WO2002034936A9 - Novel s. pyogenes dna polymerase iii holoenzyme nucleic acid molecules and proteins - Google Patents

Abstract

S. pyogenes nucleic acid molecules encoding polC, dnaE, holA, holB, dnaX, dnaN, SSB, dnaG, dnaQ, dnaA and dnaB proteins, as well as nucleic acid molecules comprising oriC are provided. The encoded proteins are also provided. The nucleic acid molecules and proteins are useful for reconstituting replicases and polymerases for sequencing, amplification, and screening for compounds which modulate the function of the polymersase or replicase.

Description

NOVEL S. PYOGENES DNA POLYMERASE III HOLOENZYME NUCLEIC ACID MOLECULES AND PROTEINS

CROSS-REFERENCE TO RELATED APPLICATIONS This application priority under 35 U.S.C. § 119 from U.S. Application Ser. No.

60/244,023, filed October 27, 2000.

FIELD OF THE INVENTION The present invention relates to gene and amino acid sequences encoding DNA poly- merase III holoenzyme subunits and structural genes from gram-positive bacteria, hi particular, the present invention provides DNA polymerase III holoenzyme subunits of S. pyogenes. The present invention also provides antibodies and other reagents useful to identify DNA polymerase III molecules. The present invention also provides nucleic acid sequences for the origin of replication of S. pyogenes.

BACKGROUND OF THE INVENTION Like many other complex mechanisms of macromolecular synthesis, the fundamental mechanisms of DNA replication have been conserved throughout biology. The chemistry and direction of synthesis, the requirement for RNA primers, the mechanisms of semi- discontinuous replication with Okazaki fragments on the lagging strand and the need for well- defined origins are shared (Kornberg, A. and Baker, T. A. (1992) in DNA Replication, WH Freeman, New York). The basic features of the replicative apparatus from different origins are also shared. All replicases consist of a replicative polymerase that is distinguished from other polymerases primarily by its capability of participating in specific protein-protein interactions with other components of the replicative apparatus. All prokaryotic cells have at least three polymerases; eukaryotes have at least five. Yet, only a subset of these polymerases can function as the replicase catalytic subunit (Table I). In eukaryotes, it has been proposed that the δ polymerase is the leading strand polymerase and ε is the lagging (Burgers, P. M. J. (1991) J. Biol. Chem. 266: 22698-22706; Nethanel, T. Kaufmann, G. (1990) J. Virol. 64: 5912-5918), whereas, in E. coli, the α subunit of DNA polymerase III serves as the sole polymerization subunit. Another key replicase component is the β subunit, the so-called sliding clamp that confers high processivity (processivity is defined as the number of nucleotides inserted per template association-catalysis-dissociation event with the replicase). β subunits form a bracelet-shaped molecule that clamps around the DNA, permitting it to rapidly slide down DNA without dissociating. The clamp contacts the polymerase by protein-protein interactions thus tethering it to the template, ensuring high processivity. Two representative prokaryotic and eukaryotic sliding clamps are β and PCNA, respectively. The crystal structures of yeast PCNA and E. coli β are nearly super-imposable (Kong, X. P. (1992) Cell 69: 425-437; Krishna, T. S. et al. (1994) Cell 79: 1233-1243). In both bacteria and eukaryotes, a 5-protein complex is responsible for transferring the sliding clamp onto a primer-terminus in an ATP-dependent reaction (Lee, S. H. et al. (1991) J. Biol. Chem. 266: 594-602; Bunz, F. et al. (1993) Proc. Natl. Acad. Sci., U. S. A. 90: 11014-11018). Some of the subunits exhibit recognizable sequence homology between eukaryotes and both Gram-negative and Gram-positive prokaryotes, and would be expected to act by a similar mechanism (Carter, J. R. (1993) J. Bacteriol. 175: 3812-

3822; O'Donnell, M. et al. (1993) Nucl. Acids Res. 21: 1-3).

The DNA polymerase III holoenzyme is the replicative polymerase of E. coli. It is responsible for synthesis of the majority of the chromosome and is the most-studied and best- characterized bacterial replicative system to date (for a review, see Kefman, Z. and O'Donnell, M (1995) Annu. Rev. Biochem. 64: 171-200). The replicative role of the enzyme has been established both by biochemical and genetic criteria. Holoenzyme was biochemically defined and purified using natural chromosomal assays. Only the holoenzyme form of DNA polymerase III efficiently replicates single-stranded bacteriophages in vitro in the presence of other known replicative proteins (Wickner, W. and Kornberg, A. (1973) Proc. Natl. Acad. Sci., U. S. A. 70: 3679-3683; Hurwitz, J. and Wiclαier, S. (1974) Proc. Natl. Acad. Sci., U. S. A. 71 : 6-10;

McHenry, C. S. and Kornberg, A. (1977) J. Biol. Chem. 252: 6478-6484). Only the holoenzyme functions in the replication of bacteriophage λ plasmids and molecules containing the E. coli replicative origin, oriC. The holoenzyme contains 10 subunits: α, τ, γ, β, δ, δ',ε ,ψ ,χ and θ of 129,900; 71,000; 47,400; 40,600; 38,700; 36,900; 26,900; 16,600; 15,000 and 8,800 daltons, respectively.

Table I. Relationships of the Components of Replicative Enzymes

Component/Function E. coli Phage T4 Eukaryotes

DNA polymerase a Gene 43 polymerase δ (and possibly ε)

Sliding Clamp β Gene 45 protein PCNA

Clamp loading comDnaX, δ, δ', χ, Gene 44/62 comActivator 1 (RFC) plex Ψ plex

Single-stranded DNA SSB Gene 32 protein RFA binding protein

Primer generation DnaG primase Gene 61 protein Primase-α polymerase complex Genetic studies also support assignment of the major replicative role to the pol III holoenzyme. Temperature-sensitive mutations in dnaE, the structural gene for the E. coli α catalytic subunit, are conditionally lethal (Gefter, M. L. et al. (1971) Proc. Natl. Acad. Sci., U. S. A. 68: 3150-3153). Similarly, temperature-sensitive, conditionally lethal mutations have been isolated for the dnaN, dnaX and dnaQ genes that encode the β processivity factor, the DnaX proteins (τ and γ) and the ε proofreading exonuclease, respectively (Sakakibara, Y. and Mizukami, T. (1980) Mol. Gen. Genet. 178: 541-553; Chu, H. et al. (1977) J. Bacteriol. 132: 151-158; Henson, J. M. et al. (1979) Genetics 92: 1041-1059; Horiuch, T. et al. (1978) Mol. Gen. Genet. 163: 277-283). The structural genes for the final five holoenzyme subunits were identified by a reverse genetics approach (Carter, J. R. et al. (1993) J. Bacteriol. 175: 3812- 3822; Carter, J. R. et al. (1992) J. Bacteriol. 174: 7013-7025; Carter, J. R. et al. (1993) Mol. Gen. Genet. 241: 399-408; Carter, J. R. et al. (1993) Nucleic Acids Res. 21: 3281-3286; Carter, J. R. et al. (1993) J. Bacteriol. 175: 5604-5610; Dong, Z. et al. (1993) J. Biol. Chem. 268: 11758-11778; Xiao, H. et al. (1993) J. Biol. Chem. 268: 11773-11778). These were named holK-Ε for the δ, δ', χ, ψ and θ genes, respectively.

There are at least three distinct polymerases in E. coli, yet only the pol III holoenzyme appears to play a major replicative role. What are the special features of the pol III holoenzyme that confer its unique role in replication? Work to date suggests that the rapid elongation rate, high processivity, ability to utilize a long single-stranded template coated with the single- stranded DNA binding protein (SSB), resistance to physiological levels of salt and the ability to interact with other proteins of the replicative apparatus are all critical to its unique functions, hi contrast, other non-rep licative polymerases such as DNA polymerase I cannot substitute effectively for replicases either in vitro or in vivo (Kornberg, A. and Baker, T. A. (1992) in DNA Replication, WH Freeman, New York). This is because of their low processivity, their corresponding slow reaction rate, and their inability to interact with other components of the replication apparatus to enable catalysis of a coordinated reaction at the replication fork.

Multiple DNA polymerase informs — The DNA polymerase III holoenzyme can be biochemically resolved into a series of successively simpler forms. DNA polymerase III core contains the α catalytic subunit complexed tightly to ε (proofreading subunit) and θ. DNA polymerase III¹ contains core + τ (DnaX). DNA polymerase III* contains pol III' + the DnaX γ complex (γ,δ-δ',χψ). Holoenzyme is composed of pol III* + β. Processivity — Studies of the processivities of the multiple polymerase III forms have revealed individual contributions of subunits (Fay, P. J. et al. (1981) J. Biol. Chem. 256: 976- 983; Fay, P. J. et al. (1982) J. Biol. Chem. 257: 5692-5699). The multiple forms of DNA polymerase III exhibit strikingly different processivities. The core pol III has a low processivity (ca. 10 bases) in low ionic strength that decreases to being completely distributive (processivity

= 1) under more physiological conditions. Processivity is enhanced by addition of the τ sub- unit to form pol III'. Pol IIP achieves maximum processivity in the presence of physiological concentrations of spermidine, an agent that inhibits the core pol III. Addition of the γ complex (γδδ'χψ) to pol III' to form pol III* further increases processivity in the presence of single- stranded DNA binding protein (SSB). The holoenzyme exhibits a processivity orders of magnitude greater than any of its subassemblies. hi carefully controlled experiments with single- stranded phage DNA, the entire template (up to 8000 nucleotides) is synthesized in a single processive event in fewer than 15s at 30°C (Johanson, K. O. and McHenry, C. S. (1982) J. Biol. Chem. 257: 12310-12315) (1 min at 22°C Fay, P. J. et al. (1981) ibid.). For coupled replication fork systems where the holoenzyme acts with primosomal components, processivities of 150-

500 kb have been directly observed (Wu, C. A. et al. (1992) J. Biol. Chem. 267: 4064-4073). These products are synthesized at rates of 500-700 nt/s, permitting synthesis of 100,000 bases in ca. 3 min. Thus, a progression in processivities that parallels the structural complexity of the corresponding enzyme form is observed. For comparative purposes, the processivities of "repair-type" polymerases of the bacterial DNA polymerase I class are typically 15-50 bases

(Bambara, R. A. et al. (1978) J. Biol. Chem. 253: 413-423).

Initiation Complex Formation — To achieve high processivity, the holoenzyme requires ATP (or dATP) and primed DNA to form a stable initiation complex (Fay et al. (1981) ibid.). Initiation complexes can be isolated by gel filtration and, upon addition of dNTPs, polymerize a complete RFII (the abbreviations used are: PCR, polymerase chain reaction; Taq, Thermus aquaticus; Tth, Tltermus thermophilus; DTT, dithiothreitol; SSB, single-stranded DNA binding protein; RFII, replicative form 11— a duplex circle containing one nick at the site where replication is completed) in 10-15 seconds without dissociating (Wickner, W. and Kornberg, A. (1973) ibid.; Hurwitz, J. and Wickner, S. (1974) ibid.); Johanson, K. O. and McHenry, C. S. (1980) J. Biol. Chem. 255: 10984-10990). Initiation complex formation can be monitored experimentally as a conversion of replicative activity to anti-β IgG resistance (Johanson, K. O. and McHenry, C. S. (1982) ibid.; Johanson, K. O. and McHenry, C. S. (1980) ibid.), β participates in elongation; antibody resistance arises from β's immersion in the complex, sterically precluding antibody attachment. Consistent with this observation, it has been shown that a kinase recognition peptide fused to the carboxyl-terminus of β can be readily phosphorylated in solution but not in initiation complexes (Stukenberg, P. J. (1994) Cell 78: 877-887).

Structure of the β Sliding Clamp — The X-ray crystallographic structure of β, solved by Kuriyan, O'Donnell and coworkers (Kong, X. P. (1992) ibid.), provides a simple and elegant explanation for its function. The β dimer forms a bracelet-like structure, presumably with DNA passing through the central hole, permitting it to slide down DNA rapidly but preventing it from readily dissociating. Protein-protein contacts between β and other components of the replicative complex tether the polymerase to the DNA, increasing its processivity. A tightly clasped bracelet would not be expected to readily associate with DNA. This explains the need for an energy-dependent clamp-setting complex, the DnaX-complex, to recognize the primer terminus and open and close the β-bracelet around DNA.

DnaX Complex: The Apparatus that Sets the β Sliding Clamp onto Primed DNA — The DnaX protein contains a consensus ATP binding site near its amino-terminus (Yin, K. C. et al. (1986) Nucleic Acids Res. 14: 6541-6549) that is used to bind and hydrolyze ATP powering the setting of the β processivity clamp onto the primer-terminus, in concert with δ-δ'-χ-ψ. DnaX binds ATP with a dissociation constant of ca. 2 μM and is a DNA-dependent ATPase (Truchihashi, Z. and Kornberg, A. (1989) J. Biol. Chem. 264: 17790-17795; Lee, S. H. and Walker, J. R. (1987) Proc. Natl. Acad. Sci. U. S. A. 84: 2713-2717). The primer-terminus ap- pears to be the most active effector of the ATPase (Onrust, R. et al. (1991) J. Biol. Chem. 266:

21681-21686). DnaX (τ) binds the α subunit DNA polymerase III core and causes it to dimer- ize, forming the dimeric scaffold upon which other auxiliary proteins can assemble to form a dimeric replicative complex. In vitro, the τ subunit can readily form a "τ-complex" (τ-ψ-χ-δ- δ') that functions to load β onto primed DNA (Dallman, H. G. and McHenry, C. S. (1995) J. Biol. Chem. 270: 29563-29569; Onrust, R. et al. (1995) J. Biol. Chem. 270: 13348-13357;

Dallmann, H. G. et al. (1995) J. Biol. Chem. 270: 29555-29562). The stoichiometry of the DnaX complexes has been determined, and it has been found that the complex has 3 copies of the DnaX protein and 1 each of the ancillary subunits (DnaX₃διδ'ιχιψι) (Prichard, A. and McHenry, C. S. (2000) unpublished results). Structure of the DNA polymerase III holoenzyme- Figure 1 illustrates the current working hypothesis for holoenzyme subunit-subunit interactions, α and ε form an isolable complex upon mixing (Maki, H. and Kornberg, A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84; 4389- 4392). The structural gene for ε has also been found to suppress dnaE (a) mutations (Mauer, R. et al. (1984) Genetics 108; 25-38). Suppressor mutations most likely arise through modification of the α subunit that interacts directly with the suppressed mutant gene product. Pol III core (αεθ) is isolable (McHenry, C. S. and Crow, W. (1979) J. Biol. Chem. 254: 1748-1753). DnaX (τ) can be isolated in a complex with pol III core (McHenry, C. S. (1982) J. Biol. Chem. 257: 2657-2663). Suppressor data also suggest an interaction between DnaX and β (Engstrom,

J. et al. (1986) Genetics 113: 499-516), although a direct interaction has not yet been demonstrated biochemically. DnaX in the presence of δ and δ' can transfer β to primed DNA to form a preinitiation complex Bryan, S. et al. (1990) in DNA Replication and Mutagenesis, American Society for Microbiology, Washington, D.C). Suppressor data indicate an interaction between β and α Kuwabara, N. and Uchida, H. (1981) Proc. Natl. Acad. Sci. U. S. A. 78: 5764-5767), a notion supported by the ability of β to interact with and increase the processivity of core pol III Laduca, R. J. et al (1986) J. Biol. Chem 261: 7550-7557) and the observation of an interaction between β and the carboxyl-terminal domain of the α catalytic subunit (Kim, D. R. and McHenry (1996) J. Biol. Chem. 271: 20699-20704). Genetic evidence for α-α interaction and for the dimeric nature of pol ffl holoenzyme was obtained through interallelic complementation between dnaE_ϊ026 and dnaE_4S6 or dnάB_su (Bryan, S. et al. (1990) ibid.); if this interaction occurs, it must be weak and require the presence of other subunits, since no α-α interaction is seen in vitro, χ and ψ have been isolated in a complex with DnaX (Olson, M. W. et al. (1995) J. Biol. Chem. 270: 29570-29577; O'Donnell, M. and Studwell, P. S. (1990) J. Biol. Chem. 265: 1179-1187). δ and δ' can interact weakly by themselves in solution and together can interact with DnaX (Dallman, H. G. and McHenry, C. S. (1995) J. Biol. Chem. 270: 29563- 29569; Olson, M. W. et al. (1995) ibid.; Onrust, R. and O'Donnell, M. (1993) J. Biol. Chem. 268: 11766-11772). ψ and δ' are apparently the subunits that interact directly with DnaX (Onrust, R. et al. (1995) J. Biol. Chem. 270: 13348-13357). A direct δ-β interaction has been de- tected (Naktinis, V. et al. (1995) J. Biol. Chem. 270: 13358-13365). There are three copies of

DnaX protein in holoenzyme (Prichard, A., Dallman, H. G, Glover, B. and McHenry (2000) unpublished results).

DNA Replication in Gram-positive Organisms - To date, DNA replication in Gram- positive organisms has received considerably less attention. Of the elongation components of

B. subtilis, one of the earliest Gram-positive organisms studied, only the basic DNA polymerase III catalytic subunit has been purified (Low, R.L. et al. (1976) J. Biol. Chem. 251 : 1311-1325; Hammond, R.A. et al. (1991) Gene 98: 29-36, and references therein). This en- zyme shows sequence similarity to the E. coli DNA polymerase III, but differs in that the 3'- 5' proofreading activity is contained within the same polypeptide chain. Examination of the amino acid sequence of B. subtilis pol III reveals sequence with close similarity with the E. coli ε proofreading subunit inserted near the amino-terminus (Barnes, M. et al. (1992) Gene 111: 43-49). With the completion of several genomic sequences from Gram-positive organisms, it became apparent that a second DNA polymerase III α subunit exists with the sequence more closely resembling the E. coli-like enzyme (Koonin, E. V. and Bork, P. (1996) Trends Biochem. Sci. 21 : 128-129). Recently, a similar situation has been observed in the more distant Thermotoga maritima (Huang, Y. P. and Ito, J. (1998) Nucleic Acids Res 26: 5300-5309). Pritchard (Pritchard, A. and McHenry, C. S. (1999) J. Mol. Biol. 285: 1067-1080) and Ito

(Huang, Y. P. and Ito, J. (1998) supra) have referred to the prototypical E. cob-like and B. sub- tt/is-like polymerases type I and II, respectively, a convention that will be used in this application. A type II pol III, where it exists, is always present as the second pol Ill-like enzyme. This raises important questions regarding the mechanistic contributions of each polymerase. In B. subtilis the prototypical Gram-positive type II pol LΪI is clearly essential for cell viability.

Hydroxyphenylazopyrimidines inhibit this enzyme and drug-resistance maps to the structural gene for the type II enzyme (Love, E. et al. (1976) Mol. Genet. 144: 313-321). However, D. Ehrlich and colleagues have recently shown that the type I pol III is also required for cell viability (personal communication). The genomic sequences of B. subtilis and other related organisms reveal the likely structural genes for the DNA polymerase III holoenzyme auxiliary subunits; the products of these putative structural genes remain to be experimentally verified. B. subtilis homologs of dnaX, holB and dnaN are also apparent and documented by "The Bacillus subtilis Genome Sequencing Project", coordinated through Institut Pasteur, Paris, France. Of the components ab- solutely essential for E. coli holoenzyme activity, only hoi A, the structural gene for the δ sub- unit, remains to be identified. The sequence of this subunit is not well conserved even in organisms closely related to E. coli. Thus, it is likely present in B. subtilis and related organisms, but not detectable by homology searching programs. The gene for single-stranded DNA binding protein, ssb, is apparent. Primosomal components are more divergent. The primase itself is apparent from sequence examination and has been documented in the genomes of B. subtilis and other organisms. Ogasawara and colleagues detected a similarity between the E. coli dnάB gene and the B. subtilis dnaC gene (Table II), an assignment that is supported by mutant phenotype (Saka- moto, Y. et al., (1995) Microbiology 141: 641-644). The analog of the E. coli dnaC gene required for assembly of the replicative helicase onto DNA is less apparent. It appears that the Gram-positive dnal is the best candidate (Koonin, Ε. V. (1992) Nucleic Acids Res. 20: 1997). With respect to Table II, Counterparts for all of the noted B. subtilis genes are apparent in the Streptococcus pyogenes genome database maintained by the Streptococcal Genome Sequencing Project at the University of Oklahoma. Table II Ε. coli and Corresponding B. subtilis Replication Proteins

E coli subunit/function B. subtilislS. homolgene pyogenes ogy gene with

E. coli

Elongation Components dnaE α / replicative polymerase dnάE-type I strong polC α + ε / replicative polymerase dnaE-type 11° moderate dnaQ ε / 3'— >5' proofreading exonuc lease dinG moderate⁶ holE θ / no known function not known dnaX γ, τ / ATPase that loads β₂ onto DNA dnaX strong hoi A δ / binds β, essential part of DnaX complex not known holB δ' / essential part of DnaX complex holB strong holC X / nonessential-interacts with SSB not known holD ψ / nonessential-increases the affinity of DnaX for δ' not known dnaN β / processivity factor dnaN strong ssb SSB / single stranded DNA binding protein ssb strong dnaG primase / RNA priming dnaG strong

Origin initiation proteins dnaA origin binding and initiation protein dnaA strong dnaB replication fork helicase dnaG weak dnaQ, accessory factor, loading DnaB helicase onto DNA dnal weak interacts with Dnal in B. subtilis dnaB interacts with DnaA in B. subtilis dndD ^a Counterparts for all of the noted B. subtilis genes are apparent in the Streptococcus pyogenes genome database (available at the University of Oklahoma's Advanced Center for Genome Technology - ACGT web site). ^b referred to as dnaE in B. subtilis database ^c referred to as polC in B. subtilis database. ^d The dinG was named by its weak alignment with the dinG product of E. coli; however, E. coli dinG lacks two of the critical acids and histidines found in the ε proofreading subunit of all bacteria. Thus, the dinG assignment in B. subtilis may not be correct; it may instead be a novel class of d aQ found associated with the type I DNA polymerase III. ^eRefers to alignment of amino-terminal portion of B. subtilis and S. pyogenes dinG with E. coli dnaQ.

Using computer programs that compare DNA sequences, one can observe a family of proteins, including E. coli DnaC and B. subtilis Dnal that align. The alignment is weak however, and the tentative assignment will require experimental verification. B. subtilis appears to be more complex than E. coli in that two other genes, dnaB and dndD, have been implicated in the initiation of B. subtilis replication that have no apparent E. coli counterparts. Two hybrid screens have revealed a strong B. subtilis DnaB-Dnal interaction and a DnaA-DnaD interaction (Moriya, S. et al. (1999) Plasmid 41: 17-29).

A clear homolog of the origin-specific DnaA protein exists in B. subtilis. This protein is highly conserved among bacteria as is the consensus 9-mer DnaA binding box. The origin of Gram-positive bacteria appears to be more complex than the origin of E. coli. In E. coli, the origin is composed of one cluster of DnaA binding boxes upstream of the dnaA gene. In B. subtilis, instead of one cluster of DnaA boxes, there are three: two upstream of the dnaA gene and one downstream (Moriya, S et al. (1992) Molec. Microbiol. 6: 309-315; Moriya, S. et al. (1999) supra). For origin function, two DnaA box clusters are required, the one immediately upstream of dnaA and the one downstream, hiitiation of replication occurs in the downstream cluster, but interaction with the upstream region is necessary. Loop formation showing DnaA mediated interactions of the upstream and downstream element have been documented in vitro (Krause, M. et al. (1997) J. Mol. Biol. 274: 365-380). An in vitro replication system has been developed that is dependent on the B. subtilis origin composed of the two DnaA box clusters (Moriya, S. et al. (1994) Mol. Microbiol. 12: 469-478). Antibodies directed against the B. subtilis DnaA and DnaB proteins inhibit the system. Analogous findings for Staphylococcus aureus origin structure and function, including the requirement for only the first upstream DnaA cluster and the downstream cluster, were presented at the 1999 DNA Replication Keystone symposium (May, Ε. et al. (1999) in abstract book for Molecular Mechanisms in DNA Replication and Recombination Meeting, Keystone Symposia, Taos, New Mexico, February

16-22). Thus, it is likely that related Gram-positive bacteria have the same origin structure and conserve the same replication initiation mechanism.

DNA replication in Streptococcus pyogenes (S. pyogenes) - S. pyogenes is a clinically important Gram-positive pathogenic bacterium causing chronic infections like tonsillitis and erysipelas in humans. Rheumatic fever and glomerulonephritis are the results of more serious acute S. pyogenes infections (Alouf, J. Ε. (1980) Pharmacol. Ther. 11 : 661-717). A worldwide increase in serious systematic and toxic S. pyogenes (and other pathogenic Gram-positive bacteria) has been reported in the last 20 years (Nowak, R. (1994) Science 264, 1665). An under- standing of replication in S. pyogenes and other Gram-positive bacteria would allow the development of new agents to combat this serious health threat.

Accordingly, it is an object of this invention to address the relative roles of the two DNA polymerase Ills in Gram-positive bacteria. Recently, the existence of two pol III genes and gene products in S. pyogenes has been continued by another laboratory (Brack, I. and O'Donnel, M. (2000) J. Biol. Chem. 275: 28971-28983). In addition, the existence and functional role of holoenzyme subunits τ, δ, δ' as well as SSB from the same organism have also been demonstrated (Brack, I. and O'Donnell, M. (2000) ibid.).

BRIEF SUMMARY OF THE INVENTION The present invention relates to gene and amino acid sequences encoding DNA polymerase III holoenzyme subunits from S. pyogenes, S. pyogenes genes and nucleic acid molecules, including those that encode such proteins and to antibodies raised against such proteins. The present invention also includes methods to obtain such proteins, nucleic acid molecules and antibodies. Furthermore, the present invention is directed to nucleic sequences encoding the S. pyogenes origin of replication, and methods to obtain the sequence.

The present invention provides an isolated S. pyogenes DNA polymerase type I sub- unit protein represented by SEQ ID NO:3 and an amino acid sequence having at least 95% se- quence identity to an amino acid sequence represented by SEQ ID NO:3, a polypeptide encoded by a nucleic acid molecule represented by SEQ LD NO:l, or a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ JD NO: 1. In some embodiments the polypeptide is capable of extending primed DNA in a gap-filling polymerase assay. The present invention also provides the isolated nucleic acid molecule represented by SEQ ID NO: 1 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ LD NO:l.

An isolated bacterial DNA polymerase type II subunit protein, wherein the type II a subunit protein represented by SEQ LD NO: 6, an amino acid sequence selected from the group consisting of an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ID NO: 6, a polypeptide encoded by a nucleic acid molecule represented by SEQ ID NO:4, or a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO:4. In some embodiments the polypeptide is capable of extending primed DNA in a gap-filling polymerase assay. The present invention also provides an isolated nucleic acid molecule represented by SEQ ID NO:4 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO:4. h another embodiment, DNA polymerase III type II α-subunit has a molecular weight of about 165 kDa as determined by Tris-glycine SDS PAGE. The present invention further provides isolated bacterial DNA polymerase β subunit, wherein the β subunit, represented by SEQ ID NO:9, amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ID NO: 9, an isolated polypeptide encoded by a nucleic acid molecule represented by SEQ ID NO:7, or a polypeptide en- coded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO:7. hi some embodiments, the polypeptide is capable of stimulation of the processivity of the DNA polymerase in a processivity stimulation assay. The invention also provides an isolated nucleic acid molecule represented by SEQ ID NO: 7 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO:7. In another embodiment, the beta processivity factor has a molecular weight of about 39 kDa as determined by Tris-glycine SDS PAGE.

The invention also provides an isolated bacterial DNA polymerase DnaA protein, represented by SEQ ID NO: 12, an amino acid sequence an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ID NO: 12, a polypep- tide encoded by a nucleic acid molecule represented by SEQ ID NO: 10, or a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO: 10. In some embodiments, the polypeptide is capable of binding to dnaA boxes in a dnaA box binding assay. The invention also provides an isolated nucleic acid molecule represented by SEQ LD NO: 10 and a nucleic acid molecule having at least 85% ho- mology to a nucleic acid molecule represented by SEQ ID NO:10. hi another embodiment,

DnaA protein has a molecular weight of about 52 kDa as determined by Tris-glycine SDS PAGE.

The invention also provides an isolated bacterial DNA polymerase DnaX subunit protein, represented by SEQ LD NO: 15, an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ID NO:15, a polypeptide encoded by a nucleic acid molecule represented by SEQ LD NO: 13, or a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ LD NO: 13. In some embodiments the polypeptide is capable of stimulation of the processitivity of the DNA polymerase in a reconstitution assay. The invention also provides an isolated nucleic acid molecule represented by SEQ LD NO: 13 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO: 13.

The invention further provides an isolated bacterial DNA polymerase δ' subunit protein, represented by SEQ LD NO: 18, an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ID NO: 18, a polypeptide encoded by a nucleic acid molecule represented by SEQ ID NO: 15, or a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO: 15. In some embodiments, the isolated polypeptide of Claim 22, wherein the polypeptide is capable of stimulation of the processitivity of the DNA polymerase in a reconstitution assay.

The invention further provides an isolated nucleic acid molecule represented by SEQ ID NO: 15 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ LD NO: 15.

Other prefened DNA polymerase III proteins include amino acid sequence SEQ ID NO: 90, and amino acid sequence SEQ ID NO:91, as well as proteins that are encoded by nucleic acid molecules that are allelic variants of the nucleic acid molecules that encode proteins having any of those SEQ ID NO's.

In a further embodiment, the invention provides an isolated S. pyogenes origin of replication, represented by SEQ ID NO:22 and a nucleic acid molecule having at least 95% se- quence identity to a nucleic acid molecule represented by SEQ ID NO:22. In another embodiment, the nucleic acid molecule has at least 85% homology to the nucleic acid molecule represented by SEQ ID NO:22.

In further embodiments, the invention provides an antibody, wherein the antibody is capable of specifically binding to at least one antigenic determinant on the protein encoded by an an amino acid sequence selected from the group consisting of an amino acid sequence represented by SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO: 18, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:90, and SEQ ID NO:91; and an amino acid sequence selected from the group consisting of an amino acid sequence having at least 95% sequence identity to any of these amino acid sequences. The invention provides a method for producing anti-DNA polymerase III subunit antibodies comprising exposing an animal having immunocompetent cells to an immunogen comprising at least an antigentic portion of DNA polymerase III subunit, preferably an S. pyogenes type I subunit, an S. pyogenes type II subunit, an S. pyogenes β subunit, an S. pyogenes DnaA subunit, an S. pyogenes DnaX subunit, an S. pyogenes δ' subunit, an S. pyogenes SSB-1 subunit, or an S. pyogenes SSB-2 subunit.

The invention also provides a method for detecting an S. pyogenes DNA polymerase III subunit protein comprising providing in any order, a sample suspected of containing S. pyogenes DNA polymerase III, an antibody capable of specifically binding to at least a portion of the S. pyogenes DNA polymerase III subunit protein; mixing the sample and the antibody under conditions wherein the antibody can bind to the S. pyogenes DNA polymerase III; and detecting the binding.

The present invention also relates to fusion proteins and mimetopes of S. pyogenes DNA polymerase III proteins. Also included are methods, including recombinant methods, to produce proteins, mimetopes and antibodies of the present invention, hi one embodiment, the invention provides a recombinant molecule comprising at least a portion of an S. pyogenes DNA polymerase III holB nucleic acid molecule, at least a portion of an S. pyogenes DNA polymerase III holA nucleic acid molecule, and at least a portion of an S. pyogenes DNA poly- merase III dnaX nucleic acid molecule. Preferably, the holB, holA, and dnaX nucleic acid molecules are operably linked to a transcription control element.

The present invention also relates to recombinant molecules and recombinant cells that include at least a portion of an S. pyogenes DNA polymerase III nucleic acid molecule of the present invention. Also included are methods to produce such nucleic acid molecules, recom- binant molecules and recombinant cells. hi yet another embodiment, the invention provides a method of preparing an S. pyogenes clamp-loader complex, comprising providing a recombinant molecule comprising at least a portion of an S. pyogenes DNA polymerase III holB nucleic acid molecule, at least a portion of an S. pyogenes DNA polymerase III holA nucleic acid molecule, and at least a por- tion of an S. pyogenes DNA polymerase III dnaX nucleic acid molecule, providing a transcription control element operably linked to any of these nucleic acid molecules, expressing the nucleic acid molecules of a) to generate δ, δ', and T subunit proteins under conditions that promote the formation of the δδ'τ clamp-loader complex; and isolating the clamp-loader complex. The present invention also provides methods for detection of nucleic acid molecules encoding at least a portion of DNA polymerase III holoenzyme, or DNA polymerase III holoenzyme subunit in a biological sample comprising the steps of: a) hybridizing at least a portion of a nucleic acid molecule of the present invention to nucleic acid material of a biological sample, thereby forming a hybridization complex, and b) detecting the hybridization complex, wherein the presence of the complex conelates with the presence of a polynucleotide encoding at least a portion of DNA polymerase III holoenzyme or DNA polymerase III holoenzyme sub- unit in the biological sample, i alternative prefened embodiment of the methods, the nucleic acid material of the biological sample is amplified by the polymerase chain reaction. The present invention also provides methods for detecting DNA polymerase III holoenzyme or holoenzyme subunit expression, including expression of abnormal or mutated DNA polymerase III holoenzyme or holoenzyme subunit proteins or gene sequences comprising the steps of a) providing a test sample suspected of containing DNA polymerase III holoenzyme or DNA polymerase III holoenzyme subunit protein, as appropriate; and b) comparing test DNA polymerase III holoenzyme or holoenzyme subunit with quantitated DNA polymerase II holoenzyme or holoenzyme subunit in a control to detennine the relative concentration of the test DNA polymerase III holoenzyme or holoenzyme subunit in the sample, hi addition, the methods may be conducted using any suitable means to determine the relative concentration of DNA polymerase holoenzyme or holoenzyme subunit in the test and control samples.

The invention provides numerous methods to identify compounds that modulate various activities or functions of the S. pyogenes DNA polymerase III subunit proteins or assemblies, detailed in the following paragraphs. In prefened embodiments utilizing these methods, the S. pyogenes DNA polymerase III subunit protein of the method is encoded by a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:4, SEQ ID NO:7,

SEQ ID NO: 10, SEQ ID NO:13, SEQ ID NO:16, and SEQ ID NO:22; or a protein comprising a homologue of any of these proteins, wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay; or an isolated bacterial nucleic acid molecule which is fully complementary to any of these nucleic acid molecules.

The present invention also provides a method of screening for a compound that modulates the activity of a DNA polymerase III replicase, said method comprising contacting an isolated replicase with at least one test compound under conditions permissive for replicase activ- ity, assessing the activity of the replicase in the presence of the test compound, and comparing the activity of the replicase in the presence of the test compound with the activity of the replicase in the absence of the test compound, wherein a change in the activity of the replicase in the presence of the test compound is indicative of a compound that modulates the activity of the replicase, wherein said replicase comprises an isolated S. pyogenes DNA polymerase III subunit protein, hi prefened embodiments, the isolated S. pyogenes DNA polymerase III sub- unit protein is encoded by a nucleic acid molecule selected from the group consisting of SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, SEQ LD NO:16, and SEQ ID NO:22; and a protein comprising a homologue of any of these proteins, wherein the homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay and an isolated bacterial nucleic acid molecule which is fully complementary to any of the nucleic acid molecules recited. The present invention also provides a compound that modulates the activity of a DNA polymerase III replicase identified by any of these methods.

In some embodiments, the method comprises forming a reaction mixture that includes a primed DNA molecule, a DNA polymerase subunit, a candidate compound, a dNTP, and optionally, a member of the group consisting of a β subunit, a T complex, and both the β subunit and the T complex to form a replicase.

The present invention also provides a method of identifying compounds that modulate the activity of a DnaX complex and a β subunit in stimulating a DNA polymerase replicase comprising contacting a primed DNA (which may be coated with SSB) with a DNA polymerase replicase, a β subunit, and a T complex (or subunit or subassembly of the DnaX com- plex) in the presence of the candidate pharmaceutical, and dNTPs (or modified dNTPs) to fonn a reaction mixture, subjecting the reaction mixture to conditions effective to achieve nucleic acid polymerization in the absence of the candidate compound, and comparing the nucleic acid polymerization in the presence of the test compound with the nucleic acid polymerization in the absence of the test compound, wherein a change in the nucleic acid polymerization in the presence of the test compound is indicative of a compound that modulates the activity of a DnaX complex and a β subunit, wherein said 7 complex (or subunit or subassembly of the T complex) comprises an S. pyogenes DNA polymerase III subunit protein. The invention also provides a compound that modulates the activity of a DnaX complex and a β subunit in stimulating a DNA polymerase replicase identified by the methods. In a further embodiment, the invention provides a method to identify compounds that modulate the ability of a β subunit and a DnaX complex (or a subunit or subassembly of the DnaX complex) to interact comprising contacting the β subunit with the DnaX complex (or subunit or subassembly of the DnaX complex) in the presence of the compounds to form a reaction mixture, subjecting the reaction mixture to conditions under which the DnaX complex (or the subunit or subassembly of the DnaX complex) and the β subunit would interact in the absence of the compound, and comparing the extent of interaction in the presence of the test compound with the extent of interaction in the absence of the test compound, wherein a change in the interaction between the β subunit and the DnaX complex (or the subunit or subassembly of the DnaX complex) is indicative of a compound that modulates the interaction, wherein said DnaX complex (or subunit or subassembly of the DnaX complex) comprises an S. pyogenes DNA polymerase III subunit protein. The invention also provides a compound that modulates the ability of a β subunit and a DnaX complex to interact identified by these methods. The invention also provides a method to identify compounds that modulate the ability of a DnaX complex (or a subassembly of the DnaX complex) to assemble a β subunit onto a DNA molecule comprising contacting a circular primed DNA molecule (which may be coated with SSB) with the DnaX complex (or the subassembly thereof) and the β subunit in the presence of the compound, and ATP or dATP to form a reaction mixture, subjecting the reaction mixture to conditions under which the DnaX complex (or subassembly) assembles the β sub- unit on the DNA molecule absent the compound, and comparing extent of assembly in the presence of the test with the extent of assembly in the absence of the test compound, wherein a change in the amount of β subunit on the DNA molecule is indicative of a compound that modulates the ability of a DnaX complex (or a subassembly of the DnaX complex) to assemble a β subunit onto a DNA molecule, wherein the DnaX complex (or a subassembly of the DnaX complex) comprises an S. pyogenes DNA polymerase III subunit protein. Also provided is a compound that modulates the ability of a DnaX complex to assemble a β subunit onto a DNA molecule identified by this method.

In yet another embodiment, the invention provides a method to identify compounds that modulate the ability of a DnaX complex (or a subunit (s) of the DnaX complex) to disassemble a β subunit from a DNA molecule comprising contacting a DNA molecule onto which the β subunit has been assembled in the presence of the compound, to form a reaction mixture, subjecting the reaction mixture to conditions under which the DnaX complex (or a subunit (s) or subassembly of the DnaX complex) disassembles the β subunit from the DNA molecule absent the compound, and comparing the extent of assembly in the presence of the test compound with the extent of assembly in the absence of the test compound, wherein a change in the amount of β subunit on the DNA molecule is indicative of a compound that modulates the ability of a DnaX complex (or a subassembly of the DnaX complex) to disassemble a β subunit onto a DNA molecule, wherein the DnaX complex (or a subassembly of the DnaX complex) comprises an S. pyogenes DNA polymerase III subunit protein. Also included in the invention is a compound that modulates the ability of a DnaX complex to disassemble a β subunit from a DNA molecule identified by this method. The invention also provides a method to identify compounds that modulate the dATP/ATP binding activity of a DnaX complex or a DnaX complex subunit (e.g., T subunit) comprising contacting the DnaX complex (or the DnaX complex subunit) with dATP/ATP either in the presence or absence of a DNA molecule and/or the β subunit in the presence of the compound to form a reaction mixture; subjecting the reaction mixture to conditions in which the DnaX complex (or the subunit of DnaX complex) interacts with dATP/ATP in the absence of the compound; and comparing the extent of binding in the presence of the test compound with the extent of binding in the absence of the test compound, wherein a change in the dATP/ATP binding is indicative of a compound that modulates the dATP/ATP binding activity of a DnaX complex or a DnaX complex subunit (e.g. , τ subunit), wherein the DnaX complex

(or the subunit of DnaX complex) comprises an S. pyogenes DNA polymerase III subunit protein. The invention also provides a compound that modulates the dATP/ATP binding activity of a DnaX complex or a DnaX complex subunit identified by this method.

The invention also provides a method to identify compound that modulate the dATP/ ATPase activity of a DnaX complex or a DnaX complex subunit (e.g. , the r subunit) comprising contacting the DnaX complex (or the DnaX complex subunit) with dATP/ATP either in the presence or absence of a DNA molecule and/or a β subunit in the presence of the compound to form a reaction mixture; subjecting the reaction mixture to conditions in which the DnaX subunit (or complex) hydrolyzes dATP/ATP in the absence of the compound; and comparing the extent of hydrolysis in the presence of the test compound with the extent of hydrolysis in the absence of the test compound, wherein a change in the amount of dATP/ATP hydrolyzed is indicative of a compound that modulates the dATP/ ATPase activity of a DnaX complex or a DnaX complex subunit (e.g., the T subunit) wherein the DnaX complex (or sub- unit) comprises an S. pyogenes DNA polymerase III subunit protein. The invention also pro- vides a compound that modulates the dATP/ATP binding activity of a DnaX complex or a

DnaX complex subunit identified by this method.

The present invention provides a method for identifying compound that modulate the activity of a DNA polymerase replicase comprising contacting a circular primed DNA molecule, optionally coated with SSB, with a DnaX complex, a β subunit and an subunit in the presence of the compound, and dNTPs (or modified dNTPs) to form a reaction mixture; subjecting the reaction mixture to conditions, which in the absence of the compound, affect nucleic acid polymerization; and comparing the nucleic acid polymerization in the presence of the test compound with the nucleic acid polymerization in the absence of the test compound, wherein a change in the activity of the replicase in the presence of the test compound is indicative of a compound that modulates the activity of the replicase, wherein the DnaX complex comprises an S. pyogenes DNA polymerase III subunit protein. The invention also provides a compound that modulates the activity of a DNA polymerase III replicase identified by the method of Claim 62 or 63.

The invention further provides a method to identify compound that modulate the ability of a δ subunit and the δ' and/or DnaX subunit to interact comprising contacting the δ subunit with the δ' and/or δ' plus DnaX subunit in the presence of the compound to form a reaction mixture subjecting the reaction mixture to conditions under which the δ subunit and the δ' and/or δ' plus DnaX subunit would interact in the absence of the compound, comparing the extent of interaction in the presence of the test compound with the extent of interaction in the absence of the test compound, wherein a change in the interaction between the δ subunit and the δ' and/or DnaX subunit is indicative of a compound that modulates the interaction, wherein the DnaX complex comprises an S. pyogenes DNA polymerase III subunit protein. The inven- tion also provides a compound that modulates the ability of a δ subunit and the δ' and/or DnaX subunit to interact by this method . hi another embodiment, the invention provides a method of synthesizing a DNA molecule comprising hybridizing a primer to a first DNA molecule, and incubating said DNA molecule in the presence of a DNA polymerase replicase and one or more dNTPs under conditions sufficient to synthesize a second DNA molecule complementary to all or a portion of said first

DNA molecule, wherein said DNA polymerase replicase comprises an S. pyogenes DNA polymerase III subunit protein, hi prefened embodimetns, the DNA polymerase replicase comprises an S. pyogenes clamp-loader complex, S. pyogenes β subunit, and an S. pyogenes PolC subunit.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1. Structural features of the DNA polymerase III holoenzyme. FIG. 2. DNA sequence of S. pyogenes polC gene.

FIG. 3. Amino acid sequence of S. pyogenes pol III type II (PolC) protein. FIG. 4. Elution profile of NB-StPolC FrII from the UltraLink™ Immobilized Mono- meric Avidin column indicating total protein and specific activity in the gap-filling assay.

FIG. 5. SDS-polyacrylamide gel electrophoresis analysis of S. pyogenes pol III type II (PolC) co-expressed with GroEL and GroES. FIG. 6. Western analysis of polyclonal antibody sensitivity in epitope recognition at various concentrations for S. pyogenes PolC.

FIG. 7. SDS-polyacrylamide gel electrophoresis analysis of optimization of ammonium sulfate precipitation of S. pyogenes PolC. FIG. 8A-B. Activity analysis of optimization of ammonium sulfate precipitation of S. pyogenes PolC.

FIG. 9A-B. SDS -polyacrylamide gel electrophoresis analysis of the elution profile of S. pyogenes PolC by DEAE column chromatography.

FIG. 10. Activity analysis of the elution profile of S. pyogenes PolC by DEAE column chromatography.

FIG. 11. Activity analysis of the elution profile of S. pyogenes PolC by Heparin column cliromatography.

FIG. 12. SDS-polyacrylamide gel electrophoresis summary of the purification of S. pyogenes PolC. FIG. 13. DNA sequence of S. pyogenes dnaE gene.

FIG. 14. Amino acid sequence of S. pyogenes pol III type I (DnaE) protein.

FIG. 15. Protein and activity profile for the Bio-Rex® 70 cation exchange chromatography column purification of S. pyogenes DnaE.

FIG. 16. SDS-polyacrylamide gel electrophoresis analysis for the Bio-Rex® 70 cation exchange chromatography column purification of S. pyogenes DnaE.

FIG. 17. Protein and activity profile for the SP Sepharose™ High Performance chromatography column purification of S. pyogenes DnaE.

FIG. 18. SDS-polyacrylamide gel electrophoresis analysis for the SP-Sepharose™ chromatography column purification of S. pyogenes DnaE. FIG. 19. Comparison of inhibition of S. pyogenes Pol HI type I (DnaE) and type II

(PolC) by TMAU with B. subtilis type II DNA polymerase III and E. coli DNA type I polymerase III.

FIG. 20. Reversal of TMAU inhibition of type II Pol HI activity by adding back dGTP.

FIG. 21A-B. DNA sequence of S. pyogenes dnaN gene and the amino acid sequence of the β subunit encoded by the dnaN gene.

FIG. 22. Protein concentration profile of SP Sepharose™ High Performance column chromatography purification of native S. pyogenes β subunit. FIG. 23. Protein concentration and activity profile of Q Sepharose™ High Performance column chromatography of native S. pyogenes β subunit.

FIG. 24. Protein concentration and activity profile of Sephacryl™ S-300 column cliromatography purification of native S. pyogenes β subunit. FIG. 25. Summary of each step of the purification of native S. pyogenes β by SDS- polyacrylamide gel electrophoresis.

FIG. 26. Protein concentration profile of Ni-NTA column chromatography of C- terminal tagged S. pyogenes β subunit.

FIG. 27. Biotin blot of the fractions located under the protein peaks in FIG. 28. FIG. 28. Summary of each step of the purification of C-terminal tagged S. pyogenes β by SDS-polyacrylamide gel electrophoresis.

FIG. 29. Western analysis of polyclonal antibody sensitivity in epitope recognition at various concentrations for S. pyogenes β subunit.

FIG. 30A-B. DNA sequence of S. pyogenes dnaA gene and the amino acid sequence of the DnaA protein encoded by the dnaA gene.

FIG. 31. Protein concentration and DnaA box binding activity profile for the Bio- Rex® 70 cation exchange chromatography column purification of S. pyogenes DnaA.

FIG. 32. Summary of each step of the purification of native S. pyogenes DnaA by SDS-polyacrylamide gel electrophoresis. FIG. 33. Non-denaturing polyacrylamide gel electrophoresis of the hybridization efficiency of oligonucleotides EO-9 and EO-10 containing a DnaA binding box to determine the ratio at which 100% annealment occurs.

FIG. 34A-B. A. Assay to determine the ability of crude S. pyogenes DnaA (FrII) to bind DnaA box containing annealed oligonucleotides. B. fri similar assays, the concentration of annealed oligonucleotides was varied and the concentration of purified S. pyogenes DnaA was held constant.

FIG. 35. Assays to determine that S. pyogenes DnaA specifically binds annealed oligonucleotides containing a DnaA box.

FIG. 36. Protein concentration profile of Ni-NTA column cliromatography of C- terminal tagged S. pyogenes DnaA.

FIG. 37A-B. A. SDS-polyacrylamide gel electrophoresis of the fractions under the protein peak of the Ni-NTA column purification of C-tenninal tagged S. pyogenes DnaA shown in Fig. 39. B. Biotin blot of the same fraction eluted from the Ni-NTA column. FIG. 38. The region contained in S. pyogenes oriC required for replication.

FIG. 39. The alignment of the candidate S. pyogenes SSBs shown together with E. coli SSB.

FIG. 40A-B. DNA sequence of S. pyogenes dnaX gene and the amino acid sequence of the τ subunit encoded by the dnaX gene.

FIG. 41. Alignment of S. pyogenes DnaX (upper) and HolB (lower) with the B. subtilis and E. coli homologs.

FIG. 42. DNA sequence of the polyclonal region of the pAl-CB-Ndel plasmid.

FIG. 43. Depiction of the PCR product containing the S. pyogenes dnaX gene. FIG. 44. Depiction of the plasmid vector p Al -Spy-dnaX containing the S. pyogenes dnaX gene.

FIG. 45A-B. DNA sequence of S. pyogenes holB gene and the amino acid sequence of the δ' subunit encoded by the hoϊB gene.

FIG. 46. Depiction of the PCR product containing the S. pyogenes holB gene. FIG. 47. Depiction of the plasmid vector pAl-Spy-holB containing the S. pyogenes holB gene.

FIG. 48A-B. DNA sequence of S. pyogenes holA gene and the amino acid sequence of the δ subunit encoded by the hoi A gene.

FIG. 49. Alignment of S. pyogenes HolA with its B. subtilis (YqeN) homolog. FIG. 50. Depiction of the PCR product containing the S. pyogenes hoi A gene.

FIG. 51. Depiction of the plasmid vector pAl-Spy-holA containing the S. pyogenes holA gene.

FIG. 52. Depiction of the plasmid vector pAl-Spy-holBA with the operon containing the S. pyogenes holB and holA genes. FIG. 53. DNA sequence of the region between the holB and holA gene in the pAl-

Spy-holBA plasmid vector.

FIG. 54. Depiction of the plasmid vector pAl-Spy-holBAX with the operon containing the S. pyogenes holB, holA and dnaX genes.

FIG. 55. DNA sequence of the region between the holA and dnaX gene in the pAl- Spy-holBAX plasmid vector.

FIG. 56A-B. Activity analysis of optimization of ammonium sulfate precipitation of S. pyogenes δ', δ, and DnaX clamp loader complex expressed from the pAl-Spy-holBAX plasmid vector. FIG. 57. Activity and protein concentration analysis of the elution profile of S. pyogenes clamp loader complex by Heparin column chromatography.

FIG. 58. Summary of each step of the purification of native S. pyogenes clamp loader complex by SDS-polyacrylamide gel electrophoresis. FIG. 59. Titration of the native S. pyogenes clamp loader complex in reconstitution assays.

FIG. 60. Titration of the native S. pyogenes PolC in reconstitution assays.

FIG. 61. Titration of the native S. pyogenes β in reconstitution assays.

FIG. 62. Alignment of S. pyogenes DnaQ (DinG) with its Aquifex, B. subtilis, T. pal- lidum and E. coli homologs.

FIG. 63. The S. pyogenes DnaG primase is shown aligned with the homologous E. coli and B. subtilis proteins.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to gene and amino acid sequences encoding DNA polymerase III holoenzyme subunits and structural genes from S. pyogenes. As used herein, the term "gene" refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide or precursor (e.g., DNA polymerase III holoenzyme or holoenzyme subunit, as appropriate). The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the full-length or fragment are retained. The term also encompasses the coding region of a structural gene and the including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end such that the gene conesponds to the length of the full-length mRNA. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic fonn or clone of a gene contains the coding region interrupted with non- coding sequences termed "intervening regions" or "intervening sequences." The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. As used herein, the term "DNA polymerase III holoenzyme" refers to the entire DNA po- lymerase III entity (i. e., all of the polymerase subunits, as well as the other associated accessory proteins required for processive replication of a chromosome or genome), while "DNA polymerase III" is just the core [ , ., θ]). "DNA polymerase III holoenzyme subunit" is used in reference to any of the subunit entities that comprise the DNA polymerase III holoenzyme. Thus, the term "DNA polymerase III" encompasses "DNA polymerase III holoenzyme sub- units" and "DNA polymerase III subunits." Subunits include, but may not be limited to DnaE (DNA polymerase III type I α-subunit), PolC (DNA polymerase III type II, α-subunit), dnaN (the beta (β) processivity factor), DnaX, HolA, HolB, SSB, and DnaA proteins. Where "amino acid sequence" is recited herein to refer to an amino acid sequence of a naturally occuning protein molecule, "amino acid sequence" and like terms, such as "polypeptide" or "protein" are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited proteins.

One embodiment of the present invention is an isolated DNA polymerase III holoen- zyme subunit protein. According to the present invention, an isolated, or biologically pure, protein, is a protein that has been removed from its natural environment. As such, "isolated" and "biologically pure" do not necessarily reflect the extent to which the protein has been purified. An isolated S. pyogenes DNA polymerase III holoenzyme subunit protein of the present invention can be obtained from its natural source, can be produced using recombinant DNA technology or can be produced by chemical synthesis. As used herein, an isolated S. pyogenes

DNA polymerase III holoenzyme subunit protein can be a full-length protein or any homologue of such a protein. A prefened DNA polymerase III holoenzyme subunit protein of the present invention is an S. pyogenes DNA polymerase III holoenzyme subunit, including the DNA polymerase III type I α-subunit, also refened to herein as dnaE or StdnaE, DNA poly- merase III type II subunit, also refened to herein as PolC, or StpolC, the beta processivity factor, also refened to herein as β subunit, and DnaA protein, DnaX protein, also refened to as tau subunit (τ subunit), delta prime subunit (δ' subunit), delta subunit (δ subunit) or a homolog of any of these subunits (including, but not limited to the encoded proteins, full-length proteins, processed proteins, fusion proteins and multivalent proteins thereof) as well as proteins that are truncated homologs of proteins that include at least portions of the aforementioned proteins.

Another embodiment of the present invention includes an isolated S. pyogenes DNA polymerase III subunit protein, including the DNA polymerase III type I subunit, DNA polymerase III type II subunit, β processivity factor, DnaA, DnaX protein, δ' subunit, δ subunit proteins. In one embodiment, a prefened DNA polymerase III type I a subunit has a molecular weight of about 120 kDa as determined by Tris-glycine SDS PAGE. In another embodiment,

DNA polymerase III type II subunit has a molecular weight of about 165 kDa as determined by Tris-glycine SDS PAGE. In another embodiment, the beta processivity factor has a molecular weight of about 39 kDa as determined by Tris-glycine SDS PAGE, h another embodiment, DnaA protein has a molecular weight of about 52 kDa as determined by Tris-glycine SDS PAGE, hi another embodiment, DnaX protein has a molecular weight of about 62 kDa as determined by Tris-glycine SDS PAGE, hi another embodiment, δ' protein has a molecular weight of about 34 kDa as detennined by Tris-glycine SDS PAGE, hi another embodiment, δ protein has a molecular weight of about 40 kDa as determined by Tris-glycine SDS PAGE.

Particularly prefened DNA polymerase III proteins include amino acid sequence SEQ ID NO:6, amino acid sequence SEQ ID NO:3, amino acid sequence SEQ ID NO:9, amino acid sequence SEQ ID NO: 12, amino acid sequence SEQ ID NO: 15, amino acid sequence SEQ ID NO:18, and/or amino acid sequence SEQ ID NO:21, as well as proteins that are encoded by nucleic acid molecules that are allelic variants of the nucleic acid molecules that encode proteins having any of those SEQ ID NO's. Examples of methods to produce such proteins are disclosed herein, including in the Examples section.

A prefened S. pyogenes DNA polymerase III protein subunit is capable of performing the function of that subunit in a functional assay, hi one embodiment, DNA polymerase III type I subunit DNA is capable of extending primed DNA in a gap-filling polymerase assay, hi another embodiment, DNA polymerase III type II subunit is capable of extending primed DNA in a gap-filling polymerase activity. In another embodiment β subunit is capable of stimulation of the processitivity of the DNA polymerase in the presence of β subunit in a processivity stimulation assay, hi another embodiment DnaA is capable of binding to dnaA boxes in a dnaA box binding assay, hi another embodiment DnaX subunit is capable of stimulation of the processitivity of the DNA polymerase in a reconstitution assay. In another embodiment δ' -subunit is capable of stimulation of the processitivity of the DNA polymerase in a reconstitution assay. Ln another embodiment δ subunit is capable of stimulation of the processitivity of the DNA polymerase in a reconstitution assay. Examples of such assays are detailed in the Ex- amples section. The ability of such protein subunits to function in an activity detection assay suggests the utility of such proteins and mimetopes in an assay to screen for antibacterial drug candidates that inhibit S. pyogenes replicase. As used herein, "replicase" means an enzyme that duplicates a polynucleotide sequence (either RNA or DNA).

The phrase "capable of perfonning the function of that subunit in a functional assay" means that the protein has at least about 50% of the activity of the natural protein subunit in the functional assay. In prefened embodiments, the protein has at least about 60% of the activity of the natural protein subunit in the functional assay, hi more prefened embodiments, the protein has at least about 70% of the activity of the natural protein subunit in the functional assay. In more prefened embodiments, the protein has at least about 80% of the activity of the natural protein subunit in the functional assay. In more prefened embodiments, the protein has at least about 90% of the activity of the natural protein subunit in the functional assay.

As used herein, an isolated protein of the present invention can be a full-length protein or any homo log of such a protein, such as a protein in which amino acids have been deleted, inserted, inverted, substituted and/or derivatized (e.g., by glycosylation, phosphorylation, ace- tylation, myristoylation, prenylation, palmitoylation, amidation and/or addition of glyc- erophosphatidyl inositol) such that the homo log comprises a protein having an amino acid sequence that is sufficiently similar to a natural S. pyogenes DNA polymerase protein that a nu- cleic acid sequence encoding the homo log is capable of hybridizing under stringent conditions to (i.e., with) the complement of a nucleic acid sequence encoding the conesponding natural S. pyogenes DNA polymerase amino acid sequence. As used herein, stringent hybridization conditions refer to standard hybridization conditions under which nucleic acid molecules, including oligonucleotides, are used to identify similar nucleic acid molecules. Such standard condi- tions are disclosed, for example, in Sambrook et al, Molecular Cloning: A Laboratory Manual,

Cold Spring Harbor Labs Press, 1989; Sambrook et al, ibid., is incorporated by reference herein in its entirety. Stringent hybridization conditions typically permit isolation of nucleic acid molecules having at least about 70% nucleic acid sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction. Formula to calculate the appropri- ate hybridization and wash conditions to achieve hybridization permitting 30% or fewer mismatches of nucleotides are disclosed, for example, in Meinkoth et al, 1984, Anal. Biochem. 138, 267-284; Meinkoth et al, ibid., is incorporated by reference herein in its entirety, i prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 80% nucleic acid sequence identity with the nucleic acid molecule being used to probe, h more prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 90% nucleic acid sequence identity with the nucleic acid molecule being used to probe. In more prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 95% nucleic acid sequence identity with the nucleic acid molecule being used to probe. The minimal size of a protein homolog of the present invention is a size sufficient to be encoded by a nucleic acid molecule capable of forming a stable hybrid with the complementary sequence of a nucleic acid molecule encoding the conesponding natural protein. As such, the size of the nucleic acid molecule encoding such a protein homolog is dependent on nucleic acid composition and percent homology between the nucleic acid molecule and complementary sequence as well as upon hybridization conditions per se (e.g., temperature, salt concentration, and formamide concentration). The minimal size of such nucleic acid molecules is typically at least about 12 to about 15 nucleotides in length if the nucleic acid molecules are GC-rich and at least about 15 to about 17 bases in length if they are AT-rich. As such, the minimal size of a nucleic acid molecule used to encode a protease protein homolog of the present invention is from about 12 to about 18 nucleotides in length. There is no limit on the maximal size of such a nucleic acid molecule in that the nucleic acid molecule can include a portion of a gene, an entire gene, or multiple genes, or portions thereof. Similarly, the minimal size of a polymerase protein homolog of the present invention is from about 4 to about 6 amino acids in length, with prefened sizes depending on whether a full-length, multivalent (i.e., fusion protein having more than one domain each of which has a function), or functional portions of such proteins are desired. Polymerase protein homologs of the present invention preferably have activity conesponding to the natural subunit. A protein homolog of the present invention can be the result of allelic variation of a natural gene encoding an S. pyogenes DNA polymerase III holoenzyme subunit. A natural gene refers to the form of the gene found most often in nature. DNA polymerase holoenzyme III subunit homologs can be produced using techniques known in the art including, but not limited to, direct modifications to a gene encoding a protein using, for example, classic or recom- binant DNA techniques to effect random or targeted mutagenesis. Isolated DNA polymerase

III subunit proteins of the present invention, including homologs, can be identified in a straightforward manner by the protein's ability to perform the subunit' s specified function. Examples of such techniques are delineated in the Examples section.

The present invention also includes mimetopes of S. pyogenes DNA polymerase holo- enzyme III subunit proteins, hi accordance with the present invention, a mimetope refers to any compound that is able to mimic the ability of an isolated S. pyogenes DNA polymerase holoenzyme III subunit protein of the present invention to perform the function of that subunit in a functional assay. A mimetope can be a peptide that has been modified to decrease its susceptibility to degradation but that still retains functional ability. Other examples of mimetopes include, but are not limited to, anti-idiotypic antibodies or fragments thereof, that include at least one binding site that mimics one or more epitopes of an isolated protein of the present invention; non-proteinaceous immunogenic portions of an isolated protein (e.g., carbohydrate structures); and synthetic or natural organic molecules, including nucleic acids, that have a structure similar to at least one epitope of an isolated protein of the present invention. Such mimetopes can be designed using computer- generated structures of proteins of the present invention. Mimetopes can also be obtained by generating random samples of molecules, such as oligonucleotides, peptides or other organic molecules, and screening such samples by affinity chromatography techniques using the conesponding binding partner.

One embodiment of the present invention is a fusion protein that includes a S. pyogenes DNA polymerase holoenzyme III subunit protein-containing domain attached to a fusion segment. As used herein, the term "fusion protein" refers to a chimeric protein containing the protein of interest (i.e., DNA polymerase III holoenzyme or holoenzyme subunit and fragments thereof) joined to an exogenous protein fragment (the fusion partner which consists of a non-

DNA polymerase III holoenzyme or holoenzyme subunit protein). The fusion partner may enhance solubility of the DNA polymerase III holoenzyme or holoenzyme subunit protein as expressed in a host cell, may provide an affinity tag to allow purification of the recombinant fusion protein from the host cell or culture supernatant, or both. If desired, the fusion protein may be removed from the protein of interest (i.e., DNA polymerase III holoenzyme, holoenzyme subunit protein, or fragments thereof) by a variety of enzymatic or chemical means known to the art. Inclusion of a fusion segment as part of a S. pyogenes DNA polymerase holoenzyme III subunit of the present invention can enhance the protein's stability during production, storage and/or use. Depending on the segment's characteristics, a fusion segment can also act as an immunopotentiator to enhance the immune response mounted by an animal immunized with an S. pyogenes DNA polymerase holoenzyme III subunit protein containing such a fusion segment. Furthermore, a fusion segment can function as a tool to simplify purification of an S. pyogenes DNA polymerase holoenzyme III subunit protein, such as to enable purification of the resultant fusion protein using affinity chromatography. A suitable fusion segment can be a domain of any size that has the desired function (e.g., imparts increased stability, imparts increased immunogenicity to a protein, and/or simplifies purification of a protein). It is within the scope of the present invention to use one or more fusion segments. Fusion segments can be joined to amino and/or carboxyl termini of the S. pyogenes DNA polymerase holoenzyme III subunit-containing domain of the protein. Linkages between fusion segments and S. pyogenes DNA polymerase holoenzyme III subunit-containing domains of fusion proteins can be susceptible to cleavage in order to enable straight-forward recovery of the S. pyogenes DNA polymerase holoenzyme III subunit-containing domains of such proteins. Fusion proteins are preferably produced by culturing a recombinant cell transformed with a fusion nucleic acid molecule that encodes a protein including the fusion segment attached to either the carboxyl and/or amino terminal end of a S. pyogenes DNA polymerase holoenzyme III subunit- containing domain.

Prefened fusion segments for use in the present invention include a glutathione binding domain, such as glutathione-S-transferase (GST) or a portion thereof capable of binding to glutathione; a metal binding domain, such as a poly-histidine segment capable of binding to a divalent metal ion; an immunoglobulin binding domain, such as Protein A, Protein G, T cell, B cell, F_c receptor or complement protein antibody-binding domains; a sugar binding domain such as a maltose binding domain from a maltose binding protein; and/or a "tag" domain (e.g., at least a portion of -galactosidase, a strep tag peptide, other domains that can be purified using compounds that bind to the domain, such as monoclonal antibodies). More prefened fusion segments include metal binding domains, such as a poly-histidine segment; a maltose binding domain; and a hexahistidine/biotin binding peptide. Examples of particularly prefened fusion proteins of the present invention include S. pyogenes N-tenninal hexahis- tidine/biotinylated StPolC, NB-StpolC, NB-StDnaE, and/or C-terminal hexahis- tidine/biotinylated CB-StN, and CB-StA, the productions of which are disclosed herein.

Another embodiment of the present invention is an isolated nucleic acid molecule that hybridizes under stringent hybridization conditions with at least one of the S. pyogenes DNA polymerase III holoenzyme subunit genes of the present invention. An S. pyogenes polC gene of the present invention includes nucleic acid sequence SEQ ID NO:l, which encodes a DNA polymerase III type II subunit protein including SEQ ED NO:3. Another prefened S. pyogenes gene is dnaE, and includes nucleic acid sequence SEQ ED NO:4, which encodes a DNA polymerase III type I subunit protein including SEQ ID NO:6. Another prefened S. pyogenes gene is dndN, and includes nucleic acid sequence SEQ ED NO:7, which encodes a DNA polymerase III β subunit protein including SEQ ID NO:9. Another prefened S. pyogenes gene is dnαA, and includes nucleic acid sequence SEQ ED NO: 10, which encodes a DnaA protein including SEQ ED NO: 12. Another prefened S. pyogenes gene is dndX, and includes nucleic acid sequence SEQ ID NO: 13, which encodes a DNA polymerase III DnaX subunit protein including SEQ ED NO:15. Another prefened S. pyogenes gene is holB, and includes nucleic acid sequence SEQ ED NO: 16, which encodes a DNA polymerase III δ' subunit protein including SEQ LD NO: 18. Another prefened S. pyogenes gene is hoi A, and includes nucleic acid sequence SEQ ED NO: 19, which encodes a DNA polymerase III δ subunit protein including SEQ LD NO:21. It should be noted that since nucleic acid sequencing technology is not entirely er- ror-free, sequences presented herein, at best, represent an apparent nucleic acid sequence of the nucleic acid molecules encoding a S. pyogenes DNA polymerase holoenzyme subunit protein of the present invention. A nucleic acid molecule of the present invention can include an isolated natural gene or a homolog thereof, the latter of which is described in more detail below. A nucleic acid molecule of the present invention can include one or more regulatory regions, full-length or partial coding regions, or combinations thereof. The minimal size of a nucleic acid molecule of the present invention is the minimal size that can fonn a stable hybrid with one of the aforementioned genes under stringent hybridization conditions.

Ln one embodiment, hybridization conditions will permit isolation of nucleic acid mole- cules having at least about 70% nucleic acid sequence identity with the nucleic acid molecule being used to probe. In prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 80% nucleic acid sequence identity with the nucleic acid molecule being used to probe, hi more prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 90% nucleic acid sequence identity with the nucleic acid molecule being used to probe. In more prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 95% nucleic acid sequence identity with the nucleic acid molecule being used to probe.

In accordance with the present invention, an isolated nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid with which it is ordinarily associated in its natural source. Isolated nucleic acid molecules are thus present in a fonn or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids as nucleic acids such as DNA and RNA found in the state they exist in nature. The isolated nucleic acid molecule may be present in single-stranded or double- stranded form. When an isolated nucleic acid molecule is to be utilized to express a protein, the nucleic acid molecule will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or polynucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded). "Isolated" does not reflect the extent to which the nucleic acid molecule has been purified. An iso- lated nucleic acid molecule can include DNA, RNA, or derivatives of either DNA or RNA.

An isolated S. pyogenes DNA polymerase III holoenzyme subunit nucleic acid molecule of the present invention can be obtained from its natural source either as an entire (i.e., complete) gene or a portion thereof capable of forming a stable hybrid with that gene. An iso- lated S. pyogenes DNA polymerase III holoenzyme subunit nucleic acid molecule can also be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis. Isolated S. pyogenes DNA polymerase III holoenzyme subunit nucleic acid molecules include natural nucleic acid molecules and homologs thereof, including, but not limited to, natural allelic variants and modified nucleic acid molecules in which nucleotides have been inserted, deleted, substituted, and/or inverted in such a manner that such modifications do not substantially interfere with the nucleic acid molecule's ability to encode a protein of the present invention or to form stable hybrids under stringent conditions with natural gene isolates. An S. pyogenes DNA polymerase III holoenzyme subunit nucleic acid molecule homolog can be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et al, ibid.). For example, nucleic acid molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification and/or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof. Nucleic acid molecule homologs can be selected from a mixture of modified nucleic acids by screening for the function of the protein encoded by the nucleic acid (e.g., ability to elicit an immune response against at least one epitope of a S. pyogenes DNA polymerase III holoenzyme subunit protein, ability to bind to immune serum) and/or by hybridization with a S. pyogenes DNA polymerase III holoenzyme subunit gene.

The present invention also provides methods for detection of nucleic acid molecules encoding at least a portion of DNA polymerase III holoenzyme, or DNA polymerase III holoenzyme subunit in a biological sample comprising the steps of: a) hybridizing at least a portion of a nucleic acid molecule of the present invention to nucleic acid material of a biological sample, thereby forming a hybridization complex, and b) detecting the hybridization complex, wherein the presence of the complex conelates with the presence of a polynucleotide encoding at least a portion of DNA polymerase III holoenzyme or DNA polymerase III holoenzyme sub- unit in the biological sample. In prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 80% nucleic acid sequence identity with the nucleic acid molecule being used to probe, hi more prefened embodiments, hybridi- hybridization conditions will permit isolation of nucleic acid molecules having at least about 90% nucleic acid sequence identity with the nucleic acid molecule being used to probe. Ln more prefened embodiments, hybridization conditions will permit isolation of nucleic acid molecules having at least about 95% nucleic acid sequence identity with the nucleic acid mole- cule being used to probe, i alternative prefened embodiment of the methods, the nucleic acid material of the biological sample is amplified by the polymerase chain reaction.

The present invention also includes a recombinant vector, which includes at least one S. pyogenes DNA polymerase III nucleic acid molecule of the present invention, inserted into any vector capable of delivering the nucleic acid molecule into a host cell. Such a vector contains heterologous nucleic acid sequences, which are nucleic acid sequences that are not naturally found adjacent to nucleic acid molecules of the present invention and that preferably are derived from a species other than the species from which the nucleic acid molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid. Recombinant vectors can be used in the cloning, sequencing, and/or oth- erwise manipulating of S. pyogenes DNA polymerase III nucleic acid molecules of the present invention. One type of recombinant vector, refened to herein as a recombinant molecule and described in more detail below, can be used in the expression of nucleic acid molecules of the present invention. Prefened recombinant vectors are capable of replicating in the transformed cell. Isolated S. pyogenes DNA polymerase III proteins of the present invention can be produced in a variety of ways, including production and recovery of natural proteins, production and recovery of recombinant proteins, and chemical synthesis of the proteins. In one embodiment, an isolated protein of the present invention is produced by culturing a cell capable of expressing the protein under conditions effective to produce the protein, and recovering the pro- tein. A prefened cell to culture is a recombinant cell that is capable of expressing the protein, the recombinant cell being produced by transforming a host cell with one or more nucleic acid molecules of the present invention. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, micro- injection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed nucleic acid molecules of the present invention can remain extra chromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained. Suitable and prefened nucleic acid molecules with which to transform a cell are as disclosed herein for suitable and preferred S. pyogenes DNA polymerase III nucleic acid molecules per se. Particularly prefened nucleic acid molecules to include in recombinant cells of the present invention include polC, dnaN, dnaE, dnaA, dnaX, holB, holA and oriC.

Suitable host cells to transform include any cell that can be transformed with a nucleic acid molecule of the present invention. Host cells can be either untransformed cells or cells that are already transformed with at least one nucleic acid molecule. Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing S. pyogenes DNA polymerase III proteins of the present invention or can be capable of producing such proteins after being transformed with at least one nucleic acid molecule of the present invention. Host cells of the present invention can be any cell capable of producing at least one protein of the present invention, and include bacterial, fungal (including yeast), insect, other animal and plant cells. Prefened host cells include bacterial, mycobacterial, yeast, insect and mammalian cells. More prefened host cells include Escherichia coli. Particularly prefened host cells are Escherichia coli, including DH5α, APl.Ll and MGC1030. Alternative prefened host cells are S. pyogenes, including JRS4.

A recombinant cell is preferably produced by transforming a host cell with one or more recombinant molecules, each comprising one or more nucleic acid molecules of the present in- vention operatively linked to an expression vector containing one or more transcription control sequences. The phrase operatively linked refers to insertion of a nucleic acid molecule into an expression vector in a manner such that the molecule is able to be expressed when transformed into a host cell. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified nucleic acid molecule. The term "vehicle" is sometimes used interchangeably with "vector." Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, parasite, insect, other animal, and plant cells. Prefened expression vectors of the present invention can direct gene expression in bacterial, yeast, insect and mammalian cells and more preferably in the cell types heretofore disclosed. Recombinant molecules of the present invention may also (a) contain secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed S. pyogenes protein of the present invention to be secreted from the cell that produces the protein and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules of the present invention as fusion proteins. Eukaryotic recombinant molecules may include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules of the present invention.

Suitable signal segments include natural signal segments or any heterologous signal segment capable of directing the secretion of a protein of the present invention. Prefened sig- nal segments include, but are not limited to, tissue plasminogen activator (t-PA), interferon, interleukin, growth hormone, histocompatibility and viral envelope glycoprotein signal segments.

Nucleic acid molecules of the present invention can be operatively linked to expression vectors containing regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of nucleic acid molecules of the present invention, hi particular, recombinant molecules of the present invention include transcription control sequences. Transcription confrol sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enliancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art. Prefened transcription control sequences include those which function in bacterial, yeast, in- sect and mammalian cells, such as, but not limited to, pAl, tac, lac, trp, trc, oxy-pro, omp/lpp, rrnB, bacteriophage lambda (λ), bacteriophage T7, T71ac, bacteriophage T3, bacteriophage SP6, bacteriophage SP01, metallothionein, α-mating factor, Pichia alcohol oxidase, alphaviras subgenomic promoters (such as Sindbis virus subgenomic promoters), antibiotic resistance gene, baculoviras, Heliothis zea insect viras, vaccinia viras, herpesvirus, poxvirus, adenoviras, cytomegalo viras (such as intermediate early promoters, simian viras 40, retro virus, actin, ret- roviral long tenninal repeat, Rous sarcoma viras, heat shock, phosphate and nitrate transcription control sequences as well as other sequences capable of controlling gene expression in prokaryotic or eukaryotic cells. Additional suitable transcription control sequences include tis- sue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or interleukins). A particularly prefened transcription control sequence is pAl. Transcription control sequences of the present invention can also include naturally occurring transcription control sequences naturally associated with S. pyogenes. A recombinant molecule of the present invention is a molecule that can include at least one of any nucleic acid molecule heretofore described operatively linked to at least one of any transcription control sequence capable of effectively regulating expression of the nucleic acid molecule(s) in the cell to be transformed, examples of which are disclosed herein. Particularly prefened recombinant molecules include pAl-StpolC, pAl-NB-StpolC, pAl-StdnaE, pAl-NB- StdnaE, pAl-StN, pAl-CB-StN, pAl-StA, , pAl-Spy-dnaX, pAl-Spy-holB, pAl-Spy/holA, pAl-Spy-holBA, pAl-Spy-holBAX and pAl-CB-StA. Details regarding the production of such recombinant molecules are disclosed herein.

A recombinant cell of the present invention includes any cell transfonned with at least one of any nucleic acid molecule of the present invention. Suitable and prefened nucleic acid molecules as well as suitable and prefened recombinant molecules with which to transfer cells are disclosed herein. Particularly prefened recombinant cells include pAl-StpolC/MGC1030, pAl-NB-StpolC/MGC1030, pAl-NB-StpolC/DH5α [pREP4-GroESL], pAl- StdnaE/MGC1030, pAl-NB-StdnaE/MGC1030, pAl-StN/MGC1030, pAl-CB- StN/MGC1030, pAl-StA/MGC1030, pAl-Spy-dnaX/MGC1030, pAl-Spy-holB/MGC1030, pAl-Spy/holA/MGC1030, pAl-Spy-holBA/MGC1030, pAl-Spy-holBAX/MGC1030 and pAl-CB-StA MGC1030. Details regarding the production of these recombinant cells are disclosed herein.

Recombinant cells of the present invention can also be co-transformed with one or more recombinant molecules including S. pyogenes DNA Polymerase III nucleic acid mole- cules encoding one or more proteins of the present invention.

It may be appreciated by one skilled in the art that use of recombinant DNA technologies can improve expression of transfonned nucleic acid molecules by manipulating, for example, the number of copies of the nucleic acid molecules within a host cell, the efficiency with which those nucleic acid molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of nucleic acid molecules of the present invention include, but are not limited to, operatively linking nucleic acid molecules to high-copy number plasmids, integration of the nucleic acid molecules into one or more host cell chromo- somes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of nucleic acid molecules of the present invention to conespond to the codon us- age of the host cell, deletion of sequences that destabilize transcripts, and use of confrol signals that temporally separate recombinant cell growth from recombinant enzyme production during fermentation. The activity of an expressed recombinant protein of the present invention may be improved by fragmenting, modifying, or derivatizing nucleic acid molecules encoding such a protein. Recombinant cells of the present invention can be used to produce one or more proteins of the present invention by culturing such cells under conditions effective to produce such a protein, and recovering the protein. Effective conditions to produce a protein include, but are not limited to, appropriate media, bioreactor, temperature, pH and oxygen conditions that permit protein production. An appropriate, or effective, medium refers to any medium in which a cell of the present invention, when cultured, is capable of producing an S. pyogenes DNA Polymerase III protein of the present invention. Such a medium is typically an aqueous medium comprising assimilable carbon, nitrogen and phosphate sources, as well as appropriate salts, minerals, metals and other nutrients, such as vitamins. The medium may comprise complex nutrients or may be a defined minimal medium. Cells of the present invention can be cultured in conventional fermentation bioreactors, which include, but are not limited to, batch, fed- batch, cell recycle, and continuous fermentors. Culturing can also be conducted in shake flasks, test tubes, microtiter dishes, and petri plates. Culturing is carried out at a temperature, pH and oxygen content appropriate for the recombinant cell. Such culturing conditions are well within the expertise of one of ordinary skill in the art. Examples of suitable conditions are included in the Examples section.

Depending on the vector and host system used for production, resultant proteins of the present invention may either remain within the recombinant cell; be secreted into the fennenta- tion medium; be secreted into a space between two cellular membranes, such as the periplas- mic space in E. coli; or be retained on the outer surface of a cell or viral membrane. The phrase "recovering the protein" refers simply to collecting the whole fermentation medium containing the protein and need not imply additional steps of separation or purification. Proteins of the present invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chroma- tography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, cliromato- focusing and differential solubilization. Proteins of the present invention are preferably retrieved in "substantially pure" form. As used herein, "substantially pure" refers to a purity that allows for the effective use of the protein as a therapeutic composition or diagnostic.

The present invention also includes isolated antibodies capable of selectively binding to an S. pyogenes DNA Polymerase III holoenzyme subunit protein of the present invention or to a mimetope thereof. Such antibodies are also refened to herein as anti-S. pyogenes DNA Polymerase III holoenzyme subunit antibodies. Particularly prefened antibodies of this embodi- ment include anti-PolC antibodies, anti-/3 subunit antibodies, anti-DnaE antibodies, anti-DnaX- subunit antibodies, anti-δ' subunit antibodies, anti-δ subunit antibodies and anti-DnaA antibodies.

Isolated antibodies are antibodies that have been removed from their natural milieu. The term "isolated" does not refer to the state of purity of such antibodies. As such, isolated antibodies can include anti-sera containing such antibodies, or antibodies that have been purified to varying degrees.

As used herein, the term "selectively binds to" refers to the ability of antibodies of the present invention to preferentially bind to specified proteins and mimetopes thereof of the present invention. Binding can be measured using a variety of methods known to those skilled in the art including immunoblot assays, immunoprecipitation assays, radioimmunoassays, enzyme immunoassays (e.g., ELISA), immunofluorescent antibody assays and immunoelectron microscopy; see, for example, Sambrook et al, ibid.

Antibodies of the present invention can be either polyclonal or monoclonal antibodies. Antibodies of the present invention include functional equivalents such as antibody fragments and genetically-engineered antibodies, including single chain antibodies, that are capable of selectively binding to at least one of the epitopes of the protein or mimetope used to obtain the antibodies. Antibodies of the present invention also include chimeric antibodies that can bind to more than one epitope. Prefened antibodies are raised in response to proteins, or mimetopes thereof, that are encoded, at least in part, by a nucleic acid molecule of the present invention. Methods to generate and detect antibodies are known in the art. See, e.g., Harlow and Lane,

Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, incorporated by reference herein in its entirety. Prefened methods are disclosed herein in the Examples section. A prefened method to produce antibodies of the present invention includes (a) administering to an animal an effective amount of a protein or mimetope thereof of the present invention to produce the antibodies and (b) recovering the antibodies, hi another method, antibodies of the present invention are produced recombinantly using techniques as heretofore disclosed to produce S. pyogenes DNA Polymerase III holoenzyme subunit proteins of the present invention. Antibodies raised against defined proteins or mimetopes can be advantageous because such antibodies are not substantially contaminated with antibodies against other substances that might otherwise cause interference in a diagnostic assay or side effects if used in a therapeutic composition. Antibodies of the present invention have a variety of potential uses that are within the scope of the present invention. For example, such antibodies can be used (a) as therapeutic compounds to passively immunize an animal in order to protect the animal from bacteria susceptible to treatment by such antibodies, preferably S. pyogenes, (b) as reagents in assays to detect infection by such bacteria and/or (c) as tools to screen expression libraries and/or to re- cover desired proteins of the present invention from a mixture of proteins and other contaminants. Furthennore, antibodies of the present invention can be used to target cytotoxic agents to bacteria of the present invention in order to directly kill such bacteria. Targeting can be accomplished by conjugating (i.e., stably joining) such antibodies to the cytotoxic agents using techniques known to those skilled in the art. Suitable cytotoxic agents are known to those skilled in the art. Suitable cytotoxic agents include, but are not limited to: double-chain toxins

(i.e., toxins having A and B chains), such as diphtheria toxin, ricin toxin, Pseudomonas exotoxin, modeccin toxin, abrin toxin, and shiga toxin; single-chain toxins, such as pokeweed antiviral protein, α-amanitin, and ribosome inhibiting proteins; and chemical toxins, such as melphalan, methotrexate, nitrogen mustard, doxorubicin and daunomycin. Prefened double- chain toxins are modified to include the toxic domain and translocation domain of the toxin but lack the toxin's intrinsic cell binding domain.

The present invention also provides methods for detecting DNA polymerase III comprising: providing in any order, a sample suspected of containing DNA polymerase III, and antibody capable of specifically binding to at least a portion of the DNA polymerase III; mixing the sample and the antibody under conditions wherein the antibody can bind to the DNA polymerase III; and detecting the binding, hi prefened embodiments of the methods, the sample comprises a Gram-positive pathogenic bacteria. In alternative prefened embodiments, the organism is S. pyogenes. Methods for detecting proteins with antibodies are well known to those skilled in the art, see, for example Harlow and Lane, ibid., and include immunoblot assays, immunoprecipitation assays, enzyme immunoassays (e.g., ELISA), radioimmunoassays, im- munofluorescent antibody assays and immunoelectron microscopy.

The present invention also provides methods for detection of nucleic acid molecules encoding at least a portion of DNA polymerase III holoenzyme, or D A polymerase III holoenzyme subunit in a biological sample comprising the steps of: a) hybridizing at least a portion of a nucleic acid molecule of the present invention to nucleic acid material of a biological sample, thereby fonning a hybridization complex, and b) detecting the hybridization complex, wherein the presence of the complex conelates with the presence of a polynucleotide encoding at least a portion of DNA polymerase III holoenzyme or DNA polymerase III holoenzyme sub- unit in the biological sample, hi alternative prefened embodiment of the methods, the nucleic acid material of the biological sample is amplified by the polymerase chain reaction.

The present invention also provides methods for detecting DNA polymerase III holoen- zyme or holoenzyme subunit expression, including expression of abnormal or mutated DNA polymerase III holoenzyme or holoenzyme subunit proteins or gene sequences comprising the steps of a) providing a test sample suspected of containing DNA polymerase III holoenzyme or DNA polymerase III holoenzyme subunit protein, as appropriate; and b) comparing the test DNA polymerase III holoenzyme or holoenzyme subunit, in the sample with the quantitated DNA polymerase III holoenzyme or holoenzyme subunit in the control to determine the relative concentration of the test DNA polymerase III holoenzyme or holoenzyme subunit in the sample. In addition, the methods may be conducted using any suitable means to determine the relative concentration of DNA polymerase holoenzyme or holoenzyme subunit in the test and control samples. Examples of such methods may be found in the Examples section. Another embodiment of the present invention is a method for detecting functional activity of S. pyogenes DNA polymerase III protein subunits. A prefened method is the detection of activity comprising a) providing a test sample suspected of containing DNA polymerase III holoenzyme subunit protein; and b) comparing the activity of the test holoenzyme subunit in the sample with a quantitated DNA polymerase III holoenzyme subunit in a control to deter- mine the relative activity of the test DNA polymerase III holoenzyme subunit in the sample. In one embodiment the activity is polymerase gap-filling activity for the detection of DNA polymerase III type I subunit or DNA polymerase III type II subunit. In another embodiment, the activity is the stimulation of the processivity of the DNA polymerase for detection of the β subunit. hi another embodiment the activity is binding to dnaA boxes for detection of DnaA. In another embodiment DnaX subunit is capable of stimulation of the processivity of the DNA polymerase in a reconstitution assay. In another embodiment δ' subunit is capable of stimulation of the processivity of the DNA polymerase in a reconstitution assay. In another embodi- ment δ subunit is capable of stimulation of the processivity of the DNA polymerase in a reconstitution assay. Examples of such methods may be found in the Examples section.

The present invention also provides methods for screening antibacterial drug candidates that inhibit replicase activity of S. pyogenes DNA polymerase holoenzyme. This method comprises the steps of a) providing an test inhibitor suspected of inhibiting DNA polymerase III holoenzyme replication, b) detecting the DNA polymerase III replication reaction in test and control reaction, and c) comparing the test to the control, wherein the amount of replication conelates with the inhibitory effect of the test inhibitor. The present invention also provides a conesponding method for screening antibacterial drug candidates that inhibit the activity of S. pyogenes primosome. Examples of such methods may be found in the Examples section. Another embodiment of the present invention is an isolated nucleic acid molecule that hybridizes under stringent hybridization conditions with the S. pyogenes oriC gene of the present invention. An S. pyogenes oriC gene of the present invention includes nucleic acid sequence SEQ ID NO:22. Another embodiment of the present invention is a recombinant molecule containing the S. pyogenes oriC. Particularly prefened recombinant molecules include pSt-oril , pSt-ori2. Another embodiment is a recombinant cell transformed with an S. pyogenes nucleic acid molecule. Particularly prefened recombinant cells include pSt-oril/JRS4, pSt- ori2/JRS4, pSt-oril/DH5θ! and pSt-ori2/DH5α. Details regarding the production of these recombinant molecules and recombinant cells are disclosed herein.

In another embodiment, the present invention provides a method for analyzing the S. pyogenes origin of replication. This method comprises transforming cells with a recombinant molecule suspected of containing the S. pyogenes origin of replication, and detecting the replication of the recombinant molecule.

The following examples are provided to further assist those of ordinary skill in the art. Such examples are intended to be illustrative and therefore should not be regarded as limiting the invention. A number of exemplary modifications and variations are described in this application and others will become apparent to those of skill in this art. Such variations are considered to fall within the scope of the invention as described and claimed herein. EXAMPLES

The following examples include a number of recombinant DNA and protein chemistry techniques known to those skilled in the art; see, for example, Sambrook et al, ibid.

Example 1. Construction of Vectors for Expression of S. pyogenes Replication Proteins Starting Vectors

A. Construction of pAl-CB-Cla-1 Starting Vector Vector pAl-CB-Cla-1 (ATG project phase LA) was prepared by modifying vector pDRK-C (Kim, D. R. and McHenry, C. S. (1996) J. Biol. Chem. 271 : 20690-20698) that contains: 1) a pBR322 origin of replication, 2) a gene expressing the lacI^Q repressor protein, and 3) a semisynthetic E. coli promoter (pAl) that is repressed by the lacI^Q repressor. Bacteria containing the pDRK-C plasmid were grown overnight in 10 ml of 2xYT culture media (16 μg/L bacto-tryptone, 10 g/L bacto-yeast extract, 5 g/L NaCl, pH 7.0) containing 100 g/ml ampicillin at 37 °C in a shaking incubator. Plasmid DNA was prepared and digested with BamHI. All plasmid DNA preparations listed here and below were purified using WIZARD^® and WIZARD^® Plus DNA (Promega, Madison, Wisconsin) purification systems according to instruction from manufacturer. The resulting 3' ends were filled in to the end of the conesponding template strand with the Klenow fragment of DNA pol I in the presence of Mg^""^", the four dNTPs (dATP, dGTP, dTTP, and dCTP), and re- sealed with T4 DNA ligase, in the presence of 1 mM ATP. Plasmids were transformed into

DH5α bacteria, plasmid-containing colonies were selected by ampicillin resistance, and the plasmids were prepared and screened for loss of the BamHI site. One of the colonies that contained plasmids that could no longer be cleaved by BamHI was selected, grown, and us'ed for preparation of the intennediate plasmid pDRKC-Bam^mmus. The S. pyogenes DNA polymerase III holoenzyme or holoenzyme subunits were expressed in E. coli host cells. Nucleic acid (plasmids) may be introduced into bacterial host cells in a number of ways including transformation of bacterial cells made competent for transformation by treatment with calcium chloride or by electroporation. A review of the use of transformation techniques is provided in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1989) pp.1.74-1.84. The strategy used to introduce plasmids into DH5α bacteria here is also used in all following similar transformation reactions. pDRKC-Bam^mmus was prepared and digested with Xbal and E>rαIII to remove a small polylinker (this removed the polylinker containing ^bαl-NcoI-Notl-Dr EII restriction sites). The following adaptor/linkers was synthesized, amiealed and inserted into the Xbal and Drαlll digested pDRKC-Bam^minus (ATG linker/adaptor #P38-S1 and P38-A1; ATG refers tliroughout this document to ATG Laboratories, Eden Prairie, Mimiesota). The annealed DΝA duplex contains Xbal and Drain sticky ends for insertion into pDRKC-Bam^mιnus.

5' -CTAGGAGGTTTTAATCGATGCGGCCGGATCCTCGAGTCTAGACACTGG-3 ' SEQ LD NO:41 3 ' -CTCCAAAATTAGCTACGCCGGCCTAGGAGCTCAGATCTGTG-5 ' SEQ ED NO:42

Plasmids were transformed into DH5α and plasmid-containing colonies were selected by ampicillin resistance. Plasmids were prepared and the conversion of the BamHI site to GGATCGATCC, and the replacement of the original polylinker with the annealed DNA duplex was confirmed by DNA sequencing (ATG SEQ # 415; ATG primer P38-S5576). Crea- tion of the, filled-in BamHI site was found to have created a Clάl restriction site, but it is not cleaved by Clal if plasmids are purified from methylase-proficient (dam⁺) E. coli strains.

One of the isolates was chosen for future use and named pAl-CB-Cla-1 (previously refened to in ATG, Inc. communication as pAl-CB-CEBXXDS). This isolate was grown and stored as a glycerol stock culture (ATG glycerol stock #254) (glycerol stocks, as used herein refer to a plasmid transformed into an E. coli carrier strain and stored frozen in 15% glycerol).

As an example, the following is a reproduction of the above oligonucleotides with the relevant sequences annotated:

5 ' -CTAGGAGCTTTTAATCGATGCGGCCGGATCCTCGAGTCTAGACACTGG-3 ' SEQ ED NO \A 1 3 ' -CTCCAAAATTAGCTACGCCGGCCTAGGAGCTCAGATCTGTG-5 ' SEQ ED NO:42

In this sequence, the following annotations apply:

CTAG—Sticky end for Xbal; however, cleavage destroys the site, so it is not re-cleaved. AGGAGG = ribosome binding site (RBS).

CM site.

ATG = initiation codon. CGGCCG = E gI site. GGATCC = RαmHI site. CTCGAG =^oI site.

TCTAGA = ^bαI site.

CACTGG = 3 '-overhang to regenerate DralH site.

5 The linker/adaptors in the following sections are not annotated, but a similar strategy also applies in those cases.

B. Construction of pAl-CB-Cla-2 Starting Vector For the pAl-CB-Cla-1 plasmid to be useful for expression of several of the S. pyogenes genes, modifications were needed (ATG project El-2). To remove a Kpnl restriction site downstream of the C-terminal biotin tag, 0 plasmid pAl-CB-Cla-1 DNA was digested with Kpnl. The resulting 3 ' recessed and overhanging ends were removed by filling in the recessed 3' ends and trimming back the overhanging 3' ends with Klenow fragment. The plasmid was then resealed with T4 DNA ligase in the presence of 1 mM ATP. Plasmids were transformed into E. coli, and plasmid-containing colonies were selected based on ampicillin resistance. Destruction of the Kpnl site in these plasmids 5 was confirmed by DNA sequencing (ATG seq.# 630-631; primers P64-A215 and P38-S5576).

One of the isolates was chosen for future use and named pAl-CB-Clal(Kpn^") (ATG glycerol stock #424).

The plasmid pAl-CB-Clal(Kpn^") was digested with the restriction endonucleases Clal and Spel to remove the polylinker containing the restrictions sites: Eagl, BamHI, Xhόl, Xball

20 and DraUI. Two oligonucleotides (ATG linker/adaptor #P67-S1 and P67-A1) were annealed to form the adaptor/linker (shown below as SEQ ID NO:43 and SEQ ED NO:44). This adaptor/linker contained Clal and Spel sticky ends to allow insertion into the conesponding sites within ClaVSpel digested pAl-CB-Clal(Kpn^") plasmid. The plasmids containing the inserts were resealed and transformed into DH5α.

^>5

5 ' -CGATA AAAAAAAAGG CCGGCCGCTA GCGGTACCA-3 ' SEQ LD NO :43

3 ' -TAT TTTTTTTTCC GGCCGGCGAT CGCCATGGTG ATC- 5 ' SEQ ED NO:44

DH5α E. coli clones containing the inserts (positive clones) were selected by ampicillin resistance. One positive isolate was grown and the plasmid DNA prepared. The sequence of the plasmid across the inserted region was confirmed by DNA sequencing (ATG seq.# 649, primer P38-S5576). The introduction of this adaptor/linker into pAl-CB-Clal(Kpn^') formed a new polylinker containing the restriction sites C -spacer-Esel-Nbel Kpnl-Speϊ and resulted in a new plasmid pAl-CB-Cla-2 (ATG glycerol stock #440).

C. Construction of pAl-CB-Νco-1 Starting Vector pAl-CB-Νco-1 plasmid was constructed by modifying the pDRK-C plasmid (ATG project Al-2). Plasmid pDRK-C DΝA was digested with Kpnl and the resulting recessed and overhanging 3' ends were filled in

("blunted") with DΝA polymerase I Klenow fragment. The plasmid was then resealed and used to transform DH5α strain of E. coli. Plasmid-containing colonies were selected by ampicillin resistance and the plasmids were prepared and screened for loss of the Kpnl site. One positive clone containing a plasmid that could not be cleaved by Kpnl was selected for se- quencing. The sequence was confinned by DΝA sequencing (ATG SΕQ # 627 and 632; primers P38-S5576 and P64-A215). This plasmid was named pDRK-C (Kpn-) (ATG glycerol stock #414).

The plasmid pDRK-C (Kpn^") was digested with restriction endonucleases Xbal and Spel to remove the polylinker containing the restriction sites NeoL Eagl, and Drαlll. Two oli- gonucleotides (ATG linker/adaptor #P63-S1 and P63-A1) were annealed to form the adaptor/linker (shown below as SΕQ LD ΝO:45 and SΕQ LD NO:46). This adaptor/linker contained Xbal and Spel sticky ends to allow insertion into the conesponding restriction sites present on the pDRK-C (Kpn^") plasmid. The plasmid containing the inserted region was resealed and transformed into DH5α strain of E. coli. The introduction of this adaptor/linker into pDRK-C (Kpn^") fonned a new polylinker containing the restriction sites Xbal-PacI-NcoI-spacev-Kpnl- spacer-Fsel-Spel.

5 ' -CTAGAGGAGGTTAATTAACCATGGAAAAAAAAAGGTACCAAAAAAAAAGGCCGGCCA-3 '

SΕQ ΕD NO:45 3 ' -TCCTCCAATTAATTGGTACCTTTTTTTTTCCATGGTTTTTTTTTCCGGCCGGTGATC-5 '

SΕQ LD NO:46

The resulting ampicillin resistant clones were screened for introduction of a Kpnl restriction site. The plasmid from one positive clone was sequenced and was found to have the conect sequence in the region of the inserted linker/adaptor (ATG SΕQ # 646 and 647; primers p38-S5576 and P65-A106). This plasmid was named ρAl-CB-Nco-1 (ATG glycerol stock #438).

P. Construction of pAl-CB-Nsil Starting Vector To prepare the pAl-CB-Nsil plasmid (ATG project II), pAl-CB-Nco-1 was digested with restriction endonucleases Pad and Kpnl to remove the polylinker containing the restriction sites Pacl-NcoI-spacer-Kpnl. Two oligonucleotides (ATG linker/adaptor #P68-S1 and P68-A1) were annealed to form the adaptor/linker shown below as SEQ ED ΝO:47 and SEQ ED NO:48. This adaptor/linker contained Pad and Kpnl sticky ends to allow insertion into the conesponding PacVKpnl digested pAl- CB-Nco-1 plasmid. The plasmid was resealed and transformed into DH5α. Introduction of this adaptor/linker into pAl-CB-Nco-1 formed a new polylinker containing the restriction sites Xbal-PacI-Nsil-spacev-Kpnl-SOacer-Fsel-Spel. The only change was the replacement of the Ncol restriction site with an Nsil restriction site.

5 ' -TTAAATGCATAAAAAAAAAGGTAC-3 ' SEQ LD NO :47

3 ^■ - TAATTTACGTATTTTTTTTTC - 5 ^■ SEQ LD NO : 48

The resulting clones were screened for introduction of an Nsil restriction site. One positive clone was sequenced and was found to have the conect sequence in the region of the inserted linker/adaptor (ATG SEQ # 663, primer P65-A106). This plasmid was named ρAl-CB-Nsi-1

(ATG glycerol stock #445).

E. Construction of pAl-CB-Ndel Starting Vector To construct plasmid pAl-CB-Ndel (ATG project C2-3), pAl-CB-Ncol was digested with Noel. The overhanging ends were blunted with Klenow fragment to destroy the Noel restriction site outside of the polylinker re- gion. The linear plasmid was resealed fonmng pAl-CB-ΝcoI(ΝdeI-). This plasmid was transformed into DH5α and plasmids were isolated from one resulting ampicillin-resistant colony. The plasmids were screened for the loss of the Ndeϊ site. The region filled in by Klenow fragment was sequenced to confirm the loss of the Noel site (ATG SEQ 661, primer P65-S2529). pAl-CB-ΝcoI(ΝdeI-) was digested with Pad and Spel restriction enzymes. This removed the polylinker containing PαcI-NcoI-spacer-Kpnl-spacev-Fsel-Spel restriction sites. An annealed

DΝA duplex or adaptor/linker (shown below as SEQ ID ΝO:49 and SEQ ID NO:50) containing Pad and Spel sticky ends (ATG linker/adaptor P65-S1 and P65-A1) was inserted into the digested pAl-CB-NcoI(NdeI-) plasmid.

5' -TAACAATGAAAAAAAAAACCAGGTTGCTAGCGGTACCA-3 ' SEQ ED NO:49

3 ' -TAATTGTATACTTTTTTTTTTGGTCCAACGATCGCCATGGTGATC-5' SEQ ED NO:50 The introduction of this adaptor/linker into pAl-CB-NcoI(NdeI-) formed a new polylinker containing the restriction sites PacI-Ndel-spacer-Nhel-Kpnl-Fsel-Spel. This plasmid was transformed into DH5α and the plasmids were isolated from one resulting ampicillin-resistant colony. These plasmids were screened for the introduction of an Ndel site. The region containing the inserted sequence was subjected to DΝA sequencing to confinn insertion of the conect sequence (ATG SEQ #718, primer P38-S5576). This plasmid was named pAl-CB-Νdel (ATG glycerol stock #464).

F. Construction of pAl-ΝB-Ayr-2 Starting Vector To construct pAl-NB-Avr-2 (ATG project B 1-2), DRK-N(M), a plasmid designed for expression of proteins with an amino- terminal tag was used as the starting plasmid. The amino-terminal tag is composed of a 30 amino acid peptide that is biotinylated in vivo, a hexahistidine site, and thrombin cleavage site (Kim, D. R. and McHenry, C. S. (1996) supra). Also, there is a pBR322 origin of replication, a gene expressing the laqI^Q repressor protein, and a semisynthetic E. coli promoter (pAl) that is repressed by the lαcf¹ repressor. The following two oligonucleotides were separately synthe- sized, amiealed to form a duplex with sticky ends (Avrlϊ and Sail), and inserted into the

AvrlllSall digested pDRK-N(M). The synthetic linker/adaptor is comprised of two annealed oligonucleotides (ATG linker/adaptor P64-S1 and P64-A1) (shown below as SEQ LD NO:51 and SEQ ED NO:52).

5 ' -CTAGGAAAAAAAAAGGTACCAAAAAAAAAGGCCGGCCACTAGTG-3 ' SEQ LD NO:51

3 ' - CTTTTTTTTTCC ATGGTTTTTTTTTCCGGCCGGTGATCACAGCT - 5 ' SEQ LD NO : 52

The insertion of these annealed DNA fragments converted the polylinker following the fusion peptide from Avrll-DralU-Sall to Avrll— spacer— Kpήl— spacer— Fsel— Spel— Sail. These plas- mids were transformed into DH5α strain of E. coli and the resulting ampicillin resistant colonies were screened for plasmids that contained a Spel site carried by the linker/adaptor. One positive clone was selected and the sequence of the inserted region was confirmed by DNA sequencing across the linker/adaptor region (ATG SEQ #648, primer P64-A215). This plasmid was named pAl-NB-Avr-2 (ATG glycerol stock #439). G. Construction of pAl-NB-Kpnl Starting Vector The pAl-NB-Avr-2 plasmid was modified to construct pAl-NB-Kpnl (ATG project DI) by replacing the polylinker containing the^vrlL-spacer-Kpnl— spacer-Esel-S^el-Sα/I with a polylinker containing the restriction sites Pstl-Kpnl-Spacer-Nsil-SacI-Nhel-Hindlll-spacer-Spel. This was accomplished by diges- tion of pAl-NB-Avr-2 with Pstl and Spel restriction enzymes and insertion of the annealed DNA duplex shown below (ATG adaptor/linker # P64-S1 and P64-A1). The ends of the annealed duplex DNA formed sticky ends conesponding to Pstl Spel restriction sites (shown below as SEQ ED NO:53 and SEQ ED NO:54).

5 ' -GGTACCAAAAATGCATGAGCTCGCTAGCAAGCTTAAAAAAAAAA-3 ' SEQ ED NO:53 3 ^■ -ACGTCCATGGTTTTTACGTACTCGAGCGATCGTTCGAATTTTTTTTTTGATC-5 ' SEQ ED NO:54

The first spacer allows PstUNsil double digests and the last spacer allows HindHI/Spel double digests. The plasmids were transformed into DH5α strain of E. coli and ampicillin resistant colonies were screened for plasmids that contained HindlH restriction site canϊed by the linker/adaptor. The sequence of the linker/adaptor region was confirmed by DNA sequencing (ATG SEQ #662, primer P64-A215). This plasmid was named pAl-NB-Kpn-1 (ATG glycerol stock #446).

Example 2. Cloning and Expression of S. pyogenes Polymerase III (PolC) Catalytic Sub- unit

Sequence information released as part of the University of Oklahoma's Streptococcal Genome Sequencing Project was utilized to identify genes and gene products of replication ap- paratus components. A search of the S. pyogenes sequence database vs. a prototypical low

G+C gram-positive firmicute polC gene (B. subtilis) revealed significant homology to two contiguous sequences (contig 207 and 301, contig numbering as of March 1997 ). Upon closer examination, it became apparent that contig. 207 contained an open reading frame (ORF) that was homologous to the amino-terminus of B. subtilis PolC, and contig 301 contained an open reading frame homologous to the remainder of B. subtilis PolC, but also contained 148 residues of identical overlap with the contig. 207 open reading frame. The overlap at the DNA sequence level was identical, as well, eliminating the possibility of two related genes. Contig. 207 and 301 overlap and together encode the entire S. pyogenes polC, the catalytic subunit of DNA polymerase III type II. The two sequences were merged in the region of overlap and translated to provide the complete sequence of S. pyogenes polC, which is 51% identical and aligns over its entire length with B. subtilis polC.

In addition to the "prototypical" gram-positive DNA polymerase III (type II), a second DNA polymerase III- like sequence was detected in the S. pyogenes genome at the Streptococcal Genome Sequencing Project. Others have detected this DNA polymerase ILI-like second sequence for other gram-positive organisms. Searches of the S. pyogenes sequence database vs. E. coli pol III found some homology to a sequence (contig 226, contig numbering as of March 1997 ). This "type I" DNA polymerase III that resembles the E. coli DNA polymerase III has not previously been purified from any organism that also expresses the prototypical gram-positive (type II) polymerase. Thus, its existence and activity remained hypothetical until now. The existence of two DNA polymerase Ills in S. pyogenes raises issues pertaining to their contributions and which one(s) participate(s) directly in DNA replication. Thus, it became necessary to also express the S. pyogenes type I DNA polymerase III (StDnaΕ) to allow these issues to be resolved. A. Construction of Plasmids (pAl-StpolC) that Overexpress S. pyosenes Type II α- subunit (StpolC gene) from the pAl Promoter (pAl) The construction of pAl-StpolC (ATG project G) was performed by insertion of the S. pyogenes polC gene into the pAl-CB-Cla-2 plasmid. T epolC gene was amplified from S. pyogenes genomic DNA using PCR (a gift from Dr. Brace Roe at the Univ. of Oklahoma). The forward/sense primer (ATG # P73-S1, 5'- CC ATCGATGTC AGATTTATTCGCT-3 ' , SΕQ LD NO:55), used in the PCR reaction was designed to have a upstream Clal site that overlaps the "AT" of the "ATG" start codon of the polC gene. The underlined region of forward/sense primer indicates nucleotides that are complementary to the 5' end of the gene, here and in sequences below. The reverse/anti-sense primer (ATG # P73-A4411, 5 ' -GAGCTAGCTAGAAAAAGTC ATC AAA-3 ' , SΕQ ID NO:56) was designed to add an Nhel site downstream of the S. pyogenes polC "TAG" stop, which would overlap the "G" of the stop codon. The underlined region of reverse/antisense primers indicates nucleotides that are complementary to the 3' end of the gene, here and in sequences below. This 4.4 kb PCR fragment containing the entire S. pyogenes polG gene was digested with two restriction enzymes Clal and NΛel and inserted into the ClaVNhel digested pAl-CB- Cla-2 plasmid. Plasmids were transformed into E. coli and plasmid-containing colonies were selected by ampicillin resistance. The plasmids were prepared and screened for by N7ze II Clal restrictions digests yielding 4.4 and 5.6 kb fragments and Kpnl digests yielding 1.38 and 8.65 kb fragments. The conect sequence of both strands of the DΝA containing the entire polC gene was confirmed by DΝA sequencing (ATG SΕQ #721-723, 725-739, 741-742; primers: P38-S5576, P73-S377, P73-S778, P73-S1567, P73-S2001, P73-S2444, P73-S2782, P73-

S3240, P73-S3590, P73-S3985, P73-A106, P73-A4064, P73-A3593, P73-A3237, P73-A2785, P73-A2403, P73-A2027, P73-A1578, P73-A830, P73-A393). This plasmid canying the wild- type S. pyogenes polC gene was designated pAl-StpolC (ATG glycerol stock #468 and # 497). The DNA coding sequence of the S. pyogenes type II α- subunit gene (polC) is shown in Figure 2( SEQ LD NO:l). The start codon (atg) and the stop codon (tag) are shown in boldface letters. Also shown is the protein (amino acid) sequence derived from the DNA coding sequence (Figure 3, SEQ ID NO:3). B. Verification of Expression of Native S pyogenes type II α subunit (polC gene product StPolC) bv rjAl-StpolC/MGC1030 pAl-StpolC plasmids were transformed into MGC1030 E. coli bacteria (mcrA, mcrB, lamBDA(-), in (RRND-RRNE)l, lexA3). Single colonies of transformed cells selected for by ampicillin resistance were inoculated into 2 ml of 2xYT culture media (16 g/L bacto-tryptone, 10 g/L bacto-yeast extract, 5 g/L NaCl, pH 7.0) containing 100 μg/ml ampicillin and grown overnight at 37 °C in a shaking incubator. Following overnight growth, 0.5 ml of the turbid culture was used to inoculate 1.5 ml of the same media. The cultures were grown for 1 hour at 37 °C with shaking and expression was induced by addition of isopropyl-β-D-thiogalactopyranoside (LPTG) to a final concentration of 1 mM. The cells were harvested by centrifugation 3 hours post-induction. The cell pellets were immediately resuspended in 1/10 culture volume of 2x Laemelli sample buffer (125 mM Tris-HCl (pH 6.8),

20% glycerol, 4% sodium dodecyl sulfate (SDS), 5% β-mercaptoethanol (βME) and 0.005% bromophenol blue w/v), and sonicated to complete lyses of cells and to shear the DNA. The samples were heated for 10 minutes at 90-100 °C, and centrifuged to remove insoluble debris. A small aliquot of each supernatant (3.5 μl) was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and

0.1% SDS. A protein, migrating midway between 120 kDa and 200 kDa, the high molecular weight standard of the Gibco 10 kDa protein ladder, was observed as a distinct band in the induced cultures, but was not observed in the uninduced control. This protein was determined to be consistent with the expected molecular weight of 165 kDa calculated from the StPolC amino acid sequence. The detected protein represented approximately 5% of the total E. coli protein, based on the intensity of Coomassie blue staining of the protein bands on the gel.

C. Large-Scale Growth of Native S pyosenes Type II α-subunit (yolG Gene Product StPolC) bvpAl-StpolC/MGC1030 Strain pAl-StpolC/MGC1030 was grown in a 250 L fermentor (Fermentation Run # 98-11), to produce cells for purification of S. pyogenes polC gene product (StPolC). F-medium (1.4% yeast extract, 0.8% tryptone, 1.2% K₂HPO₄, and 0.12%

KH₂PO₄, (pH 7.2)) was sterilized, glucose was added to 1% from a 40% sterile solution and ampicillin (100 mg/L) was added. A large-scale inoculum (to 28 L), was initiated from a 1 ml glycerol stock culture (i.e., culture stored in 15% glycerol at -80 °C) and grown overnight at 37°C with 40 LPM aeration. The inoculum was transfened (approximately 5.6 L) to the 250 L fermentor containing 160 L of F-medium with 1% glucose, and 100 mg/L ampicillin (starting OD₆oo of 0.06, i.e., the optical density (OD) is a unit used to measure light scattered by particles (cells) in solution at a particular wavelength (600 nanometers) in calculating the concen- tration of the particles (cells) in the solution). To calculate the amount of overnight culture to add to a fermentor run, in this fermentation there was 160 L initial F-media, enough should be added to bring the media present in the fermentor to an OD₆oo = 0.06. This allows enough time for the cell density to double 3-4 times before induction. Quality control of the inoculum showed that 10 out of 10 colonies grown on LB media were also able to grow on ampicillin- containing medium. This constitutes positive colonies here and in following sections. The culture was incubated at 37 °C, with 40 LPM aeration, and stined at 20 rpm. Expression of S. pyogenes polC was induced by addition of LPTG to 1 mM when the culture reached an OD₆oo= 0.85 (expression of foreign proteins in E. coli is induced when the cell density reaches approximately an OD₆oo= 0.6-0.8). Additional ampicillin (200 mg/L) was added at the same time as induction. One hour post-induction, the temperature was reduced to 28 °C and additional ampicillin (200 mg/L) was added at 2 hours post-induction. The pH was maintained at 7.2 throughout the growth by addition of NH OH. Cell harvest was initiated 3 hours after induction at OD₆oo equivalent of 8.88, and the cells were chilled to 10 °C during harvest. The harvest volume was 170 L, and the final harvest weight was approximately 1.9 kg of cell paste. An equal amount (w/w) of Tris-sucrose buffer (50 mM Tris (pH 7.5), 10% sucrose) was added to the cell paste. Cells were frozen by pouring the cells suspension into liquid nitrogen, and stored at -20 °C, until processed.

D. Determination of Optimal Ammonium Sulfate Precipitation Conditions of Native S pyogenes PolC As an initial purification step, many endogenous E. coli proteins can be re- moved by adding ammonium sulfate to concentrations that cause the protein of interest (and some endogenous proteins) to precipitate out of solution, while other proteins remain in solution. The precipitated protein can then be separated from the proteins still in solution by centrifugation. Each protein precipitates out of solution at different concentrations of ammonium sulfate (depending on amino acid composition, distribution of polar/non-polar surface exposed amino acids, molecular shape and level of hydration). Therefore, the concentration of ammonium sulfate (expressed as percent saturation) in which each target protein precipitates out of solution has to be determined. StPolC Frl (410 ml) was obtained from lysis of 100 g of cells (pAl-StpolC/MGC1030) as described in Example 2E. Frl was divided into six samples of 60 ml each and labeled 30%, 35%, 40%, 45%, 50% and 70%. The protein in each sample was precipitated by adding varying amounts ammonium sulfate so that the final concentration of ammonium sulfate was: 30%, 35%, 40%, 45%, 50%, and 70% saturation, respectively, at 4 °C The mixture was stined for an additional 30 min at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 °C). The supernatant was removed from each sample and the resulting pellets were resuspended in buffer T (50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 20% glycerol, 1 mM DTT, 25 mM NaCl). The protein concentration of each sample from the resuspended pellets and the supematants was determined using the Coomassie Protein Assay Reagent (Pierce) and bovine serum albumin (BSA) as a standard. The resuspended pellets from the 40% ammonium sulfate precipitated samples contained over 90% of the total S. pyogenes PolC and this concentration of ammonium sulfate was used in all subsequent precipitations of PolC. The samples were also analyzed by SDS-PAGE as described above. E. Purification of S pyogenes polC Product from Large-Scale Growth of pAl-

StpolC/MGC1030 The first step in purification of proteins is to lyse the protein over- expressing cells and separate the recombinant protein from most of the other cellular components. Lysis of cells from the large-scale growth of pAl-StPolC/MGC1030 was accomplished by creation of spheroplasts of the cells canying the expressed S. pyogenes PolC. 1000 g of a 1:1 suspension of frozen cells (500 g cells) in Tris-sucrose which had been stored at -20 °C were added to 1375 ml Tris-sucrose buffer that had been pre-warmed to 55 °C (2.75 ml/g of cells). To the stined mixture, 25 ml of 0.5 M 1,4-dithiothreitol (DTT) (0.05 ml/g of cells) and 125 ml of lysis buffer (2M NaCl, 0.3M spermidine in Tris-sucrose adjusted to pH 7.5) (0.25 ml/g of cells) was added. Spermidine (18 mM) in the lysis buffer was added to keep the nu- cleoid condensed within partially disrupted cells and to displace DNA binding proteins. The pH of the slurry was adjusted to pH 7.5 by the addition of 5 ml of 2 M Tris base, and 1 g ly- sozyrne (Worthington Biochemical Corporation, cat #38H2088) was added resuspended in 25 ml of Tris-sucrose buffer (2 mg lysozyme/g of cells). The sluny was distributed into 250 ml centrifuge bottles after stining 5 min and incubated at 4 °C for 1 hour. The 250 ml centrifuge bottles were then placed in a 37 °C swirling water bath and gently inverted every 30 seconds for 4 minutes. The insoluble cellular components were removed by centrifugation (23,000 x g, 60 min, 4 °C). The recovered supernatant (1.9 1) constituted Fraction I (Frl) (12.8 mg/ml). All protein concentrations here and below are determined using the Coomassie Protein Assay Re- agent from Pierce using bovine serum albumin (BSA) as a standard. To Frl, ammonium sulfate (0.226 g to each initial ml Fraction 1-40% saturation) was added over a 15 min interval. The mixture stined an additional 30 min at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 °C). The resulting pellets were quick frozen by immersion in liq- uid nitrogen and stored at -80 °C until fixture use.

F. Assay to Determine the Ability of S. Pyosenes polC Product (StPolC) to Extend Primed DNA (Gap Filling Assay) The catalytic subunit of a replicative complex has a very low processivity in the absence of other holoenzyme subunits on the primed template. However, the catalytic subunit can fill the gaps of activated (gapped) DNA very effectively by fast association and dissociation reactions in low salt conditions (McHenry and Crow (1979) J.

Biol. Chem. 254: 1748-1753). Assay mixtures (25 μl) contained 32 mM HEPES (pH 7.5), 13% glycerol, 0.01% Nonidet P40, 0.13 mg/ml BSA, 10 mM MgCl₂, 0.2 mg/ml activated calf- thymus DNA, 57μM each of dGTP, dATP, and dCTP, and 21 μM [³H]TTP (approximately 100 cpm/pmol). The reactions were started by the addition of a dilution of samples of DNA poly- merase and incubated at 30 °C for 5 minutes. The reactions were stopped by placing the reaction tube on ice. The amount of DNA synthesized in the assay was measured by first precipitating the DNA with 2 drops of 0.2 M sodium pyrophosphate (PPi) and 0.5 ml of 10% TCA. Trapping of precipitated DNA and removal of unincorporated nucleoside triphosphates was accomplished by filtering the mixture through GFC filters (Whatman) and washing the filters with 12 ml 0.2M sodium PP;/1M HCl and then 4 ml of ethanol. The filters were then allowed to dry and [³H]TTP incorporated was quantified by immersing the filters in 5 ml of liquid scintillation fluid (Ecoscint-O, National Diagnostics) and counting on a Beckman LS 3801 scintillation counter. One unit of enzyme activity is defined as one picomole of total nucleotides incorporated per min at 37 °C. Positive controls containing E. coli DNA pol III were included in each set of assays.

G. Growth, Expression and Activity Optimization of S pyogenes PolC Early purification efforts of S. pyogenes PolC resulted in high levels (up to 10% of the cell protein) of inactive enzyme. Numerous approaches (over 20 different conditions), including expression at decreased temperature, alternative lysis methods, Zn^"1^ supplementation, alternative lysis buffers and growth in the presence of osmolytes were attempted without success. Co-expression with heat shock proteins proved successful. When expressed in a background with groΕL and groES heat shock proteins expressed from a second plasmid with a compatible origin (Gaspers, P. et al. (1994) Cell. Mol. Biol. 40: 635-644), significantly elevated levels of activity were ob- served in extracts and in low percentage ammonium sulfate cuts that do not precipitate E. coli DNA polymerase I, the major background activity. In preliminary experiments, the activities of ammonium sulfate fractions enriched in either native S. pyogenes PolC or N-terminal bioti- nylated StPolC were found to have approximately equivalent activity, consistent with the ob- servations with E. coli DNA polymerase III (Kim, D. R. and McHenry, C. S. (1996) J. Biol.

Chem. 271: 20681-20689). Thus, the experiments described below were performed using the hexahis/biotin tagged protein to facilitate purification. Upon purification of the hexahis/biotin tagged protein on Ni-NTA chromatography columns, highly purified but inactive protein in the imidazole-eluted fractions was observed. DNA polymerase III type II enzymes are metallopro- teins (Barnes, M. H. et al. (1998) Biochemistry 37: 15254-15260) and it was hypothesized that the Ni-NTA matrix might be removing the enzyme-associated metal ion(s) and thus inactivating the enzyme. Next "soft-release" monomeric avidin affinity columns using the enzyme whose folding was assisted by groΕL/ΕS were exploited with striking success. In a single step, nearly pure S. pyogenes PolC was obtained, with the specific activity of the peak fraction greater than 1 million units/mg, which is comparable to other DNA polymerase Ills. This work is detailed in the following sections.

H. Construction of pAl Promoter-Containing Plasmids (pAl-NB-StpolC) that Overex- press S. pyogenes PolC Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site (NB) To permit rapid purification of S. pyogenes PolC, plasmids were de- signed to fuse the S. pyogenes polC gene to the downstream end of a sequence designed to express a hexahistidine/biotin binding fusion peptide (Kim, D. R. and McHenry, C. S. (1996) J. Biol. Chem. 271 : 20690-20698) (ATG project H). The 5' end of the gene encoding the S. pyogenes PolC was amplified by PCR. The forward/sense primer (ATG # P73-S3, 5'-CTGCAG TCAGATTTATTCGCTAA-3 ' SΕQ LD NO: 19) was designed so that the 5' end of the primer contained a non-complementary Pstl site. This Pstl restriction sequence was placed adjacent to

17 nt that are complementary to the 5' end of t polC gene beginning at codon #2, so that the normal initiating ATG start codon was excluded from the PCR product. The reverse/antisense primer (ATG primer # P73-A1024, 5'-CGACCCGCTTTTGCCCTTCTG-3' SΕQ ID NO:58) was complementary to a region downstream of a unique Sαcl restriction site located within the S. pyogenes polG gene. The product of this PCR reaction was digested with Pstl and Sαcl and inserted into the pAl-NB-Kpn-1 plasmid digested with the same restriction endonucleases and re-ligated with T4 DNA ligase. Integration of the 5' end of the gene encoding the S. pyogenes PolC beginning at codon #2 into the Pstl site of pAl-NB-Kpn-1 places the polC gene in-frame with the amino-terminal hexahistidine/biotin binding fusion protein. This plasmid was transformed into DH5α and positive isolates were selected for ampicillin resistance. Plasmids were prepared from one positive isolate and the sequence of the inserted region was confirmed by DNA sequencing (ATG SEQ # 743-746; primers P64-A215, P73-A393, P73-S377 and P38- S5576). The result of this insertion formed the intermediate plasmid pAl-NB-StpolC(5') and the isolate was grown and stored as a glycerol stock culture (ATG glycerol stock #471). The 3' three-fourths of the gene encoding the S. pyogenes PolC was cut out of the pAl-StpolC plasmid using the restriction enzymes Sαcl and Spel (located just downstream of the stop codon). This 3' fragment was inserted into the pAl-NB-StpolC(5') plasmid digested with the same Sαcl and Spel restriction enzymes. The plasmid was re-ligated with T4 DNA ligase and plasmids containing the entire gene encoding S. pyogenes PolC were transformed into DH5α. Plasmids from positive isolates were screened for by digesting with SacUSpel (yielding 3.5 kb, 6.4 kb fragments) and NdeUSpel (yielding 1.8 kb, 2.4 kb, 2.7 kb, 3.1 kb fragments). This plasmid was named pAl-NB-StpolC and the isolate was grown and stored as a stock culture (ATG glycerol stock #480).

I. Verification of Expression of S. pyogenes PolC Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site by pAl-NB-StrjolC/MGC1030 and pAl-NB- StpolC/DH5α l^"rjREP4-GroESL1 pAl-NB-StpolC plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #501) or DH5α [pREP4-GroESL] bacteria (ATG glycerol stock #772) using methods described in Example 1 A. The DH5α [pREP4-GroESL] bacteria also contained a plasmid carrying genes encoding E. coli heat shock (chaperon) proteins GroES and GroEL (Caspers P. et al. (1994) Cell. Mol. Biol. 40: 635-644) to investigate whether these chaperon proteins enhance proper folding of NB-StpolC (see following sections). Two 1.5 ml volumes of 2xYT culture media containing 100 μg/ml ampicillin was inoculated 1:50 (v/v) from overnight cultures of pAl-NB-StpolC/MGC1030 and pAl-NB-StpolC/DH5α [pREP4-

GroESL] and grown at 37 °C with shaking (200 rpm) until the OD₆oo reached about 0.6. Protein expression was induced by adding EPTG to a final concentration of 1 mM followed by the addition of -biotin to a final concentration of 10 μM. The control culture received J-biotin only (the culture was not induced with EPTG). After allowing 3 hours for protein expression, each culture was harvested by centrifugation. Cells pelleted by centrifugation from 1 ml cultures were resuspended in 1/10 culture volumes of 2x Laemelli sample buffer (2x solution: 125 mM Tris-HCl (pH 6.8), 20% glycerol, 4% SDS, 5% β-mercaptoethanol (βME), and 0.005% bromphenol blue w/v), and sonicated, to. complete lysis of cells and to shear the DNA. The samples were heated for 10 minutes at 90-100 °C, and centrifuged to remove insoluble debris. A small aliquot of each supernatant (3.0 μl), conesponding to 0.0429 OD₆oo was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS (w/v). A protein band from both cultures migrating midway between 120 kDa and 200 kDa, the high molecular weight standard of the Gibco 10 kDa protein ladder, was observed as a distinct band in each of the induced cultures, but was not observed in the uninduced controls. These proteins were determined to be consistent with the expected molecular weight of 168 kDa. The detected protein from both cultures represented approximately 5% of the total E. coli protein, based on the intensity of Coomassie blue staining of the protein bands on the gel.

Here and in following sections "Biotin blot" analysis is used to specifically detect a protein fused to an N- or C-terminal peptide that contains a biotinylation site. In nonnally growing cells a certain percentage of proteins containing a biotinylation site are bound by biotin. The detection of these proteins is by virtue of avidin binding to the biotin bound to the fu- sion peptide. Alkaline phosphatase-conjugated streptavidin (Pierce Chemical Company, Rock- ford, IL, Catalog #21324) is used and can be detected using chemicals that allow the alkaline phosphatase and therefore the protein of interest to be visualized.

The total protein in each lysate was transfened (blotted) from polyacrylamide gel to nitrocellulose using a Novex transfer apparatus at 30 V constant voltage in 12 mM Tris base, 96 mM glycine, 0.01% SDS (w/v), and 20% methanol (v/v) for 60 minutes at room temperature.

Each lane contained 1 μl of the supernatant, prepared as described above, conesponding to 0.0143 OD₆oo units of culture material. The blotted nitrocellulose was blocked in 0.2% Tween 20 (v/v)-TBS (Tris-buffered saline; 8 g/L NaCl, 0.2 g/L KC1, 3 g/L Tris-HCl, (pH 7.4)) containing 5% non-fat dry milk (w/v) for 1 hour at room temperature. The blotted nitrocellulose was next rinsed with 0.2% Tween 20 (v/v)-TBS (TBST), and then incubated in 2 μg/ml alkaline phosphatase-conjugated streptavidin (Pierce Chemical Company, Rockford, IL, Catalog #21324) in TBST for 1 hour at room temperature. Following extensive washing in TBST, the blot was developed with BCEP/NBT (KPL #50-81-07; one component system). The endogenous E. coli biotin-carboxyl carrier protein (biotin-CCP), ca. 20 kDa was detectable in both induced and non-induced samples. A protein from each culture, migrating midway between

120 kDa and 200 kDa, the high molecular weight standard, of the Gibco 10 kDa protein ladder was observed as a distinct band in each of the induced cultures, but was not observed in the uninduced control. J. Large-Scale Growth of S. pyogenes PolC Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site bvpAl-NB-StpolC/DH5α rpREP4-GroESL] and pAl-NB-StpolC/MGC1030 Strains pAl-NB-StpolC/DH5α [pREP4-GroESL] (fermentation run #99-20) and pAl-NB-StpolC/MGC1030 (fermentation run #99-24) were grown in a 250 L fermentor to produce cells for purification of S. pyogenes PolC fused to an N-terminal hexahistidine and a biotinylation site. Growth conditions were as described in Example 2C. Cell harvest was initiated 2.5 and 1 hour after induction (respectively), and the cells were chilled to 10 °C during harvest. The harvest volume was 180 L, and the final harvest weight was approximately 1.35 and 0.58 kg of cell paste, respectively. An equal amount (w/w) of Tris-sucrose buffer was added to the cell paste, mixed and then frozen by pouring the cell suspensions into liquid nitrogen. Cell paste was stored at - 20°C, until processed.

K. Purification of S. Pyogenes polC Product (PolC) Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site by ρAl-NB-StpolC/DH5α FPREP4- GroESL] Lysis of 1000 g of a 1:1 suspension of frozen cells (500 g of cells) containing pAl- NB-StpolC/DH5α [pREP4-GroESL], stored in Tris-sucrose at -20 °C, was preformed as described in Example 2E. The recovered supernatant (1.88 1) constituted Frl. The concentration of Frl was 21 mg/ml giving 39.5 g total protein. To Frl, ammonium sulfate (0.291 g to each initial ml Fraction 1-50% saturation) was added over a 15 min interval. The mixture was stined for an additional 30 min at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 °C). The resulting pellets were quick frozen by immersion in liquid nitrogen and stored at -80 °C.

Pellets containing ammonium sulfate precipitated protein from approximately 25 g of original cell weight were resuspended in 7 ml of phosphate buffered saline plus buffer (PBS plus) (25% glycerol, 75 mM sodium phosphate (pH 7.2), 112 mM NaCl, 1 mM phenylmethyl- sulfonyl fluoride (PMSF), 5 mM DTT). The suspension was homogenized using a Dounce homogenizer. The resulting solution was centrifuged (16,000 x g) and the supernatant constituted FrII (90 mg/ml).

Subsequently, the 6.5 ml of FrII was loaded onto a 2 ml UltraLink™ Immobilized Monomeric Avidin column (1.1 cm x 2.5 cm) (Pierce) equilibrated in phosphate buffered sa- line solution (PBS) (0.1 M sodium phosphate, (pH 7.2), 0.15 M NaCl) according to manufacturers instructions. The sample was loaded at a flow rate of 0.09 ml/min. The flow through was passed back through the column two times to allow all biotinylated protein to bind the avidin. The column was next washed with 60 ml of PBS plus buffer, at a flow rate of 0.08 ml/min (fractions 1-34). Fractions (2 ml) were collected continuously through the wash and elution procedure. The NB-StPolC was eluted from the column in 24 ml of PBS elution buffer (2 mM D-biotin, 10% glycerol in PBS) at a flow rate of 0.09 ml/min (fractions 35-47). Each fraction was assayed to determine protein concentration and activity in gap filling assays (Figure 4). The fractions beneath the protein and activity peaks were analyzed by SDS-PAGE. In fractions 35-47, Coomassie-stained SDS-PAGE gel analysis indicated that the PolC protein was over 95% pure.

Fractions 35-47 contained activity in gap filling assays and were pooled and constituted Frill (0.1 mg/ml). Frill (24 ml) contained over 95% pure protein (0.1 mg/ml) resulting in 2.2 mg of purified S. pyogenes PolC expressed in the presence of the chaperon proteins GroES and GroEL. Figure 5 shows SDS-PAGE analysis (Coomassie Blue staining) of PolC at different stages of purification described above. Fractions 1-3 were denatured and subjected to electrophoresis on a 10% SDS-polyacrylamide. Frl (cell lysate, 50 μg), FrII (ammonium sulfate-40%, 50 μg) and Frill (avidin affinity column peak, 10 μg). Table III summarizes NB-St-PolC purification. Five hundred grams of cells were originally lysed to produce Frl, however only enough Frl equal to lysis of 12.5 g of cells were carried to Frill, therefore Table III represents lysis of 12.5 g cells.

Table III. NB-StPolC Purification Summary (pAl-NB-StpolC/ DH5α [pREP4-GroESL)

L. Purification of S Pyogenes yolG Product (PolC) Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site bvpAl-NB-StpolC/MGC1030 (no GroESL) Cells over-expressing NB-StPolC in the absence of chaperon proteins were analyzed. Lysis of 200 g of a 1:1 suspension of frozen cells (100 g of cells) containing pAl-NB- StpolC/MGC1030 stored in Tris-sucrose at -20 °C, was preformed as described in Example 2E. The recovered supernatant (0.4 1) constituted Frl (7.9 mg/ml). To Frl, ammonium sulfate (0.291 g to each initial ml Fraction 1-50% saturation) was added over a 15 min interval. After stirring an additional 30 min at 4 °C the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 °C) and the resulting pellets were quick frozen by immersion in liquid nitrogen and stored at -80 °C. The ammonium sulfate precipitate from approximately 25 g of original cell weight was resuspended in 7 ml of PBS plus buffer and homogenized using a Dounce ho- mogenizer. The resulting solution was clarified by centrifugation (23000 x g, 4 °C, 30 min) and the supernatant constituted FrII (18 mg/ml). Subsequently, the 7 ml of FrII was loaded onto a 2 ml UltraLink™ Immobilized Monomeric Avidin column (1.1 cm x 2.5 cm) (Pierce) equilibrated in PBS. The column was next washed with 70 ml of PBS plus buffer at a flow rate of 0.07 ml/min (fractions 1-35). Fractions (2 ml) were collected continuously through the wash and elution procedure. The NB-StPolC was eluted from the column in 26 ml of PBS elution buffer (2 mM D-biotin, 10% glycerol in PBS) at a flow rate of 0.09 ml/min (fractions 35-47). Each fraction was assayed to determine protein concentration and activity in gap filling assays.

The fractions beneath the protein and activity peaks were analyzed by SDS-PAGE and each fraction (35-47) was over 95% pure.

When the recovery of PolC proteins expressed in the presence and absence of GroES and GroEL were compared, the total units of activity after avidin column purification was 40 times less when S. pyogenes PolC was grown in the absence of the chaperon proteins. This observation indicates that the chaperon proteins aid in the overall recovery of activity.

M. Production of Polvclonal Antibodies Against S. pyogenes PolC Fused to an N- Terminal Peptide That Contains Hexahistidine and a Biotinylation Site (NB-PolC) For production of polyclonal antibodies against S. pyogenes NB-PolC, 2 ml of the NB-PolC (0.2 mg/ml) dialyzed in PBS was injected directly into a vial containing adjuvant (RLBI Adjuvant System

(RAS)). This solution was mixed and allowed to come to room temperature. One ml of the adjuvant/NB-PolC mixture was used to inoculate a rabbit (0.2 mg/ml); 0.05 ml in each of six sites intradermal injections, 0.3 ml intramuscular injections in each hind leg, and 0.1 ml subcutaneous injection in the neck region. The rabbit received a booster using the same formulation 28 days after the initial inoculation. A test bleed (10 ml) was collected on day 41. The rabbit received a second booster injection using the same formulation at day 56 and a second test bleed (10 ml) at day 69. The rabbit received a third booster injection at day 105 and another test bleed (10 ml) at day 105. Total blood was collected on day 119.

The optimum concentration for binding of S. pyogenes NB-PolC by antibody serum was determined after each test bleed and after the final bleed. This was carried out using

Western analysis, in which a small aliquot of NB-PolC (4.5 μg/well) was electrophoresed onto a 10% SDS-PAGE mini-gel (10 x 10 cm). The protein was then fransfened onto nitrocellulose membrane as described in Example 21. The membrane was cut into strips with each strip con- taining an identical band of NB-PolC. The blotted nitrocellulose was blocked in 0.2% Tween 20 (v/v)-TBS (TBST) containing 5% non-fat dry milk (w/v) for 1 hour at room temperature and then rinsed with TBST. The strips were placed in antiserum/TBST (dilutions of: 1:100,1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, and 1:12800) for 1 hour and then washed 4 times for 5 min in TBST. Next, the strips were placed in secondary antibody-conjugated to alkaline phosphatase (goat anti-rabbit IgG (H+L), 1 :3000 dilution in TBST) (Bio-Rad® ) for 1 hour. The strips were then washed 4 times for 5 min with TBST. Following this extensive washing, the blots were developed with BCLP/NBT (KPL #50-81-07; one component system). Using antiserum from the total blood collected, proteins conesponding to S. pyogenes PolC were visualized as distinct bands at the highest dilution of antiserum. These bands became more intense as the dilution of antiserum was decreased.

The negative control consists of antiserum that was harvested from the rabbit before antibodies were grown against NB-StPolC. The positive control entailed the detection of NB- StPolC by virtue of avidin binding to the biotin bound at the biotin-binding sequence located in the N-tenninal fusion protein. This procedure is described in Example 21. The less intense bands beneath the NB-StPolC are likely degradation products of the NB-StPolC.

Next, the minimum amount of S. pyogenes NB-PolC needed for recognition by antibody seram was determined. This was carried out using SDS-PAGE in which small aliquots of NB-StPolC (0.002, 0.004, 0.008, 0.016, 0.032, 0.0625, 0.125, 0.250, and 0.50 μg/well) were electrophoresed onto a 10% SDS-PAGE mini-gel (10 x 10 cm). The protein was fransfened onto nitrocellulose membrane and blocked as described above. The membrane was placed in antiserum/TBST (dilution of 1 : 10000) for 1 hour and then washed 4 times for 5 min in TBST. Next, the membrane was placed in secondary antibody-conjugated to alkaline phosphatase (goat anti-rabbit IgG (H+L), 1:3000 dilution in TBST) (Bio-Rad® ) for 1 hour. The membrane was then washed 4 times for 5 min with TBST. Following this extensive washing, the blot was developed with BCLP/NBT (KPL #50-81-07; one component system). Protein conesponding to S. pyogenes NB-PolC was visualized as a distinct band at 0.016 μg of NB-StPolC. These bands became more intense as the concentration of NB-StPolC was increased (Figure 6).

N. Expression of native S. pyogenes PolC in the presence of groES and groEL. Exam- pie 2G demonstrated successful co-expression of S. pyogenes PolC with heat shock proteins. That when expressed in a background with groEL and groES heat shock proteins expressed from a second plasmid with a compatible origin (Caspers, P. et al. (1994) Cell. Mol. Biol. 40: 635-644), significantly elevated levels of activity were observed in extracts and in low percent- age ammonium sulfate cuts that do not precipitate E. coli DNA polymerase I, the major background activity. Ln preliminary experiments, the activities of ammonium sulfate fractions enriched in either native S. pyogenes PolC or N-terminal biotinylated PolC were found to have approximately equivalent activity, consistent with our observations with E. coli DNA poly- merase LH (Kim, D. R. and McHenry, C S. (1996) J. Biol. Chem. 271 : 20681-20689). Thus, to reconstitute an S. pyogenes minimal replication system composed of native subunits, native PolC has been purified.

O. Re-determination of Optimal Ammonium Sulfate Precipitation Conditions of Native S. pyogenes PolC Expressed in the presence of groEL and groES. S. pyogenes PolC Frl (107 ml) was obtained from lysis of 25 g of cells (pAl-StpolC/DH5α [pREP4-GroESL]) as described in Example 2E. Frl was divided into five samples of 21 ml each and labeled 35%, 40%, 45%, 50% and 60%. The protein in each sample was precipitated by adding varying amounts ammonium sulfate so that the final concentration of ammonium sulfate was: 35%, 40%, 45%, 50%, and 60% saturation, respectively, at 4 °C The mixtures were stined for an additional 30 min at 4 °C and the precipitates were collected by centrifugation (23,000 x g, 45 min, 0 °C). The supernatant was removed from each sample and the resulting pellets were resuspended in a buffer containing 50 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, 20% glycerol, 2.0 mM DTT, 25 mM NaCl and designated as FrII. The protein concentration of each sample from the resuspended pellets (FrII) and the supematants was determined using the Coomassie Pro- tein Assay Reagent (Pierce) and bovine seram albumin (BSA) as a standard. The resuspended pellets contained increasing concentration of protein as the % ammonium sulfate used to precipitate the samples was increased. This data was confirmed by SDS-polyacrylamide gel electrophoresis (Figure 7). The FrII from each sample was also assayed by gap-filling activity assays described in example 2F and total units (Figure 8A) and the specific activities (Figure 8B) were detennined. Based on results of SDS-polyacrylamide gel electrophoresis and the activity assays, 45% ammonium sulfate saturation was selected as the optimum condition to yield maximal PolC activity with minimal contamination.

P. Purification of native S pyogenes PolC from Large-Scale Growth of pAl- StpolC/DH5α rpREP4-GroESL]. S. pyogenes PolC Frl (560 ml) was obtained from lysis of 123 g of cells (pAl-StpolC/DH5α [pREP4-GroESL]) as described in Example 2E. Ammonium sulfate was added (0.258 g/ml-45% saturation) to Frl over a 30 min interval. The mix was stined an additional 1 h at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 1 h at 4 °C). The resulting protein pellet was resuspended in Buffer 2 (50 mM Tris-HCl, (pH 7.5), 10% glycerol, 0.5 mM EDTA, 2 mM DTT) resulting in FrII. The PolC subunit in FrII was further purified by a DEAE Sepharose™ Fast Flow (Pharmacia) column (230 ml, 6.0 x 12 cm). The column was equilibrated in Buffer 2 plus 150 mM NaCl. Previous to loading, the sample was diluted with Buffer 2 to the conductivity of the equilibrated DEAE column (378 ml, 11.9 mg/ml) and then loaded onto the column at a flow rate of 0.4 ml/min. 3% of the protein was observed to flow through the column but contained no detectable activity. The column was washed with 5 column volumes of Buffer 2 plus 150 mM NaCl at a flow rate of 3.5 ml/min. 25% of the total loaded protein containing 3% of the total loaded activity was observed in the wash. The protein was eluted from the column in 10 column volumes of Buffer 2 containing a 150-400 mM NaCl linear gradient at a flow rate of 2.0 ml/min. Ninety fractions

(25 ml) were collected and assayed by SDS-polyacrylamide gel electrophoresis (Figure 9A-B) and in reconstitution assays (described in Example 14) (Figure 10). Fractions 32-42 (240 ml) were pooled and contained 50% of the total loaded activity.

The pool from the DEAE column was further purified using a Heparin Sepharose™ Fast Flow (Pharmacia) column. The heparin column (100 ml, 3 x 21 cm) was equilibrated in

Buffer 2 plus 100 mM NaCl. Previous to loading, the sample was diluted in Buffer 2 to the conductivity of the heparin column (415 ml) and loaded onto the column at a flow rate of 1 ml/min. Approximately 65% of the total protein loaded onto the column was observed to flow through the column, and this protein contained 2% of the total loaded activity. The column was washed (1.5 ml/min) with 8 column volumes of Buffer 2 plus 100 mM NaCl. Approximately 24%o of the total protein loaded onto the column was observed in the wash, and this protein contained 2% of the total loaded activity. The protein was eluted from the column (0.7 ml/min) in 10 column volumes of Buffer 2 containing a 100-475 mM NaCl linear gradient. Fractions were collected (100) containing 9.5 ml. Fractions were assayed for protein concen- tration and activity using the reconstitution assay (Figure 11). Fractions 43-52 were pooled (90 ml) and contained over 95% homogeneous S. pyogenes PolC. A summary of the purification steps is shown in Table IV and the result of each purification step was visualized by SDS- polyacrylamide gel electrophoresis (Figure 12). Table IN. Summary of S. pyogenes PolC Purification

Purification Volume Total Protein Total Activity Specific Activity

Step (ml) (mg) (Units) (Units/mg)

Frl 560 16537 6.8 x 10⁴ 4.0

FrII 375 4447 1.9 x lO⁸ 4.2 x 10⁴

Frill 415 801 9.1 x 10⁷ 1.1 x lO⁵

FrlN 90 23 2.5 x 10⁷ 1.1 x lO⁶

Example 3. Cloning and Expression of S. pyogenes Polymerase III (DnaE) Catalytic Sub- unit

A. Construction of Plasmids (pAl-StdnaE) that Overexpress S. pyogenes type I α- subunit from the dnaE gene under Control of pAl Promoter (pAl) In order to compare the functionality of the type I and type II polymerases identified in S. pyogenes, it was also necessary to express the type I α subunit (DnaE). The construction of pAl-StdnaE (ATG project I) was performed by insertion of the native S. pyogenes dnaE gene into the pAl-CB-Νsi-1 plasmid (ATG project 12). The dnaE gene was amplified from S. pyogenes genomic DΝA (a gift from Dr. Bruce Roe at the Univ. of Oklahoma) using PCR. The forward/sense primer (ATG # P74-S1, 5 '-CCAATGCATATGTTTGCTCAACTTGATAC-3 ' SEQ LD ΝO:59) used in the PCR reaction was designed to have an upstream Nsil site to allow insertion into the NstL restriction site in pAl-CB-Νsi-1. The reverse/anti-sense primer (ATG # P74-A3120, 5'-

GGGGTACCTTATCGAAAAACCGTT-3 ' SEQ ID ΝO:60) was designed to add a Kpnl site downstream of the S. pyogenes dnαE TAA stop codon. The 3.1kb PCR fragment contained the entire S. pyogenes dnαE gene and was cut with the two restriction enzymes Nsil and Kpnl and inserted into the NsiVKpnl digested pAl-CB-Nsi-1 plasmid. The plasmids were transformed into DH5α bacteria and positive isolates were selected for ampicillin resistance. Plasmid DNA was prepared from one positive isolate and both strands of DNA were sequenced across the PCR inserted region to confirm the conect sequence (ATG SEQ #747-750, 752, 754-762 and 768, primers P38-S5576, P74-S364, P74-S782, P74-S1167, P74-S1975, P74-S2789, P65- A106, P74-A2726, P74-A2335, P74-A1918, P74-A1545, P74-A1119, P74-A730, P74-A348, P74-A1). The resulting plasmid was named pAl-StdnaE and the positive clone was grown and stored as a stock culture (ATG glycerol stock #498).

The Nsil site contains an extra ATG start codon that was located two codons upstream and in the same reading frame as the authentic dnαE gene ATG start codon (AGGAGGTTAATTAAATGCATATGTTTGCTC (SEQ ID NO:94), both start codons are underlined and the authentic ATG is in bold). To remove the upstream ATG, pAl-StdnaE was digested with Nsil. The 3' overhang on the Nsil site was blunted back with T4 DNA polymerase in the presence of 0.1 mM dNTP's at 12 °C for 20 min. The plasmid was re-ligated which removed the nucleotides TGCA from the sequence hence removing the Nsil restriction site's ATG (AGGAGGTTAATTAAATATGTTTGCTC (SEQ D NO:95)). The plasmids were transfonned into DH5α bacteria and positive isolates were selected for ampicillin resistance. Plasmid DNA was prepared from one positive isolate and the removal of the Nsil restriction site was confirmed by DNA sequencing across the repaired region (ATG SEQ #905,906, primers P38-S5576 and P74-A348). This final plasmid carried the entire S. pyogenes dnaE gene, and was named pAl-StdnaE(Nsi-) (ATG glycerol stock #549).

The DNA coding sequence of the S. pyogenes type I α-subunit gene (dnaE) is shown in Figure 13 (SEQ ED NO:4). The start codon (atg) and the stop codon (taa) are in bold print. Also shown is the protein (amino acid) sequence derived from the DNA coding sequence (Fig- ure 14, SEQ ED NO:6).

B. Verification of Expression of Native S. pyogenes type I α subunit (dnaE gene product) by pAl-StdnaE/MGC1030 pAl-StdnaE(Nsi-) plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #549). Bacterial cultures were grown, harvested and lysed as described in Example 2B. A small aliquot of each clarified lysate (3.5 μl) was loaded onto a 4- 20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. A distinct protein, migrating slightly below the 120 kDa molecular weight standard of the Gibco 10 kDa protein ladder, could not be detected, either because of low expression levels or because its mobility is very similar to that of β- galactosidase since they both migrate in the 120 kDa range. C. Large Scale Growth of pAl-StdnaE/MGC1030 Strain MGC1030/pAl-StdnaE was grown in a 250 L fermentor (fermentor run #98-15), to produce cells for purification of S. pyogenes dnaE product (StDnaE) as described above. Cell harvest was initiated 3 hours after induction, at OD₆oo of 2.66, and the cells were chilled to 10 °C during harvest. The harvest volume was 167 L, and the final harvest weight was approximately 1.04 kg of cell paste. An equal amount (w/w) of 50 mM Tris (pH 7.5) and 10% sucrose solution was added to the cell paste. Quality control results showed 10 out of 10 positive colonies that had grown on LB media also grew on ampicillin-containing medium in the inoculum. Colonies that grow on ampicillin containing LB media after being fransfened from LB media that does not contain am- picillin are labeled positive colonies. Similarly, 9 out of 9 positive colonies at induction and 10/10 positive colonies at harvest were observed. Cells were frozen by pouring the cells suspension into liquid nitrogen, and stored at -20 °C, until processed.

D. Purification of S. Pyogenes dnaE Product (type I α subunit) from Large Scale Growth of pAl-StdnaE/MGC1030 Lysis of 200 g of a 1 : 1 suspension of frozen cells (100 g of cells), pAl-StdnaE/MGC1030, in Tris-sucrose that had been stored at -20 °C was preformed as described in Example 2E. The recovered supernatant (414 ml) constituted Frl. The concentration of Frl was 8.54 mg/ml giving 3.54 g total protein. To Frl, ammonium sulfate (0.226 g to each initial ml Fraction 1-40% saturation) was added over a 15 min interval. After stirring for an additional 30 min at 4 °C the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 °C). One-half of the resulting pellets were resuspended in 10 ml of Bio-Rex® equilibration buffer (50 μM imidazole (pH 6.8), 50 mM NaCl, 20% glycerol, 5 mM DTT and 1 mM PMSF) and homogenized using a Dounce homogenizer and clarified by centrifugation (26,895 x g, 30 min, 4 °C). The supernatant (FrII, 13.2 mg/ml) was dialyzed (50kDa MW cut off Spec- tra/Por® dialysis membrane) against 2 L of Bio-Rex® equilibration buffer for 15 hours.

The dialyzed sample was clarified by centrifugation in an SS-35 rotor (26,895 x g, 4°C, 10 min). The conductivity of the dialyzed sample was adjusted to that of the equilibration buffer by diluting with 20% glycerol, 5 mM DTT. The sample was loaded (0.08 ml/min) onto a 37 ml (1.7 x 22.5 cm) Bio-Rex® 70 cation exchange chromatography column (100-200 mesh) (Bio-Rad® ) equilibrated in Bio-Rex® equilibration buffer. The column was developed to resolve the type I α subunit from the majority of contaminating protein. The column was washed with 3 column volumes of equilibration buffer (0.5 ml/min). The sample was eluted from the column in 15 column volumes (570 ml) of equilibration buffer containing a 100-500 mM gradient of NaCl at a flow rate of 0.5 ml/min. Fractions were collected in 7.5 ml volumes resulting in 75 fractions. Protein concentrations and activity for fractions were determined

(Figure 15). Fractions encompassing the protein and activity peak were analyzed by SDS- PAGE (Figure 16).

All gradient eluted fractions containing over 300,000 units (33-40) of gap-filling polymerase activity were pooled and constitute Frill (0.5 mg/ml). To Frill, ammonium sulfate (0.291 g to each initial ml Fraction 111-50% saturation) was added over a 15 min interval. After stining for an additional 30 min at 4 °C the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 °C). One-sixth of Frill (one pellet) was resuspended in 2 ml of buffer C (20% glycerol, 50 mM Tris/HCl (pH 7.5), 5 mM DTT, 1 mM PMSF) and homogenized on ice using a Dounce homogenizer. The sample was clarified by centrifugation (26895 x g, 30 min, 4 °C). The homogenized sample was dialyzed against 2 L of buffer C overnight at 4 °C. Precipitate was removed by centrifugation (23,000 x g, 10 min, 4 °C) and resulted in a supernatant that constituted FrlN (1.2 mg/ml).

A 1 ml SP Sepharose™ High Performance (Pharmacia) column (0.5 x 5 cm) was equilibrated in buffer C and washed overnight with 80 ml of buffer C (0.05 ml/min). FrlN (1.6 ml) was loaded on the column (0.05 ml/min) and the column was washed using 10 column volumes (CN) of buffer C (0.1 ml/min). The column was eluted (0.1 ml/min) with 20 column volumes of buffer C containing a 0-400 mM ΝaCl gradient. Fifty fractions containing 0.4 ml each were collected and protein concentrations and activities were assayed (Figure 17). SDS- PAGE analysis of the activity containing fractions indicated that StDnaE was greater than 90% pure (Figure 18).

All gradient eluted fractions containing over 200,000 units (23-27) of gap-filling polymerase activity were pooled and constitute FrN (0.1 mg/ml). The purification summary is shown below in Table N. One hundred grams of cells were originally lysed to produce Frl, however only enough Frl equal to lysis of 8.5 g of cells were canied to FrN therefore this table represents lysis of 8.5 g cells.

Table V. StDnaE Purification Summary

E. Construction of pAl Promoter-Containing Plasmids (pAl-ΝB-StdnaE) that Overex- press S pyogenes type I α-subunit (StDnaE) Fused to an Ν-Tenninal Peptide That Contains

Hexahistidine and a Biotinylation Site To permit rapid purification of the S. pyogenes type I α- subunit (StDnaE), plasmids were designed to fuse the gene encoding StDnaE to the downstream end of the sequence expressing a hexahistidine/biotin binding fusion protein (ATG pro- ject J). The 5' end of the S. pyogenes dnaE gene was amplified by PCR. The forward/sense primer (ATG # P74-S2Kpn, 5 '-GGGGTACCATTTGCTCAACTTGATACT-3 ' SEQ ID NO: 61) was designed so that the 5' end of the primer contained a non-complementary Kpnl site and an additional A in the non-complementary region of the primer. This was placed adjacent to 18 nucleotides, which were complementary to the 5' end of the dnaE gene beginning at codon #2, so that the ATG start codon was excluded from the PCR product. The re- verse/antisense primer (ATG primer # P74-A492, 5'-ATCTTGCGCAAAATAACGAACTG TCCTTAG-3' SEQ ID NO:62) was complementary to a region downstream of a unique Hindlll restriction site. The Hindlll site is approximately 297 bases downstream of the start codon of the S. pyogenes dnaE gene. The product of this PCR reaction was digested with Kpnl and

Hindlll and inserted into the pAl-NB-Kpn-1 plasmid digested with the same restriction endonucleases, and re-sealed with T4 DNA ligase. Integration of the 5' end of the gene encoding S. pyogenes DnaE beginning at codon #2 into the Kpnl site of pAl-NB-Kpn-1 places the gene in- frame with the amino-terminal hexahistidine/biotin binding fusion protein. This plasmid was transformed into DH5α and plasmid-containing colonies were selected for ampicillin resistance. Plasmids were purified from one positive clone and the conect sequence of the insert was confinned by DNA sequencing (ATG SEQ # 719-720, primers P64-A215 and P38- S5576). The result of this insertion formed the intermediate plasmid pAl-NB-StdnaE(5') (ATG glycerol stock #469). The remaining 3' region of the gene encoding the S. pyogenes type I α subunit was cut out of the pAl-StdnaE plasmid using the restriction enzymes Hindlll and Spel (located just downstream of the stop codon). This resulted in a fragment approximately 2834 bases in length. This 3' fragment was inserted into pAl-NB-StdnaE(5') also digested withHt zαTLI and Spel restriction enzymes. The plasmid was re-sealed with T4 DNA ligase transformed into DΗ5α. Plasmids were purified from one ampicillin resistant clone and those containing the entire S. pyogenes dnaE gene were screened for by digesting with Hindlll/ Spel (yielding 2.8 kb, 5.9 kb fragments) and Kpnl (yielding 3.1 kb and 5.6 kb fragments). This final plasmid carried the entire S. pyogenes dnαE gene fused to an N-terminal fusion peptide and was named pAl-NB-StdnaE (ATG glycerol stock # 481). F. Verification of Expression of S. pyogenes Type I α-subunit (StDnaE) Fused to an N-

Terminal Peptide (NB-StDnaE) That Contains Hexahistidine and a Biotinylation Site by pAl- NB-StdnaE/MGC1030 pAl-NB-StdnaE plasmids were transformed into MGC1030 bacterial (ATG glycerol stock #502) as described in Example 1 A. Bacterial cultures were grown, har- vested and lysed as described in Example 2B. A small aliquot of each clarified lysate (3.0 μl), conesponding to 0.0429 OD₆₀o was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS (w/v). A band conesponding to a molecular weight of approximately 121 kDa could not be distinguished from the β-galactosidase band on Coomassie stained gels. The total protein in each lysate was fransfened (blotted) from polyacrylamide gel to nitrocellulose as described in Example 21. Each lane contained 1 μl of the supernatant, conesponding to 0.0143 OD₆oo units of culture material. Proteins on the blotted nitrocellulose were visualized by interactions with phosphatase-conjugated streptavidin as described above. The endogenous E. coli biotin-CCP protein with the molecular weight of about 20 kDa was detectable in both induced and non- induced samples. A protein, migrating approximately equal to the 120 kDa high molecular weight standard of the Gibco 10 kDa protein ladder, was observed as a distinct band in the induced cultures, but was not observed in the uninduced control.

Example 4. Specific Inhibition of type II Polymerase (PolC) with 6-(3,4- trimethyleneanilino uracil)

A characteristic of prototypical Gram-positive DNA polymerase Ills is their specific inhibition by 6-(3,4-trimethyleneanilino uracil) (TMAU) (Brown, N.C. et al. (1977) J Med. Chem. 20: 1186-1189). TMAU is a mimic of dGTP, which fonns a tight ternary complex op- posite a C in the template trapping the polymerase resulting in inhibition of activity. TMAU however does not inliibit the ability of E. coli like type I polymerase III. The inhibition of type I and II enzymes which were obtained from S. pyogenes was compared with B. subtilis type II DNA polymerase III and E. coli DNA type I polymerase III. E. coli DNA polymerase III type I, B. subtilis DNA polymerase III type II, S. pyogenes DNA polymerase type I, and S. pyogenes DNA polymerase type II, were titrated in the assay to determine the optimal polymerase activity levels for each enzyme. The optimum levels of the polymerases were 1 nM, 9 nM, 14 nM and 40 nM, respectively. These polymerase levels gave a strong response in the linear detection range.

Assays (25 μl) contained 32 mM HEPES (pH 7.5), 13% Glycerol, 0.01% NP-40, 0.13 mg/ml BSA, lOmM MgCl₂, 0.2 mg/ml activated calf-thymus DNA, 57 μM dATP, 57 μM dCTP, and 21 μM [³H]TTP (360 cpm/pmol). No dGTP was present in the basic assay. The reactions were started by the addition of 1 μl of a suitable dilution of the polymerases. The reaction mixtures were incubated at 30 °C for 5 minutes. The reactions were stopped by placing the reaction tubes on ice, and the DNA polymerized was precipitated and quantitated as described in Example 2F. TMAU was added to the reactions in the following final concentrations: 0, 0.1, 0.2, 0.4, 0.8, 1.6, 3.2, 6.4, 12.8, 25, 50, 100, and 200 μM. E. coli polymerase III and the S. pyogenes polymerase III type I showed very little inhibition by TMAU, while the B. subtilis DNA polymerase III and the S. pyogenes polymerase III type II were strongly inhibited

(Figure 19).

Since TMAU is a competitor of dGTP, adding excess amounts of dGTP to the inhibited reactions should eliminate inhibition of the polymerase activity by TMAU. The effect of dGTP on the inhibitory activity of TMAU with the B. subtilis and S. pyogenes type II DNA polymerases was therefore tested. The following concentrations of dGTP nucleotides were added to the reactions described above at 0, 1, 3, 10, 30, 100, 300, 600 μM. Control reactions were carried out at each concentration of dGTP in which TMAU was absent. The inhibitor (TMAU) concentration was set at 5 μM, adequate for 80% inhibition of polymerase activity, hi these assays reversal of inhibition by addition of dGTP was observed, as expected (Figure 20). However, the reversal of inhibition of the S. pyogenes enzyme occuned at lower dGTP concentrations than with the B. subtilis enzyme. These findings further identify S. pyogenes polC gene product as an authentic prototypical gram-positive polymerase III type II that is functionally distinct from the type I DNA polymerase III.

Example 5. Stimulation of S. Pyogenes DNA Polymerase III Type II by S. Pyogenes β subunit

As an additional test to define S. pyogenes DNA polymerase III type II (StPolC) as the replicative polymerase, the ability of the S. pyogenes β subunit (construction, purification and assays are described in following sections) to stimulate the activity of type II (StPolC) S. pyo- genes pol III was assayed. These assays were carried out using the primer/extension assays described in Example 6D. The assays allowed determination of the ability of S. pyogenes β subunit to stimulate the processivity of the DNA polymerase III. S. pyogenes DNA polymerase III type II (5 ng) were titrated with increasing concentrations of S. pyogenes β-subunit. Assays were conducted in the presence of the 4 dNTPs, including radiolabeled dTTP, and 1.3 μM primer-template (described in Example 6D). In these assays, stimulation by the β subunit of the S pyogenes type II DNA polymerase III (StPolC) was observed. The amount of stimulation was similar to that seen with E. coli DNA pol III control ran in parallel (data not shown). Example 6. Identification of S. pyogenes dnaN Gene Encoding the β subunit

In E. coli, the β subunit is functional as a homodimer (Stukenberg, P. T. et al. (1991) J. Biol. Chem. 266, 11328-11334). This dimer confers the ability of high processive synthesis to the core polymerase. To identify the S. pyogenes β subunit, the S. pyogenes contiguous se- quence database at the University of Oklahoma's Advanced Center for Genome Technology

Streptococcal Genome Sequencing Project was searched. Using ORF Finder (NCBI) and the amino acid sequence for B. subtilis DnaN, two adjacent open reading frames that were highly homologous were located (contig. 295, contig numbering as of March 1997). The DNA sequence that conesponded to the homologous sequences was extracted, and a six-frame transla- tion was made. Upon comparing the homology against B. subtilis DnaN a marked shift in the reading frame of high level of alignment within a 9 base region was found. The sequence was edited and a base was added to one point in the 9 base region to bring the two regions of homology into the same frame. The resulting protein (378 amino acids) aligned with 39% identity along the entire length of the 377 residues S. aureus DnaN protein. The identity of the S. pyogenes dnaN gene was further supported, by its positioning relative to the S. pyogenes dnaA gene discussed more fully in Example 8. The sequence obtained from this search was used to develop PCR primer used to extract the gene out of the S. pyogenes genomic DNA.

The DNA coding sequence of the S. pyogenes dnaN (β subunit) gene (StN) is shown in Figure 21 A (SEQ ID NO:7). The start codon (atg) and the stop codon (taa) are in bold print. Also shown in Figure 21B (SEQ LD NO:9) is the protein (amino acid) sequence of the β sub- unit derived from the DNA coding sequence (upper case letters).

A. Consfruction of Plasmids (pAl-StN) that Overexpress Native S. pyogenes β- subunit from the pAl Promoter The construction of pAl-StN was performed by insertion of the native S. pyogenes dnaN gene into the pAl-CB-Nde-1 plasmid (ATG project L). The dnaN gene was amplified from S. pyogenes genomic DNA using PCR. The forward/sense primer (ATG # P95-S1, 5'-GGATTTCCATATGATTCAATTTTCAATTAATCGCA-3' SEQ ED NO:63) used in the PCR reaction was designed to have a upstream Ndel site, which overlaps the ATG start codon, to allow insertion into the Noel restriction site of pAl-CB-Νde-1. The reverse/anti-sense primer (ATG # P95-A1159, 5'-AAGCTTGGTACCTTAGTTTGTT CGTACTGGTG-3' SEQ LD ΝO:64) was designed to add a Kpnl site downstream of the S. pyogenes dnαN TAA stop codon. This 1.14 kb PCR fragment that contained the entire S. pyogenes dnαN gene was cut with the two restriction enzymes Noel and Kpnl and inserted into the Ndel/Kpnϊ digested pAl-CB-Νde-lplasmid. The plasmid was re-ligated with T4 DΝA ligase and transformed into DH5α. The resulting plasmid containing colonies were selected for by resistance to ampicillin and isolated plasmids which contained the entire gene encoding the S. pyogenes β subunit were screened for by digesting with Ndel/Kpnl (yielding 1.14 kb, 5.6 kb fragments). One positive clone was selected and the sequence of the region containing the in- serted PCR product was confirmed by DNA sequencing (ATG SEQ #951-956; primers P38-

S5576, P65-A106, P95-S378, P95-S805, P95-A777, P95-A402). This plasmid was named pAl-StN (ATG glycerol stock #578). Even though the gene (dnaN) for the full length S. pyogenes β-subunit was inserted into pAl-CB-Nde-1, which contains a hexahistidine/biotin binding fusion peptide, the fusion peptide is located downstream and out of frame with the dnaN gene and is not expressed.

B. Verification of Expression of Native S. pyogenes β subunit (dnaN gene product) by pAl-StN/MGC1030 pAl-StN plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #585). Bacterial cultures were grown, harvested and lysed as described in Example 2B. A small aliquot of each clarified lysate (3.0 μl) was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. A protein, migrating slightly above the 40 kDa weight standard of the Gibco 10 kDa protein ladder was observed as a distinct band in the induced cultures, but was not observed in the uninduced control. This protein was determined to be consistent with the expected molecular weight of 42 kDa. The detected protein represented 1- 2% of the total E. coli protein as visualized by Coomassie staining.

C. Large Scale Growth of pAl-StN/MGC1030 Strain MGC1030/(pAl-StN) was grown in a 250 L fermentor (fermentor ran #99-7), to produce cells for purification of S. pyogenes dnaN gene product (β subunit) as described in Example 2C. Cell harvest was initiated 4 hours after induction at OD₆oo equivalent of 3.48, and the cells were chilled to 10 °C during harvest. The harvest volume was 176 L, and the final harvest weight was approximately 1.59 kg of cell paste. An equal amount (w/w) of 50 mM Tris (pH 7.5) and 10% sucrose solution was used to re-suspend the cell paste. The cell shiny was frozen by pouring the suspension into liquid nitrogen, and stored at -20°C, until processed. Quality control results showed 10 out of 10 positive colonies on ampicillin-containing medium in the inoculum and 10 out of 11 positive colonies at harvest.

D. A Primer Extension Assay Development for Detection of S. Pyogenes β-subunit To be able to effectively purify S. pyogenes β subunit a functional assay was needed. Replicative polymerases ranging from E. coli to yeast are stimulated by their cognate "sliding clamp proc- essivity factors", β and PCNA respectively, in the absence of other holoenzyme subunits if they are present at high non-physiological concentrations (Crate, J. J. et al. (1983) J. Biol. Chem. 258: 11344-11349). This is due to the ability to these factors to assemble on linear DNA in the absence of the clamp loader (DnaX or replication factor C, RFC) at these high concentrations. To develop an assay for detection of the S. pyogenes β subunit the low processivity of DNA replicative polymerases in the absence of other members of the replicative complex has been exploited, i the absence of the β subunit the DNA polymerase (α-subunit) will only extend a primer by approximately 10 nucleotides per each binding event (Crate, J. J., supra). A substrate (shown below) was developed that allowed detection of this stimulation by the β-subunit.

5 ' - TGCAAATCGCGTTAGCTTAG > „ > > * *******************

EO-8 SEQ ED NO:65

3 ' -ACGTTTAGCGCAATCGAATCTGTCCTGTGTGTTCCTGCTGTCTCCGTTTCAAAAAAAAAAAAAAAftAAAA EO-7 SEQ LD NO:66

In theory, the enzyme will bind the annealed primer/template and extend the primer along the template ( >). The template lacks "A"s for the first 30 nucleotides and then contains a string of "A"s. In a single binding event, the polymerase without the associated β subunit will not extend the primer to a point in which radiolabeled dTTPs will be incorporated (******) opposite the string of "A"s. Therefore, in the presence of a large excess of template and limiting amounts of DNA polymerase, it is possible to limit the number of binding events to less than 1. This allowed us to develop an assay to detect stimulation of the processivity of the DNA polymerase in the presence of β subunit.

To allow annealing, the template (EO7, SEQ ID NO:66) and primer (EO8, SEQ ED NO:65) were diluted to 10 μM each in annealing buffer (10 mM Tris-HCl, pH 7.5, 0.1 mM

EDTA), heated to 90 °C in a heating block and allowed to slowly cool to room temperature. Reactions (25 μl) to assay β subunit stimulation of DNA polymerase were carried out at 30 °C for 5 min in enzyme dilution buffer (EDB) (50 mM HEPES (pH 7.5), 20% glycerol, 0.02% nonidet P40, 0.2 mg/ml BSA, 10 mM DTT, 10 mM MgCl₂), dNTP mix (50 μM dATP, dCTP, dGTP and 18 μM [³H]dTTP, 100 cpm/pmol) and varying amounts of DNA polymerase (1 μl), β subunit and annealed DNA.

In reactions using E. coli DNA polymerase α subunits, the concentration of primer/template was varied between 0.1-1.3 μM to determine the amount needed to maintain the level of incorporation of radioactivity to that of the background signal, due to single binding events. These reactions were carried out in the absence of β subunits at three concentrations of α-subunit, 0.3, 0.6, and 1.2 nM. There was no increase in the total dTTP incorporated between 0.6 and 1.3 μM of primer/template. Therefore, in following reactions to assay for lev- els of S. pyogenes a subunit to be used in β subunit purification procedures, 1.3 μM primer/template was used.

To determine the optimum amount of S. pyogenes polymerase to use in β subunit purification procedures, assays were set up in which 1 μl of S. pyogenes PolC FrII (0.65x10⁴ U/mg in gap filling assay, 90 mg/ml) was added to the reactions described above (25 μl). A series of reactions were carried out using S. pyogenes PolC FrII diluted 1:1, 2:1, 3:1, 4:1, and 8 : 1 using enzyme dilution buffer. These assays contained C-terminal tagged S. pyogenes β subunit (0.36 μM) and parallel control assays contained no β-subunit. Samples containing S. pyogenes PolC FrII that was not diluted gave a signal slightly above background in the absence of β subunit, and a 10-fold increase when β subunit was added in all reactions. Assays containing S. pyo- genes PolC FrII that had been diluted gave the same signal in the absence of β subunit, but a lower signal in the presence of β subunit. Therefore undiluted S. pyogenes PolC FrII was used in subsequent assays to isolate native S. pyogenes β subunit.

E. Purification of S. Pyogenes dnaN Gene Product (β subunit) from Large Scale Growth of pAl-StN/MGC1030 Lysis of 1000 g of a 1:1 suspension of frozen cells (500 g of cells), pAl-StN/MGC1030, in Tris-sucrose which had been stored at -20 °C was preformed as described in Example 2E. The recovered supernatant (1.73 1) constituted Frl. Frl contained a volume of 1730 ml at 16.6 mg/ml (28.7 g total protein).

To Frl, ammonium sulfate (0.258 g to each initial ml Fraction 1-45% saturation) was added over a 15 min interval. The mixture was stined for an additional 30 min at 4 °C and the precipitate collected by centrifugation (23,000 x g, 60 min, 0 °C). The resulting pellet was resuspended in 20 ml of 10 mM sodium acetate (NaOAc), pH 5.5, homogenized using a Dounce homogenizer and clarified by centrifugation. The supernatant constituted FrII (41 mg/ml). FrII was dialyzed (10 kDa MW cut off Spectra/Por® dialysis membrane) against 2 L of 10 mM NaOAc (pH 5.5). After 2 hours the dialysis buffer was changed and dialysis continued for an additional 2 hours.

A SP Sepharose™ High Performance column (70 ml, 5 x 4.5 cm) (Pharmacia) was equilibrated in 10 mM NaOAc (pH 5.5). The dialyzed fraction II containing S. pyogenes β- subunit was diluted with 10 mM NaOAc (pH 5.5) to adjust the conductivity to that of the column (120 ml final volume) and loaded onto the column at a flow rate of 0.1 column volumes (CV)/min. The column was washed with 3 CV of 10 mM NaOAc (pH 5.5) at a flow rate of 0.1 CV/min. The sample was eluted from the column in 12 CV (840 ml) of a 10 mM NaOAc (pH 5.5) to 10 mM imidazole (pH 7.0) gradient at a flow rate of 3.0 ml/min. The eluate was collected in 8.5 ml fractions and the protein concentrations for each fraction was determined (Figure 22).

Samples conesponding to fractions under the protein peak were analyzed by SDS- PAGE and Western analysis (data not shown). The samples were electrophoresised onto 10% SDS-PAGE gels (18 x 16 x 0.075 cm) as described in Example 2B. Gels were both stained with Coomassie Brilliant Blue and fransfened (blotted) onto membranes. Protein fransfened on membranes was detected with polyclonal antibodies produced against S. pyogenes C- terminal tagged β subunit (CB-StN) (discussed below in Example 6K). The native S. pyogenes β-subunit eluted in a single peak between fractions 38-72 (approximately 300 ml) with S. pyo- genes β subunit constituting over 10% of the total protein (Frill) (0.52 mg/ml). Fractions 38-

72 all contained substantial amounts of the β-subunit and were therefore pooled. The pH of the pooled Frill was adjusted to pH 7.5 by addition of 30 ml of 0.5 M Tris-HCl, pH 7.5, giving a final concentration of 50 mM Tris-HCl. The sample (330 ml) was loaded on Q Sepharose™ High Performance column (12.3 ml, 2.5 x 2.5 cm) (Pharmacia) equilibrated in 50 mM Tris-HCl (pH 7.5) at a flow rate of 1 ml/min. The column was washed with 50 ml of 50 mM Tris-HCl

(pH 7.5) at a flow rate of 1 ml/min. The protein was eluted in 120 ml of 50 mM Tris-HCl (pH 7.5) using a 0-500 mM sodium chloride (NaCl) gradient at a flow rate of 1 ml/min. The eluate was collected in 1 ml fractions and analyzed by protein and activity assays (Figure 23).

The fractions were also analyzed using SDS-PAGE and Western analysis (data not shown). The samples were electrophoresed onto 10% SDS-PAGE gels (18 x 16 x 0.075 cm) as described in Example 2B. Gels were both stained with Coomassie Brilliant Blue as well as blotted onto membranes and the proteins were detected with polyclonal antibodies grown against S. pyogenes C-tenninal tagged β subunit (CB-StN) (described in Example 6K). S. pyogenes β-subunit eluted as peak midway through the gradient, which overlapped peaks contain- ing contaminating proteins. Fractions (70-84, 14 ml) containing S. pyogenes β subunit as de- tennined by Western analysis were pooled with the β-subunit constituting over 50% of the total protein (FrLV) (2.6 mg/ml). The 14 ml from the Q Sepharose™ column was concentrated into 2 ml (18 mg/ml) (Amicon Ultrafiltration Cell, Model 8010). One ml of the concentrated Q Sepharose™ eluate was loaded onto an Sephacryl™ S-300 column (88 ml, 40:1 heightiwidfh ratio) equilibrated in Buffer A (20 mM potassium phosphate, (pH 6.5), 100 mM KC1, 25% glycerol and 5 mM DTT). This was accomplished by running the buffer above the resin bed down to the resin bed, adding the sample (1 ml), running the sample into the resin and rebuilding the buffer above the resin bed. The sample was then eluted in Buffer A at a flow rate of 0.2 ml/min and collected in 1 ml fractions and analyzed by protein and activity assays (Figure 24).

These fractions were also analyzed using SDS-PAGE and Western analysis. The samples were electrophoresed onto 10% SDS-PAGE gels (18 x 16 x 0.075 cm) as described in Example 2B. Gels were both stained with Coomassie Brilliant Blue as well as blotted onto membranes and detected with polyclonal antibodies grown against S. pyogenes C-terminal tagged β-subunit (CB-StN) (data not shown). Fractions containing S. pyogenes β subunit as detennined by Western analysis (48-54, 10 ml) were pooled. The pooled fractions contained S. pyogenes β subunit that was approximately 80% pure (FrV) (0.85 mg/ml). FrV was quick frozen in liquid nitrogen and stored at -80°C. Summary of purification fractions is given in Table VI. Only one half of FrIV was used to make FrV, but the table extrapolates the values for FrV to represent the use of all of FrlN.

Table VI. S. pyogenes β Purification Summary

The protein makeup from each step in the purification scheme was analyzed by SDS- Polyacrylamide gel electrophoresis and is shown in a summary gel (Figure 25).

F. Construction of pAl Promoter-Containing Plasmids fpAl-CB-StΝ) that Overex- press S. pyogenes β-subunit Fused to a C-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site Before the actual purification of the native S. pyogenes β subunit, polyclonal antibodies were required to aid in Western analysis of different steps in the purification of native S. pyogenes β subunit. To produce these antibodies, the S. pyogenes β subunit fused to a C-terminal peptide that contained a hexahistidine and biotinylation site was designed to en- hance and simplify purification. The S. pyogenes β subunit fused to a C-terminal hexahistidine/biotin binding fusion protein was constructed from a modified pAl-StN (ATG project M). This was accomplished by removing the native dnaN stop codon and bringing the downstream sequence coding for the hexahistidine/biotin binding fusion peptide into the same reading frame with the dnaN gene. A PCR fragment encompassing the 3' end of the S. pyogenes dnaN gene was constructed from S. pyogenes genomic DNA (ATG primers # P95-S805 and

P95-A1142Spe). The forward/sense primer (P95-S805, 5'-CAATCCCTTCGCCACGCTATG- 3 ' SEQ ED NO: 67) was complementary to a region upstream of a Hindlll restriction site approximately 258bp upstream of the S. pyogenes dnaN stop codon. The 3' twenty nucleotides of the reverse/anti-sense primer (P95-A1142Spe, 5 '-CCACTAGTGTTTGTTCGTACTGGTGT AA-3 ' SEQ ID NO:68) were complementary to the 3 ' terminal twenty nucleotides of the dnaN gene, excluding the TAA stop codon. The non-complementary portion of the reverse/anti- sense primer contained a Spel restriction site adjacent to the penultimate 3' codon of the dnaN gene. The resulting 265bp PCR fragment was digested with two restriction enzymes, Hindlll and Spel, and inserted into the

pAl-StN. This resulted in the loss of a Kpnl restriction site and the addition of the Spel restriction site in frame with the dnαN gene. The addition of the Spel restriction site resulted in the addition of two codons encoding the amino acids Threonine and Serine (Thr and Ser) between the penultimate dnαN codon and the beginning of the C-temiinal fusion peptide. This plasmid was transformed into DΗ5α and plasmid-containing clones were selected for by ampicillin resistance. One positive isolate was selected and the plasmid was purified and sequenced across the PCR inserted region to confirm the conect sequence (ATG SEQ #966 and 967: primers P95-S805 and P65-A106). This final plasmid canied the entire S. pyogenes dnαN gene fused to a C-terminal fusion peptide and was named pAl-CB-StN (ATG glycerol stock #581).

G. Verification of Expression of S. pyogenes β subunit Fused to a C-Tenninal Peptide That Contains Hexahistidine and a Biotinylation Site bypAl-CB-StN/MGC1030 pAl-CB-StN plasmids were transformed into MGC1030 bacterial as described in Example IA (ATG glycerol stock #588). Bacterial cultures were grown, harvested and lysed as described in Example 2B. A small aliquot of each clarified lysate (3.0 μl) was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS (w/v). A band conesponding to a molecular weight of approximately 45.5 kDa could be distinguished on Coomassie stained gels. This band represented 1-2% of the total protein present as visualized by Coomassie staining. The total protein in each lysate was fransfened (blotted) from the polyacrylamide gel to nitrocellulose. The blot was developed using alkaline phosphatase-conjugated streptavidin as described in Example 21. The endogenous E. coli biotin-CCP protein, with a molecular weight of about 20 kDa, was detectable in both induced and non-induced samples. A protein, migrating approximately equal to the molecular weight standard of 50 kDa of the Gibco 10 kDa protein ladder was observed as a distinct band in the induced cultures, but was not observed in the non-induced control. This is consistent with the migration pattern of a protein with an approximate molecular weight of 45- 46 kDa.

H. Large Scale Growth of pAl-CB-StN/MGC1030 Strain MGC1030 (pAl-CB-StN) was grown in a 250 L fermentor, as described in Example 2C Expression of S. pyogenes dnaN was induced when the culture reached an OD₆oo of 0.74. Additional ampicillin (200 mg/L) was added at induction along with 1 mM LPTG. One hour after the induction the temperature was reduced to 28 °C and additional ampicillin (200 mg/L) was added at 2 hours post-induction. Cell harvest was initiated 4 hours after induction at OD₆oo equivalent of 3.72, and the cells were chilled to 10 °C during harvest. The harvest volume was 177 L, and the final harvest weight was approximately 1.54 kg of cell paste. An equal amount (w/w) of 50 mM Tris (pH

7.5) and 10%> sucrose solution was mixed with the cell paste. The cells were frozen by pouring the cell suspension into liquid nitrogen, and stored at -20 °C until processed. Quality control results showed 10 out of 10 positive colonies on ampicillin-containing medium in the inoculum and 10 out of 10 positive colonies at harvest. I. Determination of Optimal Ammonium Sulfate Precipitation Conditions of S. pyogenes CB-β-subunit The protein in seven aliquots (600 μl) of Frl (from following section) was precipitated by adding varying amounts of saturated ammonium sulfate so that the final concentration of ammonium sulfate was: 30%, 35%, 40%, 45%, 50%, 55% and 80% saturation. The mixture was stined for an additional 30 min at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 45 min, 4 °C). The resulting pellets were resuspended in buffer T

(50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 20 % glycerol, 1 mM DTT, 25 mM NaCl). The protein concentration of each sample was determined using the Coomassie Protein Assay Reagent (Pierce Chemical Company, Rockford, IL) and bovine serum albumin (BSA) as a standard. The samples were analyzed by SDS-PAGE (data not shown) as described in Example 2B. The resuspended pellets from the 40% ammonium sulfate precipitated samples contained over 90% of S. pyogenes DnaN.

J. Purification of S. Pyogenes dnaN Gene Product (β subunit) Fused to a C-Terminal Peptide Containing a Hexahistidine and Biotinylation Site from pAl-CB-StN/MGC1030 To purify S. pyogenes β subunit, 16 g cells were lysed as described in Example 2E to produce Frl (70 ml, 3.7 mg/ml). FrII was prepared by adding ammonium sulfate to 45% saturation (0.258 g of AS to each ml of Frl) and the precipitate was collected by centrifugation (44,000 x g, 20 min, 4 °C). The precipitate was dissolved in 10 ml of buffer N (50 mM sodium phosphate (pH 7.6), 300 mM NaCl, 5 mM β-mercaptoethanol) (2.7 mg/ml). The solution was applied to a 1 ml Ni⁺⁺-NTA column equilibrated in buffer N, washed with 20 ml Buffer N + l mM imidazole and eluted in 30 ml Buffer N plus 30% glycerol containing a gradient of 1 to 500 mM imidazole. The elution was at a flow rate of 0.1 ml/min and was collected in 1 ml fractions. The protein concentrations for individual fractions were determined (Figure 26). Two major protein peaks were seen in the protein column profile, fractions 24-27 and

28-34. The fractions conesponding to the regions under the peak were analyzed by biotin blot analysis as described in Example 21 (Figure 27). Fractions from both peaks contained CB-StN, however most of the S. pyogenes β subunit was contained in the second pool. Fractions containing over one-half the concentration of β subunit found in both of the peak tubes were pooled separately. These pools (fractions 24-27 and 28-34) were analyzed by SDS- polyacrylamide gel electrophoresis in a summary gel (Figure 28). As can be seen, the first protein peak (fractions 24-27) contained almost no CB-StN protein, while the second peak (fractions 28-34) contained almost exclusively CB-StN protein. The second pool constituted Frill (4.5 ml, 0.47 mg/ml). hidividual aliquots from the second pool were rapidly frozen by irnmer- sion in liquid N₂ and stored at -80 °C. CB-StN protein purification results are summarized in

Table VII. Table VII. Purification Summary of S. pyogenes dnaN protein fused to a C-Terminal Tag

K. Production of polyclonal antibodies against S. pyogenes β subunit (CB-StN) Polyclonal antibodies against S. pyogenes dnaN gene product (β subunit) were produced by inoculation of a rabbit with CB-StN and harvested from the rabbit as described Example 2M. The optimum concentration for binding of S. pyogenes CB-StN by antibody serum was determined after each test bleed and after the final bleed. This was carried out using SDS-polyacrylamide gel electrophoresis (PAGE) in which a small aliquot of CB-StN (5 μg/well) was electrophore- sed onto a 10% SDS-PAGE mini-gel (10 x 10 cm). The protein was then fransfened onto nitrocellulose membrane as described in Example 21. The membrane was cut into strips with each strip containing an identical band of CB-StN. The blotted nitrocellulose was blocked in 0.2% Tween 20 (v/v)-TBS (TBST) containing 5% non-fat dry milk (w/v) for 1 hour at room temperature, then rinsed with TBST. The strips were placed in antiserum/TBST (dilutions of; 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000 and 1:128000) for 1 hour and then washed 4 times for 5 min in TBST. Next, the strips were placed in secondary antibody-conjugated to alkaline phosphatase (goat anti-rabbit IgG (H+L), 1:3000 dilution in TBST) (Bio-Rad® ) for 1 hour. The strips were then washed 4 times for 5 min with TBST.

Following this extensive washing, the blots were developed with BCLP/NBT (KPL #50-81-07; one component system). Proteins conesponding to S. pyogenes CB-StN were visualized as distinct bands at the highest dilution of antiserum (1 : 128000). These bands became more intense as the dilution of antiserum was decreased. The negative control consists of antiserum that was harvested from the rabbit before antibodies were grown against CB-StN.

Next, the minimum amount of S. pyogenes CB-StN needed for recognition by antiserum was determined. This was carried out using SDS-polyacrylamide gel electrophoresis (PAGE) in which small aliquots of CB-StN (0.002, 0.004, 0.007, 0.015, 0.03, 0.06, 0.125, 0.25, and 0.5 μg/well) were electrophoresed onto a 10% SDS-PAGE mini-gel (10 x 10 cm). The protein was fransfened onto nitrocellulose membrane. The nitrocellulose was cut into strips each containing a different concentration of S. pyogenes CB-StN and blocked as described for optimization of antiserum concentration. The strips were placed in antiserum/TBST (dilution of 1 : 10000) for 1 hour and then washed 4 times for 5 min in TBST. Next, the ships were placed in secondary antibody-conjugated to alkaline phosphatase (goat anti-rabbit IgG (H+L), 1 :3000 dilution in TBST) (Bio-Rad® ) for 1 hour. The strips were then washed 4 times for 5 min with TBST. Following this extensive washing, the blots were developed with BCLP/NBT (KPL #50-81-07; one component system). A protein band conesponding to S. pyogenes CB- StN was visualized as a distinct band at a concentration of 0.06 μg. These bands became more intense as the concentration of CB-StN was increased (Figure 29).

Example 7. Identification and Expression of the S. pyogenes dnaA gene The DnaA protein is a sequence specific DNA-binding protein, proposed to recognize

9-mer sequences tenned DnaA boxes present at the origin of replication (oriC). The binding of the DnaA protein to oriC is an initial step in an ordered series of events leading to the replication of the genomic DNA. A search of the S. pyogenes Genomic Database at the University of Oklahoma's Advanced Center for Genome Technology vs. the amino acid sequences of DnaA from E. coli, B. subtilis, and S. aureus all identified the same 431 amino acid ORF on contig

295 with high significance. This contig number refers to the version of the Streptococcus database searched on October 1998. As the project nears completion contig numbers sometimes change as they are merged with others. An alignment of S. pyogenes and S. aureus DnaA proteins show that the two genes align with 42% identity. The proteins all have very similar mo- lecular weights (all about 50 kDa). The B. subtilis DnaA has been purified and shown to bind oligonucleotides containing DnaA box sequences (Fukuoka, T., et al. (1990) J. Biochem. 107: 732-739).

The DNA coding sequence of the S. pyogenes dnaA gene (StA) is shown in Figure 30A (SEQ LD NO: 10). The start codon (atg) and the stop codon (taa) are in bold print. Also, shown in Figure 30B (SEQ LD NO: 12) is the DnaA protein (amino acid) sequence derived from the DNA coding sequence (uppercase letters).

A. Construction of Plasmids (pAl-StA) that Overexpress S. pyogenes dnaA gene product (DnaA protein) from the pAl Promoter The pAl-StA plasmid was designed to overexpress the full-length native S. pyogenes dnaA gene product (DnaA protein) (ATG project N). The construction of pAl-StA was performed by insertion of the S. pyogenes dnaA gene into the pAl-CB-Ndel plasmid. The dnaA gene was amplified from S. pyogenes genomic DNA using PCR with primers designed from the sequence obtained from the S. pyogenes Genomic Database at the University of Oklahoma's Advanced Center for Genome Technology (ATG primers P96-S1 and P96-A1387). The forward/sense primer (P96-S1, 5 '-GGAATTCCATATGACTGA AAATGAACAAAT-3 ' SEQ ID NO:69) was designed to add an Noel site that overlapped the ATG start codon. The anti-sense primer (P96-A1378, 5 '-AAGCTTGGTACCTTATTTAATT TTGTTTTTTATGG-3 ' SEQ LD ΝO:70) was designed to add a Kpnl site downstream of the dnaA stop codon. This 1.4kb PCR fragment that contained the entire S. pyogenes dnaA gene was cut with the restriction enzymes Ndel and Kpnl and inserted into the Nαel/iQtml-digested pAl-CB-Νdel plasmid. The plasmid was re-ligated with T4 DΝA ligase and transformed into DH5α. Resulting colonies were selected for by ampicillin resistance and those which contained plasmids canying the entire dnaA gene were screened for by digesting the plasmids with NdellKpnl (yielding 1.14 kb, 5.6 kb fragments). Plasmids from one positive clone were selected and the sequence of both strands of the inserted DΝA was confirmed by DΝA sequencing (ATG SEQ # 957-964, primers P38-S5576, P65-A106, P96-S480, P96-S740, P96-S1038, P96-A964, P96-A533, P96-A266). This resulting plasmid was named pAl-StA (ATG glycerol stock 579). B. Verification of Expression of Native S pyogenes DnaA (dnaA gene product) by pAl-StA/MGC1030 pAl-StA plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #591). Bacterial cultures were grown, harvested and lysed as described in Example 2B. A small aliquot of each clarified lysate (3.0 μl) was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. A protein, migrating slightly above the 50 kDa weight standard of the

Gibco 10 kDa protein ladder was observed as a distinct band in the induced cultures, but was not observed in the uninduced control. This protein was determined to be consistent with the expected molecular weight of 52 kDa. The detected protein represented 1-2% of total E. coli protein as visualized by Coomassie staining. C. Large Scale Growth of pAl-StA/MGC1030 Strain MGC 1030 (pAl -StA) was grown in a 250 L fennentor, to produce cells for purification of S. pyogenes dnaA gene product (DnaA) as described in Example 2C. Cell harvest was initiated 4 hours after induction at OD₆oo equivalent of 4.44, and the cells were chilled to 10 °C during harvest. The harvest volume was approximately 180 L, and the final harvest weight was approximately 1.72 kg of cell paste. An equal amount (w/w) of 50 mM Tris (pH 7.5) and 10% sucrose solution was used to resuspend the cell paste. Cells were frozen by pouring the cell suspension into liquid nitrogen, and stored at -20°C, until processed. Quality control results showed 10 out of 10 positive colonies on ampicillin-containing medium in the inoculum and 7 out of 10 positive colonies at harvest. D. Determination of Optimal Ammonium Sulfate Precipitation Conditions of native S. pyogenes DnaA The protein in seven aliquots (100 μl) of Frl (from following section) were precipitated by adding varying amounts of saturated ammonium sulfate so that the final concentration of ammonium sulfate was: 30%, 35%, 40%, 45%, 50%, 55% and 80% saturation. The mixture was stined for an additional 30 min at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 °C). The resulting pellets were resuspended in assay buffer (50 mM Tricine-KOH (pH 8.25), 2.5 mM MgOAc, 0.3 mM EDTA, 20 % glycerol, 0.007 % Triton® X-100, 5 mM DTT). The protein concentration of each resuspended sample and the supematants from the centrifugation were determined. The samples were also analyzed by SDS-PAGE (data not shown) as described in Example 2B. At 40% ammonium sulfate saturation, all of the S. pyogenes DnaA had disappeared from the supernatant. The resuspended pellets from the 40% ammonium sulfate precipitated samples contained over 90% of S. pyogenes DnaA. E. Purification of S. Pyogenes DnaA Protein from Large Scale Growth of pAl-

StA/MGC1030 Frl was prepared from 1700 g of the 1:1 suspension of frozen cells (850 g) in Tris-sucrose from the large-scale preparation as described in Example 2E (3.3 L, 9.4 mg/ml). To Frl, ammonium sulfate (0.226 g to each initial ml Fraction 1-40% saturation) was added over a 15 min interval. The mixture was stined for an additional 30 min at 4 °C and the pre- cipitate collected by centrifugation (23,000 x g, 60 min, 0 °C). The recovered pellets were re- supended (on ice) in 75 ml of equilibration buffer (25 mM HEPES-KOH (pH 7.4), 20 % glycerol, 10 mM MgCl₂, 50 mM KC1, 5 mM DTT), homogenized with a Dounce homogenizer and clarified by centrifugation. The supernatant was dialyzed (10 kDa MW cut off Spectra/Por® dialysis membrane) against 1 L of equilibration buffer for 8 hours. The dialysate constitutes FrII (85 ml, 19.4 mg/ml). The conductivity of the dialyzed sample was adjusted to that of the equilibration buffer by diluting to 325 ml with 20% glycerol, 5 mM DTT. This sample was loaded (1 ml/min) onto a 50 ml (2.5 x 10 cm) Bio-Rex® 70 cation exchange chromatography column equilibrated with equilibration buffer. The column was washed with 3 column volumes of equilibration buffer. The sample was eluted from the column in 12 column volumes (600 ml) of equilibration buffer containing a 50-1000 mM gradient of KC1 at a flow rate of

0.75 ml/min. Fractions were collected in 5 ml volumes. The protein concentration and binding activity (see the following section) of each fraction were determined (Figure 31).

The fractions were also analyzed using SDS-PAGE (data not shown). A low molecular weight contaminant (35 kDa) in approximately equal concentrations as S. pyogenes DnaA pro- tein eluted in the same fraction as the target protein. The fractions containing S. pyogenes

DnaA were pooled (175 ml, 2.3 mg/ml) and constituted Frill. Frill was ammonium sulfate precipitated (0.436 g of AS to each ml-70% saturation). The mixture was stined for an additional 30 min at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 60 min, 0 °C). There were six equal pellets of precipitate, which were quick frozen in liquid N₂ and stored at -80 °C.

En an attempt to separate the low molecular weight contaminant from S. pyogenes DnaA, a resin for hydrophobic interaction chromatography was selected. One of the six pellets from the Bio-Rex® 70 column was dissolved in 30 ml (Frill, 2.23 mg/ml) of ToyoPearl Butyl-

650 equilibrium buffer (IM ammonium sulfate, 10 mM potassium phosphate (pH 7.5)). The sample was homogenized using a Dounce homogenizer and clarified by centrifugation (23,000 x g, 60 min, 0 °C). The clarified sample was loaded onto a ToyoPearl Butyl-650 column (16 ml) equilibrated in ToyoPearl Butyl-650 equilibrium buffer at a flow rate of 0.25 ml/min. The column was washed with 50 ml of ToyoPearl Butyl-650 equilibration buffer and the sample was eluted in 150 ml of ToyoPearl Butyl-650 elution buffer (10 mM potassium phosphate, 20% glycerol and 5 mM DTT) containing a 1-0 M gradient of ammonium sulfate. The S. pyogenes DnaA protein was not resolved from the 35 kDa contaminating protein. Other attempts to separate S. pyogenes DnaA from the 35 kDa contaminating protein was made using ToyoPearl Phenyl-650 and ToyoPearl Ether-650 columns, which are increasingly less hydro- phobic than the ToyoPearl Butyl-650 resin, respectively. The same procedure used in the ToyoPearl Butyl-650 column purification was also used here. These attempts also were not successful in resolving S. pyogenes DnaA from the 35 kDa contaminating protein. Next, an ion exchange column was used to attempt to separate S. pyogenes DnaA from the 35 kDa contaminating protein. Another of the pellets was resuspended in 15 ml of Q-Sepharose™ equilibration buffer (25 mM Tris-HCl (pH 8.8), 25 mM KC1, 5 mM DTT, 20% glycerol). The sample was homogenized using a Dounce homogenizer and clarified by centrifuging (23,000 x g, 60 min, 0 °C). The sample was then dialyzed overnight against 1 L of Q-Sepharose™ equilibration buffer (10 kDa MW cut off Spectra Por® dialysis membrane) (Frill, 4.5 mg/ml). The conductivity of the sample was adjusted to that of the equilibration buffer by adding 30 ml of 20% glycerol. The sample was then loaded onto a 15 ml Q-Sepharose™ column equilibrated in the Q-Sepharose™ equilibration buffer at a flow rate of 1 ml/min. The column was washed with 3 column volumes of Q-Sepharose™ equilibration buffer and the sample was eluted in 180 ml equilibration buffer containing a 25-500 mM KC1 gradient. SDS- polyacrylamide gel electrophoresis analysis indicated that the fractions containing S. pyogenes

DnaA protein and those containing the 35 kDa contaminating protein were overlapping (data not shown). To better separate the contaminating protein from StA, another StA Frill pellet was prepared for chromatography on the Q-Sepharose™ column. This column was also eluted in 180 ml equilibration buffer, except the KC1 gradient was much more shallow to allow better separation of the two proteins. The column was eluted in equilibration buffer contained a 150- 300 mM KC1 gradient. The fractions containing the S. pyogenes DnaA protein outside of the overlapping region were combined to provide 90% pure samples of S. pyogenes DnaA protein (0.9 mg/ml) (FrlN). However, because of the overlapping the contaminating 36 kDa protein, much of the S. pyogenes DnaA was lost during the purification steps. The steps in the purification of S. pyogenes DnaA were analyzed by SDS-polyacrylamide gel electrophoresis (Figure 32). Table VIII summarizes the purification of S. pyogenes DnaA protein. 850 g of cells were originally lysed to produce Frl, however only enough Frl equal to lysis of 142 g of cells were carried to FrlN, therefore this table represents lysis of 142 g cells.

Table VIII. S. pyogenes DnaA protein Purification Summary

mer on a nitrocellulose filter as defined in the assay section.

F. Development of a Functional Assay to Detect S. pyogenes binding of DΝA Containing DnaA Binding Boxes To enable developing a purification scheme in which the maximal level of active DnaA protein is obtained, a quantitative DΝA binding assay was developed that exploited the ability of DnaA protein to bind to nitrocellulose filters and retain radiolabeled DnaA box containing DΝA. To provide an assay ligand, a 49-mer DΝA duplex containing one DnaA box (underlined) centrally positioned was synthesized.

5 ' -AACGGTTAGGCACTATGAAATAGTTATCCACAAGTTGTGAACATCCATT-3 ' (EO-9)

SEQ ID ΝO:71 3 ' -TTGCCAATCCGTGATACTTTATCAATAGGTGTTCAACACTTGTAGGTAA- 5 ' (EO-10)

SEQ ED NO:72

The DNA oligonucleotide (EO-10) complementary to the oligonucleotide containing the DnaA box (underlined) was 5' end labeled using [³²P] according to the forward labeling reaction protocol of T4 polynucleotide kinase (GibcoBRL, Gaithersburg, MD). The two complementary oligonucleotides were annealed by mixing in annealing buffer (10 mM Tris-HCl (pH 7.5), 0.1 mM EDTA), heating to 90 °C in a heating block and slowly cooling to room temperature. To insure 100 % annealing, the annealed (varying from a 0.2 - 1.8 oligonucleotide ratio) and con- trol oligonucleotides were electrophoresed onto a non-denaturing 10% polyacrylamide gel

(Figure 33). The induced gel shift of the labeled complementary oligonucleotide (EO-10) when amiealed to EO-9 was quantitated using a Molecular Dynamics Phosphorlfniager. At a 1:1 ratio, 100% of the labeled complementary oligonucleotide was observed annealed to its counterpart containing the DnaA box. The ability of S. pyogenes DnaA to bind DNA duplexes was quantified using filter- binding assays. Assays (25 μl) contained 40 nM ³²P -labeled 49-mer containing DnaA box (3- 10,000 cpm/pmol), the indicated amounts of S. pyogenes DnaA and binding buffer (50 mM Tricine-KOH (pH 8.25), 2.5 mM MgOAc, 0.3 mM EDTA, 20 % glycerol, 0.007 % Triton® X- 100, 5 mM DTT, 1 mM ATP). The samples were incubated at 0 °C for 10 min. After incuba- tion 20 μl of the assay mix was spotted onto a 2.5 cm Millipore HA nitrocellulose filter and washed under a gentle vacuum with 1 ml of washing buffer (same as the binding buffer except Triton® X-100 was 0.005 % and there was no ATP). The filters were dried and the radioactivity was quantitated.

To detennine if the expressed S. pyogenes DnaA was functional in binding the DNA duplex containing a DnaA box, FrII from induced and uninduced cells carrying plasmid pAl-

StA were compared. Binding of FrII from the induced cells to the P-labeled 49-mer resulted in significant binding compared to that of FrII prepared from the same cells but that were not induced (Figure 34A). In a separate experiment, when annealed oligonucleotides were titrated against fixed DnaA (1 pmol), near saturation of binding of DnaA box was observed at 400 nM annealed DNA oligonucleotides (Figure 34B).

Similar assays showed that S. pyogenes DnaA did not bind annealed oligonucleotides that did not contain the DnaA box (Figure 35). When DNA duplexes (shown below) not containing DnaA boxes (EO-5/EO-6) ( - DnaA box) were substituted for those containing a DnaA box (+ DnaA box), no binding by S. pyogenes DnaA was observed. In these assays the concentrations of the amiealed DNA oligonucleotides were 1 pmol and the concentrations of StA were as indicated in the figure.

5 ' -TCGGAGAACTATATCGCACAA-3 ' (EO-5) SEQ ED NO:73

3 ' - GCCTCTTGATA AGCGTGTT- 5 ' (EO-6) SEQ LD NO:74

G. Construction of pAl Promoter-Containing Plasmids (pAl-CB-StA) that Overexpress S. pyogenes dnaA product (DnaA) Fused to a C-Terminal Peptide That Contains Hexa- histidine and a Biotinylation Site To aid in purification of S. pyogenes DnaA and for future use in production of antibodies the DnaA protein was expressed with a C-terminal tag. A plasmid containing S. pyogenes DnaA fused to a C-terminal hexahistidine/biotin binding fusion protein was developed through the modification of pAl-StN (ATG project O). This was accomplished by removing the stop codon and bringing the downstream sequence coding for the hexahis- tidine/biotin binding fusion peptide in frame with the αnαA gene. pAl-StA contains the native full-length S. pyogenes dnaA gene and a downstream out of frame C-term fusion peptide sequence. To bring the downstream fusion peptide into frame with the dnaA gene, two adaptor/linkers (ATG adaptor/linker # P96-S1316 and P96-A1361) were annealed to create a duplex DNA fragment (shown below) with "sticky" ends conesponding to two restriction enzymes sites, .8^361 and Spel, in the pAl -StA plasmid.

5' -TTAGGATCGAAATTGAAACCATAAAAAACAAAATTAAAA-3 ' SEQ ED NO:75 3 ' -CCTAGCTTTAACTTTGGTATTTTTTGTTTTAATTTTGATC-5' SEQ ED NO:76

The pAl-StA plasmid was digested with the restriction enzymes Bsu36I and Spel and the adaptor DNA duplex was inserted at these sites. Digestion of pAl-StA with Bsu36I and Spel removed the region between the Bsu36I restriction site and the Spel restriction site (approximately 48 bp) that included the stop codon and a unique Kpnl restriction site. This adaptor DNA duplex re-installed the 3' end of the dnaA gene between the Bsu36I and Spel restric- tion sites, excluding the stop codon and the Kpnl site and brought the penultimate 3 ' codon of the dnaA gene in frame with the C-terminal fusion peptide. This resulted in the addition of two amino acids (Thr and Ser) between the penultimate dnaA codon and the beginning of the C- teπninal fusion protein. This plasmid was transformed into DH5α bacteria. One positive clone was selected and the plasmid DNA was purified. The conect sequence of the plasmid containing the inserted DNA was confirmed by DNA sequencing (ATG SEQ # 968 and 969, primers P96-S1038 and P65-A106). This plasmid was named pAl-CB-StA (ATG glycerol stock #582). H. Verification of Expression of S. pyogenes DnaA Fused to a C-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site by pAl-CB-StA/MGC1030 pAl-CB-StA plasmids were transformed into MGC1030 bacterial (ATG glycerol stock #594) using methods described in Example 1 A. Bacterial cultures were grown, harvested and lysed as described in Example 2B. A small aliquot of each clarified lysate (3.0 μl) was loaded onto a 4-20% SDS- PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS (w/v). A band conesponding to a molecular weight of approximately 55 kDa could be distinguished on Coomassie stained gels. This band represented 1-2% of the total E. coli protein as visualized by Coomassie staining. The total protein in each lysate (1 μl/lane) was fransfened (blotted) from the polyacrylamide gel to nitrocellulose. The blotted nitrocellulose was developed using alkaline phosphatase-conjugated streptavidin. The endoge- nous E. coli biotin-CCP protein, ~20 kDa, was detectable in both induced and uninduced samples. A protein migrating between the molecular weight standards of 50 and 60 kDa of the Gibco 10 kDa protein ladder was observed as a distinct band in the induced cultures, but was not observed in the non-induced control. This is consistent with the migration pattern of a protein with an approximate molecular weight of 55 kDa. I. Large Scale Growth of pAl-CB-StA/MGC1030 Strain MGC 1030 (pAl -CB-St A) was grown in a 250 L fermentor (fermentor run #99-2), to produce cells for purification of S. pyogenes dnaA gene product (CB-StDnaA) as described in Example 2C Cell harvest was initiated 4 hours after induction at OD₆oo equivalent of 3.84, and the cells were chilled to 10 °C during harvest. The harvest volume was approximately 170 L, and the final harvest weight was approximately 1.4 kg of cell paste. An equal amount (w/w) of 50 mM Tris (pH 7.5) and

10% sucrose solution was used to prepare a slurry from the cell paste. Cells were frozen by pouring the cell suspension into liquid nitrogen, and stored at -20°C, until processed. Quality control results showed 9 out of 10 positive colonies on ampicillin-containing medium in the inoculum and 4 out of 10 positive colonies at harvest. J. Purification of S Pyogenes DnaA Protein from Large Scale Growth of pAl-CB-

StA/MGC1030 Twenty-one grams of cells were lysed as described in Example 2E to produce Frl (85 ml, 2.62 mg/ml). FrII was prepared by adding ammonium sulfate to 45% saturation and the precipitate was collected by centrifugation (44,000 x g, 20 min, 4 °C). The resulting pellet was dissolved in 10 ml of Ni-NTA equilibration buffer (75 mM sodium phosphate, (pH 7.6), 300 mM NaCl, 5 mM β-mercaptoethanol) (1.44 mg/ml). The solution was applied to a 1 ml Ni^-NTA column, equilibrated in the equilibration buffer, at a flow rate of 0.1 ml/min and washed with 20 ml Ni-NTA equilibration buffer + 1 mM imidazole. The proteins were eluted in 30 ml of Ni-NTA equilibration buffer plus 30% glycerol containing a 1-500 mM imidazole gradient. Individual fractions (1.0 ml) were collected and protein concentrations for each fraction were determined (Figure 36).

Fractions conesponding to the region under the protein peak were analyzed using SDS- PAGE (Figure 37 A) and biotin blot (Figure 37B) analysis as described in Example 21. Frac- tions containing DnaA eluted in the second half of the single protein peak shown in Figure 36.

These fractions were pooled (28-34) and contained samples of S. pyogenes DnaA that were over 90% pure. The pooled proteins represent Frill (0.11 mg/ml, 2.5 ml). Individual aliquots were rapidly frozen by immersion in liquid N and stored at -80 °C. Example 8. Identification of S. pyogenes Origin of Replication Chromosomal DNA replication initiates at a unique site, oriC, and proceeds bidirec- tionally around the circular chromosome. Binding of unique DnaA boxes contained within the oriC by multiple copies of DnaA initiates replication of the genome and aids in DNA strand separation. Hence, origins are characterized by containing several sites in which DnaA binds. To reconstitute a full S. pyogenes DNA replication system that is dependent upon the S. pyo- genes chromosomal replication origin, the sequence required for origin of replication is needed. To prove that the oriC containing sequence is authentic, it must be shown that once inserted into a circular DNA (plasmid) and transformed into S. pyogenes in vivo, the oriC can direct replication of the plasmid. For a control, the same plasmid without the oriC must not be replicated. Recently a replication origin (oriC) was identified in Streptococcus pneumoniae that was closely related to B. subtilis (Gasc, A. M. et al. (1998) Microbiology 144: 433-439). This identification, although reasonable, was theoretical since it was not demonstrated that these sequences could direct replication of a plasmid in vivo, presumably because of technical difficulties that appeared in these studies. Like B. subtilis, S. pneumoniae contains three islands of clustered DnaA binding sites-two upstream of the dnaA gene and one downstream between dnaA and dnaN. At the DNA Replication Keystone Symposium (1999), a poster was presented showing that Staphylococcus aureus also had a similar anangement of DnaA clusters relative to dnaA and dnaN (May, E. et al. (1999) Molecular Mechanisms in DNA Replication and Recombination Meeting, Keystone Symposia, Taos, New Mexico, February 16-22). Importantly, S aureus also only required two elements, the one immediately upstream and the one downstream of dnaA for function. Attempts to clone the third upstream element in the context of the downstream elements from any Gram-positive organism have not been success- ful to date, probably because the upstream element interferes with host chromosomal replication by an unknown regulatory mechanism (Moriya, S. et al. (1999) Plasmid 41: 17-29). Recently, the S. pyogenes sequence around dnaA became sufficiently refined to permit a more thorough analysis (University of Oklahoma's Advanced Center for Genome Technology Strep- tococcal Genome Sequencing Project). From sequence examination, it became apparent that S. pyogenes had conserved the origin structure (oriC) found in S. pneumoniae, S. aureus and B. subtilis. S. pyogenes contained the same dnaA-dnάN gene anangement found in almost all bacteria. The major DnaA box clusters required for origin of replication were found immediately upstream of dnaA (region 1) and between dnaA and dnaN (region 2) (Figure 38, SEQ ED #22). Boxes (shaded 9-mers) indicate consensus DnaA binding sequences (TTAT(A/C)CACA (SEQ LD NO:88) or TGTG(G/T)ATAA (SEQ ED NO:89)). Perfect matches are underlined; the remaining boxes differ by only one of the 9 base consensus. The anows shown above them indicate the orientations of the boxes. Genes flanking the DnaA clusters within the origin are shown as black background and white type, with only their start and stop codons shown. The flanking upstream gene is spoOI in both S. pyogenes and S. pneumoniae. In region 2 (down- sfream of dnaA), four dnaA boxes are found in S. pyogenes; only three are present in B. subtilis and S. pneumoniae. However, in the distal immediately adjacent boxes found in S. pyogenes, steric factors probably preclude binding of DnaA protein to both sites simultaneously. In region 1 (immediately upstream of dnaA) seven boxes are observed in S. pyogenes, eight are present in B. subtilis and six with S. pneumoniae. In B. subtilis an AT-rich segment immediately in front of dnaN provides the unwinding site where replication is initiated (Moriya, S. et al.

(1994) Mol. Microbiol. 12: 469-478). A similar sequence in S. pyogenes (boldface and underlined letters in Figure 38) was observed.

Knowledge of the location and structure of the S. pyogenes DNA replication origin (oriC), by analogy to S. pneumoniae, S. aureus and B. subtilis, allowed us to directly clone the S. pyogenes origin into the shuttle vector pSM5000. This is the same shuttle vector used by

Moriya and colleagues to isolate the B. subtilis replication origin (Moriya, S. et al. (1992) Molec. Microbiol. 6: 309-315). pSM5000 contains anE. coli origin of replication and chloramphenicol (Cm), tetracycline- and ampicillin-resistance elements, permitting manipula- tion in E. coli, but it cannot replicate in Gram-positive organisms such as B. subtilis or S. pyogenes without introduction of an origin that is functional in those organisms. The chloram- phenicol-resistance gene permits detection of as few as one copy of plasmid/cell in gram- positive bacteria grown on rich media containing 3 μg/ml chloramphenicol. A. Construction of Plasmids Containing the S. pyogenes Origin of Replication The S. pyogenes origin was isolated directly by PCR (ATG primers #P136-S132 and P136-A3495; 5'-GCTATGAGTTAGTTGCTGGAGAACGACGAC-3' SΕQ ID NO:77 and 5'-CTCAATAA GGTAAGTTGGATTGAAGCTGAT-3' SΕQ LD NO:78, respectively) from sequences flanking two unique Hindlll restriction sites. This encompassed a region from 555 bases upstream of the stop codon of spoOJ to 876 bases downstream of the beginning of dnaN (see Figure 38 for orientation) (ATG project #AB). The PCR product was cleaved with Hindlll, yielding a 3173 bp product that was cloned into the unique Hindlll site of pSM5000. This plasmid was analyzed by restriction digest using Hindlll (yielding 5.7 and 3.2 kb fragments) andNcoI (yielding 6.5 and 2.3 kb fragments). This plasmid was named pSt-oril and was transformed into DH5α strain of E. coli and yielded amp^R/cam^R colonies. Several colonies were isolated, and four (pSt-oril(a-d)) canying oril were used for further studies. These four isolates were stored as stock cultures (ATG glycerol stock #790, 791, 792, 793).

To ascertain if a slightly truncated form of the S. pyogenes origin could also support autonomous replication, a smaller segment of the S. pyogenes chromosome containing the ori- gin of replication was amplified by PCR using primers with non-complementary tails containing Hindlll sites (ATG primers #P136-S393 and P136-A2686; 5 '-GAATTCAAGCTTGTTAC AACTCCCAGCACCTATCATT-3 ' SΕQ LD ΝO:79 and 5 '-GAATTCAAGCTTAACCAGCA TTTTCATTACTTACAG-3 ' SΕQ LD NO:80, respectively). The PCR products were cleaved with Hindlll and cloned into the unique Hindlll site of pSM5000. This plasmid was analyzed by restriction digest using Hindlll (yielding 5.7 and 2.3 kb fragments) and BamHI/Xbal (yielding 7.0 and 0.9 kb fragments). This plasmid was named pSt-ori2 and was transformed into DH5α and yielded amp^R/Cm^R colonies. The S. pyogenes chromosomal boundaries of pSt-ori2 were 350 bases upstream of the end of spoOJ and 199 bases downstream of the beginning of dnaN. Several colonies were isolated, and four, canying pSt-ori2(a-d) were used for further studies. These four isolates were stored as stock cultures (ATG glycerol stock #794, 795, 796, 797).

B. Functional Analysis of S. pyogenes Origin of Replication The pSM5000 contains an E. coli origin of replication permitting manipulation in E. coli, but it cannot replicate in Gram-positive organisms. The insertion of the S. pyogenes oriC into pSM5000 would allow the plasmid to be replicated in S. pyogenes. In spite of significant effort, initial attempts were unsuccessful in introducing either pSt-oril or pSt-ori2 into S. pyogenes and obtaining stable Cm^R colonies. Discovery of several critical technical factors were key in overcoming this dif- ficulty. First, S. pyogenes, strain JRS4 was obtained from Dr. Mike Caparon (Washington

University, St. Louis, MO). This strain was more amenable to electroporation than the previous strain used. Second, the minimum concentration of chloramphenicol (Cm) inhibiting total growth of S. pyogenes JRS4 was determined, and work proceeded just above that threshold in subsequent cloning efforts. To accomplish this, S. pyogenes JRS4 was grown overnight in THY media (30 g/L, Todd Hewitt and 0.2% yeast extract) and then streaked onto THY plates containing from 2-5.5 μg/ml Cm. Growth of S. pyogenes JRS4 was inhibited at Cm concentrations of 2 μg/ml or above. To be absolutely sure of inhibition of growth of non-transformed S. pyogenes JRS4, Cm concentrations were set at 3 μg/ml. A third factor was to grow cells in the presence of 20 mM glycine to weaken cell walls and improve the electroporation efficiency. S. pyogenes JRS4 cells were prepared for electroporation by growing overnight in THY media containing 20 mM Glycine (THYB) under 5% CO₂. This overnight culture was added to 100 ml of THYB containing 2% Protose Peptone (DEFCO) to OD₆₀₀ 0.03-0.05. This sample was incubated in at 37 °C until OD₆oo 0.14 was reached (early log phase). The cells were collected by centrifugation (4340 x g, 6 min, 14 °C). The supernatant was removed and the pellet was resuspended in 2 ml of the supernatant. The cells were then heat shocked for 9 min at 43

°C and the volume was increase to 10 ml by addition of sterilized 15% glycerol at room temperature. The cells were collected by centrifugation (4340 x g, 6 min, 14 °C) and washed two times using sterile 15% glycerol. The final pellet was resuspended in 0.6 ml of sterile 15% glycerol and kept at room temperature (5-10 min) and then used in electroporation. Aliquots of 200 μl of cells were added to 35 μl of DNA and then placed in cold electroporation cuvettes

(0.2 cm) (Bio-Rad® , Hercules, CA). The mixture was electroporated (1.75 kV, 25 μF, 400 Ohms) and fransfened to 10 ml of ice cold THYB. The samples were incubated on ice for 1 hour and then fransfened to a 37 °C water bath and incubation continued for 1 hour. The cells were then collected by centrifugation (4340 x g, 6 min, 14 °C) and the supernatant was re- moved. The cell pellet was resuspended in 400 μl of the supernatant. The cells were then plated on THY plates containing 3 μg/ml Cm.

To optimize electroporation conditions, the plasmid pABG5 was used to elecfroporate S. pyogenes JRS4. pABG5 (also obtained from Dr. Mike Caparon) contains a Cm resistant marker, an E. coli oriC and a broad range Gram-positive oriC. This plasmid is replicated in S. pyogenes JRS4 and serves as a positive control. As a negative control, S. pyogenes JRS4 was transformed with pSM5000, which has a Cm resistant marker but lacks a Gram-positive oriC and therefore cannot be replicated. As an additional control, colonies selected as positive iso- lates were re-streaked on THY plates containing 3 μg/ml Cm as a re-confirmation.

The optimum amount of DNA to be used in electroporation of S. pyogenes JRS4 with both pSt-oril or pSt-ori2 and pABG5 was determined by varying the concentration of plasmid between 500 ng and 10 μg. The titration of the plasmid conesponded to the number of resulting colonies. At a plasmid concentration of 7.5 μg, after 18 hours of incubation at 37 °C, ap- proximately 80 positive colonies were observed on plates containing S. pyogenes JRS4 electro- porated with pABG5. At the same plasmid concentration of pSt-oril or pSt-ori2, after 45 hours of incubation an average of 5 positive colonies were observed (1-10/plate). This concentration of plasmids was used in subsequent electroporation of S. pyogenes JRS4.

The next step in showing the functionality of the S. pyogenes oriC was to extract the electroporated plasmid back out of S. pyogenes. This method was first investigated with pABG5-containing colonies. A 10 ml sample of THYB containing 3 μg/ml of Cm was inoculated with a positive colony and grown overnight at 37 °C. The cells were then collected by centrifugation (4340 x g, 6 min, 14 °C) and the supernatant was discarded. The cells were washed with 1 ml 20 mM Tris-HCl, (pH 8.2) and then resuspended in 320 μl of 20 mM Tris- HCl, (pH 8.2). The sample was then added to 700 μl of sterile 24% polyethylene glycol 8000

(PEG 8000). Finally, 700 μl of lysozyme (10 mg/ml) (Worthington Biochemical Corporation, catalog #38H2088) dissolved in 20 mM Tris-HCl, (pH 8.0), and 15 μl of mutanolysin (5000 U/ml) (Sigma, St. Louis, MO, catalog #M-9901) were added to the cell sample and incubated (37 °C, 1 h, 200 1pm). The plasmids were isolated using Eppendorf-5 Prime PERFECTprep™ Plasmid DNA Preparation Kit according to the manufacturers (Eppendorf-5 Prime) instructions. This method was successful in isolating pABG5 and was therefore used to isolate the pSt-oril or pSt-ori2 plasmids from S. pyogenes JSR4.

The yield of plasmids (pSt-oril and pSt-ori2) from S. pyogenes was low. To obtain larger amounts of plasmid needed for extensive analysis, the plasmids were transformed back into DH5α. Colonies of transformed DH5α, denoted pSt-oril/DH5o! and pSt-ori2/DH5θ!, were grown overnight in 100 ml cultures of Luria-Bertani medium (LB) (bacto-tryptone, 10 g/L, bacto-yeast extract, 5 g/L, NaCl, 10 g/L). The plasmids were purified using QIAprep® Spin Miniprep Kits according to the manufacturers (QIAgen®) instructions. The isolated plasmids were screened for the presence of S. pyogenes oriC by digestion with HindlH (yielding 5.7 kb and 3.2 kb or 2.3 kb fragments).

Since the oriC inserts contained HindlH restriction sites on both ends and were inserted into a single Hindlll restriction site on pSM5000, it was possible that the insert could be ori- ented in either direction relative to the recipient plasmid. Therefore, any stractural interference by the recipient plasmid on replication induced by having the oriC in one orientation might be circumvented by having the oriC oriented in both directions relative to pSM5000. A DNA sequencing primer (pSM5K1428-48R, 5'-GCATCCAGGGTGACGGTGCCG-3' SEQ ED NO: 81) was design from a sequence 90 nt downstream of the Hindlll restriction site on the pSM5000 plasmid. This would allow the sequence inserted into the Hindlll site to be identified and also the orientation of the insert relative to pSM5000. Plasmids from positive isolates, from both pSt-oril and pSt-ori2, were subjected to DNA sequencing. Surprisingly, both plasmids were determined to contain only the ori-2 (the truncated fonn) insert and both were oriented in the reverse direction relative to the recipient plasmid numbering. The ability to replicate a plasmid containing our insert in S. pyogenes (that without the insert could not be replicated) proves that the cloned S. pyogenes region extending from 350 bases upstream of the end of spoOJ and 199 bases downstream of the beginning of dnaN contains the authentic origin of replication. The difficulty encountered is also characteristic of cloned functional Gram-positive origins, as they interfere or compete with host chromosomal replication, resulting in low-copy number and instability (Moriya, S. et al. N. (1999) Plasmid

Al: 17-29). For the first time, the oriC from S. pyogenes, an important Gram-positive pathogenic organism has been isolated.

Example 9. Cloning, expression and purification of S. pyogenes SSB In all replication systems studied to date, a cognate single-stranded DNA binding protein (SSB) is a required co-factor (Kornberg, A. and Baker, T. A. (1992) ibid.). Gram-positive organisms contain two candidate SSBs. Although in the published B. subtilis genome, one is termed SSB and the other (ywpH) and annotated "similar to SSB", it does not appear that there is sufficient difference to make a clear distinction in the absence of biochemical experiments. Both proteins will be expressed and it will be determined which (perhaps both) participate in the S. pyogenes replicative reaction. The alignment of the candidate S. pyogenes SSBs (SSB-1, SEQ ID NO:23 and SSB-2, SEQ LD NO:24) is shown in Figure 39 together with E. coli SSB (SEQ ED NO:25). Identical residues are highlighted in black; similar residues that are conserved between proteins are highlighted in gray.

Both S. pyogenes SSB candidates will be expressed as native proteins in the vector pAl-CB-ClaI-2. The coding sequences for both SSB-1 and SSB-2 will be isolated by PCR us- ing a forward primer with a non-complementary tail containing a Clal site that partially overlaps the initiating ATG. The reverse primers for both will include the natural stop codon followed by a noncomplementary Kpnl site for SSB- 1 and either a noncomplementary Kpnl or Spel site for SSB-2 (the goal here and with all similar constructions is to use terminal restriction sites that don't occur within the coding sequence). The PCR products will be cleaved by restriction enzymes recognizing the tenninal sites and cloned into the conesponding sites of the vector. The resulting plasmids will be transformed into E.coli expression/fermentation strain (MGC1030; uvrD, ompT, lexA3, Tl-resistant) and expression in terms of time of induction and induction temperature will be optimized. Nearly complete success has been achieved by this approach. Occasional problems have always been overcome by either i) expression with a different RNA polymerase (T7), ii) expression in the presence of co-induced heat shock proteins (groEL/groES and/or dna ldndKJgrpE with or without expression of thioredoxin), iii) co-expression of a rare tRNA or modification of rare codons to more commonly used ones or tv) coexpression with a binding partner to cover a hydrophobic face and avoid precipitation. If a Gram-positive environment is important, there are several systems for expression of bacterial in 5. subtilis (LeGrice, S. F. (1990) Methods Enzymol. 185:201-214; Brueckner, R. (1992)

Gene 122: 187-192). More efficient streptococcal expression vectors can be developed, as needed. Expression will be optimized using an SDS gel analysis if the expressed protein is visible as a distinct band. Initially, the expression will be optimized for total expressed protein , and monitored to assure that the majority of expressed protein is soluble. It the expressed protein cannot be directly visualized on gels from crade extracts, small DNA cellulose columns

(see next paragraph) will be ran, and eluted with high salt to permit detection of the expressed protein.

The expressed SSBs will by purified by chromatography on single-stranded DNA cellulose (Lohman, T. M. et al. (1986) Biochemistry 25: 21-25). Historically, very tight binding to SS-DNA cellulose provided the definition for SSBs (Alberts, B. M. et al. (1968) Cold Springs

Harb. Symp. Quant. Biol. 33: 289-305). Experience with this resin in the purification of the E. coli SSB protein provides guidance for one skilled in the art. Lysates will be ammonium sulfate precipitated. If the expressed protein is detectable from Coomassie-stained SDS gels, the concentration used will be optimized to provide a near quantitative yield of SSB with the exclusion of as many contaminants as possible. Redissolved ammonium sulfate precipitates will be applied to single-stranded DNA cellulose columns. Increasing salt elution buffers will be applied to the columns until SSB elutes, as judged by SDS gels. Based on the behavior of other SSBs, the S. pyogenes SSBs are expected to elute in 1-2 M NaCl. The identity of the final purified protein will be verified by transfer to membranes and amino-terminal sequencing. Further purification steps will be used, if needed, to obtain pure protein. Pure E. coli SSB is obtained after a single-chromatographic step, however. Any developed purification procedure will be scaled up to obtain the high quantities of SSB (10-100 mg) required to support these proposed studies. SSB can be tested for functionality using as ssDNA-SSB protein binding assay, or a reconstitution assay.

Example 10. Expression and purification of S. pyogenes x (DnaX) subunit

A. Identification of S. pyogenes dnaX. With S. pyogenes DNA polymerase III (both type I and II) and the β processivity factors in hand, by analogy to all other replication systems examined (E. coli, yeast and mammalian) the DnaX clamp loader assembly is expected to be the only remaining critical component required to reconstitute a minimal processive DNA polymerase III holoenzyme. Thus, we set out to obtain the expected components that are essential for DnaX complex function: DnaX (τ) protein, δ' and δ. The genes coding for τ (dnaX) and δ' (holB) are apparent from examination of the sequence of the S. pyogenes genome. Sequence information released as part of the University of Oklahoma's Streptococcal Genome Sequencing Project was utilized to identify genes and gene products of replication apparatus components. A search of the S. pyogenes sequence database vs. a prototypical low G+C Gram- positive firmicute αnα gene (B. subtilis) allowed identification of the S. pyogenes dnaX gene. The DNA coding sequence of the S. pyogenes dnaX gene is shown in Figure 40A (SEQ ED

NO:53). The start codon (atg) and the stop codon (tag) are shown in boldface letters. Also shown is the protein (amino acid) sequence derived from the DNA coding sequence (Figure 40B, SEQ LD NO:15). The alignment of S. pyogenes DnaX with the B. subtilis and E. coli homologs are shown in Figure 41 (upper alignment). Identical residues are highlighted in black; similar residues that are conserved between proteins are highlighted in gray.

B. Construction of Plasmids fpAl-Spy-dnaX) that Overexpress S. pyogenes τ subunit (dnαX gene) from the pAl Promoter fpAll Construction of pAl-Spy-dnaX entailed PCR am- plification of the S. pyogenes dnaX gene from S. pyogenes genomic DNA and insertion into the pAl-CB-Ndel plasmid. The forward/sense primer was (ATG #P206-S3):

5 'gactGGATCCCGGGAGGAGGACCGGTACCATGTATCAAGCTCTTTATCG-3 ' SEQ LD NO:82.

The 5' four nucleotides (lower case) serve as a clamp region to allow efficient digestion by the restriction enzyme. Next, there are overlapping BamHI/Smal restriction sites that conespond to the BamHUSmal restriction sites in the polyclonal region of pAl-CB-Ndel (Figure 42). In Figure 42, the restriction sites are shown above their cognate DNA sequence here and in sequences shown below. Next, the uppercase/bold letters indicate the new Shine-Dalgarno sequence (or ribosome binding site-RBS), which replaced the RBS removed from pAl-CB-Ndel digested with BamHUSaϊl. Following this is overlapping Agel and Kpnl restriction sites that will be used in construction of the clamp-loader operon described later. The _^4gel and Kpnl will also optimally space the ATG start codon downstream of the RBS. The underlined region of the primer indicates the region that is complementary to the 5' end of the S. pyogenes dnaX gene.

The reverse/antisense primer was (ATG # P206-A1715) : 5 '-gactGTCGACTTATTAGTCGTCAATAGTATTTATTTTATCG-3 ' SEQ ED NO:83.

The 5' four nucleotides (lower case) serve as a clamp region to allow efficient digestion by the restriction enzyme. Next, is a Sail restriction site, followed by two stop codons in tandem (bold), one that is complementary to the native stop and one that is added in the non- complementary portion of the primer. The underlined region of the primer indicates the region of the primer complementary to the 3 ' end of S. pyogenes dnaX gene. This resulted in the PCR product PCR SpydnaX (Figure 43). In Figure 43, and following figures depicting PCR products and finished vectors, restriction sites are noted and the cleavage site is shown in parentheses. In depiction of PCR products the primers are shown as anows above and below the PCR product, hi depiction of finished vector plasmids, the genes are shown as oversized arrows and are labeled. The promoters are labeled as pAl .

The PCR product was cut with BamHI and Sail restriction enzymes. PAl-CB-Ndel was also digested with BamHI and Sail restriction enzymes. This removed the RBS located be- tween the Xbal and Pad restriction sites along with the rest of the region located between the BamHI and Sail restriction sites, including the downstream C-term tag (see the insert region of pAl-CB-Ndel, Figure 42) on the pAl-CB-Ndel plasmid. The digested PCR product (containing a new RBS) was inserted into the digested pAl-CB-Ndel. Plasmids were transformed into E. coli and plasmid-containing colonies were selected by ampicillin resistance. The plasmids were prepared and screened for by BamHI/Sall restrictions digests yielding 1.6 and 5.6 kb fragments. The conect sequence of both strands of the DNA containing the entire dnaX gene was confirmed by DNA sequencing (ATG SΕQ #2850-2858, 2861-2864 and 2914-2915, primers P38-S5576, P64-A215, P206-S348, P206-S768, P206-S1211, P206-A1323, P206-A932, P206-A606, P206-A199, P206-S 1592). This plasmid canying the native S. pyogenes dnaX gene was designated pAl-Spy-dnaX (ATG glycerol stock #1535) (Figure 44).

C. Verification of Expression of Native S. pyogenes τ (dnaX gene product) by pAl- Spy-dnaX/MGC 1030. pAl-Spy-dnaX plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #1543). Bacterial cultures were grown, harvested and lysed as described in example 2B. A small aliquot of each clarified lysate (3.5 μl) was loaded onto a 4-20% SDS-

PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. A distinct protein migrating just above the 60 kDa marker (S. pyogenes DnaX has an approximate molecular mass of 62 kDa) could not be visualized in lanes containing proteins from bacterial lysates from induced cultures. The plasmid pAl-CB-Ndel (another expression vectors) contains a /αcl^q gene, which produces a protein that represses lacZ operators. All the genes under control of the pAl promoter are repressed in the presence of the repressor protein because the pAl promoter contains two lac operators. The pAl promoter is, however, exceptionally active upon induction with isopropyl-β-D-thio-galactoside (EPTG) and strongly repressed in its absence. This promoter is inserted between the XJtoI and EcoRI re- striction sites. Thus, bacterial cultures induced with LPTG express genes under control of pAl promoters. If the bacterial cultures are not induced with LPTG, genes on the plasmids are not expressed.

D. Construction. Expression and Purification of an N-Tenninal Tagged S pyogenes DnaX (pAl-NB-StPnaX). Based on studies of E. coli DnaX and T. thermophilus DnaX, it is known that N-terminal fusions are functional in reconstituted replication reactions. To express

S. pyogenes DnaX, the gene will be PCR amplified using a forward primer that begins its complementarity with codon 2 and a reverse primer that ends its complementarity with the natural stop codon. The forward primer will contain a 5 '-noncomplementary tail that contains a Pstl site plus additional bases. The reverse primer will contain a noncomplementary Kpnl site in its 5'-tail. The PCR product will be cleaved with Psfl and Kpnl and inserted in the conesponding sites of vector pAl-NB-ArvII.

The resulting biotin/hexahis tagged τ protein will be purified by Ni^-NTA chromatog- raphy. The resulting protein will be identified by Coomassie-stained gels and the authenticity of the final purified proteins verified by biotin blots (Kim, D. R. and McHenry, C. S. (1996) J. Biol. Chem. 271 : 20690-20698). If necessary, additional purification can be achieved by affinity chromatography on monomeric avidin affinity columns. The significant experience with these procedures with E. coli, T. thermophilus and a few S. pyogenes fusion proteins will pro- vide guidance.

The purified protein will be used to generate a battery of monoclonal antibodies through the University of Colorado Cancer Center Monoclonal Antibody Core. This facility, on a fee basis, previously made monoclonals to the ten E. coli DNA polymerase III holoenzyme subunits. The resulting antibody will be useful in monitoring the purification of native S. pyogenes τ protein and in immunoprecipitation experiments proposed later to aid in the identification of associated components if the direct biochemical strategies are not successful. Initial screening will be by ΕLISA assays complemented by Western blots on positives. The latter assay system is used to distinguish antibodies that react with any trace contaminants present in the S. pyogenes τ fusion protein preparation. As a confrol, the E. coli α subunit that has the same fusion peptide will be included in the screen, in order to eliminate antibodies that are directed against the fusion peptide. Those antibodies that also bind strongly to native protein bound to a BIA-core chip will be selected to ensure reactivity with native protein so it can also be used as an immunoprecipitating agent. Selected hybridomas are grown up at the 3 liter level to produce an abundant quantity of antibody and purified, where necessary, by standard proce- dures.

Example 11. Expression and purification of the S. pyogenes δ' (holB) subunit

A. Identification of S. pyogenes holB gene. A search of the S. pyogenes sequence database vs. a prototypical low G+C gram-positive firmicute holB gene (B. subtilis) allowed identi- fication of the S. pyogenes holB gene. The DNA coding sequence of the S. pyogenes holB gene is shown in Figure 45A (SEQ ED NO: 16). The start codon (atg) and the stop codon (tag) are shown in boldface letters. Also, shown is the protein (amino acid) sequence derived from the DNA coding sequence ofholB (Figure 45B, SEQ ID NO: 18). An alignment of S. pyogenes δ with the B. subtilis and E. coli homologs are shown in Figure 41 (lower alignment). Identical residues are highlighted in black; similar residues that are conserved between proteins are highlighted in gray.

B. Construction of Plasmids (pAl-Spy-holB) that Overexpress S. pyogenes δ' Subunit from the pAl Promoter (pAl . To construct the pAl-Spy-holB, the holB gene was amplified from S. pyogenes genomic DNA. The forward/sense primer was (ATG #P204-S32):

5 '-ggGAATTCCAT^PG(^rcrOGCGCAAAAAGCTCCTAACG-3 ' SΕQ ID NO:84.

At the 5' end of the primer is a two nucleotide clamp (lower case) to allow for efficient cutting by the restriction enzyme. Next, there is an EcoRI and an adjacent Noel restriction sites for insertion into pAl-CB-Νdel. The ATG start codon overlaps the Noel restriction site, hi the holB gene, the third codon "tta" codes for the amino acid Leu. This is a low usage codon in E. coli and was changed to a high usage codon "ctg" by the forward/sense primer in the PCR reaction. This codon change does not affect the identity of the amino acid coded for, but it allows a more efficient synthesis of the protein in E. coli. The first three codons of the forward primer are therefore non-complementary because of the modified codon #3 and are shown in italics. The region of the primer complementary to holB begimiing at codon #4 are shown as underlined.

The reverse/antisense primer was (ATG #P204-A939): 5'-gactGCTAGCCTGCAGCCrCC7TTATTATTCTGACATCACCATA-3' SΕQ ID ΝO:85.

The 5' four nucleotides (lower case) serve as a clamp region to allow efficient digestion by the restriction enzyme. Next, there is an Nheϊ restriction site for insertion into pAl-CB-Ndel.

This is followed by a Pstϊ restriction site that will allow the gene placed downstream ofholB to be removed and placed into a vector containing an N-terminal fusion peptide if needed in the future. Following the Pstl restriction site is an RBS site which will allow the ribosome to recognize the conect AUG start codon on the messenger RNA (mRNA) for the gene placed downstream ofholB in construction of a clamp-loader operon (discussed below) (shown as italics). There is an additional stop codon placed between the RBS and the native stop codon (bold), followed by the sequence complementary to the 3' end ofholB (underlined). This resulted in the PCR product PCR SpyholB (Figure 46). The PCR product was cut with Ndel and Nbel restriction enzymes. PAl-CB-Νdel was also digested with Noel and Nbel restriction enzymes. The digested PCR product was inserted into the digested pAl-CB-Νdel. Plasmids were transformed into E. coli and plasmid- containing colonies were selected by ampicillin resistance. The plasmids were prepared and screened for by Ndel/Nhel restrictions digests yielding 0.9 and 5.6 kb fragments. The conect sequence of both strands of the DΝA containing the entire holB gene was confirmed by DΝA sequencing (ATG SΕQ #2838-2843, primers P38-S5576, P65-A106, P204-S457, P204-S761, P204-A627, P204-A264). This plasmid canying the native S. pyogenes holB gene was designated pAl-Spy-holB (ATG glycerol stock #1509) (Figure 47). B. Verification of Expression of Native S. pyogenes δ' (holB gene product) bypAl-

Spy-holB/MGC1030. pAl-Spy-holB plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #1531). Bacterial cultures were grown, harvested and lysed as described in example 2B. A small aliquot of each clarified lysate (3.5 μl) was loaded onto a 4-20% SDS- PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. A distinct protein migrating just above the 30 kDa marker of the

Gibco 10 kDa protein ladder could be detected, consistent with the S. pyogenes δ' molecular mass of approximately 33.6 kDa). This protein band was visible in the lanes from bacterial lysates from induced cultures, but was not visible in the lanes containing proteins from bacterial lysates from uninduced cultures. Visual inspection indicated that this protein band consti- tuted less than 1% of the total protein in the bacterial lysate.

Example 12. Identification of the structural gene (holA) for the δ subunit of S. pyogenes DNA polymerase III holoenzyme

A. Identification of hoi A encoding the δ Subunit of S. pyogenes. Using a ψ-blast ap- proach, methods have been developed that permit identification of the stractural gene for the δ subunit of DNA polymerase III holoenzyme from all bacteria, described in detail in U.S. Provisional Patent Application Ser. No. 60/218,246, filed July 14, 2000, and U.S. Patent Application Ser. No. 09/906,179, filed July 16, 2001, entitled "Novel DNA Polymerase III Holoenzyme Delta Subunit Nucleic Acid Molecules And Proteins," incorporated by reference herein in its entirety. Using this procedure, the S. pyogenes holB homolog of B. subtilis (yqeN) was identified. Search of this gene vs. the S. pyogenes database at the University of Oklahoma permitted easy identification of a homologous gene (random probability score = 8xl0^"114; 64% identity). The DNA coding sequence of the S. pyogenes hoi A gene is shown in Figure 48 A (SEQ D NO:19). The start codon (atg) and the stop codon (tag) are shown in boldface letters. Also, shown is the protein (amino acid) sequence derived from the DNA coding sequence of hoi A (Figure 48B, SEQ ED NO:21). The alignment of the S. pyogenes HolA and B. subtilis homolog (YqeN) is shown in Figure 49. Identical residues are shown as white letters on black background and similar residues are shown as white letters on gray background.

B. Construction of Plasmids (pAl-Spy-holA) that Overexpress S. pyogenes δ Subunit from the pAl Promoter (pAl). To construct the pAl-Spy-holA plasmid, the hoi A gene was amplified from S. pyogenes genomic DNA. The forward/sense primer was (ATG #P205-S13): S'-gactTCTAGAGGAGGagcGCTAGC^rO^rCGCG^rCGAAAAGATTGAAAAACTGAG- 3' SEQ ID NO:86.At the 5' end of the primer is a four base clamp (lower case) to allow for efficient cutting by the restriction enzyme. Following the clamp sequence is an Xbal restriction site for insertion of hoi A into pAl-CB-Ndel. Next, the bold letters indicate the new RBS, which replaced the RBS removed from pAl-CB-Ndel digested with XbaVKpnl. The new RBS overlaps the Xbal restriction site by one nucleotide. There is a three nucleotide insertion (lower case) to allow optimal spacing between the RBS and the start ATG codon. Following the spacer is an NAel restriction site that will be used to insert the hoi A gene downstream of holB in construction of the clamp-loader operon (discussed below), hi the hoi A gene, codons #2 and 4 are "att" and "ata", respectively, and both code for the amino acid Leu. These codons are low usage codons in E. coli and were replaced with high usage codons "ate" by the for- ward/sense primer in the PCR reaction. These codon changes do not affect the identity of the amino acids coded for, but it allows a more efficient synthesis of the protein in E. coli. Therefore, the first four codons in the forward primer, which contain modified codons #2 and 4, are in italics. The region of the primer complementary to hoi A beginning at codon #5 is underlined.

The reverse/antisense primer (ATG #P205-A1101 is):

5'-tactGGTACCTGCAGCCTCCTCT4CTATTTTTGAGAGTGAGTCAT-3' SEQ ID ΝO:87.

At the 5' end of the primer is a four nucleotide clamp (lower case) to allow for efficient cutting by the restriction enzyme. Following the clamp region is overlapping Kpnl and Pstl restriction sites. The Kpnl restriction site will be used for insertion into pAl-CB-Ndel. The Pstl restriction site can be used to extract the dnaX gene, which will be placed downstream of hoi A in the clamp-loader operon (discussed below), and insert it into an N-terminal vector if needed in the future. Next, is an RBS (bold) that will be used by the downstream dnaX gene in the clamp- loader operon. This is followed by an additional stop codon (italics) that will be adjacent to the native stop codon. The nucleotides complementary to the 3' end of hoi A are underlined. This resulted in the PCR product PCR SpyholA (Figure 50).

The PCR product was cut with Xbal and Kpnl restriction enzymes. PAl-CB-Ndel was also digested with bαl and Kpnl restriction enzymes. The digested PCR product was inserted into the digested pAl-CB-Ndel. Plasmids were transformed into E. coli and plasmid- containing colonies were selected by ampicillin resistance. The plasmids were prepared and screened for y XbaVKpnl restrictions digests yielding 1.1 and 5.6 kb fragments. The conect sequence of both strands of the DNA containing the entire holA gene was confirmed by DNA sequencing (ATG SΕQ #2844-2849, primers P38-S5576, P65-A106, P205-S437, P205-S721, P205-A732, P205-A301). This plasmid canying the native S. pyogenes holA gene was designated pAl-Spy-holA (ATG glycerol stock #1511) (Figure 51). B. Verification of Expression of Native S. pyogenes δ (holA gene product) by pAl-

Spy-holA/MGC 1030. pAl-Spy-holA plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #1532). Bacterial cultures were grown, harvested and lysed as described in example 2B. A small aliquot of each clarified lysate (3.5 μl) was loaded onto a 4-20% SDS- PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1 % SDS. A distinct protein migrating just below the 40 kDa marker of the

Gibco 10 kDa protein ladder could be detected (S. pyogenes δ has a molecular mass of approximately 39.6 kDa). This protein band was visible in the lanes from bacterial lysates from induced cultures, but was not visible in the lanes containing proteins from bacterial lysates from uninduced cultures. Visual inspection indicated that this protein band constituted 1-2% of the total protein in the bacterial lysate.

Example 13. Construction of pAl-Spy-holBAX: A Vector Containing an Operon Composed of S. pyogenes holB, holA and dnaX.

A. Construction of Plasmid (pAl-Spy-holBA) that Overexpresses S. pyogenes δ' and δ subunits from the pAl Promoter (pAl). A plasmid was prepared that contained an operon that was composed of minimal subunits needed for a functional S. pyogenes clamp-loader complex; holB and hoi A, and dnaX respectively. This was accomplished by first digesting pAl -SpyholA with Nhel and Kpnl restriction enzymes. This resulted in the extraction of a fragment containing the entire hoi A gene. pAl-Spy-holB was also digested with NAel and Kpnl restriction enzymes, which are located downstream of the holB gene. The fragment from pAl-Spy- holA was inserted into the digested pAl-Spy-holB. This resulted in the plasmid pAl-Spy- holBA (Figure 52) which contained an operon composed of hoi A placed downstream ofholB and optimally spaced downstream of the RBS added downstream ofholB in the constraction of pAl-Spy-holB. The region between the holB and hoi A gene is shown in Figure 53. The tandem stop codons ofholB axe shown in bold upper case, the RBS is shown as bold lower case, and the hoi A start codon is shown as bold underlined upper case.

Plasmids were transformed into E. coli and plasmid-containing colonies were selected by ampicillin resistance. The plasmids were prepared and screened for by NheUKpήl restrictions digests yielding 1.1 and 6.5 kb fragments. The conect sequence of the 5' and 3' end of both genes was confirmed by DΝA sequencing (ATG SΕQ #2883-2885, primers P38-S5576, P204-S761P205-S721). These plasmids canying the native S. pyogenes holB and holA genes were designated pAl-Spy-holBA (ATG glycerol stock #1524). B. Verification of Expression of Native S. pyogenes δ' (holB product) and δ (hoi A gene product) by pAl-Spy-holBA/MGC1030. pAl-Spy-holBA plasmids were transformed into MGC1030 bacteria (ATG glycerol stock #1533). Bacterial cultures were grown, harvested and lysed as described in Example 2B. A small aliquot of each clarified lysate (3.5 μl) was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. Two distinct protein bands were visualized, one migrating just below the 40 kDa marker and the other migrating just above the 30 kDa marker of the Gibco 10 kDa protein ladder. These protein bands were visible in the lanes from bacterial lysates from induced cultures, but were not visible in the lanes containing proteins from bacterial lysates from uninduced cultures. Visual inspection indicated that these two pro- tein bands constituted 1-2% of the total protein in the bacterial lysate.

C. Constraction of Plasmid (pAl-Spy-holBAX) that Overexpresses S. pyogenes δ', δ and DnaX Subunits from the pAl Promoter (pAl). pAl-Spy-dnaX was digested -with. Kpnl and Sail and inserted into KpnllSaH digested pAl-Spy-holBA. This resulted in the plasmid pAl-Spy-holBAX (Figure 54), which contained an operon composed of holB, hoi A and dnaX, respectively. Each gene was optimally spaced downstream of its unique RBS. The region between the hoi A and dnaX gene is shown in Figure 55. The tandem stop codons of hoi A are shown in bold upper case, the RBS is shown as bold lower case, and the dnaX start codon is shown as bold underlined upper case. Plasmids were transformed into E. coli and plasmid-containing colonies were selected by ampicillin resistance. The plasmids were prepared and screened for by Kpnl] Sail restrictions digests yielding 1.7 and 7.5 kb fragments and Ndel/SaH restriction digests yielding 3.7 and 5.4 kb fragments. The conect sequence of the 5' and 3' end of each gene was confirmed by DNA sequencing (ATG SΕQ #2921-2924, primers P38-S5576, P204-S761, P205-S721,

P206-S1592). These plasmids canying the native S. pyogenes holB, hoi A and dnaX genes were designated pAl-Spy-holBAX (ATG glycerol stock #1546).

D. Verification of Expression of Native S. pyogenes δ' (holB product), δ (hoi A product) and DnaX (dnaX product) bvρAl-Spy-holBA/MGC1030 and pAl-Spy-holBAX/APl.Ll. pAl-Spy-holBAX plasmids were transformed into both MGC1030 and API XI bacteria (ATG glycerol stock #1554 and #1555, respectively). Bacterial cultures were grown, harvested and lysed as described in example 2B. A small aliquot of each clarified lysate (3.5 μl) was loaded onto a 4-20% SDS-PAGE mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. Three distinct proteins were visualized, one migrating just below the 40 kDa marker, one migrating just above the 30 kDa marker and one migrating just above the 60 kDa marker of the Gibco 10 kDa protein ladder. These protein bands were visible in the lanes containing proteins from bacterial lysates from induced cultures, but were not visible in the lanes containing proteins from bacterial lysates from uninduced cultures. Visual inspection indicated that these three protein bands constituted 1-2% of the total protein in the bacterial lysate.

E. Large Scale Growth of the Clamp-Loader Complex Containing Native S. pyogenes δ', δ and DnaX (holB, hoi A and dnaX gene products) by pAl-Spy-holBAX/APl.Ll. Strain pAl-Syp-holBAX/APl.Ll was grown in a 250 L fennentor (Fermentation Run # 01-08), to produce cells for purification of S. pyogenes δ', δ and DnaX. Bacterial cultures were grown and harvested as described in example 2C. Cell harvest was initiated 3 hours after induction at

OD₆oo equivalent of 5.6, and the cells were chilled to 10 °C during harvest. Quality control of the inoculum showed that 9 out of 10 positive colonies (positive colonies grow on LB media and are also able to grow on ampicillin-containing medium). Quality control of the harvest showed 0 out 10 positive colonies. The harvest volume was 180 L, and the final harvest weight was approximately 2.48 kg of cell paste. An equal amount (w/w) of Tris-sucrose buffer

(50 mM Tris (pH 7.5), 10% sucrose) was added to the cell paste. Cells were frozen by pouring the cells suspension into liquid nitrogen, and stored at -20 °C, until processed. F. Determination of Optimal Ammonium Sulfate Precipitation Conditions of Native S. pyogenes Clamp-loader Complex. As an initial purification step, many endogenous E. coli proteins can be removed by adding ammonium sulfate to concentrations that cause the protein of interest (and some endogenous proteins) to precipitate out of solution, while other proteins remain in solution. The precipitated protein can then be separated from the proteins still in solution by centrifugation. Each protein precipitates out of solution at different concentrations of ammonium sulfate (depending on amino acid composition, distribution of polar/non-polar surface exposed amino acids, molecular shape and level of hydration). Therefore, the concentration of ammonium sulfate (expressed as percent saturation) in which each target protein pre- cipitates out of solution has to be determined. This is especially important here because three separate proteins are expressed and will be purified as a complex.

S. pyogenes clamp-loader complex Frl (90 ml) was obtained from lysis of 25 g of cells (pAl-Spy-holBAX/APl.Ll) as described in Example 2E. Frl was divided into six samples of 15 ml each and labeled 10%, 20%, 30%, 40%, 50% and 60%. The protein in each sample was precipitated by adding varying amounts ammonium sulfate so that the final concentration of ammonium sulfate was: 10%, 25%, 30%, 40%, 50%, and 60% saturation, respectively, at 4 °C. The mixture was stined for an additional 30 min at 4 °C and the precipitate was collected by centrifuged (23,000 x g, 45 min, 0 °C). The supernatant was removed from each sample and the resulting pellets were resuspended in a buffer containing 50 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, 10% glycerol, 2.0 mM DTT, 25 mM NaCl and is designated as FrII. The protein concentration of each sample from the resuspended pellets (FrII) and the supematants was determined using the Coomassie Protein Assay Reagent (Pierce) and bovine serum albumin (BSA) as a standard. The resuspended pellets contained increasing concentration of protein as the per cent ammonium sulfate used to precipitate the samples was increased. This data was confirmed by SDS-polyacrylamide gel electrophoresis.

To determine the % ammonium sulfate to use in preparation of large-scale clamp-loader complex containing maximum levels of clamp-loader activity and minimum levels of contamination, reconstitution assays were used. Based on SDS-polyacrylamide gels, FrII samples precipitated at 20%, 30%, 40% and 50% saturation with ammonium sulfate were assayed in 25 μl reconstitution reactions modified from those described in Example 14. Briefly, reactions contained 19 μl of the primed-template mix, 3 μl EDB buffer, 1 μl S. pyogenes PolC (α subunit) (1.9 μM), 1 μl S. pyogenes β (2.62 μM), and 1 μl of various dilutions ofpAl-Spy- holBAX/APl.Ll FrII. To maintain activity in the linear range samples precipitated in 20% ammonium sulfate saturation were assayed at dilutions between 1:10 and 1:160. Samples were diluted in EDB buffer. Samples precipitated in 30%, 40% and 50% ammonium sulfate saturation were assayed at dilutions between 1 :200 and 1 :6400. The reactions were incubated for 5 min at 30 °C. The reactions were terminated by placing the reaction tubes on ice and adding 2 drops of 0.2 M NaPP and 0.5 ml 10% TCA. The solution was filtered under vacuum through

Whatman GF/C glass microfiber filters. The filters were then washed with 3 ml of IM HCl/0.2 M NaPPj and 1 ml 95% EtOH and dried using a heat lamp. The pmol of nucleotides incoφorated were quantified by scintillation counting and total units (Figure 56A) and the specific activities (Figure 56B) were determined. The samples precipitated using 30% ammonium sul- fate saturation contained the greatest amount of total clamp-loader activity and highest specific activity.

G. Purification of S. pyogenes Clamp-Loader Complex from Large-Scale Growth of pAl-Spy-holBAX/APl XI . S. pyogenes clamp-loader complex Frl (2250 ml) was obtained from lysis of 550 g of cells (pAl-Spy-holBAX/APl.Ll) as described in Example 2E. Ammo- nium sulfate was added (0.164 g/ml-30% saturation) to Frl over a 30 min interval. The mix was stined an additional 1 h at 4 °C and the precipitate was collected by centrifugation (23,000 x g, 1 h at 4 °C). The resulting protein pellet was resuspended in Buffer 1 (50 mM Tris-HCl, (pH 7.5), 20% glycerol, 0.5 mM EDTA, 2 mM DTT) resulting in FrII. The clamp-loading complex in FrII was further purified by a Heparin Sepharose™ Fast Flow (Phannacia) column (80 ml, 3.0 x 20 cm). The column was equilibrated in Buffer 1 plus 50 mM NaCl. The sample was diluted with Buffer 1 to the conductivity of the heparin column (81 ml, 7.2 mg/ml) and loaded onto the column at a flow rate of 0.65 ml/min. Approximately 4% of the protein was observed to flow through the column containing no detectable activity. The column was washed with 4 column volumes of Buffer 1 plus 50 mM NaCl. Approximately 18% of the total loaded protein was observed in the wash also containing no detectable activity. The protein was eluted from the column in 10 column volumes of Buffer 1 containing a 50-300 mM NaCl linear gradient at a flow rate of 0.78 ml/min. Eighty fractions (9.5 ml) were collected and assayed for protein concentration and in reconstitution assays as described in Example 14 (Figure 57). Fractions 50-62 (114 ml, 0.16 mg/ml) were pooled (Frill) and the volume of the pool was reduced to 15 ml (1.2 mg/ml) by placing the sample in dialysis tubing (10 kDa cutoff, Spectra/Por Membrane) and exposing to Carbowax PEG 8000 (Fisher) until the volume was reduced to the desired volume (FrlN). A summary of the purification steps is shown in Table IX and the result of each purification step was visualized by SDS-polyacrylamide gel electrophoresis (Figure 58).

Table IX. Summary of S. pyogenes Clamp-Loader Purification

Purification Volume Total Protein Total Activity Specific Activ¬

Step (ml) (mg) (Units) ity (Units/mg)

Frl 2250 45712 3.2 10° 7.0 x lO⁴

FrII 81 581 3.5 x lO⁸ 5.2 x lO⁵

Frill 114 18 3.5 x lO⁶ 2.0 x lO⁵

FrlN 15 18 2.8 x lO⁷ 1.5 x 10°

Example 14. Development of a Reconstituted S. pyogenes Replicative Polymerase

A. Determination of Functionality of S. pyogenes PolC, β and the Clamp-Loader Complex. A primary goal of this endeavor has been to obtain the minimal assembly of the essential subunits of a processive S. pyogenes replicase that should permit processive synthesis of long stretches of DΝA. It was hypothesized that, minimally, S. pyogenes PolC, β, and the clamp- loader complex would be required. A modified form of the standard assay for the E. coli DΝA polymerase III holoenzyme was used. The method comprised synthesis on a long single- stranded circular template primed by an RΝA primer. Ml 3 Gori single-stranded DΝA was primed by the action of the E. coli DnaG primase in a large volume reaction that was aliquoted and frozen away for use in all reported assays. RΝA primed M13 Gori single-stranded DΝA is prepared (9.5 ml) by adding: 0.5 ml MgOAc (250 mM), 1.125 ml M13 Gori (240 μM, nt), 0.2 ml purified E. coli SSB proteins (4.3 mg/ml), 1.5 ml dΝTP mix (400 μM dATP, dCTP, dGTP and 150 μM [³H]-dTTP (100 cpm/pmol), 0.5 ml rΝTP mix (5 mM of each ATP, CTP, GTP and UTP), 0.025 ml purified E. coli primase (0.665 mg/ml) and 5.65 ml EDB (50 mM HEPES (pH 7.5), 20% glycerol, 0.02 % ΝP40, 0.2 mg/ml BSA). The radioactive dNTP mix was not used in the priming reaction but was used by the replication polymerase when it is added in the actual replication reaction (M13 Gori reaction). The priming mix was incubated at 30°C for 5 min and then placed on ice. The mixture was divided into 400 μl aliquots and stored at -80°C until use. This mixture was used in all Ml 3 Gori assays and is refened to as the primed- template mix.

Initially all of the S. pyogenes subunits (PolC, β, clamp-loader complex FrLE) were assayed together to determine if the complex could support processive polymerization of the Ml 3 Gori primed template. The concentration of each S. pyogenes component used in this ini- tial set of assays was arbitrarily set. In numerous assays, PolC was varied from 0.08-0.3 μM, β was varied from 0.2-20 μM, and 1-4 μl clamp-loader complex FrII was used. The subunits were diluted in EDB buffer and combined (6 μl total) and then mixed with 19 μl of the primed- template mix to yield a 25 μl reaction. The reactions contained approximately 550 pmol of primed-template (total nucleotides). Reactions were initiated by combining the enzyme mix and the primed-template mix and incubating for 5 min at 30 °C. Placing the reaction tubes on ice and adding 2 drops of 0.2 M NaPP, and 0.5 ml 10% TCA tenninated the reactions. The solution was filtered under vacuum through Whatman GF/C glass microfibre filters. The filters were then washed with 3 ml of IM HCl/0.2 M NaPP, and 1 ml 95% EtOH and dried using a heat lamp. The pmol of nucleotides incorporated were quantified by scintillation counting. The results of these assays indicated that using partially purified clamp-loader complex, PolC and β was saturating in these reactions at 0.013 and 0.23 μM, respectively.

B. Concentration Optimization of the Components of the S. pyogenes Replicative Polymerase in Reconstitution Assays. Upon completed purification of the clamp-loader complex, the three components of the S. pyogenes replicative polymerase were assessed individually in the presence of excess levels of the other components. The clamp-loader complex was assayed as described above while holding PolC and β concentrations at 0.013 and 0.23 μM (0.31 and 5.6 pmol), respectively. The clamp-loader complex was varied from 0.29 nM to 0.037 μM (0.008-0.92 pmols). This titration indicated that the clamp-loader complex became saturating at approximately 0.009 μM (0.23 pmol), this data is shown in Figure 59. Next, PolC was assayed while holding clamp-loader complex and β constant at 0.009 and 0.23 μM (0.23 and 5.6 pmol). S. pyogenes Pol C was varied between 0.2 nM and 0.13 μM (0.005-3.1 pmol). The concentration of PolC was observed to become saturating at approximately 0.013 μM (0.3 pmol) (Figure 60). Finally, β was assayed while holding clamp-loader complex and PolC at constant concentration of 0.009 and 0.013 μM (0.23 and 0.3 pmol), respectively. The concentration of β was varied between 0.011 and 0.45 μM (0.28 and 11.2 pmol). The concentration of β was observed to become saturating at 0.11 μM (2.8 pmol) (Figure 61).

All of the components of the S. pyogenes replicative polymerase have been shown to be required for processive polymerization. In future assays for screening of chemical compound libraries, the assay conditions determined here will be used to determine the ability of a chemical compound to inhibit DNA replication in S. pyogenes. The assays will be designed so that component concentrations used will be just above the linear regions observed in the individual titration curves. This will insure that inhibition of any component of the reconstituted replicative complex by a compound will be detected.

Example 15. Use of S. pyogenes x-δ-δ' to obtain additional components of the DnaX com- plex and reconstitution of S. pyogenes DnaX complex

In other cellular systems examined to date, the ATPase that transfers the sliding clamp processivity factor (i.e., β₂ in E. coli, PCNA in eukaryotes) contains five different proteins that are tightly and cooperatively bound in a complex. In E. coli, the proteins that associate with DnaX are δ, δ', χ and ψ. χ and ψ are not sufficiently conserved to recognize them from the genomes of sequenced organisms. They do, however, assemble in a highly cooperative fashion, which should aid in their detection. To isolate the S. pyogenes homologs of the DnaX- associating protein, the DnaX-biotin fusion protein described earlier will be immobilized by its high affinity for a streptavidin- agarose column. Then, lysates of native S. pyogenes cells will be incubated with the resin and the S. pyogenes DnaX-associated protein allowed to exchange and bind to the immobilized DnaX. Since E. coli δ-δ' and χ-ψ bind the third of five τ domains, the amino-terminal fusion should not sterically interfere. Such fusions do not interfere with binding in E. coli.

Once the S. pyogenes DnaX-associated proteins become bound to the affinity column, contaminants will be washed away. In E. coli, the half-life for DnaX complex dissociation is on the order of 30 minutes in the presence of all of its partners, enabling a thorough washing.

Specifically bound proteins will be eluted as part of an intact complex with biotin or denatur- ants, separated by SDS-PAGE, fransfened to a membrane, and both amino-terminal and internal peptide sequences detennined, using methods previously used successfully for identifying subunits of the replication complexes from other organisms (McHenry, C. S. et al. (1997) J. Mol. Biol. 272: 178-189). These sequences will be used to identify the stractural gene for the isolated proteins by inspection of the open reading frames of the S. pyogenes genome. These proteins will be expressed and purified, their ability to form a specific complex with S. pyogenes DnaX with a defined stoichiometry confirmed, and used to reconstitute S. pyogenes DnaX complex to provide material to reconstitute a functional S. pyogenes DNA polymerase III holoenzyme. Example 16. Identification, Expression and Purification of DinG exonuclease

With reconstitution of the DnaX complex and identification and expression of the available components together with the β processivity factor and two different DNA polymerase Ills, the only component that is anticipated to be required to fully reconstitute the core DNA polymerase III, type I is the 3'— »5' proofreading exonuclease. The type II enzyme contains the proofreading exonuclease as part of the polymerase chain (Barnes, M. et al. (1992) Gene 111 : 43-49). Examination of the genome sequences of Gram-positive organisms yields an apparent ε 3'— »5' exonuclease candidate whose amino-terminus closely resembles the ε proofreading subunit of other bacteria. It is assigned dinG in B. subtilis because of an unveri- fied weak homology to E. coli dinG. It contains the essential four acidic residues found in other ε proofreading exonucleases (but not in E. coli dinG). An alignment of S. pyogenes dnaQ (SEQ D NO:91) with homologs from Aquifex, B. subtilis, E. coli and T. pallidum (SEQ ED Nos: 35, 36, 37, and 38, respectively) is shown in Figure 62. Identical residues are highlighted in black; similar residues that are conserved between proteins are highlighted in gray. These conserved acidic residues presumably are involved in chelation of 2 Mg ions that is central to the mechanism of the proofreading activity of E. coli DNA polymerase I and other exonucleases (Xu, Y. et al. (1997) J. Mol. Biol. 268: 284-302) ). ε (DinG) will be expressed using strategies similar to those described above and purified using an assay developed for E. coli ε, the conversion of radiolabeled oligonucleotides to a form that will no longer bind to DEAE filters in high salt (Griep, M. et al. (1990) Biochemistry 29: 9006-9014)). Once the candidate S. pyogenes ε is obtained in pure form, the proofreading subunit will be added back to DNA polymerase III type I and be tested for formation of a defined stoichiometric complex by gel filtration.

If additional factors are required that bind to either type I or II DNA polymerase III from S. pyogenes, biotinylated fusion polymerase can be expressed and binding proteins can be isolated much as described for DnaX. Additional factors, if necessary, could be purified on the basis of their stimulatory activity as described in the DnaX section.

Example 17. The use of reconstituted replicase from S. pyogenes for screening of anti- bacterial drug candidates that inhibit the replicase

Based on the mechanism of E. coli replicase, it is anticipated that this screen enabling detection of inhibitors i) against the catalytic sites (polymerase site in pol III and ATPase site in DnaX), ii) against the special interaction between any replicase and its cognate SSB, iii) inhibition of any of the multiple contacts required during assembly of the β processivity factor on DNA (δ-β contact, a conformational change transmitted through δ' to δ from the ATPase site in DnaX, a late stage DnaX-β contact, and zv) inhibition of the critical link between DNA polymerase EH and β. This single assay provides seven known targets , as well as those that have not yet been identified. It is already known that the elongation reaction of the E. coli holoenzyme can be followed by fluorescence methods that avoid the requirement for any post- reaction workup (Seville, M. et al. (1996) BioTechniques 21 : 664-672). Once lead inhibitors are discovered, they will be screened against a human recombinant replicase system and cross- reactive inhibitors eliminated. For the more promising candidate leads, the extensive knowledge of the mechanism of replicases can be used to identify the specific target or, minimally, restrict the possible candidates. For example, it can be determined whether an inhibitor targets the polymerase alone in a simple auxiliary factor-independent gap filling assay (McHenry, C.S., and Crow, W. (1979) J. Biol. Chem. 254: 1748-1753), if it targets the ATPase activity of DnaX (Tsuchihashi, Z. and Kornberg, A. (1989) J. Biol. Chem. 264: 17790-17795; Lee, S.-H. and Walker, J. R. (1987)

Proc. Natl. Acad. Sci. U. S. A. 84: 2713-2717; Onrust, R. et al. (1991) J. Biol. Chem. 266: 21681-21686), and if it inhibits δ binding to β either alone or in an ATP-effector depending reaction when δ is part of the DnaX complex. An independently determination can also be made as to whether candidate inhibitors block the ATP-dependent assembly of β onto primed DNA by the DnaX complex (Johanson, K. O. and McHenry, C. S. (1982) J. Biol. Chem. 257:

12310-12315; Stukenberg, P. T. et al. (1994) Cell 78: 877-887). This will provide a differential analysis of the site of inhibition. If neither the β-δ contact nor ATPase activity of DnaX is blocked, this would implicate the transient γ-β interaction or an unknown interaction as being the target. Independent assays can be perfonned to determine whether inhibitors effect the ability of DNA polymerase III to assemble onto a primed-template preloaded with β and to processively extend the primer upon the addition of dNTPs. If the inhibitor affects assembly, a polymerase-β interaction is likely being targeted. If processivity is influenced, either the dynamic interaction of the polymerase with the β is being targeted or a specific conformational change in the polymerase following dNTP incorporation leading to translocation. The latter possibility should be addressable with processivity assays with the polymerase alone (Fay, P. J. et al. (1981) J. Biol. Chem. 256: 976-983; Fay, P. J. et al. (1982) J. Biol. Chem. 257: 5692- 5699). A role in SSB binding in inhibition can be distinguished by comparing results from as- says performed in the presence or absence of this protein (Glover, B. and McHenry, C. S. (1998) J. Biol. Chem. 273: 23476-23484).

Example 18. Identification and isolation of components required for formation of RNA primers for S. pyogenes replication. Cloning, expression and purification of DnaG primase. h E. coli, in the absence of SSB, the replicative helicase can associate transiently with single-stranded DNA and the DnaG primase, permitting random formation of RNA primers that can be elongated efficiently by the DNA polymerase III holoenzyme (Arai, K.-I. and Kornberg, A. (1979) Proc. Natl. Acad. Sci. U. S. A. 76: 4308-4312). While there is no absolute assurance that this mechanism will be conserved in S. pyogenes, reconstitution of the primer formation reaction will be attempted prior to embarking on reconstitution of the entire DnaA- and origin-dependent initiation reaction because it could provide a convenient way- point to permit optimization of part of the initiation reaction before embarking on the entire reaction.

The gene for dnaG primase (SEQ ED NO:90) is apparent from the sequence of the S. pyogenes genome. It is shown in Figure 63 aligned with the homologous E. coli (SEQ ED NO:39) and B. subtilis (SEQ LD NO:40) proteins. Identical residues are highlighted in black; similar residues that are conserved between proteins are highlighted in gray. The protein will be expressed by strategies presented for preceding examples in this application, just as others and we have done for E. coli primase. It is preferable, where possible, to purify proteins using functional assays to ensure their activity is preserved. The E. coli primase normally requires other proteins for action. However, a variety of phages and single-strands obtained from duplex plasmids enable generation of primers directly by DnaG that can be elongated by DNA polymerase III holoenzyme (Zechel, K. et al. (1975) J. Biol. Chem. 250: 4684-4689); Tanaka,

K. et al. (1994) J. Bacteriol. 176: 3606-3613); Rowen, L. and Kornberg, A. (1978) J. Biol. Chem. 253: 770-774). Whether redissolved ammonium sulfate fractions from S. pyogenes DnaG primase expressed in E. coli have a markedly increased activity on M13Gori (M13 with the DnaG-dependent bacteriophage G4 origin cloned into it) or other templates routinely used will be determined. To M13Gori DNA will be added S. pyogenes SSB, reconstituted S. pyogenes DNA polymerase III holoenzyme, radioactive dNTPs, unlabeled rNTPs, Mg⁺⁺ and varying quantities of S. pyogenes DnaG primase. If an increase in DNA synthesis is seen by the standard TCA precipitation/GFC filtration assay, it will be optimized to give a linear response with added DnaG and used to monitor purification of the protein.

At high concentrations, DnaG primase from E. coli will synthesize short RNA oligonucleotides using some oligonucleotide templates (Swart, J. and Griep, M. (1995) Biochemistry 49: 16097-16106). The E. coli primase shows a preference for oligonucleotides containing a

CTG sequence at least five bases from the 3 '-end of the template. If this approach described in the preceding paragraph is not successful, several templates available as oligonucleotide stocks will be screened to see if short RNA synthesis catalyzed by recombinant S. pyogenes DnaG primase can be achieved on one. This assay would monitor incorporation of a radioactive rNTP (ATP or GTP) into an oligonucleotide that is trapped on DΕAΕ filters under conditions where rNTPs are washed off (Rowen, L. and Kornberg, A. (1978) J. Biol. Chem. 253: 758- 764). If an activity assay can not be developed by this or the strategies explained below that exploit a potential dependency on the S. pyogenes replicative helicase and associated factors, tagged primase will be purified by affinity methods, antibodies will be made and used to follow the purification of native proteins. If a "blind purification" is pursued , without direction of a functional assay, those conditions that preserve activity with the E. coli primase will be utilized. The antibodies should also be useful for inactivating DnaG in extracts that support replication of chromosomal replication origin containing plasmids to permit assaying the protein and developing new purifications if the protein purified blindly turns out to be inadequate.

Example 19. Cloning, expression and purification of the S. pyogenes replicative helicase and reconstitution of a "general priming" reaction. hi E. coli, the DnaB helicase greatly stimulates primer formation on primed single- stranded DNA (Arai, K.-I. and Kornberg, A. (1979) ibid.). These primers are efficiently used by the DNA polymerase III holoenzyme to form long products, essentially amplifying the signal from primer production. The helicase from E. coli has been purified using this assay (Gao, D. and McHenry, C. S., unpublished results), which is convenient, linear and quantitative. These procedures will be repeated for the S. pyogenes DnaC protein, apparently the functional analog of the E. coli DnaB helicase (Sakamoto, Y. et al. (1995) Microbiology 141: 641-644) (note Gram-positive gene assignments in Table II where E. coli DnaB and B. subtilis DnaC are functional equivalents). S. pyogenes DnaC protein will be expressed, attempting a native (untagged) protein expression initially. Ammonium sulfate fractions from S. pyogenes DnaC- expressing E. coli strains will be tested for activity (relative to non-expressing controls). If significant activity is observed, assays will be optimized to give a linear response vs. the quan- tity of DnaC protein added and the assay will be used to guide the purification. Failing this, affinity columns using biotinylated DnaG on streptavidin beads will be prepared and used to determine whether DnaC is retained. The E. coli DnaB helicase interacts directly with primase free in solution (Tougu, K. et al. (1994) J. Biol. Chem. 269: 4675-4682). If retention is observed, purification could be achieved as described above for τ-associating proteins (Example 15). DNA, small oligonucleotides or Mg^-ATP might be required as an effector to permit the association. If these methods fail, tenninally-biotin/hexahis tagged DnaC will be prepared and used to purify the protein by Ni⁺⁺-NTA and, if needed, soft-release monomeric avidin chromatography. In the latter case, antibodies would be made and used as described above for DnaG.

Example 20. Identification and expression of additional primosome candidates.

_, Native S. pyogenes DnaB, DnaD and Dnal will be expressed, and an attempt will be made to see if ammonium sulfate cuts from extracts of expressing cells stimulate a general priming reaction in the presence of single-stranded DNA and DnaG in the presence and ab- sence of DnaC. If activity is detected, the conesponding protein will be purified as described above for DnaC. In addition to classical chromatographic approaches or the use of bio- tin/hexahis protein tags, it may be possible to take advantage of the observations, acquired from the yeast two-hybrid system, that the DnaC and DnaA proteins interact with the Dnal and DnaD proteins, respectively (Moriya, S. et al. (1999) Plasmid 41: 17-29). One protein, in the hexahis/biotin tagged form might provide an effective affinity ligand for its partner as described in preceding sections of this proposal. Once a functional assay for any of the above components is established, it will be used to establish purifications for the participating native recombinant proteins optimizing for a procedure that yields protein with maximal activity.

Example 21. The use of reconstituted primosome assembly from S. pyogenes (or its components) for screening of antibacterial drug candidates.

By analogy to the E. coli system, it is anticipated that the most likely minimal outcome will be the development of a helicase- and primase-dependent priming assay. The proteins could be assayed alone for their ability to cooperatively enable synthesis of short RNA primers or for their ability to generate primers that could be elongated by the Gram-positive replicase.

This assay would reveal, in addition to the targets listed in Example 15, the primase activity, the helicase-DNA interaction and the primase-helicase interaction. All three targets can be assayed independently in E. coli and presumably can be in the S. pyogenes system. Of course, the flexibility is present to develop a suitable assay independent of the proteins required and to use those assays to specifically identify targets of inhibitors, much like the strategies described in Example 15.

Claims

CLAIMS We claim:

1. An isolated S. pyogenes DNA polymerase type I . subunit protein, wherein the type I subunit protein is selected from the group consisting of:

5 a) an amino acid sequence represented by SEQ ID NO:3; and b) an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ID NO:3.

2. An isolated polypeptide selected from the group consisting of a polypeptide encoded by a nucleic acid molecule represented by SEQ ED NO:l and a polypeptide encoded by a 0 nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by

SEQ ED NO: 1.

3. The isolated polypeptide of Claim 2, wherein the polypeptide is capable of extending primed DNA in a gap-filling polymerase assay.

4. An isolated nucleic acid molecule selected from the group consisting of a nu- 5 cleic acid molecule represented by SEQ LD NO:l and a nucleic acid molecule having at least

85% homology to a nucleic acid molecule represented by SEQ LD NO:l.

5. An isolated bacterial DNA polymerase type II subunit protein, wherein the type II a subunit protein is selected from the group consisting of: a) an amino acid sequence represented by SEQ ED NO:6; and 0 b) an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ED NO:6.

6. An isolated polypeptide selected from the group consisting of a polypeptide encoded by a nucleic acid molecule represented by SEQ D NO:4 and a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by

!5 SEQ ED NO:4.

7. The isolated polypeptide of Claim 6, wherein the polypeptide is capable of extending primed DNA in a gap-filling polymerase assay.

8. An isolated nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ED NO:4 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ED NO:4.

9. An isolated bacterial DNA polymerase β subunit, wherein the β subunit selected from the group consisting of: a) an amino acid sequence represented by SEQ ID NO:9; and b) an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ ED NO:9.

10. An isolated polypeptide selected from the group consisting of a polypeptide en- coded by a nucleic acid molecule represented by SEQ ED NO:7 and a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ED NO:7.

11. The isolated polypeptide of Claim 10, wherein the polypeptide is capable of stimulation of the processivity of the DNA polymerase in a processivity stimulation assay.

12. An isolated nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ D NO:7 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ LD NO:7.

13. An isolated bacterial DNA polymerase DnaA protein, wherein the DnaA protein is selected from the group consisting of: a) an amino acid sequence represented by SEQ ED NO: 12; and b) an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ LD NO: 12.

14. An isolated polypeptide selected from the group consisting of a polypeptide encoded by a nucleic acid molecule represented by SEQ ED NO: 10 and a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO: 10.

15. The isolated polypeptide of Claim 14, wherein the polypeptide is capable of binding to dnaA boxes in a dnaA box binding assay.

16. An isolated nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ED NO: 10 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO: 10.

17. An isolated bacterial DNA polymerase DnaX subunit protein, wherein the DnaX subunit protein is selected from the group consisting of: a) an amino acid sequence represented by SEQ LD NO: 15; and b) an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented by SEQ LD NO:15.

18. An isolated polypeptide selected from the group consisting of a polypeptide en- coded by a nucleic acid molecule represented by SEQ ED NO: 13 and a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ED NO: 13.

19. The isolated polypeptide of Claim 18, wherein the polypeptide is capable of stimulation of the processitivity of the DNA polymerase in a reconstitution assay.

20. An isolated nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ID NO: 13 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ LD NO:13.

21. An isolated bacterial DNA polymerase δ' subunit protein, wherein the δ' subunit selected from the group consisting of: a) an amino acid sequence represented by SEQ ED NO: 18; and b) an amino acid sequence having at least 95°/o sequence identity to an amino acid sequence represented by SEQ LD NO: 18.

22. An isolated polypeptide selected from the group consisting of a polypeptide encoded by a nucleic acid molecule represented by SEQ ID NO: 15 and a polypeptide encoded by a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ED NO: 15.

23. The isolated polypeptide of Claim 22, wherein the polypeptide is capable of stimulation of the processitivity of the DNA polymerase in a reconstitution assay.

24. An isolated nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ED NO: 15 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ LD NO: 15.

25. An antibody, wherein the antibody is capable of specifically binding to at least one antigenic determinant on the protein encoded by an amino acid sequence selected from the group consisting of a) an amino acid sequence selected from the group consisting of an amino acid sequence represented by SEQ ID NO:3, SEQ ED NO:6, SEQ ED NO:9, SEQ ED NO: 12, SEQ LD NO:15, SEQ ID NO:18, SEQ ED NO:23, SEQ ED NO:24, SEQ LD NO:90, and SEQ ED NO:91; and b) an amino acid sequence selected from the group consisting of an amino acid sequence having at least 95% sequence identity to an amino acid sequence represented in a).

26. The antibody of Claim 19, wherein the antibody type is selected from the group consisting of polyclonal, monoclonal, chimeric, single chain, F_ab fragments, and an F_ab expres- sion library.

27. A method for producing anti-DNA polymerase III subunit antibodies comprising exposing an animal having immunocompetent cells to an immunogen comprising at least an antigentic portion of DNA polymerase III subunit.

28. The method of Claim 27, wherein the DNA polymerase III subunit is selected from the group consisting of an S. pyogenes type I subunit, an S. pyogenes type II subunit, an S. pyogenes β subunit, an S. pyogenes DnaA subunit, an S. pyogenes DnaX subunit, an S. pyogenes δ' subunit, an S. pyogenes SSB-1 subunit, and an S. pyogenes SSB-2 subunit.

29. The method of Claim 27, further comprising the step of harvesting the antibodies.

30. The method of Claim 27, further comprising fusing the immunocompetent cells with an immortal cell line under conditions such that a hybridoma is produced.

31. A method for detecting an S. pyogenes DNA polymerase III subunit protein comprising, a) providing in any order, a sample suspected of containing S. pyogenes DNA po- lymerase III, an antibody capable of specifically binding to at least a portion of the S. pyogenes DNA polymerase III subunit protein; b) mixing the sample and the antibody under conditions wherein the antibody can bind to the S. pyogenes DNA polymerase III; and c) detecting the binding.

32. A recombinant molecule comprising at least a portion of an S. pyogenes DNA polymerase III holB nucleic acid molecule, at least a portion of an S. pyogenes DNA polymerase III holA nucleic acid molecule, and at least a portion of an S. pyogenes DNA polymerase III dnaX nucleic acid molecule.

33. The recombinant molecule of Claim 32, wherein the holB, holA, and dnaX nucleic acid molecules are operably linked to a transcription control element.

34. The recombinant molecule of Claim 33, wherein the transcription control element is pAl.

35. The recombinant molecule of Claim 33, wherein the transcription control ele- ment is an RBS.

36. A method of preparing an S. pyogenes clamp-loader complex, comprising: a) providing a recombinant molecule comprising at least a portion of an S. pyogenes DNA polymerase III holB nucleic acid molecule, at least a portion of an S. pyogenes DNA polymerase III holA nucleic acid molecule, and at least a portion of an S. pyogenes DNA poly- merase III dnaX nucleic acid molecule; b) providing a transcription control element operably linked to a nucleic acid molecule of a) c) expressing said nucleic acid molecules of a) to generate δ, δ', and τ subunit proteins under conditions that promote the formation of the δδ'τ clamp-loader complex; and d) isolating said clamp-loader complex.

37. A method for isolating a component of an S. pyogenes DnaX complex comprising a) providing an S. pyogenes DnaX, b) contacting the S. pyogenes DnaX with a sample suspected of containing a DnaX complex component under conditions sufficient for the DnaX complex component to bind to DnaX to form a DnaX: component complex; c) dissociating the DnaX: component complex, whereby the component may be isolated.

38. A method for isolating an S. pyogenes DnaX complex comprising a) providing an S. pyogenes DnaX, b) contacting the S. pyogenes DnaX with a sample suspected of containing DnaX complex components under conditions sufficient for DnaX complex components to bind to DnaX to form a DnaX:component complex; and c) isolating the DnaX complex.

39. An isolated S. pyogenes origin of replication, wherein the origin of replication is selected from the group consisting of: a) a nucleic acid molecule represented by SEQ ID NO:22; and b) a nucleic acid molecule having at least 95% sequence identity to a nucleic acid molecule represented by SEQ ID NO:22.

40. An isolated nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ID NO:22 and a nucleic acid molecule having at least 85% homology to a nucleic acid molecule represented by SEQ ID NO:22.

41. A method of screening for a compound that modulates the activity of a DNA polymerase III replicase, said method comprising: a) contacting an isolated replicase with at least one test compound under conditions permissive for replicase activity; b) assessing the activity of the replicase in the presence of the test compound; and c) comparing the activity of the replicase in the presence of the test compound with the activity of the replicase in the absence of the test compound, wherein a change in the activity of the replicase in the presence of the test compound is indicative of a compound that modulates the activity of the replicase, wherein said replicase comprises an isolated S. pyogenes DNA polymerase III subunit protein.

42. The method of Claim 41 , wherein said isolated S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO:16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

43. A compound that modulates the activity of a DNA polymerase III replicase identified by the method of Claim 41 or 42.

44. A method of identifying compounds which modulate the activity of a DNA polymerase III replicase comprising a) forming a reaction mixture that includes a primed DNA molecule, a DNA polymerase α subunit, a candidate compound, a dNTP, and optionally, a member of the group consisting of a β subunit, a τ complex, and both the β subunit and the τ complex to form a replicase; b) subjecting the reaction mixture to conditions effective to achieve nucleic acid polymerization in the absence of the candidate compound: and c) comparing the activity of the replicase in the presence of the test compound with the activity of the replicase in the absence of the test compound, wherein a change in the activity of the replicase in the presence of the test compound is indicative of a compound that modulates the activity of the replicase, wherein said replicase comprises an S. pyogenes DNA polymerase III subunit protein.

45. The method of Claim 44, wherein said isolated S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13,

SEQ ID NO: 16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

46. A compound that modulates the activity of a DNA polymerase III replicase identified by the method of Claim 44 or 45.

47. A method of identifying compounds that modulate the activity of a DnaX complex and a β subunit in stimulating a DNA polymerase replicase comprising a) contacting a primed DNA (which may be coated with SSB) with a DNA poly- merase replicase, a β subunit, and a τ complex (or subunit or subassembly of the DnaX complex) in the presence of the candidate pharmaceutical, and dNTPs (or modified dNTPs) to form a reaction mixture b) subjecting the reaction mixture to conditions effective to achieve nucleic acid polymerization in the absence of the candidate compound; and c) comparing the nucleic acid polymerization in the presence of the test compound with the nucleic acid polymerization in the absence of the test compound, wherein a change in the nucleic acid polymerization in the presence of the test compound is indicative of a compound that modulates the activity of a DnaX complex and a β subunit, wherein said τ complex (or subunit or subassembly of the τ complex) comprises an S. pyogenes DNA polymerase III subunit protein.

48. The method of Claim 47, wherein said S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13,

SEQ ID NO:16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

49. A compound that modulates the activity of a DNA polymerase III replicase identified by the method of Claim 47 or 48.

50. A method to identify compounds that modulate the ability of a β subunit and a DnaX complex (or a subunit or subassembly of the DnaX complex) to interact comprising a) contacting the β subunit with the DnaX complex (or subunit or subassembly of the DnaX complex) in the presence of the compounds to form a reaction mixture; b) subjecting the reaction mixture to conditions under which the DnaX complex (or the subunit or subassembly of the DnaX complex) and the β subunit would interact in the absence of the compound; and c) comparing the extent of interaction in the presence of the test compound with the extent of interaction in the absence of the test compound, wherein a change in the interaction between the β subunit and the DnaX complex (or the subunit or subassembly of the DnaX complex) is indicative of a compound that modulates the interaction, wherein said DnaX complex (or subunit or subassembly of the DnaX complex) com- prises an S. pyogenes DNA polymerase III subunit protein.

51. The method of Claim 50, wherein said S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO: 10, SEQ ID NO: 13,

SEQ ID NO: 16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

52. A compound that modulates the ability of a β subunit and a DnaX complex to interact identified by the method of Claim 50 or 51.

53. A method to identify compounds that modulate the ability of a DnaX complex (or a subassembly of the DnaX complex) to assemble a β subunit onto a DNA molecule com- prising a) contacting a circular primed DNA molecule (which may be coated with SSB) with the DnaX complex (or the subassembly thereof) and the β subunit in the presence of the compound, and ATP or dATP to form a reaction mixture b) subjecting the reaction mixture to conditions under which the DnaX complex (or subassembly) assembles the β subunit on the DNA molecule absent the compound; and c) comparing extent of assembly in the presence of the test with the extent of assembly in the absence of the test compound, wherein a change in the amount of β subunit on the DNA molecule is indicative of a compound that modulates the ability of a DnaX complex (or a subassembly of the DnaX complex) to assemble a β subunit onto a DNA molecule, wherein the DnaX complex (or a subassembly of the DnaX complex) comprises an S. pyogenes DNA polymerase III subunit protein.

54. The method of Claim 53, wherein said S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO: 10, SEQ ID NO: 13,

^• SEQ ID NO: 16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a nattxral subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

55. A compound that modulates the the ability of a DnaX complex to assemble a β subunit identified by the method of Claim 53 or 54.

56. A method to identify compounds that modulate the ability of a DnaX complex (or a subunit (s) of the DnaX complex) to disassemble a β subunit from a DNA molecule com- prising a) contacting a DNA molecule onto which the β subunit has been assembled in the presence of the compound, to form a reaction mixture; b) subjecting the reaction mixture to conditions under which the DnaX complex (or a subunit (s) or subassembly of the DnaX complex) disassembles the β subunit from the DNA molecule absent the compound; and c) comparing the extent of assembly in the presence of the test compound with the extent of assembly in the absence of the test compound, wherein a change in the amount of β subunit on the DNA molecule is indicative of a compound that modulates the ability of a DnaX complex (or a subassembly of the DnaX complex) to disassemble a β subunit onto a DNA molecule, wherein the DnaX complex (or a subassembly of the DnaX complex) comprises an S. pyogenes DNA polymerase III subunit protein.

57. The method of Claim 58, wherein said DNA polymerase III δ subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein perfonns the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

58. A compound that modulates the ability of a DnaX complex to disassemble a β subunit identified by the method of Claim 56 or 57.

59. A method to identify compounds that modulate the dATP/ATP binding activity of a DnaX complex or a DnaX complex subunit (e.g. , τ subunit) comprising a) contacting the DnaX complex (or the DnaX complex subunit) with dATP/ATP either in the presence or absence of a DNA molecule and/or the β subunit in the presence of the compound to form a reaction mixture; b) subjecting the reaction mixture to conditions in which the DnaX complex (or the subunit of DnaX complex) interacts with dATP/ATP in the absence of the compound; and c) comparing the extent of binding in the presence of the test compound with the extent of binding in the absence of the test compound, wherein a change in the dATP/ATP binding is indicative of a compound that modulates the dATP/ATP binding activity of a DnaX complex or a DnaX complex subunit (e.g., τ subunit), wherein the DnaX complex (or the subunit of DnaX complex) comprises an S. pyogenes DNA polymerase III subunit protein.

60. The method of Claim 59, wherein said S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein perfonns the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

61. A compound that modulates the the dATP/ATP binding activity of a DnaX complex or a DnaX complex subunit identified by the method of Claim 59 or 60.

62. A method to identify compound that modulate the dATP/ ATPase activity of a DnaX complex or a DnaX complex subunit (e.g., the τ subunit) comprising a) contacting the DnaX complex (or the DnaX complex subunit) with dATP/ATP either in the presence or absence of a DNA molecule and/or a β subunit in the presence of the compound to form a reaction mixture; b) subjecting the reaction mixture to conditions in which the DnaX subunit (or complex) hydrolyzes dATP/ATP in the absence of the compound; and c) comparing the extent of hydrolysis in the presence of the test compound with the extent of hydrolysis in the absence of the test compound, wherein a change in the amount of dATP/ATP hydro lyzed is indicative of a compound that modulates the dATP/ ATPase activity of a DnaX complex or a DnaX complex subunit (e.g., the τ subunit) wherein the DnaX complex (or subunit) comprises an S. pyogenes DNA polymerase III subunit protein.

63. The method of Claim 62, wherein said S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO: l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

64. A compound that modulates the activity of a DNA polymerase III replicase identified by the method of Claim 62 or 63.

65. A method for identifying compound that modulate the activity of a DNA polymerase replicase comprising a) contacting a circular primed DNA molecule, optionally coated with SSB, with a DnaX complex, a β subunit and an α subunit in the presence of the compound, and dNTPs (or modified dNTPs) to fonn a reaction mixture; b) subjecting the reaction mixture to conditions, which in the absence of the compound, affect nucleic acid polymerization; and c) comparing the nucleic acid polymerization in the presence of the test compound with the nucleic acid polymerization in the absence of the test compound, wherein a change in the activity of the replicase in the presence of the test compound is indicative of a compound that modulates the activity of the replicase, wherein the DnaX complex comprises an S. pyogenes DNA polymerase III subunit protein.

66. The method of Claim 65, wherein said S. pyogenes DNA polymerase III subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural subunit protein in a bacterial replication assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

67. A compound that modulates the activity of a DNA polymerase III replicase identified by the method of Claim 65 or 66.

68. A method to identify compound that modulate the ability of a δ subunit and the δ' and/or DnaX subunit to interact comprising a) contacting the δ subunit with the δ' and/or δ' plus DnaX subunit in the presence of the compound to form a reaction mixture b) subjecting the reaction mixture to conditions under which the δ subunit and the δ' and/or δ' plus DnaX subunit would interact in the absence of the compound c) comparing the extent of interaction in the presence of the test compound with the extent of interaction in the absence of the test compound, wherein a change in the interaction between the δ subunit and the δ' and/or DnaX subunit is indicative of a compound that modulates the interaction, wherein the DnaX complex comprises an S. pyogenes DNA polymerase III subunit protein.

69. The method of Claim 68, wherein said DNA polymerase III δ subunit protein is encoded by a nucleic acid molecule selected from the group consisting of a) SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13,

SEQ ID NO: 16, and SEQ ID NO:22; and b) a protein comprising a homologue of a protein of a), wherein said homologue encodes a protein containing one or more amino acid deletions, substitutions, or insertions, and wherein said protein performs the function of a natural δ subunit protein in a bacterial replica- tion assay; and c) an isolated bacterial nucleic acid molecule which is fully complementary to any said nucleic acid molecule recited in a).

70. A compound that modulates the ability of a δ subunit and the δ' and/or DnaX subunit to interact identified by the method of Claim 68 or 69.

71. A method of synthesizing a DNA molecule comprising a) hybridizing a primer to a first DNA molecule; and b) incubating said DNA molecule in the presence of a DNA polymerase replicase and one or more dNTPs under conditions sufficient to synthesize a second DNA molecule complementary to all or a portion of said first DNA molecule; wherein said DNA polymerase replicase comprises an S. pyogenes DNA polymerase III subunit protein.

72. The method of claim 71 , wherein the DNA polymerase replicase comprises an S. pyogenes clamp-loader complex, S. pyogenes β subunit, and an S. pyogenes PolC subunit.