120
<210> 140
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 140
tgtatttcag agaaaattca ggtaccagga tgcaatggat ttatttgatt caggggacct 60
gtgtttccat gtcaaatgtt ttcaaataaa atgaaatatg agtttcaata ctttttatat 120
<210> 141
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 141
gatgcaatgg atttatttga ttcaggggac ctgtgtttcc atgtcaaatg ttttcaaata 60
aaatgaaata tgagtttcaa tactttttat attttaatat ttccattcat taatattatg 120
<210> 142
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 142
ttcaaatgac tgactttggc acatcattca tgcatcatat aatggggagg ggaaatcctt 60
aaagaaaatg catacaagta attcaggaaa acatgtcaaa cttgatgtag attatttatt 120
<210> 143
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 143
taacttgttc atgggcataa tccaaagggt tgcttgaagg tatataaaga acactaatgt 60
gggatgtagt agatcttgct tttaagtttt ggccaactgc cgaattgtta tgttgcacaa 120
<210> 144
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 144
aaaataatca atttaattct tttgggtgtt aatttcttta ttggctaaat ttgtcataaa 60
cactttatag gttatttgtt accaagactt atataataaa tataaacata cctcgatgat 120
<210> 145
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 145
agaatgactt tatttatcat tgcattataa acactttttt ctggccctta attcatgtaa 60
ctaaaagaaa acataggcat tttaaataaa caaaaatgta tttttaaaat caatgttatg 120
<210> 146
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 146
taaacacttt tttctggccc ttaattcatg taactaaaag aaaacatagg cattttaaat 60
aaacaaaaat gtatttttaa aatcaatgtt atgattttaa aaatagattc aaaaattcca 120
<210> 147
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 147
ggcattttaa ataaacaaaa atgtattttt aaaatcaatg ttatgatttt aaaaatagat 60
tcaaaaattc catacacctg aatctgaaag gcttttgcaa aactaatcaa acaaccttct 120
<210> 148
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 148
ctaatcaaac aaccttctaa gaaaggattt cttggcagga gtcaagattt ttccagaacc 60
ttttttacgg agggatttca ttggaggctt ttttaagggt aggactcttt ggggagtgtg 120
<210> 149
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 149
ttcccttaaa gtttactaac ataggctccc attttttagc tttggtagaa atgaaggtat 60
cagacctacc tgaaggccag aggggctgct cacgcctctc tgaatctttg ccgctaaacc 120
<210> 150
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 150
ttcactgact gcccactatg actgtggcaa gcagaaggct gactgtaaag agagtgtgta 60
tgtgtgccta cagatgttct tatgaacact gatctaatgg gagtaactga ctgtgacctt 120
<210> 151
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 151
cctggtggac atggtgaatg acggcgtgga ggacctccgc tgcaaataca tctccctcat 60
ctacaccaac tatgtgagca tctgcaccag ggttgggcac tgggggctga acaaagaaag 120
<210> 152
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 152
gaggacctcc gctgcaaata catctccctc atctacacca actatgtgag catctgcacc 60
agggttgggc actgggggct gaacaaagaa aggggcttct tgtgccctca ccccccttac 120
<210> 153
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 153
attagaatta tatttatatt gaagtgcaca gaatgttttt tcctcttttg tcctggtatt 60
acatttagaa aatttactat taaaaaattt taaaaggcga taccttgata cttcattgtt 120
<210> 154
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 154
ctccattttc tgcacattaa ttaccccagg aagaggggag gagggatgag gcatgaaata 60
aaaatgctcg ggaatatagg tgggtatgtt tcctgtatcc tcccttactc atctctgtct 120
<210> 155
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 155
atcctgaaga ggcttgtagt gagagatgtt tctcagcaac ccagggccac ctacaaggcc 60
tggtaagtaa tctgagagga aataagcttc ttaggatcag gattccccca tgttttcaac 120
<210> 156
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 156
ggagccccat tcaccttttc agtatataga gttatggtct ttggagagac atgagacaca 60
gagtaagagg gacggagtgg gctgtgatga ctgctgcccc tcctcaagac tggggcacag 120
<210> 157
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 157
gagttaattg aacattttat gacaagattt ttaggaaaag atagaggaat agtagtacgt 60
tgtttcaaaa taagaacaac gatagcaaaa gagctgagaa tctgctatag tactatgtct 120
<210> 158
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 158
atgttcctga cttcagataa aatttcatta ctatatttag ttatggaatg ataggaaagg 60
cataaatttt taaacttaat aaaaactgga aatatgttaa gaattaggag agccttacta 120
<210> 159
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 159
tttctattgt attctagttc tctaaccttt gcacacattt gtttaggggc tatggacaga 60
gagattctcc tgtctttgtt gtcagcattg tgcttagaga aagtagaaca atctgagtca 120
<210> 160
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 160
caatctttaa tgaactggtg agaattagaa aaggaaagtg agagtgatca atgctcagag 60
ccagttccac agcctgctga ccttggggga agaagggaca tccgtaaatg attatggagc 120
<210> 161
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 161
aagcagacgt tccgttcttg gcattacgca cctgctaaag ggagagagag tgtttgctgt 60
ggtagaccag acaggggaat ggaaggcctg ataattagcc catcctctga caaaccctgg 120
<210> 162
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 162
gttgcacctc ttgcatatag agagagacta gatgctaatt aaatataaag tacttgtgac 60
tatcctccca cataacactc ttttgggaca ccacaaattt cttccccatc tacccactcc 120
<210> 163
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 163
cccactccca cctccttccc ccagcccttc aagcagaaca gtctgtgtat actttggaaa 60
cataaactca cattatcatt aatctaagcc aagcatcatt gagaaagtaa atctgctgca 120
<210> 164
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 164
taccaagctc aaagaggttg ctatcagata ggatttgaat gaaaaatcat gtgatggtcc 60
tgggtttagt taggctttta ctgactccat tcatcccgca acaccccgtg acccctctct 120
<210> 165
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 165
gagttgtcat ggcaattatg attgacaatg gagcatcctg tgaatgccaa caatgatccc 60
taaaatgacc tctgccctac aggctgggtc ctgcagggaa tgttggcagg ctgggctcaa 120
<210> 166
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 166
ctctctctct ctctctctgt ccacacacac acacacaccg gtgtagttgc tagggcagag 60
atagctccat gaaacaaagt ataaagccag gtctgcctgg gaggtccaac cttcccaatt 120
<210> 167
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 167
attaatttat aaatcagggc aactgcaaca ggcaattttc ttatttggtc taccacttta 60
gagcaatgaa cttgacttct tttttggcta accaaagaac aatccaaagc agatgtaaac 120
<210> 168
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 168
ccaggctacg agctgggcag caattcttcc tggcaagtag ttcttgcaat ttgcctatac 60
ccagagcaga tgctgcttct gcttttccca aagaaagctt tctctatatt ctgcctttcc 120
<210> 169
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 169
attagagagg gtaggaaggc aatgaaacca ctctgaatta tgtaaagatc ttgctacttc 60
ttatagccta ataggaagaa atccaggcag gggttatagg gcatcagctg ttgaatgaat 120
<210> 170
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 170
agcatggtaa acaggtggga ggagaaaatg atcattttgg aattgtaacg aagtctctga 60
aatggaggcc cttggagtgc cagcttcaga actgtttggc cagaaccaag gacttaggat 120
<210> 171
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 171
gccagctcat cattgctgtt gtttatttat tcatgctcag atggggcggt ccaagcccgt 60
ttgttcacag acatctttcc cctcgttgaa tcttgctctc tgcctgcctt tcctactagt 120
<210> 172
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 172
ttccacccca agggagcttt tctccccttg aggccaagac agggtggggc gggggacagg 60
gatgggcagc acataaccct ctggccctct gcccttccca tgcaggtggt cagcactggg 120
<210> 173
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 173
ccccaaacct ctgatgcttc caacgtggcc ctccctgtcc ctgatgcctg cacctggcgg 60
tcccctactg ctgcctgtct accctgtccc ctaactgcac tggtggagag agcagagaat 120
<210> 174
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 174
cagtggcatg tggtgggcat cgttagttgg ggctatggct gcgggggccc gagcacccca 60
ggagtataca ccaaggtctc agcctatctc aactggatct acaatgtctg gaaggtaagg 120
<210> 175
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 175
ctgattccag aggccatcag gcctaaaagg agtagtgcag gaagctgtgc tcccatggcc 60
agtcccagat tcaggtacat acgtactgag ctattttctg cagatctctg gcctaaggcc 120
<210> 176
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 176
ggagacagga gaaaaatgga aaaagtcatc ctcaagaaga ttaaagtcta actggaagca 60
atgactatct gcttgtgaag cctttttttt tccaagttag acaagtgtta actacagcta 120
<210> 177
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 177
aaagctgctg aggccagctt ggggcccctt ctttcctgtc cctgggcact tccctggctg 60
ctctctttcc ccactgccca gcccaaggag tcccctctgc agctgacccg ggttcagcct 120
<210> 178
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 178
ggggcatgaa ggatcttctg ttttttcgta ttttctgttt tttttccttt tagtattcag 60
taaaggcctt ttttcagagt tcccacctgt ctcaggtagg ccagagagag caacatggtg 120
<210> 179
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 179
aggtattcag tttcccagac cttttgctcc tagaaacagg tcctagagcg gagggcaagg 60
gtgtggaaga gactgggtgg gtgagaatag gctgggccag actctgagcc tcagccctgg 120
<210> 180
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 180
ggctgcaggt ctgtttatag cctgtgtgtg ctgggaaaag acatcagaag tccttgccat 60
tcccccatcc cacccaagcc ctcagagcct gctcccattt gggtctagag cagcatgttc 120
<210> 181
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 181
cctcactggg ttggctgaag atagagagga ggagccaggg cctctgcttg gggtgagatg 60
ggagatgggg gaacaaaggg cagaggagat actttctcct ccggacactt ttgctgaacg 120
<210> 182
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 182
aagtggcctg gctttgaaac atggtgctat cccctagcaa gcagaggagg agcttccaga 60
cagaaaatgg tacctttccc cagagtctat gttgaggtgc accagccttt ccagtcctga 120
<210> 183
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 183
gggcaaagag catgacctga aaactggctg tgcctcaacg tcctcaactg taaaagcagc 60
tgacaatggc tggagtggag aggggctgca gctgtctggg tgtggtgttc cctctgtttt 120
<210> 184
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 184
actgaactcc aaccctgcac aggccccagc attgctcctc tgagagccag gctcagctca 60
cttctcaggc ataccaagat ggccacgaac cctacctagg tgctctcaag ccccaagagg 120
<210> 185
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 185
gattataacg ttctgttaca taaaataggg tatgccttac atttagtaaa tccagtatga 60
acaaaaaact tatgccacag ttgcaggctg ggtaaattat gggaaggaag gaaggaatca 120
<210> 186
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 186
tctagttgag agatgaggaa actgaggcat ggggatttca gggctcagtc gaggtggcaa 60
gggaagttct gctcagcatg ggcatattag acacatcagc aggttattgc agcaattgaa 120
<210> 187
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 187
ttcagttggg gcagctaact tgctgtcaat ttgtctaagc cggaaaggga gaatctgcag 60
cattagtctg tggcatgtga gaggcccatt aataaaagag ccacatgtgc tcaggggaaa 120
<210> 188
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 188
ggacttccct tccaggtggg actgagctca agggtgatgt taattactgt gtatacctac 60
cctagtctga tgtgtcctcc caaagactca tcaccccaaa ccggagagcc tctcatcttt 120
<210> 189
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 189
tctgtgcagg aagctgcagc aggtaggatt tgtctccctg ggtccaggat gtgactgtca 60
cccagagggc acctgaactg ccccaactct gcttcctcct gtagccagtg gtctttttcc 120
<210> 190
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 190
tgctttgcag ctccacctgc atttgctttg ggaccccttt gagtccctca gcgcttctct 60
ttcctacatc ctcccaggcg atcaccccct tcggggcttc ccttcctgtt tctctgtctg 120
<210> 191
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 191
gattataact cctgaagcag cccgggtggc actttcggta ggtccaggga gttaccaaag 60
taatgtgcct gtattccttg ggggccagtt tcattttatt tgacaactta agtttccatt 120
<210> 192
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 192
ttttcagatc aactcaaggt tctcgaacac atctggtacg ctcttaactt tagctgctag 60
aagtattccc agcacttgga attccatccc atctacatca gagctgtcaa caaaatggta 120
<210> 193
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 193
caagcataga attgaccctt aataggacta gtcatgatgg acagagatcc ccaatgataa 60
aggtattcac aaagaacaca ggttacaacc caattcttga gggacccttg agtgagccag 120
<210> 194
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 194
gtggtcagaa gagaataaaa gcagcaaaaa taatgtgatc agtagcagat ccctttcctc 60
ataagctgtt tctttcagaa taaaaaattc actaccaccc caccccaaac cacccaacac 120
<210> 195
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 195
gtttcccagt cattcctgac aagagtttca cgaatgaaat gagtatttgt ataaatgaat 60
gacaagcagg tatgggccag aatcacttca tgactattgc tgtgtctagt aattgttatt 120
<210> 196
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 196
gggtttaggg tccactccgc atactcccac ttgcccttgg cattggcccc atgggtggac 60
catggaggtg ggtgctgtat ggcaacagtc attcctcagc agagtggaga gggagacaca 120
<210> 197
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 197
ggattttgtt tatccgttgt gcttgttctc cctacatcag tgatgataaa atattgtcaa 60
aataatattt ttccatacta taaaggcaaa ataaaagcaa ggacatatgt tctaataaaa 120
<210> 198
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 198
ggaaatggcc ccaggaccat caaggctttg ccctgctttc tgggcagggt tcggcaaaat 60
taaaaaggaa gaaagattat ttatcgtcca cccagtgcaa attaagaaaa atggtatggt 120
<210> 199
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 199
attagagtgt cggtcccaaa tctcgcctac ctggcagaga ttcttatcgc ggttagtgct 60
ggccaactcc ctcccctgct agatgggatt ctaatcccta taagccctgg aaatgaacag 120
<210> 200
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 200
actcatcttt tttccctgta gaaatgaaac agatctattg tctgtgtttc cttcttctgg 60
gcatcttaaa tgatggatag gttcaactgg ctgagagtta tccttgtaaa taagggtatt 120
<210> 201
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 201
aatactgcta gttttttttt taaatcaata aaagcaacac tgatacatta tagcattcca 60
aggaacaaaa cagagggaga aatttcaggt tcacatccag gtcagtaagt cagcaattcc 120
<210> 202
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 202
catagcatac aatctttttt atttttctag tataccatct tataaatttt ctttgattcc 60
gccatttatt gcctgagttt caagaaataa gcaaataact gctatagagc cttcaagtaa 120
<210> 203
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 203
ccctcctact ctatgtaccc tgccatgctg tagatgtaga aaggcaggtt cttattgctg 60
tgtcatcagg gagatgcatc ctattttcag gtgagacttg cctggagttt tggtgctatt 120
<210> 204
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 204
cccttggcct gtgctgacac atccttagcc cagagggtga gcttcaccaa cgttggcctc 60
atatctcttg tctgctttct gctaattctt ttatcctaca ctagaatcac aatatctatc 120
<210> 205
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 205
tgacttaccc atggtagaat cttactaaac cagatatagc accaacttag cctatggagt 60
gaaggctggt tctcccatat gcaaacgtaa ctcttaagaa gtgatagaat aagggagaaa 120
<210> 206
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 206
tgcttcgatg gcagaaatat tcttggagaa gttataaaat cttaacacaa aagcagaagt 60
ccatcttcag gcaagtccaa gtgaaaccac cgcacacaag cctgtgtgtt tatgaggatg 120
<210> 207
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 207
ttcgtctacc ccacaggctg ccgctttgac ctgataggta gaagtcatta gcctgtgagc 60
ttatttaagc aattgggatc tgctatgtca gaccacccaa tgaaagaaat gtctcctctt 120
<210> 208
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 208
tggggtaggg agggtgaagg agcagagaat gaggacaagg ggctgcccgc ggggccctaa 60
gctcctcccc tgaggtgcac acgttcttcc tctctcagcc tctttggatg ggctgcctcc 120
<210> 209
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 209
gtgctggatt gtagcatggt gcctggtaca ggatgggcac agggatgcat gggagagcag 60
cctcgcttca gccgaaggga atcaagatgt tagaaatggg cacagctcct cctactgagg 120
<210> 210
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 210
ggatcctggg gatggcccac ctgccttggc tttgaaggcc tggcccacac tgggccatgg 60
gatctgctat gggcaggctg gctgggagtc tgctatggct tcacacattg tctacttact 120
<210> 211
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 211
accctttgaa aggtaaaagc tttttgtttt ataaaatctg atttacgggc ccccggtgca 60
gggccaaggt tttatatatt atgcaagatt tcaaaccgtg gctgtaaaac gtacggtttc 120
<210> 212
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 212
tggctcaccg aggcgcgcag ggagtggaag tgcctgagga taaaggtgta cacgtgcgag 60
tctgagatga tggaattgct gctcaaactt cgtccccttc tctgccctca gcaaacttat 120
<210> 213
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 213
tgcatctcga cacccactac ggccaacaca cagcccgggc ccctaggtga tgggtggaca 60
aatgagatgc ggtcaggatt ataagccaca cctcgcctga ctggttctcc acttcctttt 120
<210> 214
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 214
aggactgagg cctcctgggc ctcagaggcc caggcccagc tgagcacgaa tccctggtcc 60
accatggctt agcccctgct ggcaaaaggg caagatcaac tgcccctctc agaacccggc 120
<210> 215
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 215
aagggatgta tgggagaagc cagggagtgg agagagaact cgtgttcccc gatacaaggc 60
tttttaccca tgtctcccca aatagccccc cctcctccca ctagccccga ggctggagat 120
<210> 216
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 216
aagggcttga gacctacagg ataggcaggg ggcccagcag ttttagggtc ccctcaaagt 60
ataggtcttt tgaatccttg atctggtgac atttttcatt atatcaacct tcatttctgt 120
<210> 217
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 217
cacgtccctt gcctttgcag aagcctctca ccagcaccct tcctgccccg gtgacttgct 60
gccagagctc tgcctggaag tgtgatggaa gccacctggc atgagcttga aaggaactgc 120
<210> 218
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 218
tatttcccag atttgaacct ggatcttgtt gaattggaga agtgggacag acatggtaca 60
ttttgaaacc caaccattat atccttaaag agaagtacat ttctcccttc cactttgttc 120
<210> 219
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 219
tactcattta taccttactt tccaatagtt aatgttttcc aaatacacta ttgtcattct 60
tctagcaaaa gcccagaaag tattttatag ggagtcccat ggaagataag atttgatatc 120
<210> 220
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 220
atagagttgg catacctaaa ttctagaaat gctaaattgc aaaatgaatt ggaaacaatg 60
gcatttcttt ggagacaaaa ggtattgaaa tgggacacag ccccatttgg tctcttgaca 120
<210> 221
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 221
attttcttaa agtcatttaa gtttattatt tcacagaaat gaaataaact gtacagcatt 60
ggtcataagc ataggtacta gatgagtgat ataaacaatg ataaatggca ggtaattatg 120
<210> 222
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 222
tctgtactgg ggctgtgaaa ggctgggctg ccctcacact gcaggtgtcg ggggctcagg 60
agcctcttct tatcttttgt gtgactgcaa ctattttccc aagaaaatta aagtgactta 120
<210> 223
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 223
agtttatatc catatatctg taatggtggg cacagtgtag ggtgagaaga ggaagagtag 60
gagagattat ttaaaaagaa agttttacaa ccaggaagta ttggaagagg caaatcatgg 120
<210> 224
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 224
ggcacagtgt agggtgagaa gaggaagagt aggagagatt atttaaaaag aaagttttac 60
aaccaggaag tattggaaga ggcaaatcat ggcaactctg gatgtttttc ctaaaacccc 120
<210> 225
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 225
aactggggga aaagccactc attctcacaa caatccaatg ccccagagcc catgggatga 60
aaactgtgac ttaaaattca gcatagaaca cagaataaaa aagatcagaa gggcatgaga 120
<210> 226
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 226
gcaggacgag gcgctgagta agggacgggg ctgctcccag cagaatccac aaagtagctc 60
attctgctct cagcacctgt gtgagagaag gcgttggctg agcctctgga tgctcacagg 120
<210> 227
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 227
tgcgtgacct ccacaggaaa gtgcaactat cttccaaaaa tgtataaatt atcaaagatg 60
tattctataa caaaaatgac agtccttgag atgtggtgga ttaatattgc tagatcagga 120
<210> 228
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 228
acaccacaca agattgtagg agggatcaac ctcagctcaa gagtcaaaga gatgagaagc 60
atcagagcag cagcgtagct tggagaccat acaccaggtt cctgacacca gtccccgggg 120
<210> 229
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 229
tatgggcact tacatagcaa gtcagcccct gtctcatgca gagcttcaat ttctagcccc 60
ttatcatcag cgatcatact attccatggt ttctaatttt gacactttct atttttgtac 120
<210> 230
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 230
ctgggcttct ggctcctgtg ttgaggggaa gagagtgggg agaggtcgga ccagcattca 60
actcacaggc tcttcccagc ttccatcccc tttgccctgg agctgcagaa tttcctgacc 120
<210> 231
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 231
atatctgaaa ttacctcgct aaaggacgtt atcttagtag tagaaattaa tattttcctc 60
atgtacggtt acccacttct cattgcctca tatctgtaat aaagtcagac tgcaagatat 120
<210> 232
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 232
agggagttgc cagcacttgc cgggcaggac actgtagagc agctccagcc agggctggcc 60
tggtcgggga gcaccggtga ggagggcctg ctcctgaagg aatctctgga ccctgtccca 120
<210> 233
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 233
aatcctacat gaaaatcctt gagagttcaa aaggaaccaa cattcagtgc gagttctaaa 60
gaatgataaa ccttgatgtt tgcctttttc tttttataaa gagtagcagc tggttggctg 120
<210> 234
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 234
agctaggatt gtcctgtagg tggggcttca gctgctggag tggaccggaa atctgccttc 60
tccaggggct ttctggagcc ttccctctgc cttggtcctg agaacacctg gaaattcctc 120
<210> 235
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 235
ctgttgccct tggttcatta tccccttacc attcagattc tgggctagcc aaacctcatc 60
ttcccagctc atcctaacga acgccctcgg ctctctgcag gtgactgcct cctggaccaa 120
<210> 236
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 236
gccctgtctc ccagaagctt aaacatctcc actgtaatgt aacaaggcct ttttcttcac 60
ctcactgaac aaagggagct acagagggga gaaagggatg tcaaagactg cgtgtgagct 120
<210> 237
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 237
agaagacttt tgtaagatca cttgaaattc cctaggaatt gcttacagcg ctatcataaa 60
aggaacaaaa aaatccatgt gaaaatatta atcataggag gctggaaagg caaagacatt 120
<210> 238
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 238
tattttggca ttttgcaggc tataaaatga aaatatagct gagaagcaca aagaattctg 60
gcccaggtcc cagatgagag ggaagggtgg cttgagaggt gaatgtattt gttgtgtgaa 120
<210> 239
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 239
gtcatggggc gcaggctcac agggcggctc agctgctggg gacaccgccg tcagggatgg 60
ccctggcacg tggcacgtca tgccgcaggg gatctctgca tcccagcacc ccacattcct 120
<210> 240
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 240
ctcctagctt ttaaccagac tgttaatgcc tagtacctag caggcaatca ataaacacat 60
gctgattgca actagagaat aatttaattc aattattcag aaatttattg aatttctctc 120
<210> 241
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 241
tgagtgctag aagtggaaat gggggtggtt gtagctttgc tgattcatgc taccagaaag 60
gcactgaagt cccagttcca ggcagcagag tcatctacgg catgcaggac accacgttgt 120
<210> 242
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 242
ttgtagcttt gctgattcat gctaccagaa aggcactgaa gtcccagttc caggcagcag 60
agtcatctac ggcatgcagg acaccacgtt gtacaagaat gtaggttcat tgtgctgctt 120
<210> 243
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 243
tttctaggaa ttctgtggcg aaaataacaa cccacagtca tctgcacagc aattattatt 60
cattataact gaactttccc tctaaaaccg aagcttccct ttcttactgc aaaacccaac 120
<210> 244
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 244
ctcaaaaggc attgtgaagc acatcagctg aggagtgagt tataaatgaa tctaacagag 60
agacatttaa tttccttcta cataagcttg aggctgaaga ggaaaagtta gtgggcataa 120
<210> 245
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 245
gaaatggaaa atttaattaa agacaggaaa ctgaatttaa tgatctctac tgatctctta 60
aattccccaa attatttcat tatggcttac ttattgaatt ttcttaagga attctaaaat 120
<210> 246
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 246
aactgaattt aatgatctct actgatctct taaattcccc aaattatttc attatggctt 60
acttattgaa ttttcttaag gaattctaaa ataaatgaac aattacctga attttgcagt 120
<210> 247
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 247
gcttctctct atgtatttct tgagagtttg gacccatata actttagccg tcttttgaag 60
attgttggcc acaaaagaga aagcggacaa ctctagacct agggccacag tgtcaaggga 120
<210> 248
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 248
tcacctgaga ggtgctctgg gactttttca atcctccctc ctcacactcc agttacctaa 60
tttgggtcag gtagttctga aaataaaatg ctgaagtttt cttttcctgc agaacaatgt 120
<210> 249
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 249
gggactaacc aactgctctt ggaaaaacat ggctgtgcta ggaaattgac gttttcacgc 60
cagtgggagt cgagcctgat gtgggtcagg aggcctcttc atctgttctg ctggcttcag 120
<210> 250
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 250
agcacctaag ggtagaggaa ggaaaagggt ttcctgttac catattaagg gctgagtctt 60
tataccgccc attctccctc tcagttcagg ccagctcctt gacctcagtt taatgaattt 120
<210> 251
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 251
ggatcatttc tagacattga caggccactg acaactaccc ccccaccccg gaatctgagg 60
ctgaggccgc cccacaaaac tgcattttga aatcctttct acctctgggt atgggcaaag 120
<210> 252
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 252
cccagggatt ccgtgaggat tcagccccat gcgaccatgg cactccctgc cacctgcctg 60
cacaggccct gagcagagcc tggctccagc ccaaagggag acacacatcc atgccattaa 120
<210> 253
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 253
tgtgttgctt gtttttgttg aaatgagagt attgcaaata atggattagg ttgataccat 60
ttgtttgtta atttgttttg gatagtaaac cctgatttag gaaatgttca cataagaaat 120
<210> 254
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 254
agagactaaa acacgtccca gggttgcaga agaattaagt tggagacaat gatgcccaac 60
gatcaaaggg gaaaataaaa agtaatcctg atgttaatat cagggagaca gataagagct 120
<210> 255
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 255
ggaaacttga gggaatgtcc taactgcgag gtctattaca tggcagaata gtctattaga 60
tgcagaagca gtctccttgg ggatacagca gcaccatccc tgtgggagtc atttaaaaca 120
<210> 256
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 256
actttgccca ccccacctcc tctgtgcctc caacggtggc cctgccacct gcacctgctt 60
ttcctgcctg atatttataa acaagccatc tccttcacca gctaagaaac agagaaagct 120
<210> 257
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 257
gctcactcca aactcgcggc cgccctgccc cgcctgtcat cccatagtac ccaagattcc 60
cactttacag cattccattt tcttccaaga attcccctcc aggcatcaca ctgtgcccct 120
<210> 258
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 258
cagacttggc cggagcaaag ccaactaaat aaggtgcagc tgggggcaga atgtgcttct 60
ccaagcccag gccctcggcc gcccagtgct gccccagtgc ctttggctgc gacatctcag 120
<210> 259
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 259
gttcactgag ttgggttcct aatctgtttc tggcctgatt cccgcatgag tattagggtg 60
atcttaaaga gtttgctcac gtaaacgccc gtgctgggcc ctgtgaagcc agcatgttca 120
<210> 260
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 260
gcgagcccca gccaatgagc gccggcgggc cggttgccca ggcgaccagt gcgcggctcc 60
gccccccgcg gcgaggctcc cgcgcgcggc tgagtgcgga ctggagtggg aacccgggtc 120
<210> 261
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 261
cagcatgcta accgccttcc tccccagcat gctaaccgcc ttcctcccca gcatgctaac 60
cgccttcctc cccggcatgc taaccgcctt cctccccggc atgctaaccg ccttcctccc 120
<210> 262
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 262
actgaggtgg tggcattggg attggagagg agccagaagg caggtagggc aggctttctt 60
tcttctggaa gccccagcag gcaggcattt gtgtccagat aaggtgggct ggccggaccc 120
<210> 263
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 263
ttaagtgaat ttttcttttt tcctgaactc ctacagttgt gttttttttt tgtgtgtgaa 60
taaagtgatt tttctttttt tctgaactcc cacagttgtg tttgtatgtg ttggggagag 120
<210> 264
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 264
tgcgaaagga aaagggagat gccttttctt gggattgctg ggattaaacc agcttagaat 60
ctggatttaa gtataaaggc cacatggctg ctctctctgc aaggtttgaa tttgctccaa 120
<210> 265
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 265
aattcagtga tgttcttaca gttacaggta ttctaaagaa actaatatca attcatcaga 60
aaattcaaca tcgaccttat ccacttgttt aattaatcaa attttatcac tcaatagagc 120
<210> 266
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 266
ctcggccccg cgcagctccc tccggcgtcc cgcgccctcc ttccttcctc gccaggacgg 60
acgcacttcc ggcggatgtg ggggccagcc ctcggaaacg gaagtgagcg gcggggtcga 120
<210> 267
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 267
tcggaaacgg aagtgagcgg cggggtcgac tgacggtaac ggggcagaga ggctgttcgc 60
agagctgcgg aagatggtga gtgggtaccc gggcggctgg agttccacgc gggctcggga 120
<210> 268
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 268
aataatgttt tttatttgtg ttgtagaatg ccagaggact tggatctgag ctaaaggaca 60
gtattccagt tactgaactt tcagcaagtg gaccttttga aagtcatgat cttcttcgga 120
<210> 269
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 269
atatttaatc tcctctaaat gttttttttt taatgtcctt tcagtttttc ttgtgtgaaa 60
aatgaacttt tgcctagtca tccccttgaa ttatcagaaa aaaatgtaag tatattatta 120
<210> 270
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 270
ttaaaattac attgtctttt gtagttccag ctcaaccaag ataaaatgaa tttttccaca 60
ctgagaaaca ttcagggtct atttgctccg ctaaaattac agatggaatt caaggcagtg 120
<210> 271
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 271
tttcccctga gttttttcta atcttgtccc ttcatacttt tccccaaagg ttcagcgtct 60
tccatttctt tcaagctcaa atctttcact ggatgttttg aggggtaatg atgagactat 120
<210> 272
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 272
tttgagagtc ttttaaaatg tttgtttttg tttgctttca gatccatcac aaagcgaagt 60
catgggagag ccacacttga tggtggaata taaacttggt ttactgtaat agtgtgctgt 120
<210> 273
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 273
aattaagaag tataacaaaa tcacatacat ttgttccacg gtttgaataa aatttccaat 60
aactttcaaa taatgcacac atagtatcgc atggatcaaa ttccgtacat ttcaatatgg 120
<210> 274
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 274
aattaagaag tataacaaaa tcacatacat ttgttccacg gtttgaataa aatttccaat 60
aactttcaaa taatgcacac atagtatcgc atggatcaaa ttccgtacat ttcaatatgg 120
<210> 275
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 275
atgaaagtta caatatgcat gccatattga cacctattca atagataaaa tctaggaaaa 60
tcttttttgt gaatactatt tatactggaa tgcaaattca cataaaaata cttcctttaa 120
<210> 276
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 276
ataaaatcta ggaaaatctt ttttgtgaat actatttata ctggaatgca aattcacata 60
aaaatacttc ctttaaagca tgttctattt cacacaagaa attaaatgtg agctactttt 120
<210> 277
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 277
gttctatttc acacaagaaa ttaaatgtga gctactttta aaattgcaag ctttattttt 60
aatcaaacca attcaatttt aagtttttag atcattaagt ctcatacaac ttcctctaat 120
<210> 278
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 278
catcgacagg gttttattgt tacatttggc cttaacctta aaaaacaaat ttgtttacat 60
ttcatattta aatgggacat tttaaaccct gagtaaaaag acatattttt acaagtccag 120
<210> 279
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 279
ttttattgtt acatttggcc ttaaccttaa aaaacaaatt tgtttacatt tcatatttaa 60
atgggacatt ttaaaccctg agtaaaaaga catattttta caagtccagc tgtaacaatt 120
<210> 280
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 280
tgcagtgctt ttattagata aaaactattg ttaacgtttt gactttttag aatatactgt 60
ttagaaggtt aatgcttttt catgacttta aaagtttcta aatgtatttt attagtatct 120
<210> 281
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 281
tgtttagaag gttaatgctt tttcatgact ttaaaagttt ctaaatgtat tttattagta 60
tctaagtaaa aattctagat ttctatatgg atattataaa aacacctctt ctttagactg 120
<210> 282
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 282
tctatatgga tattataaaa acacctcttc tttagactgt ttatttcacc ttgatcataa 60
aaaatcattg aatactacat tcaagataat ttttctttct tggctttggg ctattgtctt 120
<210> 283
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 283
ccttgatcat aaaaaatcat tgaatactac attcaagata atttttcttt cttggctttg 60
ggctattgtc ttttcaacct taaaagttaa aattattgtt ttcctatatg taatgatact 120
<210> 284
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 284
tgtctgattt tttctgcacg tcctttactt ttctgtattc gttctaaagt tgaacacaaa 60
tctgcaaaag gaacgtgaga tgcaacagtt tgtgaagttt gtgaggcagc catcaaagcg 120
<210> 285
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 285
gcttgggtct agatgaagag cacagcatca ggaggccagg cttctaatgc ggcgcagtct 60
acagcgctgt ggactcggca actcccatca cctgccgctg cacaaacacc ctgcttgctg 120
<210> 286
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 286
cccagcctca gtctctccaa ctgagttcct gcctgcctgc ctttgctcag actgtttgcc 60
ccttactgct cttctaggcc tcattctaag ccccttctcc aagttgcctc tccttatttc 120
<210> 287
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 287
attgtgccgg cacatgaatg caccaggtgt tgaagtggag gaattaaaaa gtcagatgag 60
gggtgtgccc agaggaagca ccattctagt tgggggagcc catctgtcag ctgggaaaag 120
<210> 288
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 288
gtcttgcttt taagtccaaa gcctgagccc accaaactct cctacttctt cctgttacaa 60
attcctcttg tgcaataata atggcctgaa acgctgtaaa atatcctcat ttcagccgcc 120
<210> 289
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 289
acagctaatg agtggaggaa gagagacact tgtgtacacc acatgccttg tgttgtactt 60
ctctcaccgt gtaacctcct catgtcctct ctccccagta cggctctctt agctcagtag 120
<210> 290
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 290
tcctcattcc agatctgcaa gattgtaaga cagcctgtgc tccctcgctc cttcctctgc 60
attgcccctc ttctccctct ccaaacagag ggaactctcc tacccccaag gaggtgaaag 120
<210> 291
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 291
aaaaaggtta ttggttggca gttcagccaa tgagcgggcc tgttactagt ttgcggcatc 60
ctgtggtata ggggaagcgc tccgggcctg gaatccctac gcgtcccttt gggtttagca 120
<210> 292
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 292
ttaagtatga cctgtcagcc tctacattct ctcctgacgg aagagttttt caagttgaat 60
atgctatgaa ggctgtggaa aatagtaggt aagaaacatt taaccaggta ttacatgtct 120
<210> 293
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 293
ctccttgttt cagtacagct attggaatca gatgcaaaga tggtgttgtc tttggggtag 60
aaaaattagt cctttctaaa ctttatgaag aaggttccaa caaaagactt tttaatgttg 120
<210> 294
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 294
tagcaggttt gttggcagat gctcgttctt tagcagacat agcaagagaa gaagcttcca 60
acttcagatc taactttggc tacaacattc cactaaaagt aagttgataa catattgagg 120
<210> 295
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 295
aataagctct tctgcttccc tccatagcat cttgcagaca gagtggccat gtatgtgcat 60
gcatatacac tctacagtgc tgttagacct tttggctgca ggtaagaaat tttgtgaatt 120
<210> 296
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 296
attgccatgg tttaagctgt ttgtatactt tcatgcagtt tcatgttagg gtcttacagt 60
gtgaatgacg gtgcgcaact ctacatgatt gacccatcag gtgtttcata cgtgagtaat 120
<210> 297
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 297
ttttttctaa atagggttat tggggctgtg ccatcggcaa agccaggcaa gctgcaaaga 60
cggaaataga gaagcttcag gtaataatta atgcttgaat ttttactatg tcgtcatcct 120
<210> 298
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 298
acaagtggaa aatgttcttc tgatgaacag tatacatttt attttctata gatgaaagaa 60
atgacctgcc gtgatatcgt taaagaagtt gcaaaaatgt aagttgaaat ttttcttacc 120
<210> 299
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 299
tggaggttac caaaatctta cctttccctt ttctattcta gaatttacat agtacatgac 60
gaagttaagg ataaagcttt tgaactagaa ctcagctggg ttggtgaatg taagttattt 120
<210> 300
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 300
tactcaattt aaaattcatt tacacatgtg gcttaattta cagtaactaa tggaagacat 60
gaaattgttc caaaagatat aagagaagaa gcagagaaat atgctaaggt aagccacagc 120
<210> 301
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 301
atgatgataa tatgtaacat ttactccagc atctattgta ttttaaattt ctactccagt 60
ccaatgtaac tatttagccc tggattatac atactgtcca attttcatta aatttttgtc 120
<210> 302
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 302
cagtagcagg tgccatccgc ctccgccatg acaacagaca cattgatgtg ggtgggttta 60
cccgccatgc ggtcgatggt cttctgtgtg aaggccagcg gcagggcctc gtggcccacc 120
<210> 303
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 303
tcctgtgacc cctgcagcca gcgaaccagc acatccttgg ggctgaagcc acgtgccagg 60
cacgtcagcg tcaccagctc gttcagggcc agctcctccg acggcggcgg cagcaggtgg 120
<210> 304
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 304
ggattttgtg atgttggcgg ttagtggggt cttcaactcg gggtgggcag cagtgcaggt 60
gaaggtctcc ccatggttcc atggctgggc acagccaggc aggacactgg acacgctgta 120
<210> 305
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 305
tccgctttcg ctccaggtca cactgagtgg ctcctggggg aagaagccct ggaccaggca 60
tgcgacgacc acgttcccat cttggggggt gctgtcgagg ctcagcggga agaccttggg 120
<210> 306
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 306
cctcgttgtg cagccactgc accgagatgt cctcaggcat gaagttctgg atcaggcagg 60
cgagggtgcg cttgtcccgg ctccccggcc actccggcgt cgcaaacgca tagacttccg 120
<210> 307
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 307
aggttcacgg tccccttgct gggtgccagg tccaccacca gacaggtgat cgtgggcgac 60
ttgcggatga acaggtcgaa cgggctgggc cggcttaggt aggcgctcac ccctctcggg 120
<210> 308
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 308
atagtccctg gggtgtaccc agagacgagg cacaggagct ggatggtcgg ggggaagtgc 60
ccgccgccgt cgcaggacga ctgtaagatc ttcacggtgg gcggggtgaa gtccctggag 120
<210> 309
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 309
ggagcctgtg tcccaggtca ccatcaccgg ctccgggaag tagcccgtgg ccaggcagcc 60
cagagtcacg gaggtggcat tggagggaat gtttttgcag cagcgggtca aggggaagac 120
<210> 310
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 310
tctcccactc cacggcgatg tcgctggggt agaagccttt gaccaggcag gtcaggctga 60
cctggttctt ggtcatctcc tcctgggatg ggggcagggt gtacacctgt ggctctcggg 120
<210> 311
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 311
aactggacct cggggtcttc ctggctcacg tccaccacca cgcacgtgac ctcaggggtc 60
cgggagatca tgagagtgtc cttgggtttt ggggggaaca ggaagactga tggtcccccc 120
<210> 312
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 312
ctggagggcg aggcctgggt tggcttacct gggcatgatg ggcatggggg accatatttg 60
gactctgcag agagaagatt gggagttact cagatctggg aggagagaag gtgtctgagc 120
<210> 313
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 313
aactctcttg tccaccttgg tgttgctggg cttgtgatct acgttgcagg tgtaggtctt 60
cgtgcccaag ctgctggagg gcacggtcac cacgctgctg agggagtaga gtcctgagga 120
<210> 314
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 314
catttacccg gagacaggga gaggctcttc tgtgtgtagt ggttgtgcag agcctcatgc 60
atcacggagc atgagaagac gttcccctgc tgccacctgc tcttgtccac ggtgagcttg 120
<210> 315
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 315
aactggacct cggggtcttc gtggctcacg tccaccacca cgcacgtgac ctcaggggtc 60
cgggagatca tgagggtgtc cttgggtttt ggggggaaga ggaagactga cggtcctgcc 120
<210> 316
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 316
tactctaggg cacctgtccc gccttgagct ggagggcgag gcctgggctg gcttacctgg 60
gcacggtggg cactcgacac aacatttgcg ctctgcagag agaagattgg gagttactcg 120
<210> 317
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 317
aactgtcttg tccaccttgg tgttgctggg cttgtgatct acgttgcagg tgtaggtctg 60
ggtgccgaag ttgctggagg gcacggtcac cacgctgctg agggagtaga gtcctgagga 120
<210> 318
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 318
gttccacgac accgtcaccg gttcggggaa gtagtccttg accaggcagc ccagggccgc 60
tgtgctctcg gaggtgctcc tggagcaggg cgccaggggg aagaccgatg ggcccttggt 120
<210> 319
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 319
taccccgggg acagggagag gctcttctgc gtgtagtggt tctgcagacc ctcatgcatc 60
acggagcatg agaagacgtt cccctgctgc cacctgctct tgtccacggt gagcttgcta 120
<210> 320
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 320
acttgacctc agggtcttcg tggctcacgt ccaccaccac gcacgtgacc tcaggggtcc 60
gggagatcat gagggtatcc ttgggttttg gggggaagag gaagactgac ggtcccccca 120
<210> 321
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 321
ggcacctgtc ccgccttgag ctggagggcg aggcctgggc tggcttactt gcacatggtg 60
ggcatgtgtg agttgtgtca caacatgggg ttttgggctc tgcagagaga agattgggag 120
<210> 322
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 322
tcttgtctat ccgcgagggt ccaggcaggg tccagtgtct gggctcacgg gcattgagtg 60
tgcacctggc tggtgccacc tgcctcacct tagccccctc cctgccccaa agccaaagtc 120
<210> 323
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 323
cagtagcagg tgccgtccac ctccgccatg acaacagaca cattgacatg ggtgggttta 60
cccgccaagc ggtcgatggt cttctgtgtg aaggccagcg gcagggcctc gtggcccacc 120
<210> 324
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 324
tgcacgtgag gttcgcttct gaacctaaga gcaggtcctc gagggccggt cggtgcagtg 60
acagtcgggg gtggcagcat gagggagatg gggtaggtgg agttgaggga gatggggtag 120
<210> 325
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 325
tgggcagggc acagtcacat cctggctggg attcgtgtag tgcttcacgt ggcatgtcac 60
ggacttgccg gctaggcact gtgtggccgg cagggtcagc tggctgctcg tggtgtacag 120
<210> 326
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 326
cctcgttgtg cagccactgc accgagatgt cctcaggcat gaagttctgg atcaggcagg 60
tgagggtgcg cttgtcccgg ctccccagcc actccggcgt cgcaaacgca tagacttccg 120
<210> 327
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 327
gctggtcttg gtcgtggacc gcacgagggc cctgggcagg tgggggtggg tcaccctgca 60
ctggtaggtc tccccttcga tccagtctcg ggtgcccacc ggcagggtgg acgtgacggt 120
<210> 328
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 328
tctgtgtgta gtggttgtgc agagcctcat gcatcacgga gcatgagaag acgttcccct 60
gctgccacct gctcttgtcc acggtgagct tgctgtagag gaagaaggag ccgtcggagt 120
<210> 329
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 329
aacttgacct cagggtcttc gtggctcacg tccaccacca cgcatgtgac ctcaggggtc 60
cgggagatca tgagggtgtc cttgggtttt ggggggaaga ggaagactga cggtcccccc 120
<210> 330
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 330
ctagggcacc tgtcccgcct tgagctggag ggcgaggcct gggctggctt acctgggcac 60
ggtgggcatg tgtgagtttt gtcacaagat ttgggctctg cagagagaag attgggagtt 120
<210> 331
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 331
aactttcttg tccaccttgg tgttgctggg cttgtgattc acgttgcaga tgtaggtctg 60
ggtgcccaag ctgctggagg gcacggtcac cacgctgctg agggagtaga gtcctgagga 120
<210> 332
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 332
ggccctaggc cccctgccca atcatgttcc tatagtcggg gatgatggtc tgcttcaggt 60
ccaccaccga ggagaagatc cacttcacct gtaggcaagg cacagcacag gggtgagcga 120
<210> 333
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 333
gcggccgacc ttgaagaagg tgacggtggc actgtagcac acgcttaaca ggaagagtgt 60
gatgaagatg gtgatggtcg tccacagccc gtccagctcc ccgtcctgcg cctccgcaca 120
<210> 334
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 334
tctcccactc cacggcgatg tcgctggggt agaagccttt gaccaggcag gtcaggctga 60
cctggttctt ggtcatctcc tcccgggatg ggggcagggt gtacacctgt ggttctcggg 120
<210> 335
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 335
aactggacct cggggtcttc gtggctcacg tccaccacca cgcacgtgac ctcaggggtc 60
cgggaaatca taagggtatc cttgggtttt ggggggaaga ggaagactga cggtcctccc 120
<210> 336
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 336
ctagggcacc tgtcctgcct tgagctggag ggcgaggcct gggctggctt acctgggcac 60
cttgggcacg ggggaggtgt gtcacaagat ttgggctctg cagagagaag attgggagtt 120
<210> 337
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 337
ctagggctct tgtcccgcct tgagctggag ggcgaggcct gggctggctt acctgggcac 60
cgtgggcatg ggggaggtgt gtcacaagat ttgggctctg cagagagaag attgggagtt 120
<210> 338
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 338
ctagggctct tgtcctgcct tgagctggag ggcgaggcct gggctggctt acctgggcac 60
cgtgggcacg ggggaggtgt gtcacaagat ttgggctctg cagagagaag attgggagtt 120
<210> 339
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 339
gggctcttgt cccgccttga gctggagggc gaggcctggg ctggcttacc tgggcaccgt 60
gggcatgtgt gagttgtgtc accaagtggg gttttgagct ctgcagagag aagattggga 120
<210> 340
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 340
aactctcttg tccaccttgg tgttgctggg cttgtgattc acgttgcagg tgtaggtctg 60
ggtgcccaag ctgctggagg gcacggtcac cacgctgctg agggagtaga gtcctgagga 120
<210> 341
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 341
tcacagactt cctagagttc attcaacaag agtttattgt ggttgtactg tgagctcggc 60
cagagctgct gagtggcggg tgtggacgga tctggtccgg gatcatttca tggggccatg 120
<210> 342
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 342
gctgggcggg gctgggacac gcagcacact ccaggcccag aacgtggtgc tcctgggctg 60
tggagggggg cgtgcggggg caaacccaga agtgttcacc tcacgctggt cctccagcca 120
<210> 343
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 343
gggttctctc agcgccatca acctctgggg tgggaggctg ggatggttca gtgtgcaggt 60
gacggaggtc cccgcgttcc acaaggacct gggcagggtc agacggctgt gctggctctg 120
<210> 344
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 344
agtttagggc accaacggcc aactagttat tgggcaatag gtgttttgat agcccagggg 60
tcagaaaaaa cctggtgtct ttgtctctct ctcttcttgt tcctctttct ccttctcctt 120
<210> 345
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 345
tgtgcaggga aggggcttct cacctgtgtt acgggtggtg gctggggctg tggttgcctt 60
ggcgaggctg ccctctgctt ggggttgtgc agtgggcact gaggaggcct gtgcctttgg 120
<210> 346
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 346
tggccagcgg aagatctcct tcttactctt gctggcggtg tgctggacca cgcatttgta 60
ctcgccttgg cgccactgct ggaggggggt ggagagctgg ctgcttgtca tgtagtagct 120
<210> 347
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 347
ccctttgagt tcctctctct ggtctccgat gttcttctgt tgggatcatt tcacctacag 60
gcaacagaga cagtgtgaaa tgctttcccc gtggtcggga agggagccgg ggcagagatg 120
<210> 348
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 348
gccacagccg tgctaccttg aacaaggtga cggtggtact gtagaagagg ctcaggagga 60
agaggacgat gaaggtggag gcggtggccc acaggttctc aaagccctcc tcgtcggcgc 120
<210> 349
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 349
acctccaagc agagacagaa ggacaagcag agcctgggcc caaagccccg gtgccagcac 60
agcgcaggga gcaaactgct gcagggacag agtatccggc agggccctgg gagaatgttg 120
<210> 350
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 350
tccacacatg cctgtgtgct gcctgtatac gtgtggcctt gctttcagct ttctttctgg 60
aagcagtagg aggaatggca agtctgaggt cagcctgctg tgagcagctg cagggaattc 120
<210> 351
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 351
cccacaaaaa cccagccacc cagagacctt ctgtctccgg gcgtcacatg gaagctgact 60
gtccgtggcc ctgtcctgcc cttctcatgg aaccctctgc tggcctccca cgtaccccac 120
<210> 352
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 352
ccacgtaccc cacattctgg cctgacccct cagaagccag accactgtcg gcctgggaag 60
tccaactgca agcagacggc tgctaagtca cccccaggag tccaaaaacc ccggggggca 120
<210> 353
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 353
agagggggtg gtgaggactc acctgaggag acggtgacca gggttccctg gccccagggg 60
tcgaaccagt tgtcacattg tgacaacaat gccaggaccc caggcaagaa ctggcacccc 120
<210> 354
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 354
tgcagcaaaa cccttcagag ttaaagcagg agagaggttg tgaggactca cctgaggaga 60
cggtgaccag ggttccctgg ccccagtagt caaagtagtc acattgtggg aggccccatt 120
<210> 355
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 355
ggcagaagga aagccatctt acctgaagag acggtgacca ttgtcccttg gccccagata 60
tcaaaagcat cacacaggga cacagtccct gttcctgccc agacataaac ctgtgcccgt 120
<210> 356
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 356
cagccacaca gacccccggg ctgagaccca ggcagggagg ggtgacgttc ccagggagac 60
ggtggccggg ctgccctggc cccagtgctc caagcacttg tagccacact aaagcgcagg 120
<210> 357
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 357
gggggctgca gtgggactca cctgaggaga cagtgaccag ggtgccacgg ccccagagat 60
cgaagtacca gtagcacagc ctctgccctc ctgcttctcc catacaaaaa cacaccctcc 120
<210> 358
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 358
cctggcccag tacacctggc tccccgctat ccccagacag cagactcacc tgaggagacg 60
gtgaccaggg tgccctggcc ccagtgctgg aagtattcag ccacggtgag tcagccctga 120
<210> 359
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 359
acagtggttc tcagctcagc caaaaccctg cggctggtag ggggcctgtg gggctggggg 60
ctgatgtggc tgcggtctcc agggcgggtc gggtccaggg gcccccagca cctttgccag 120
<210> 360
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 360
cttctctggc tgggcctcca gcagtggccg ggagacagtt ttggacatag cttttctcac 60
agtggtagta gctcccacta tacccaccgt gactcggggc tgttcagaat ccacccaggc 120
<210> 361
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 361
ttgggatggg gtttctgtcc tgcccagtgt cattgtggta gccgctgcta tacccgactg 60
tgacacagac agcttcagaa acctcctggt ttgtttgggg gccttccctt gctgggctca 120
<210> 362
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 362
ctggggctgc gtggcagggg tctgtctact tggcctggtt gctgctatgg gcggcaccac 60
tgtggtaatt gtagccatct ctaccacggc ctggcacccc ctgacaataa ccacacctgg 120
<210> 363
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 363
gagccgagaa gtgtgcataa accctgcgag tccggtcagt ttttgctgct ggtttcatca 60
ctgtgggagt taccaccgta gtcacacagc aggagggccc ttcacaaaaa gcccctgagt 120
<210> 364
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 364
atgagttttt gatggactct gtgacactgt ggtagtaata accactacta tcatagtaat 60
accacagtga cacagacctc acttcaaacc taccgccagg cctggggaaa cccgggatgt 120
<210> 365
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 365
tcagtcccag gagtgggtgc gtttgcagta gggctttagg aatggggttg tgtcactgtg 60
ggaatagcag tcaccaccac aatatgctca cagtgacacg aacccccaca aaatcctcct 120
<210> 366
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 366
gccaggagtc agttttggac acagtttttc tcacggtggt cgttccagtt atacccactg 60
tgactcgggg ctgttcagaa tccgaccagg cgccctgagc tctggggcct cctgggtggg 120
<210> 367
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 367
ctccctgctc tctctgcttc cgctgacttg ggacggggtt tctggcctgg cgagtgtcac 60
tgtggtacca gccactgcta taccccactg tgatacagac agcttcagaa acctcctcgt 120
<210> 368
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 368
ctggggctgc acagcagggg cctgtctact tggcctggtt gctgctatgg gcagcaccac 60
tgtggtaacc atagctgtat ccaccacagt ctgacacccc ctgacaataa ccacacctgg 120
<210> 369
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 369
gtgtccggcc agtttttgct gctagtttca tcactgtggt agtcaccgta gtcacacagt 60
aggaggggcc ttcacaaaaa gcccctgagt gtgcccagcg gcctttccca cgcaggccct 120
<210> 370
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 370
ggtcccctgc ggggagggct gtggcatggg tttctgatgg accgtgtgat gctgtgggta 60
taacgataac tcccccaaac gtaatcataa taccacagtg acacagacct cacttcaaac 120
<210> 371
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 371
cagccccagg agtgggtgtg tttgcagtag ggctttggga atgggtctgt gtcactgtgg 60
gagtagcagc taccaccact acaatatcct cacagtgaca cgagccccca caaaatcctc 120
<210> 372
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 372
gccactggac agtttttgac gtagctattc tgacagtggt ggttccggtt atacccgctg 60
tgactcgggg ctgttcggaa tccgacgggg cgccctgagc tctggggcct cctgggtggg 120
<210> 373
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 373
ctccctgctc tctctgcttc cgctgacttg gaatggggtt tctggctggg tgagtgtcac 60
tgtggtacca gctgctgcta taccccactg tgacacagac accttcagaa acctcctggt 120
<210> 374
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 374
ttggcctggt tgctgctatg ggcggcacca ctgtggtaat cgtagccact atatccacca 60
cagtctgaca tcgcctgaca ataaccacac ctggaactgg aggcggggct gtcaggagga 120
<210> 375
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 375
gtttccagcc agtttttgcc actgggttca tcactatggt agttactgta gtcacacagc 60
aggagggccc ttcacaaaaa gcccgagtgt ggccagagac ctttcccacg caggccctgg 120
<210> 376
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 376
atgggttttt gatggactct gtgacactgt ggttataata actccccgaa ccatagtaat 60
accacagtga cacagacctc accccaaacc taccgcccag cctggggaaa cccgggatgt 120
<210> 377
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 377
atgggttttt gatggactct gtgacactgt ggttataata accagtcaaa atatcgtaat 60
accacagtga cacagacctc attctaaacc taccggcagg cctggggaaa cctgggatgt 120
<210> 378
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 378
agccccagaa gtggaatgcg tttgcagtag ggctttggga atggggctgt gtcactgtgg 60
gtatagcata caccattagt acaatatcct cacagtgaca cgagccccca caaaatcctc 120
<210> 379
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 379
gccaggagac cgttttggac gaagcttttc tcacagtggt agttccagtt atacccactg 60
tgactcgggg ctgttcagaa tccgacgggg cgccctgtgc tctggggcct cctgggtggg 120
<210> 380
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 380
ttgggatggg gtttctggcc tggcgagtgt cactgtggga cgagctgcta tactccactg 60
tgacacagac accttcagaa acttcctggt ttgtttgggg accttccctt gctgggctca 120
<210> 381
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 381
ctggggctgc acagcagggg cctgtctact tggcctggtt gctgctatgg gcagcaccac 60
tgtggtaacc atagctgtat ccaccacagt ctgacacccc ctgacaataa ccacacctgg 120
<210> 382
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 382
tgagcggaga agtgtgcata aaccttggga gtccggtcag tttttgctgc tgggttcatc 60
actgtggtag ttactgtagt cacacagtag gaggaccctt cacaaaaagc ccctgagtgt 120
<210> 383
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 383
atgggttttt gatggactct gtgacactgt gggtataata accactccaa aaatcgtaat 60
accacagtga cacagacctc accccaaacc taccgccagg cctggggaaa cccgggatgt 120
<210> 384
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 384
cagctccaga agtggaagcg tttacagcag ggctttggga atggggctgt gtcactgtgg 60
gcatagcagc tggtactact acaatatcct cacagtgaca cgagccccca caaaatcctc 120
<210> 385
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 385
cccctctctg gcgcggcctc cagcaggggc caggagagag ttttggacac agtttttctc 60
acggtggtcg ttccagttgt acccaccgtg actcggggct gttcagaatc tgccccggcg 120
<210> 386
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 386
ctcttgcaca gtaatacaca gccgtgtcct cgggagtcac agagttcagc tgcagggaga 60
actggttctt ggatgtgtct gggttgatgg ttattcgact tttcacagat actgcataat 120
<210> 387
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 387
acggcatctc cctgacactg accccatggg aggcccagca cgggcaggaa gatgaggaag 60
gagacagaca ttgtctggag ctctggtgac tgccctggtc agccagaatt cagcaggctc 120
<210> 388
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 388
caatatctaa attagctagc aaaactctac agggtgatta aaaaaaaaaa aaaaaaacaa 60
ctgtgaaggt gagaggtgca gtgagtcctt ggcagaggcc gtttgctcag ggaaagtaaa 120
<210> 389
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 389
ctctcgcaca gtaatacacg gccgtgtcgt cagatctcag cctgctcagc tccatgtagg 60
ctgtgctgat ggacgtgtcc ctggtcatgg tgacccagcc ctgaaacttc tgtgcatagt 120
<210> 390
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 390
ctggactgga ctcaatctct ttctcatcac tgggactagg gagcctctta cctgtggctg 60
ctgccaccaa gaagaggatc ctccaggtcc agtccatggt gaggaacgga gctctcaggg 120
<210> 391
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 391
cactcacagt aatacatgac cttgtccttg gctttcagat tggtcattgt aaggcagact 60
gcacttaaaa gggtgttgct tgagattgtt aatttatttg tactcatgga gagtaaccct 120
<210> 392
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 392
ctctcgcaca gtaatacaca gccgtgtctt cagatctcag gctgctcagc tccatgtagg 60
ctgtgctcgc ggatgtgtcc ctggtaatgg tgactctgcc ctggaacttc tgtgaatatt 120
<210> 393
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 393
cttgactggc ctcgatccct tcctcctcac tgggatttgg cagcccctta cctgtggctg 60
ctgccaccaa aaagaggatc ctccaggtcc agtccatggt gaggcgttgt gctctggggg 120
<210> 394
<211> 120
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 394
ggatcagagg cacctcccat acccccatgt ctgcagcctt gagacactca catctgggag 60
ctgccaccag gaggaggaag aaccacaggt gtttcatgtt cttgtgcagg aggtccatga 120
<210> 395
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 395
gactacatgg gacat 15
<210> 396
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 396
ggaacctacg acgta 15
<210> 397
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 397
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgatct 50
<210> 398
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 398
caagcagaag acggcatacg agatcggtct cggcattcct gctgaaccgc 50
<210> 399
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 399
aatgatacgg cgaccaccga g 21
<210> 400
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 400
caagcagaag acggcatacg a 21

Claims (10)

1. A capture probe for a gene associated with primary atopic disease, characterized in that: the primary atopic disease related gene is selected from two or more of FLG, CDSN, DSG1, DSP, SPINK5, PLCG2, ADGRE2, TPSAB1, FOXP3, IL2RA, TGFBR1, TGFBR2, WAS, MALT1, CARD11, WIPF1, ARPC1B, DOCK8, CARMIL2, ERBIN, ZNF341, RAG1, RAG2, DCLRE1C, ADA, IL7RA, CHD7, LIG4, ZAP70, STAT3, STAT1, STAT5B, JAK1, IL4RA, IL6ST, IL6R, PG 3.
2. The capture probe of claim 1, wherein: the capture probe is 1) or 2) as follows;
1) consists of two or more probes shown by SEQ ID No.1 to SEQ ID No.394 in a sequence table;
2) consisting of two or more of the derivatives of each probe of 1);
the derivative of each probe is the probe which is obtained by substituting and/or deleting and/or adding one or more nucleotides to each probe in the step 1) and has the same function.
3. A primary atopic disease related gene capture kit comprising the capture probe of claim 1 or 2.
4. The kit of claim 3, wherein: the kit also comprises at least one of the following components which are independently packaged as follows:
2) an enrichment buffer BL comprising human cot-1DNA, salmon sperm DNA, primers for blocking the linker sequence;
3) enrichment buffer HY comprising NaCl, sodium citrate, BSA and Tween 20;
4) library enrichment binding buffer solutions including NaCl, EDTA and Tris-HCl buffer solutions;
5) wash buffer WB1, including SDS and trisodium citrate buffer;
6) washing buffer WB2, comprising SDS and 10-fold dilution of the trisodium citrate buffer;
7) wash buffer WB3, including SDS and 2-fold dilution of the trisodium citrate buffer;
8) a library enrichment eluent which is NaOH aqueous solution;
9) a neutralization buffer NE which is a Tris-HCl buffer;
10) the PCR reaction solution comprises a primer for PCR amplification.
5. Use of the capture probe of claim 1 or 2 or the kit of claim 3 or 4 for the preparation of a product for capturing a gene associated with primary atopic disease in a sample to be tested.
6. Use of the capture probe of claim 1 or 2 or the kit of claim 3 or 4 for the preparation of a product for sequencing a gene associated with primary atopic disease in a sample to be tested.
7. Use of a capture probe according to claim 1 or 2 or a kit according to claim 3 or 4 for the manufacture of a product for detecting or predicting whether a subject has a primary atopic disease.
8. A method for capturing a primary atopic disease related gene in a test sample comprising the steps of:
capturing the genomic DNA of a sample to be tested by using the capture probe of claim 1 or 2 to obtain a capture fragment; so as to capture the primary atopic disease related gene in the sample to be tested.
9. A method for sequencing a primary atopic disease related gene or gene mutation site in a test sample, comprising the steps of:
1) capturing the genomic DNA of a sample to be tested by using the capture probe of claim 1 or 2 to obtain a capture fragment;
2) amplifying the capture fragment by using the PCR reaction solution in the kit of claim 3 or 4 to obtain a sequencing library;
3) and sequencing the sequencing library to obtain a sequencing result of the primary atopic disease related gene or the gene mutation site in the sample to be detected.
10. The capture probe of claim 1 or 2, the kit of claim 3 or 4, the use of any one of claims 5 to 7, the method of claim 8 or 9, wherein: the clinical phenotype of the primary atopic disease is selected from one or more of allergic dermatitis, urticaria, autoimmune diseases, combined immunodeficiency disease, hyper IgE syndrome, Omenn syndrome or skeletal abnormalities.
CN202110504283.3A 2021-05-08 2021-05-08 Capture probe and kit for primary atopic disease related gene and application thereof Pending CN113151447A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110504283.3A CN113151447A (en) 2021-05-08 2021-05-08 Capture probe and kit for primary atopic disease related gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110504283.3A CN113151447A (en) 2021-05-08 2021-05-08 Capture probe and kit for primary atopic disease related gene and application thereof

Publications (1)

Publication Number Publication Date
CN113151447A true CN113151447A (en) 2021-07-23

Family

ID=76874058

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110504283.3A Pending CN113151447A (en) 2021-05-08 2021-05-08 Capture probe and kit for primary atopic disease related gene and application thereof

Country Status (1)

Country Link
CN (1) CN113151447A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110029161A (en) * 2019-05-16 2019-07-19 中国人民解放军第四军医大学 CHARGE syndrome Disease-causing gene CHD7 mutation detection kit

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5591446A (en) * 1989-04-04 1997-01-07 Beiersdorf, A.G. Methods and agents for the prophylaxis of atopy
CN109371123A (en) * 2018-12-24 2019-02-22 中国医学科学院北京协和医院 For detecting the probe groups and kit of auto-inflammatory disease Disease-causing gene
CN109762882A (en) * 2018-12-24 2019-05-17 中国医学科学院北京协和医院 For detecting the probe groups and kit of primary immunodeficiency disease Disease-causing gene
CN111378736A (en) * 2018-12-28 2020-07-07 迈基诺（重庆）基因科技有限责任公司 Deafness related gene capturing kit and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5591446A (en) * 1989-04-04 1997-01-07 Beiersdorf, A.G. Methods and agents for the prophylaxis of atopy
CN109371123A (en) * 2018-12-24 2019-02-22 中国医学科学院北京协和医院 For detecting the probe groups and kit of auto-inflammatory disease Disease-causing gene
CN109762882A (en) * 2018-12-24 2019-05-17 中国医学科学院北京协和医院 For detecting the probe groups and kit of primary immunodeficiency disease Disease-causing gene
CN111378736A (en) * 2018-12-28 2020-07-07 迈基诺（重庆）基因科技有限责任公司 Deafness related gene capturing kit and application thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
JONATHAN J等: "Primary atopic disorders", 《J EXP MED》 *
JOSHUA D等: "Primary Atopic Disorders", 《ANNU REV IMMUNOL》 *
KEITH A SACCO等: "Gene–environment interactions in primary atopic disorders", 《CURR OPIN IMMUNOL 》 *
MARJORIE M等: "Follow up on atopy and the gastrointestinal tract - a review of a common association 2018", 《EXPERT REV GASTROENTEROL HEPATOL》 *
陈乡等: "全外显子测序技术检测在原发性免疫缺陷病诊断中的应用", 《国际药学研究杂志》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110029161A (en) * 2019-05-16 2019-07-19 中国人民解放军第四军医大学 CHARGE syndrome Disease-causing gene CHD7 mutation detection kit

Similar Documents

Publication Publication Date Title
US6605432B1 (en) High-throughput methods for detecting DNA methylation
KR102114412B1 (en) PREDICTING GASTROENTEROPANCREATIC NEUROENDOCRINE NEOPLASMS (GEP-NENs)
AU750183B2 (en) Prostate cancer gene
KR20170099939A (en) Sequencing control
US5945522A (en) Prostate cancer gene
AU779411B2 (en) Biallelic markers derived from genomic regions carrying genes involved in arachidonic acid metabolism
CA3050151A1 (en) Single nucleotide polymorphisms associated with cardiovascular disorders and statin response, methods of detection and uses thereof
KR20180093902A (en) Detection of fetal chromosomal anomalies using differentially methylated diene regions between fetuses and pregnant women
KR20150043566A (en) Use of markers in the identification of cardiotoxic agents
CN101668865A (en) Genetic susceptibility variants associated with cardiovascular disease
KR101019131B1 (en) Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases
KR101141543B1 (en) Polynucleotides derived from ALDH4A1, PINK1, DDOST, KIF17, LMX1A, SRGAP2, ASB3, PSME4, ANXA4, GMCL1, and MAP2 genes comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods using the same
CN106636344B (en) Gene detection kit for thalassemia based on second-generation high-throughput sequencing technology
KR20160059446A (en) Cancer panel for identification of genomic variations in cancer
US6797475B2 (en) Detection of polymorphisms in the human 5-lipoxygenase gene
CN111575379B (en) Kit for detecting 58 genes related to thyroid cancer and using method thereof
CN113151447A (en) Capture probe and kit for primary atopic disease related gene and application thereof
AU784761B2 (en) Biallelic markers related to genes involved in drug metabolism
KR20200004977A (en) Probes for detecting gene mutations for cancer, method for producing the same and method for detecting cancer using thereof
CN100516876C (en) Methods for diagnosing RCC and other solid tumors
CN108913761B (en) Kit for screening hereditary liver diseases
KR102458466B1 (en) Composition for determining the backfat thickness of a bovine including an agent capable of detecting or amplifying SNP and kit comprising the same
KR102480121B1 (en) Single nucleotide polymorphisms associated with trypanotolerance of African taurine breeds and their application
US20070292849A1 (en) Methods for Identifying Risk of Low Bmd and Treatments Thereof
KR101599753B1 (en) Primer for detecting egfr exon 21 l858r polymorphism and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20210723

RJ01 Rejection of invention patent application after publication