WO2002032375A2 - Utilisations d'anticorps monoclonal 8h9 - Google Patents

Utilisations d'anticorps monoclonal 8h9 Download PDF

Info

Publication number
WO2002032375A2
WO2002032375A2 PCT/US2001/032565 US0132565W WO0232375A2 WO 2002032375 A2 WO2002032375 A2 WO 2002032375A2 US 0132565 W US0132565 W US 0132565W WO 0232375 A2 WO0232375 A2 WO 0232375A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
tumor
cells
antigen
cell
Prior art date
Application number
PCT/US2001/032565
Other languages
English (en)
Other versions
WO2002032375A9 (fr
WO2002032375A3 (fr
WO2002032375A8 (fr
Inventor
Nai-Kong V. Cheung
Original Assignee
Sloan-Kettering Institute For Cancer Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sloan-Kettering Institute For Cancer Research filed Critical Sloan-Kettering Institute For Cancer Research
Priority to CA002423843A priority Critical patent/CA2423843A1/fr
Priority to AU2002215383A priority patent/AU2002215383A1/en
Priority to EP01983999A priority patent/EP1399187A4/fr
Priority to US10/097,558 priority patent/US7737258B2/en
Publication of WO2002032375A2 publication Critical patent/WO2002032375A2/fr
Publication of WO2002032375A3 publication Critical patent/WO2002032375A3/fr
Publication of WO2002032375A8 publication Critical patent/WO2002032375A8/fr
Priority to CA2463017A priority patent/CA2463017C/fr
Priority to US10/273,762 priority patent/US7666424B2/en
Priority to AU2002362846A priority patent/AU2002362846A1/en
Priority to PCT/US2002/033331 priority patent/WO2003033670A2/fr
Priority to EP02801782A priority patent/EP1441765A4/fr
Publication of WO2002032375A9 publication Critical patent/WO2002032375A9/fr
Priority to US10/505,658 priority patent/US7740845B2/en
Priority to US12/709,848 priority patent/US8148154B2/en
Priority to US12/721,798 priority patent/US8414892B2/en
Priority to US12/797,081 priority patent/US8501471B2/en
Priority to US13/858,234 priority patent/US9062110B2/en
Priority to US13/958,902 priority patent/US20140161814A1/en
Priority to US15/365,803 priority patent/US9938351B2/en
Priority to US15/899,801 priority patent/US20180208673A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/42—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins
    • C07K16/4208—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A61K47/6865—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell the tumour determinant being from skin, nerves or brain cancer cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6873—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting an immunoglobulin; the antibody being an anti-idiotypic antibody
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0006—Skin tests, e.g. intradermal testing, test strips, delayed hypersensitivity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3053—Skin, nerves, brain
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/42—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins
    • C07K16/4208—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig
    • C07K16/4241—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig against anti-human or anti-animal Ig
    • C07K16/4258—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig against anti-human or anti-animal Ig against anti-receptor Ig
    • C07K16/4266—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig against anti-human or anti-animal Ig against anti-receptor Ig against anti-tumor receptor Ig
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/734—Complement-dependent cytotoxicity [CDC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • Monoclonal antibody 8H9 is a murine IgGl hybridoma derived from the fusion of mouse myeloma SP2/0 cells and splenic lymphocytes from BALB/c mice immunized with human neuroblastoma.
  • 8H9 was highly reactive with human brain tumors, childhood sarcomas, neuroblastomas and less so with adenocarcinomas.
  • primary brain tumors 15/17 glioblastomas, 3/4 mixed gliomas, 4/1 1 oligodendrogliomas, 6/8 astrocytomas, 2/2 meningiomas, 3/3 schwannomas,
  • 2/2 medulloblastomas 1/1 neuro fibroma, 1/2 neuronoglial tumors, 2/3 ependymomas and 1/1 pineoblastoma were tested positive.
  • 21/21 Ewing's/PNET 28/29 rhabdomyosarcoma
  • 28/29 osteosarcomas 35/37 desmoplastiG small round cell tumors
  • 2/3 synovial sarcomas 4/4 leiomyosarcomas
  • 8H9 was nonreactive with normal human tissues including bone marrow, colon, stomach, heart, lung, muscle, thyroid, testes, pancreas, and human brain (frontal lobe, cerebellum, pons and spinal cord). Reactivity with normal cynomolgus monkey tissue was similarly restricted. Indirect immunofluorescence localized the antigen recognized by 8H9 to the cell membrane. The antigen is proteinase-sensitivc and is not easily modulated off cell surface. 8H9 immuno-precipitated a 58kD band following N-glycanase treatment, most likely a protein with heterogeneous degree of glycosylation. This novel antibody-antigen system may have potential for tumor targeting.
  • Monoclonal antibodies such as 3F8 (1) and 14.18 (2) against GQ 2 in neuroblastoma, Ml 95 against CD33 in acute leukemia (3), anti-HER2 antibodies in breast cancer (4) and anti-CD20 antibodies in lymphoma (5) have shown efficacy in recent clinical trials.
  • the prognosis in glial brain tumors and metastatic mesenchymal and neuroectodermal tumors remains dismal despite innovations in chemotherapy and radiation therapy.
  • Immunotherapy may offer new possibilities for improving the outcome in these patients.
  • Tumor antigens expressed on cell membrane are potential targets in immunotherapy.
  • Examples of tumor antigens expressed on glial tumors include neural cell adhesion molecules (6), gangliosides such as GD2 and GM 2
  • MAb UJ13A was shown to accumulate in gliomas by virtue of disruption of blood brain barrier locally (10) and another antibody, ERIC- 1 was used in a therapeutic setting in resected glioma cavities with some clinical benefit (1 1 )
  • Membrane antigens that have been targeted on osteosarcoma include GD 2 0 5), CD55 (16) and an as yet undefined osteosarcoma-associated antigen recognized by the MoAbs TP-1 and TP-3 (17).
  • these antigens are present to varying degrees on normal tissues.
  • the glycoprotein p30/32 coded by the MIC2 oncogene and recognized by the monoclonal antibody 013 in the Ewing's family of tumors is expressed on normal tissues (18).
  • the MyoD family of oncofetal proteins is nuclear in localization (19) and therefore inaccessible to antibody-targeted immunotherapy.
  • tumor antigen for targeted immunotherapy should be absent on normal tissues and abundantly expressed on tumor cell surface.
  • Such tumor-specific antigens e.g. idiotypes in B cell lymphoma are rare (20).
  • a "generic" tumor-specific antigen expressed on tumor cells of varying lineage recognized by monoclonal antibodies may have broader utility in antibody- based strategies.
  • a novel tumor-associated antigen, recognized by a murine monoclonal antibody 8H9 expressed on cell membranes of a broad spectrum of tumors of neuroectodermal, mesenchymal and epithelial origin, with restricted distribution on normal tissues.
  • This invention provides a composition comprising an effective amount of monoclonal antibody 8H9 or a derivative thereof and a suitable carriei.
  • This invention provides a pharmaceutical composition comprising an effective amount of monoclonal antibody 8H9 or a derivative thereof and a pharmaceutically acceptable carrier.
  • This invention also provides an antibody other than the monoclonal antibody 8H9 comprising the complementary determining regions of monoclonal antibody 8H9 or a derivative thereof, capable of binding to the same antigen as the monoclonal antibody 8H9.
  • This invention provides a substance capable of competitively inhibiting the binding of monoclonal antibody 8H9.
  • the substance is an antibody.
  • This invention provides an isolated scFv of monoclonal antibody 8H9 or a derivative thereof.
  • the scFv is directly or indirectly coupled to a cytotoxic agent.
  • This invention provides a cell comprising 8H9-scFv. In an embodiment, it is a red cell. This invention also provides a 8H9-scFv-gene modified cell. This invention provides a liposome modified by 8H9-scFv. This invention provides a method for directly kill, or deliver drug, DNA, RNA or derivatives thereof to cell bearing the antigen recognized by the monoclonal antibody 8H9 or to image cells or tumors bearing said antigen using the isolated 8H9-scFv or cell or liposome comprising the 8H9-scFv. This invention provides a protein with about 58 kilodaltons in molecular weight, reacting specifically with the monoclonal antibody 8H9. When this 58 kd protein is glycosylated, the apparent molecular weight is about 90 kilodaltons. This invention also provides an antibody produced by immunizing the 8H9 antigen or specific portion thereof, which is immunogenic.
  • This invention also provides a nucleic acid molecule encoding the 8H9 antigen.
  • this invention provides a nucleic acid molecule capable of specifically hybridizing the molecule encoding the 8H9 antigen.
  • the nucleic acid molecule includes but is not limited to synthetic DNA, genomic DNA, cDNA or RNA.
  • This invention provides a vector comprising the nucleic acid molecule encoding 8H9 antigen or a portion thereof.
  • This invention provides a cell comprising the nucleic acid molecule encoding 8H9 antigen.
  • This invention provides a method for producing the protein which binds to the monoclonal antibody 8H9 comprising cloning the nucleic acid molecule encoding the 8H9 antigen in an appropriate vector, expressing said protein in appropriate cells and recovery of said expressed protein.
  • This invention also provides a method for production of antibody using the protein produced by the above method.
  • This invention also provides antibodies produced by the above method.
  • the antibody is a polyclonal antibody.
  • the antibody is a monoclonal.
  • This invention provide a method of inhibiting the growth of tumor cells comprising contacting said tumor cells with an appropriate amount of monoclonal antibody 8H9 or a derivative thereof, or the antibody of claim produced by the expressed 8H9 antigen or a derivative of the produced antibody thereof.
  • This invention provides a method of inhibiting the growth of tumor cells in a subject comprising administering to the subject an appropriate amount of monoclonal antibody 8H9 or a derivative thereof, or the antibody produced by the expressed 8H9 antigen or a derivative thereof.
  • This invention provides a method for imaging a tumor in a subject comprising administering to the subject a labeled monoclonal antibody 8H9 or labeled derivatives, or a labeled antibody produced by the expressed 8H9 antigen or a labeled derivative.
  • the antibodies or derivatives are labeled by a radioisotope.
  • This invention provides a method of reducing tumor cells in a subject comprising administering to the subject monoclonal antibody 8H9 or a derivative thereof, or a monoclonal antibody produced by the expressed 8H9 antigen or a derivative thereof wherem the antibody or derivative is coupled to a cytotoxic agent to the subject.
  • This invention provides a method to evaluate the tumor bearing potential of a subject comprising measuring the expression the 8H9 antigen in the subject, wherein the increased expression of said antigen indicates higher tumor bearing potential of the subject.
  • This invention provides a transgenic animal comprising an exogenous gene encoding the 8H9 antigen.
  • This invention also provides a knock out animal wherein the gene encoding the 8H9 mouse analogous antigen has been knocked out.
  • this invention provides a method to screening new anti-tumor compound comprising contacting the above transgenic animal with the tested compound and measuring the level of expression of the 8H9 antigen in said transgenic animal, a decrease in the level of expression indicating that the compound can inhibit the expression of the 8H9 antigen and is a anti-tumor candidate.
  • FIGURE 1 Desmoplastic small round cell tumor ( 10X) immunostained with 8H9 showing strong membrane positivity and typical histology (B)
  • C Glioblastoma mulfiforme stained with 8H9 showing binding to cell membranes and fibrillary stroma
  • D Embryonal rhabdomyosarcoma stained with 8H9 showing cell membrane reactivity
  • D Negative staining of embryonal rhabdomyosarcoma with MOPC21 , an irrelevant IgGl control antibody
  • FIGURE 2 Persistence of 8H9 binding to U20S cells (A) and NMB7 cells (B) as studied by indirect immunofluorescence.
  • X-axis relative immunofluorescence
  • y-axis hours of incubation.
  • U20S cells were reacted with 8H9 and HB95, and NMB7 cells with 8H9 and 3F8. After washing, cells were recultured and persistence of immunoreactivity of the primary antibodies evaluated by indirect immunofluorescence using FITC-conjugated secondary antibody.
  • Relative immunofluorescence of 8H9 on U20S cells dropped to 80% after 48hrs (HB95 to 1 1 %), while that on NMB7 cells showed no significant drop off at 36 hrs (3F8 dropped to 39%)
  • FIGURE 3 Effect of Pronase E on 8H9 immunoreactivity with HTB82,
  • FIGURE 1 4 cycles of 3F8 and low level HAMA response are associated with prolonged survival.
  • FIGURE 2 Improved long-term survival after MoAb 3F8 in patients with stage 4 NB newly diagnosed > 1 year of age at Memorial SIoan-Kettering Cancer Center.
  • N4 to N7 are sequential protocols over 15 years.
  • N4 and N5 are chemotherapy + ABMT
  • N6 is chemotherapy + 3F8
  • N7 is N6 + 131 I-
  • FIGURE 3 Antigen modulation following binding to 8H9.
  • FIGURE 1 Reactivity of 8H9 with Ewing's sarcoma cell lines.
  • FIGURE 2 Lack of Reactivity of 8H9 with T cells or bone marrow progenitor cells.
  • Electronically gated Cd3+ cells from peripheral blood of a normal donor (top panel) are analyzed for isotype (dashed line), CD99 (thin black line) and 8H9 (thick black line).
  • Electronically gated CD34+ cells from fresh human bone marrow from a normal donor (bottom panel) are analyzed for isotype (dashed line) and 8H9 (thick black line) staining.
  • FIGURE 3 Real-time PCR analysis of t(l 1.22) in artificially contaminated PBMCs accurately quantifies EWS/F1I 1 transcript over up to five log dilutions of tumor. Crossing time (x axis) is plotted vs. fluorescence (y axis)
  • 3a Non-nested PCR of 10 XI 0 6 PBMCs contaminated from 1 : 10 to l : 10 ⁇ .
  • 3b Nested PCR of 10 X 10 6 PBMCs contaminated from 1 : 10 to 1 : 10 7 .
  • a linear relationship is observed over 5 log dilutions of tumor from 1 : 100 to 1 : 10 6 .
  • FIGURE 4 Quantitative PCR analyis of purging demonstrates 2-3 log reduction in peripheral blood and progenitor cells spikes with Ewing's Sarcoma cells. Cycle number (x axis) is plotted vs. fluorescence (y axis). Experimental samples were run with standard contaminated dilutions shown in the inset. 4a: Non-nested PCR analysis of 1X10 6 pre-purged and post-purged non-CD34 selected bone marrow from a normal healthy donor contaminated at a level of 1 : 100. A two-log reduction in tumor burden is demonstrated in the post-purged sample which shows a level of contamination at 1 : 10 4 .
  • 4b Nested PCR analysis of pre-purged and post-purged CD34 selected cells harvested following G-CSF mobilization from a patient with Ewing's sarcoma. Since this patient was negative for EWS/FLI, CD34 cells were spike with Ewing's sarcoma at a level of 1 : 10" . A three-log reduction in tumor burden is demonstrated in the post-purged sample which shows a level of contamination at 1 : 10 '.
  • 4c Nested PCR analysis of pre-purged and post- purged PBMCc from a normal healthy donor buffy coat contaminated at a level of 1 : 100.
  • a greater than 3-log reduction in tumor burden is demonstrated in the post-purged sample which shows a level of contamination of less than 1 :10 6 .
  • 4d Nested PCR analysis of pre-purged and post-purged non PBMCs from a normal healthy donor buffy coat contaminated at a level of 1 : 10 3 .
  • a 3 log reduction in tumor burden is demonstrated in the post-purged sample which shows a level of contamination at 1 :10 .
  • FIGURE 5 Contamination of patient elutriated apheresis fractions is demonstrated at at level of 1 : 10 5 -1 : 10 6 .
  • Cycle number (x axis) is plotted vs. fluorescence (y axis)
  • Patient samples are compared to standard contaminated dilutions.
  • Patient a shows contamination of all fractions at a level of 1 :10 5 - 1 : 10°.
  • Patient B shows contamination in the leukocyte fraction only at a level of approximately 1 :10 6 ,
  • Patient C shows contamination in several fractions at a similar level.
  • FIGURE 6 Progenitor CFU capability is not affected by 8H9 based purging. Colony formy units from CD34 selected cells from bone arow from a normal healthy donor (x axis) are plotted for pre- and post purged samples.
  • FIGURE 7 OKT3 mediated T cell proliferation is unchanged after purging when compared to pre-purged proliferation.
  • T cells from nomial healthy donor buffy coat were evalauted for [ H] Thymidine uptake as a measure of T cell proliferation with a decreasing concentration of O T3. Uptake is measured as counts per million (y axis) and is plotted vs. OK.T3 concentration for pre- purged (solid square), and post purged (solid circle).
  • FIGURE 1 DSRCT (40X) demonstrating cell membrane and stromal reactivity with 3F8
  • FIGURE 2 DSRCT (40X) showing strong, homogeneous, cell membrane and stromal reactivity with 8H9
  • FIGURE 1 Inhibition of 8H9 by anti-idiotype 2E9 by FACS analysis.
  • 1A Staining of LAN-1 neuroblastoma cells with 5 ug/ml of 8H9 (shaded peak) was not inhibited at low concentration of 2E9 (2 ug/ml, solid line), but almost completely at concentration of 10 ug/ml (dotted line) superimposable with the negative antibody control (solid line).
  • I B Staining of LAN-1 neuroblastoma cells with 5 ug/ml of 3F8 (anti-GD2, shaded peak) was not inhibited by any concentrations (2 ug/ml, solid line, or 200 ug/ml, dotted line) of 2E9.
  • IC Staining of HTB-82 rhabdomyosarcoma cells with 5 ug/ml of
  • FIGURE 2 SDS-PAGE (lanes a and b) and Western blot (c and d) of 8H9 scFv-Fc.
  • H heavy chain of 8H9
  • L light chain of 8H9
  • scFv-Fc chimeric fusion protein between 8H9 scFv and the human , 1 -CH2-CH3 domain.
  • 2-mercaptothanol lanes a, b and c.
  • Native gel lane d.
  • FIGURE 3 FACS analysis of 8h9-scFv-Fc staining of HTB82 rhabdomyosarcoma cells.
  • 3A Immunofluorescence increased with concentrations of 8H9-scFv-Fc (1 , 5, 25, 125 ug/ml), shaded peak is no antibody control.
  • 3B Cell staining (5 ug/ml of 8H9-scFv-Fc, thin solid line) was completely inhibited (thick solid line) at 1 ug/ml of anti-idiotypic antibody 2E9, shaded peak is no antibody control.
  • FIGURE 4 Immunoscintigraphy of human tumors using I-labeled 8H9 scFv-Fc. Mice xenografted with human LAN-1 neuroblastoma received retroorbital injections of 25 uCi of 125 I-labeled antibody. 24h, 48h and 7 days after injection, the animals were anesthesized and imaged with a gamma camera.
  • FIGURE 5 Blood clearance of 125 I-labeled chimeric 8H9 and l25 I-native 8H9. Mice xenografted with human LAN-1 neuroblastoma received retroorbital injections of " I-labeled antibody. Percent injected dose/gm of serial blood samples were plotted over time.
  • FIGURE 1 Anti-idiotype affinity enrichment of producer lines. Producer lines were stained with anti-idiotypic MoAb 2E9 before (shaded peak, A and B), and after first (dotted line peak, A) and second (thick solid line, A) affinity purification, and after first (dotted line, B) and second (solid line B) subcloning, showing improved scFv expression.
  • the indicator line K562 showed improved scFv expression after first (dotted line, C) and second (thick solid line, C) affinity purification of the producer line, and subsequent first (dotted line, C) and second (thick solid line, D) subcloning of the producer line, when compared to unpurified producer lines (shaded peaks, C and D), consistent with improvement in gene transduction efficiency.
  • the thin solid line curves in each figure represents nonproducer line (A and B) or uninfected K562 (C and D).
  • FIGURE 2 Flow cytometry analysis of scFv expression.
  • Cultured 8H9- scFv-CD28- ⁇ gene-modified lymphocytes were assayed for their scFv expression using anti-idiotypic MoAb 2E9 (solid curves) and control rat IgG 1 MoAb as control (shaded histograms) from day 13 through day 62.
  • anti-idiotypic MoAb 2E9 solid curves
  • control rat IgG 1 MoAb as control (shaded histograms) from day 13 through day 62.
  • FIGURE 3 In vitro expansion of 8H9-scFv-CD28 ⁇ - gene-modified primary human lymphocytes. Clonal expansion was expressed as a fraction of the initial viable cell number. IL-2 (100 U/ml) was added after retroviral infection and was present throughout the entire in vitro culture period. Short bars depict the days when soluble anti-idiotypic antibody 2E9 (3-10 ug/ml) was present in the culture.
  • FIGURE 4 In vitro expansion of 8H9-scFv-CD28 ⁇ - gene-modified primary human lymphocytes. Clonal expansion was expressed as a fraction of the initial viable cell number. IL-2 (100 U/ml) was added after retroviral infection and was present throughout the entire in vitro culture period. Short bars depict the days when soluble anti-idiotypic antibody 2E9 (3-10 ug/ml) was present in the culture.
  • Cytotoxicity against tumor cell lines 8H9-scFv-CD28 ⁇ - gene- modified lymphocytes from day 56 of culture (scFv-T) were assayed by 5 l Cr release assay in the presence or absence of 8H9 (50 ug/ml final concentration) as an antigen blocking agent.
  • 4A NMB-7 neuroblastoma.
  • 4B LAN-1 neuroblastoma.
  • 4C HTB-82 rhabdomyosarcoma.
  • 4D Daudi lymphoma.
  • FIGURE 5 Suppression of rhabdomyosarcoma tumor growth in SCID mice.
  • FIGURE 1 Sequential imaging of nude mouse bearing RMS xenograft 24,
  • FIGURE 4 Comparison of biodistribution of l25 I-8H9 with that of the nonspecific anticytokeratin MoAb I-2C9 (solid bars) in xenografts and normal tissues.
  • FIGURE 5 Anti tumor effect on RMS xenografts: 13 I I-8H9 versus negative control MoAb 131 I-3F8. Each mouse received 18.5MBq radiolabeled MoAb (5 mice per group). DETAILED DESCRIPTION OF THE INVENTION
  • This invention provides a composition comprising an effective amount of monoclonal antibody 8H9 or a derivative thereof and a suitable carrier.
  • This invention provides a pharmaceutical composition comprising an effective amount of monoclonal antibody 8H9 or a derivative thereof and a pharmaceutically acceptable carrier.
  • the derivative is a scFv.
  • the antibody is an antibody-fusion construct.
  • the antibody is an scFvFc.
  • This invention provides an antibody other than the monoclonal antibody 8H9 comprising the complementary determining regions of monoclonal antibody 8H9 or a derivative thereof, capable of binding to the same antigen as the monoclonal antibody 8H9.
  • This invention also provides a substance capable of competitively inhibiting the binding of monoclonal antibody 8H9.
  • the substance is an antibody.
  • This invention provides an isolated scFv of monoclonal antibody 8H9 or a derivative thereof.
  • the scFv is directly or indirectly coupled to a cytotoxic agent.
  • the scFv is linked to a first protein capable of binding to a second protein which is coupled to a cytotoxic agent.
  • Same rationale applies to the imaging uses of the 8H9 monoclonal antibody or its derivative.
  • the antibody or its derivative will be coupled to an imaging agent. Both cytotoxic or imaging agents are known in the art.
  • This invention provides a cell comprising 8H9-scFv.
  • the cell is a red cell.
  • This invention also provides a 8H9-scFv-gene modified cell.
  • This invention also provides a liposome modified by 8H9-scFv.
  • This invention provides a method for directly kill, or deliver drug, DNA, RNA or derivatives thereof to cell bearing the antigen recognized by the monoclonal antibody 8H9 or to image cells or tumors bearing said antigen using the isolated 8H9-scFv or 8FI9-scFv modified cell or liposome.
  • This invention provides a protein with about 58 kilodaltons in molecular weight, reacting specifically with the monoclonal antibody 8H9.
  • this protein is glycosylated, the apparent molecular weight is about 90 kilodaltons.
  • This invention provides an antibody produced by immunizing the expressed 8H9 antigen or specific portion thereof.
  • This invention provides a nucleic acid molecule encoding 8H9 antigen.
  • This invention provides a nucleic acid molecule capable of specifically hybridizing the nucleic acid molecule which encodes the 8H9 antigen.
  • the nucleic acid molecule includes but is not limited to synthetic DNA, genomic DNA, cDNA or RNA.
  • This invention also provides a vector comprising the nucleic acid molecule encoding the 8H9 antigen or a portion thereof. The portion could be a functional domain of said antigen.
  • This invention provides a cell comprising the nucleic acid molecule encoding the 8H9 antigen.
  • This invention provides a method for producing the protein which binds to the monoclonal antibody 8H9 comprising cloning the nucleic acid molecule which encodes the 8H9 antigen in an appropriate vector, expressing said protein in appropriate cells and recovery of said expressed protein.
  • This invention provides a method for production of antibody using the expressed 8H9 antigen or the portion which is immunogenic.
  • This invention also provides an antibody produced by the above described method.
  • the antibody is polyclonal.
  • the antibody is a monoclonal.
  • This invention provides a method of inhibiting the growth of tumor cells comprising contacting said tumor cells with an appropriate amount of monoclonal antibody 8H9 or a derivative thereof, or the antibody produced using the expressed 8H9 antigen or a derivative thereof.
  • This invention provides a method of inhibiting the growth of tumor cells in a subject comprising administering to the subject an appropriate amount of monoclonal antibody 8H9 or a derivative thereof, or the antibody produced using the expressed 8H9 antigen or a derivative thereof.
  • This invention provides a method for imaging a tumor in a subject comprising administering to the subject a labeled monoclonal antibody 8H9 or a labeled derivatives, or a labeled antibody produced using the expressed 8H9 antigen or a labeled derivative.
  • the antibody or the derivative is labeled with radioisotope.
  • This invention provides a method of reducing tumor cells in a subject comprising administering to the subject monoclonal antibody 8H9 or a derivative thereof, or a monoclonal antibody produced using the expressed 8H9 antigen or a derivative thereof wherein the antibody or derivative is coupled to a cytotoxic agent to the subject.
  • the coupling to a cytotoxic agent is indirect.
  • the coupling is first directly linking the antibody or derivative with a first protein which is capable of bind to a second protein and the second protein is covalently couple to a cytotoxic agent.
  • the cytotoxic agent is a radioisotope.
  • This invention also provides a method to evaluate the tumor bearing potential of a subject comprising measuring the expression the 8H9 antigen in the subject, wherein the increased expression of said antigen indicates higher tumor bearing potential of the subject.
  • This invention provides a transgenic animal comprising an exogenous gene encoding the 8H9 antigen.
  • the transgenic animal may also carried an knock out gene encoding the 8H9 mouse analogous antigen. In an embodiment, it is a transgenic mouse.
  • This invention provides a method to screening new anti-tumor compound comprising contacting the transgenic animal with the tested compound and measuring the level of expression of the 8H9 antigen in said transgenic animal, a decrease in the level of expression indicating that the compound can inhibit the expression of the 8H9 antigen and is a anti-tumor candidate.
  • Frozen tumors from 330 patients with neuroectodermal, mesenchymal and epithelial neoplasia were analyzed. All diagnoses of tumor samples were confirmed by hematoxylin and eosin assessment of paraffin-embedded specimens. 15 normal human tissue samples and 8 normal Gynomolgus monkey tissue samples obtained at autopsy were also analyzed.
  • Human neuroblastoma cell lines LA-N-1 was provided by Dr. Robert Seeger, Children's Hospital of Los Angeles, Los Angeles, CA. Human neuroblastoma cell lines LA-15-N, LA-66-N, LA-5S, LA-19-S and LA-19-N were provided by Dr. Robert Ross (Fordham University, NY) and IMR 32 and NMB7 by Dr. Shuen-Kuei Liao (McMaster University, Ontario, Canada).
  • Breast carcinoma cell lines SW480 and ZR75-1 were provided by Dr. S. Welt (Memorial Sloan- Kettering Cancer Center, NY) and the melanoma line SK.Mel28 by Dr. P. Chapman (Memorial Sloan-Kettering Cancer Center, NY).
  • Neuroblastoma cell lines SKNHM, SKNHB, SKNJD, SKNLP, SKNER, SKNMM, SI NCH and SK SH, rhabdomyosarcoma cell line SKRJC and Ewing's/PNET cell lines SKPPR, SKPRT and SKNMC were derived from patients with metastatic disease treated at MSKCC.
  • the following cell lines were purchased from American Type Culture Collection, Bethesda, MD: melanoma cell lines
  • HTB63 and HTB67 rhabdomyosarcoma cell line HTB82, small cell lung cancer cell line HTB 1 19, acute T-leukemia cell line Jurkat, glioblastoma multiforme cell line Glio72, breast cancer cell line HTB 22, colon carcinoma cells line SK Co-1, Hela, embryonal kidney 293, and osteosarcoma cell lines CRL1427, HTB86 and HTB 96. All cell lines were grown at 37 °C in a 6% C0 2 incubator using standard culture medium, which consisted of RPMI 1640 medium supplemented with 10% bovine calf serum, 2mM glutamine, penicillin (100 IU/ml) and streptomycin (100 ⁇ g/ml).
  • Normal human hepatocytes were purchased from Clonetics, San Diego, CA and processed immediately upon delivery. Normal human mononuclear cells were prepared from heparinized bone marrow samples by centrifugafion across a Ficoll- Hypaque density separation gradient. EBV lymphoblastoid cell lines were derived from human mononuclear cells.
  • mice Female BALB/c mice were hyperimmunized with human neuroblastoma according to previously outlined methods (21). Lymphocytes derived from these mice were fused with SP2/0 mouse myeloma cells line. Clones were selected for specific binding on ELISA. The 8H9 hybridoma secreting an IgGi monoclonal antibody was selected for further characterization after subcloning.
  • Sections were incubated with a secondary horse anti-mouse biotinylated antibody (Vector Laboratories, Burlingame, CA) followed by incubation with ABC complex ( Vector ) and developed with Vector VIP peroxidase substrate or DAB peroxidase substrate kit (Vector). A 10% hematoxylin counterstain for 4 minutes was used. Staining was graded as positive or negative and homogeneous or heterogeneous reactivity noted. Indirect immunofluorescence
  • NMB7 and U20S cell pellets were prepared as above and reacted with 100 ⁇ l each of 15 ⁇ g/ml of 8H9 or the anti-HLA A,B,C antibody, HB-95 (American Type Culture Collection, Bethesda, MD) at 4° C for 1 hour.
  • NMB7 cells were also similarly reacted with the anti-Go 2 monoclonal antibody 3F8. After washing with PBS, cells were cultured at 37 C in standard culture medium for 0, 1,2, 4, 8, 12, 24, 36 and 48h.
  • Antigen sensitivity to proteinase was tested by incubating 0.5 x 10° of HTB82, U20S and NMB7 cells at 37°C for 30 minutes in RPMI with increasing concentrations of neutral proteinase, Pronase E from streptomyces griseus (E.Merck, Darmstadt, Germany) After washing, cells were stained with 8H9 or 3F8 and studied by indirect immunofluorescence.
  • Immunoprecipitation was carried out using a modification of the standard technique. (23) 8H9-positive cell lines (NMB7, LAN- 1 , HTB82, U20S, HELA, 293) and 8H9-negative cell lines (Jurkat, I-ITB 1 19) were used. 2x 10 ,7 v iia ⁇ ble cells were washed in TBS (0.05 M Tris-HCl, pH 8, with 0.15 M NaCl) and incubated with 10 U lactoperoxidase (Sigma) 100 ul of 100 U/ml in TBS, 1 mCi l25 I (2.7 ul) and 1/6000 dilution of 30% hydrogen peroxide for 5 min at 20°C.
  • TBS 0.05 M Tris-HCl, pH 8, with 0.15 M NaCl
  • 10 U lactoperoxidase Sigma
  • the iodinated cells were washed three times in TBS, lysed on ice (30 min) in 500 ul of modified RIPA buffer (0.01 M Tris-HCl, pH 7.2, 0.15 M NaCl, 1% sodium deoxycholate, 1%> Nonidet P-40, 0.1% sodium dodecyl sulfate (SDS), 0.01 M EDTA) containing protease inhibitors (1 mM PMSF, 50 ug/ml Bestatin, 2 ug/ml Aprotinin, 0.5 ug/ml Leupeptin, 0.7 ug/ml Pepstatin, 10 ug/ml E-64).
  • modified RIPA buffer 0.01 M Tris-HCl, pH 7.2, 0.15 M NaCl, 1% sodium deoxycholate, 1%> Nonidet P-40, 0.1% sodium dodecyl sulfate (SDS), 0.01 M EDTA
  • protease inhibitors (1 mM PMSF, 50
  • the lysates were clarified by centrifugation at 15,000 ⁇ m for 5 min at 4°C, then incubated with 1 mg of 8H9 or IgGl control antibody for 16 hr at 4°C with mixing.
  • the antigen-antibody complex was collected by adso ⁇ tion onto 100 ul Protein G-sepharose beads (Sigma) for 6 hr at 4 C.
  • the immune complex immobilized on Protein G was washed three times with modified RIPA buffer, and then washed once with RIPA buffer containing 1 M NaCl, and then twice with modified TNN buffer (0.05 M Tris-HCl, pli 8, 0.15 M NaCl, 0.05% Nonidet P-40).
  • Bound proteins were removed by elution with SDS-sample buffer and analyzed by 7.5% SDS-PAGE, followed by autoradiography.
  • Deglycosylation of the radiolabeled antigen was carried out on the protein G sepharose using N-glycanase (Glyco, Novato, CA) and O-glycanase (Glyco) according to manufacturers' instructions.
  • Molecular weight was estimated using Quantity One software from BioRad Inc. (Hercules, CA).
  • 8H9 immunoreactivity in 35 neuroblastoma, melanoma, rhabdomyosarcoma, small cell lung cancer, osteosarcoma, glioblastoma, leukemia, breast cancer and colon cancer cell lines was tested using indirect immunofluorescence. Moderate to strong cell membrane reactivity with 8H9 was detected in 16/16 neuroblastoma cell lines, 3/3 melanoma cell lines, 2/2 rhabdomyosarcoma cell lines, 1/1 glioblastoma multiforme cell line, 3/3 breast cancer cell lines and 1/1 colon cancer cell lines studied. 2 of 3 Ewing's/PNET cell lines, and 2 of the 3 osteosarcoma cell lines were strongly positive while the others showed weak positivity. The small cell lung cancer cell line tested negative with 8H9 as did
  • This antigen is expressed on a broad spectrum of human neuroectodermal, mesenchymal and epithelial tumors and appears to be immunohistochemically tumor specific, namely, it is expressed on cell membranes of tumor cells with no/low membrane reactivity noted on nomial human tissues.
  • the antigen was present on 88% of neuroectodermal tumors, 96% of mesenchymal tumors and 44% of epithelial cancers tested. The specific tissue distribution suggests a unique tumor antigen not previously reported.
  • Neuroectodermal-oncofetal antigens e.g. neural cell adhesion molecules are present to varying degrees on nomial adult and fetal tissues (6).
  • Neurohematopoeitic antigens including Thy- 1 determinants (24) , CD-44 (8) and its splice variants (25) are present on normal and neoplastic brain tissue as well as hematopoeitic tissues, principally of the lymphoid lineage.
  • Gangliosides such as GD 2 and G M2 , although expressed on tumors of neuroectodermal origin, are also present on normal brain tissue (7).
  • the lactotetraose series ganglioside 3'-6"-iso LD I is widely expressed on brain tumors and on epithelial cancers and germ cell tumors as well as on normal brain tissue. (26). 25 -
  • Ependymoma-assoc ⁇ ated MabEp-C4 Not reacti ' ve with PBL, normal brain Glioma -associated GA-17, GB-4, GC-3 (32) Not reactive with normal adult or fetal brain Glioma-associated 6DS 1 (33) Not reactive with normal adult or fetal brain Intracellular IFAP-300 Anti-IFAP-300kDa (37) Not reacti ' ve with normal brain GFAP Multiple Normal neuronal cells Interstitial matrix Tenascin 81 C6 (13), Normal liver, ki ' dney; not reacti ' ve with adult brain BC-2 ( 14) Not reactive with normal brain
  • Another remarkable property of the 8H9 antigen is its expression on tumors of diverse lineage: neuroectodermal, mesenchymal and to a lesser degree epithelial tumors.
  • No monoclonal antibody to date has the binding spectrum described with 81-19.
  • This broad distribution provides MoAb 8H9 the potential of being a "generic" tumor antigen for targeted therapy.
  • Of particular interest is its expression on 28/29 rhabdomyosarcoma tumors and the rhabdomyosarcoma cell lines tested by indirect immunofluorescence. Disseminated and high risk rhabdomyosarcomas have a very poor prognosis with ⁇ 40% long term survival rate (27).
  • Ewing's family of tumors Two further groups of tumors studied were the Ewing's family of tumors and osteosarcoma.
  • the Ewing's family of tumors Gan be differentiated from other small blue round cell tumors of childhood by monoclonal antibodies recognizing glycoprotein p30/32 coded by MIC2 oncogene.
  • this protein is also expressed on nomial tissues and on other tumors, severely limiting its utility in radioimaging and therapy (18). 100% (21/21) of Ewing's family tumors tested showed immunoreactivity with MoAb
  • the 8H9 antigen appears to be a novel, previously undescribed antigen. Sensitivity to proteinase suggests that it has a protein component. Conversely, the lack of sensitivity to neuraminidase implies absence of sialic acid residues, and the lack of sensitivity to phosphatidyl-inositol specific phospholipase C implies that the 81-19 antigen is not GPI anchored. It is unlikely to be related to the neural cell adhesion molecule family due to its unique distribution and restriction of expression among nomial tissues (6). Of the currently described antibodies, which bind to glial tumors, four have been reported to be restricted to tumor tissues.
  • EGFRvlII The mutated EGFRvlII was found to be expressed on 52% of gliomas tested and crossreacts with breast and lung carcinomas (29). However, the broad distribution of the 8H9 antigen is different from EGFRvlII. Integrin 3, a 140kDa protein expressed on gliomas and medulloblastomas is targeted by the monoclonal antibody ONS-M21 which does not cross react with normal brain (30). However, negative immunoreactivity with neuroblastoma, melanoma and meningioma has been reported. (31). Similar data on glioma-specific antibodies with no cross reactivity with normal brain has been published.
  • the hydrazino-derivative of 8H9 therefore, retains the immunoreactive properties of the unmodified antibody, and may be useful for radioimaging of tumors.
  • the monoclonal antibody 8H9 recognizes a unique 58kD tumor-specific antigen with broad distribution across a spectrum of tumors of varying lineage: neuroectodemial, mesenchymal and epithelial, with restricted expression in normal tissues.
  • 8H9 may have clinical utility in the targeted therapy of these human solid tumors in vitro or in vivo. Further biochemical characterization of the 8H9 antigen is warranted and may be of interest in delineating a possible role in the oncogenic process.
  • Antibodies against EGFRvlII are Tumor Specific and React with Breast and Lung Carcinomas and Malignant Gliomas. Cancer Res., 55:3140-48, 1995.
  • MoAbs monoclonal antibodies
  • anti-CD20 lymphoma
  • anti-HER2 bieast cancer
  • anti-tenascin brain tumors
  • anti-CD33 leukemia
  • anti-TAG-72 colon cancer
  • I31 I or 99m Tc-labeled 8H9 can effectively image NB and
  • Specific aim #1 To measure the level of agreement between conventional imaging modality (CT, MRI, and nuclear scans) and antibody 8H9 imaging in known and occult sites of disease. Sensitivity analysis of 8H9 for each disease type will be conducted. 30 Specific ai #2: To calculate the absorbed dose delivered by l31 I-8H9 to tumor relative to normal organs.
  • MoAb selective for tumors have therapeutic potential 1,'2"
  • Optimal targeting of MoAb demands high tumor antigen density with homogeneous expression, lack of antigen modulation on tumor cell surface, adequate vascularity of tumor to allow deep penetration, minimal toxicity on normal tissues, low reticulo- endothelial system (RES) uptake, noninterference by circulating free antigens, and low imniunogenicity.
  • RES reticulo- endothelial system
  • Anti-CEA antibody in colorectal canGer , anti-CD20 antibodies in lymphoma, anti-HER2 antibodies in breast cancer, 6 anti-tenascin antibodies in glial brain tumors, MoAb Ml 95 against CD33 in acute leukemia and ant ⁇ -TAG-72 antibodies in colon cancer have demonstrated efficacy in clinical trials.
  • Our laboratory has developed the MoAb 3F8 which targets the ganglioside GD 2 overexpressed on NB.
  • 3F8 has been shown to have a high specificity and sensitivity in the radioimmunodetection of minimal residual disease (MRD) in patients with NB, 10 and a significant impact when used as adjuvant therapy.”
  • I31 I has been a common isotope used both for imaging and therapy pu ⁇ oses.
  • pure -emitters such as 90 ⁇ , 12 ' 13 alpha-emitting particles, 14 ' 15 such as 21 l At, 212 Bi and 213 Ac have attractive properties with promising biological effectiveness.
  • Multiple radioisotopes of varying path lengths and half-lives may be needed to enhance radiocurability of both bulk and microscopic diseases.
  • More recent developments in immunocytokines e.g. IL- 2, IL-12
  • 16 bispecific antibodies for pretargeting strategies e.g. radioisotopes or drugs
  • 17, 18 or T-bodies for retargeting immune cells 19"21 have further expanded the potentials of antibody -based immunotherapies.
  • tumor antigens expressed on glial tumors include neuroectodermal- oncofetal antigens eg. neural cell adhesion molecules (NCAM),"" gangliosides (GD2, GM2, 3'-6"-iso LD1) 23 ' 2 and neurohematopoeitic antigens (Thy-1 , 7 77
  • NCAM neural cell adhesion molecules
  • GD2, GM2, 3'-6"-iso LD1 neurohematopoeitic antigens
  • CD44 and splice variants are present to varying degrees on normal adult and fetal tissues, and for some hematopoeitic tissues as well. Notwithstanding the universal expression of NCAM by neuronal cells, anti-NCAM MoAb UJ13A was shown to accumulate in gliomas by virtue of disruption of blood brain barrier locally 28 and another MoAb ERIC-1 showed clinical benefit in resected glioma cavities. Integrin-3, a 140kDa protein expressed on gliomas and medulloblastomas and not in normal brain, is a potential target (MoAb ONS-M21) 30 , but it is poorly expressed among other tumor types.
  • the extracellular matrix protein tenascin is expressed in 50-95%) of gliomas as well as on mesenchymal tumors, carcinomas, normal human glial, liver and kidney cells.
  • 32 Anti-tenascin monoclonal antibodies 81C6, BC-2 and BC-4 33 administered directly into tumor-cavities have shown efficacy in patients with malignant gliomas. More recent investigations have focused on growth factor receptors, in particular type III mutant epidermal growth factor receptor (EGFRvlII) expressed on 52% of gliomas 34 as well as breast and lung carcinomas. 35 Given the relationship of these mutated receptors to their malignant potential, they may be ideal targets for MoAb.
  • EGFRvlII epidermal growth factor receptor
  • glioma-specific antibodies with no cross reactivity with normal brain have been described (e.g. 6DS1 , MabEp-C4), 6" they have limited reactivity with other neuroectodermal or mesenchymal tumors, and data regarding cross-reactivity with normal tissues are not available.
  • EGFRvlII the glial tumor antigens described are either found on nomial brain and/or nomial tissues, restricted to specific tumor types, or found in intracellular compartments/extracellular matrix which can limit their clinical utility for targeting to single cells or spheroids.
  • Sarcoma antigens similarly, have not been defined for the large family of sarcomas.
  • MyoD family of oncofetal proteins are specific to rhabdomyosarcoma, they are localized to the nucleus and therefore do not offer targets for antibody-based therapy.
  • the ES family of tumors can be differentiated from other small blue round cell tumors of childhood by MoAbs recognizing glycoprotein p30/32 coded by the MIC2 oncogene. However, this protein is expressed on nomial tissues (e.g. T-cells) greatly limiting the utility of MoAb in marrow purging, radioimaging or radiotherapy.
  • Membrane targets on OS include GD2, 42 glycoprotein p72, 43 CD55 44 erB2/neu 5 and the antigen recognized by the MoAb TP-3.
  • CD55 is decay-accelerating factor, a ubiquitous protein on blood cells and most tissues to prevent complement activation.
  • Clearly MoAb directed at CD55 would have significant limitations for in vivo targeting.
  • the degree of tumor heterogeneity e.g. erbB2 in OS
  • the presence of GD2 on pain fibers causes significant pain side effects in clinical trials. Nevertheless, this side effect is self-limited and this cross-reactivity did not interfere with the biodistribution and clinical efficacy of specific MoAb (see preliminary results).
  • GD2 is generally low or absent in RMS, ES, PNET, and many soft-tissue sarcomas.
  • the presence of GD2 in central neurons can limit its application in tumors arising or metastatic to the brain.
  • Our laboratory has generated a novel MoAb 8H9 by hyperimmunizing female BALB/c mice with human NB. 7 8H9 recognizes a unique surface antigen homogeneously expressed on cell membranes of a broad spectrum of tumors of neuroectodemial, mesenchymal and epithelial origin , with restricted distribution on normal tissues (see preliminary results).
  • Bivalent scFv and tetravalent scFv can be engineered to improve avidity.
  • 53 Bispecific scFv can be constructed to engage cells and proteins in various targeting strategies (e.g. pretargeting). 17,18 ScFv can also be used in T-bodies to retarget T-cells, a powerful technique to increase clonal frequency and bypassing the ITLA requirement of TCR functions. 19"21
  • scFv-fusion proteins e.g. CD28, zeta chain
  • transduced into T-cells can greatly enhance their survival following activation. 21 Even more importantly, the ability of such cells to proliferate in contact with tumor cells can further amplify the efficiency of T-cell cytotherapy.
  • Radioimmunoscintigraphy can test if an antibody-antigen system has targeting potential. Using radioiodines and technetium we have demonstrated the utility of the GD2 system for targeting in the last decade. This information has been translated into treatment strategies using both unlabeled and 13 I I labeled antibody 3F8. Dosimetry calculations have allowed quantitative estimates of therapeutic index when cytotoxic agents are delivered through antibody-based methods. Uptake (peak dose and area under the curve AUC) in specific organs relative to tumor can be measured. These studies are resource intensive and to be done well, require laboratory, radiochemistry, nuclear medicine, medical physics and clinical resource support, as well as substantial personnel effort. In pediatric patients, issues of therapeutic index may be even more pressing given the potential of late effects of treatment. In addition, despite the potential life- years saved for pediatric cancer, o ⁇ han dmgs are not economically attractive for most industrial sponsors. These circumstances have made the initial stages of clinical development even more stringent and relatively more difficult to accomplish.
  • Radioimmunoscintigraphy uses the trace label principle and gamma imaging to define the distribution of a specific antibody in various human organs. It provides estimates of antibody (and radiation) dose delivered to blood, marrow and major organs. The continual development of improved software and hardware for calculating antibody deposits in tissues is critical in implementing these studies (see preliminary results). The quantitative relationship of free circulating antigens (if present) and biodistribution of MoAb needs to be defined. The fonnation of human-anti-mouse antibody (HA MA) response will clearly affect the in vivo properties of these antibodies.
  • HA MA human-anti-mouse antibody
  • Memorial Sloan-Kettering has a strong track-record in the development and clinical applications of monoclonal antibodies.
  • Memorial Sloan-Kettering Cancer Center (MSKCC) is devoted to the research and clinical care of cancer patients.
  • the Center has an extensive patient referral base, particularly within the tri-state area.
  • the center has an established commitment and past record in the use of monoclonal antibodies in the diagnosis and therapy of human cancers, including melanoma, colon cancer, and leukemias.
  • MoAb can extend the progression-free period in a cancer that was uniformly lethal two decades ago.
  • Immune based therapies can be administered safely in the outpatient setting, thus reducing expensive in-patient costs and maximizing time in the home environment.
  • MoAb can induce idiotype network, a potential endpoint that underlies the biology in maintaining continual clinical remission.
  • GD2 is a useful marker of MRD, and specific MoAbs are highly efficacious in monitoring and purging of tumor cells.
  • the murine IgGl antibody 8H9 has obvious potential in monitoring and purging of MRD, radioimmunoscintigraphy, and radioimmunotherapy (both intravenous or compartniental). If our proposed study produces favorable results, i.e. selective tumor uptake at optimal AUC ratios (Tumor: tissues/organs), radioimmunotherapy can be explored for some of these solid tumors. More importantly, further development of the antibody would involve a major effort in humanizing and further genetic engineering to improve effector functions.
  • G D2 -specific MoAb-based targeted therapy a curative approach to a pediatric solid tumor: metastatic NB Improved understanding of the biology of NB has reshaped our clinical approach to this cancer.
  • Non-infant stage 4 NB remains a therapeutic challenge despite four decades of combination chemotherapy. Similar to many cancers,
  • Disialoganglioside GD2 is a tumor antigen well suited for targeting therapy because (1) it is expressed at a high density in human NB, is restricted to neuroectodermal tissues and is genetically stable, unlike other tumor antigens such as immunoglobulin idiotypes; (2) although it circulates in patients' serum, it does not interfere with the biodistribution of specific antibody (e.g.
  • Radiolabeled anti-G» 2 antibody 3F8 3F8 is a murine IgG 3 MoAb directed at the ganghoside GD 2 expressed on human NB cells.
  • I-3F8 targeted to human NB xenografts with exceptionally high %ID/gm.
  • Intravenous 'i-labeled IgG 3 MoAb 3F8 produced a substantial dose dependent shrinkage of established NB in preclinical studies. Dose calculations suggested that tumors that received more than 4,200 rads were completely ablated. Marrow suppression was the dose limiting toxicity. In patient studies, it is not trapped nonspecifically by the reticuloendothelial system and penetrates NBs well (0.04 to 0.11% injected dose/gm). 1 ,86 Because of the intact blood brain barrier, 'l-3F8 does not normally localize to brain, spinal cord or penetrate the surrounding CSF. 10,59
  • I3, I-3F8 is more sensitive than conventional modalities, including metaiodobenzylguanidine (MIBG) in detecting NB in patients.
  • MIBG metaiodobenzylguanidine
  • the biodistribution of l31 I-3F8 was studied in 42 patients (2 mCi per patient) with NB. 10 Comparison was made with l31 I-MIBG, 99m Tc-MDP (technetium-labeled methylene diphosphonate) bone scan, as well as CT or MRI.
  • 131 I-3F8 detected more abnormal sites (283) than 131 I-MIBG (138) or 99 Tc-MDP (69), especially in patients with extensive disease.
  • 131 I-3F8 detected the disease in 18 of them.
  • the two 131 I-3F8-imaging-negative tumors revealed ganglioneuroma, one showing microscopic foci of NB.
  • l31 I-3F8-imaging- positive tumors were all confirmed as NBs.
  • 14/26 had confirmation by iliac crest marrow aspirate/biopsy examinations. Agreement between the measured tissue radioactivity and the estimates based on planar scintigraphy validated the initial dosimetry calculations.
  • the tumor uptake in patients with NB was 0.08%>-0.1% ID/g .
  • the calculated radiation dose was 36 rads/mCi delivered to NB and 3-5 rad/mCi to blood.
  • 3F8 immunosGintigraphy was compared with 99rn Tc-glucoheptonate/DTPA planar imaging, Thallium 201 single photon emission tomography (SPECT), and 18 FDG positron emission tomography (PET). 10/1 1 malignant gliomas and 1/1 metastatic melanoma showed antibody localization. No nonspecific uptake in nomial brain or CSF was detected. Average plasma and total body clearance were 20 h and 47 h, respectively. Antibody localization was measured on surgical specimens and time activity curves were calculated based on modified conjugate views or PET. Radioactivity uptake in high grade glioma peaked at 39 h, which then decayed with a half-life of 62 h. Tumor uptake
  • Myeloablative doses of 131 I-3F8 are effective for NB with minimal extramedullary toxicities. Based on the tracer dose dosimetry, the absorbed doses to liver, spleen, red marrow, lung, total body and tumor were 537, 574, 445, 454, 499 and 4926 rads, respectively. The average rad/mCi were 2.3, 2.5, 2, 2, 1.9, and 13.7, respectively.
  • the chemical toxicities of the antibody 3F8 have been studied in phase I 76,77 and phase II studies. ' Acute toxicities included pain, urticaria, fever and hypotension which were self-limited.
  • the radiological toxicities of 131 I-3F8 were recently defined in a phase I dose escalation study.
  • PET Planar or single photon emission computed tomography
  • SPECT single photon emission computed tomography
  • One pt had an elevated opening CSF pressure that remained increased for 36-48 hours post-injection. There was no appreciable change in WBC, platelet counts, liver or kidney functions tests or CSF cell counts in all 5 patients.
  • Focal 1 1 I-3F8 uptake was demonstrated in the ventricles, spine and midbrain in 4 patients, corresponding to disease seen on MR. In the one patient who had no MR evidence of disease, 131 I-3F8 clearance was most rapid (3 hours), with no focal accumulation observed on SPECT.
  • Four patients with focal 131 I-3F8 uptake received 10 mCi of 131 I-3F8 through the Ommaya reservoir as part of a treatment protocol in a phase I toxicity study. Except for grade 2 toxicities (fever, headache, nausea and vomiting, increase in intracranial pressure) and a breakthrough seizure, there were no adverse side effects during their initial treatment.
  • Adjuvant anti-Gn 2 antibody 3F8 3F8 (without radioisotope) has also been tested in phase I and phase II studies. 5 Responses of metastatic NB in the bone marrow were seen. Another mouse antibody 14.G2a and its chimeric form 14.18 have also induced 32375 marrow remissions in patients with NB. 83 Acute self-limited toxicities of 3F8 treatment were pain, fever, urticaria, hypertension, anaphylactoid reactions, as well as decreases in blood counts and serum complement levels, and in rare patients self-limited neuropathy. 71,97 - 99
  • Anti-GD2 antibody treatment of MRD in stage 4 NB diagnosed at more than one year of age Thirty-four patients (pts) were treated with 3F8 at the end of chemotherapy. Most had either bone marrow (31 pts) or distant bony metastases (29 pts). Thirteen pts were treated at second or subsequent remission (group I), and 12 pts in this group had a history of progressive/persistent disease after ABMT; 21 pts (all on N6 protocol) were treated in first remission following induction chemotherapy (group II). At the time of 3F8 treatment, all 34 patients had stable or minimal NB.
  • HAMA Human anti-mouse antibody response
  • patient outcome Three patterns of HAMA response were identified. In pattern I, HAMA was not detectable during the 4-6 month followup period after first cycle of 3F8, 42% had no HAMA response even after receiving 2-4 cycles of 3F8 over a 4-25 month period. In pattern II, HAMA was detected but rapidly became negative during the 4-6 month followup period. In pattem III, HAMA titer was high (>5000 U/ml) and persistent during the 4-6 month followup period. When patients developed HAMA (>1000 U/ml) during a treatment cycle, pain side effects disappeared. In the absence of HAMA (pattern I) or when HAMA became negative (pattern II), patients received repeat 3F8 treatments.
  • Idiotype network is a possible mechanism for long term PFS. Since the HAMA response was primarily anti-idiotypic (Ab2), we postulate that the subsequent induction of an idiotype network which included anti-anti-idiotypic (Ab3) and anti-Gpi (Ab3') responses may be responsible for tumor control in patients. Their serum HAMA, Ab3, and Ab3' titers prior to, at 6, and at 14 months after antibody treatment were measured by ELISA. Long term PFS and survival correlated significantly with Ab3' (anti-Grj 2 ) response at 6 months, and with Ab3 response at 6 and 14 months. Non-idiotype antibody responses (anti-mouse-IgG3 or anti-tumor nuclear HUD antigen) had no apparent impact on PFS or survival.
  • N6 all survivors past 5 years
  • causes of death included disease progression, secondary leukemia, and isolated CNS relapse.
  • toxicities included hearing loss and hypothyroidism which required correction, a curative strategy for stage 4 NB appeared to be within reach.
  • Neuroblastoma, 3F8 and GD2 provided us with the proof of principle that MoAb may have potential in the permanent eradication of MRD in the curative tieatment of solid tumors in the younger population. Both RIT and idiotype-netowrk induction are possible with murine MoAb. We therefore undertook an extensive screening of MoAbs to identify candidates with a broad reactivity with pediatric/adolescent solid tumors, that may have similar targeting potential as the antibody 3F8.
  • mice Female BALB/c mice were hyperimmunized with human neuroblastoma according to previously outlined methods. 7 Splenic lymphocytes were fused with SP2/0 mouse myeloma cells line. Clones were selected for specific binding to neuroblastoma on ELISA. The 8H9 hybridoma secreting an IgGl monoclonal antibody was selected for further characterization after subcloning.
  • 8H9 immunoreactivity was seen in a characteristic, homogenous, cell membrane distribution in 272 of the 315 (86%) tumor samples examined. 88% of neuroectodermal tumors, 95% of mesenchymal tumors and 44%o of epithelial tumors tested positive with 8H9 (Tables 4-8)
  • Indirect immunofluorescence 8H9 immunoreactivity in 34 NB, melanoma, RMS, small cell lung cancer, OS, glioblastoma, leukemia, breast cancer and Golon cancer cell lines was tested using indirect immunofluorescence. Moderate to strong cell membrane reactivity with 8H9 was detected in 16/16 NB, 2/2 melanoma, 2/2 RMS, 1/1 glioblastoma multiforme, 3/3 breast cancer, and 1/1 colon cancer, 2 of 3 Ewing's/PNET, and 2 of the 3 OS cell lines.
  • 8H9 staining was equivalent to control antibody.
  • NB NMB7 or OS U20S cells were biotinylated using biotin-LC-NHS, lysed, precleared with protein-G sepharose, reacted with antibody
  • Rat Anti-idiotypic MoAb specific for 8H9 By immunofluorescence the antigen was sensitive to low temperatures. ' In view of the lability of the antigen, we chose to synthesize anti-idiotypic antibodies as surrogate antigen-mimics, in order to allow in vitro monitoring of the antibody immunoreactivity e.g. after iodination of antibody 8H9. LOU/CN rats were immunized with protein-G purified 8H9 precipitated with goat-anti- mouse Ig, emulsified in CFA. Following in vitro hybridization to the myelomas SP2/0 or 8653, 3 IgG2a clones (2E9, 1 E12, and I Fl 1) were selected for their high binding and specificity.
  • the anti-idiotypic hybridomas were cloned and antibodies produced by high density miniPERM bioreactor from Unisyn Technologies (Hopkinton, MA).
  • the anti-idiotypic antibodies are further purified by protein G (Pharmacia) affinity chromatography.
  • protein G Pharmacia affinity chromatography
  • Control IgGl MoAb antibody 2C9 remained in the blood pool without localization to sc RMS xenografts. Tumor to normal tissue ratio was favorable [range 5-55]for 8H9 (solid bar, figure 5) in contrast to control MoAb 2C9.
  • 8H9-ScFv single chain antibody
  • scFv single chain antibody
  • Vn variable regions of the heavy (Vn) and light chains (VL) of 8H9 were joined by a polylinker (L) (gly4Ser) 3 and selected by phagemid expression.
  • L polylinker
  • scFv was characterized by DNA sequencing, western blots, in vitro ELISA, immunostaining/FACS, and idiotype analysis.
  • ES is a small round blue cell tumor of childhood characterized by a t( 1 1 ,22) in most patients. Because survival remains suboptimal with standard therapy, many patients receive autologous stem cell transplant and current trials investigating adoptive transfer of autologous T cells in the context of immune therapy are underway. However, approximately 50% of patients with advanced disease have PCR detectable ES in peripheral blood and/or bone marrow and the administration of autologous cell preparations contaminated with tumor may contribute to disease relapse. To date, there is no method reported for purging contaminated hematopoietic cell populations or bone marrow preparations of ES. Merino et al in the laboratory of Dr.
  • 8H9 was used to isolate ES cells from contaminated blood cell populations.
  • purging efficiency was monitored by of t(l 1 ,22) RT-PCR. Contaminated specimens were reacted with 8H9 and then incubated with rat anti-mouse
  • Specific aim #1 To define the level of agreement between I-8H9 and conventional imaging modalities in the detection of primary and metastatic solid tumors in pediatrics.
  • HHS 441 Civil Rights
  • HHS 641 Handicapped individuals
  • form 639-A Re: sex discrimination
  • MSKCC in 1996 26%> were black, Hispanic, Asian or Native American, 70% white and 6% unknown or not responding. Of these patients, 38% were male and 62% female.
  • Time Procedure day - 10 start daily oral SSKI, cytomel for thyroid blockade day 0 5 mCi of iodine-131 on 0.25 to 0.75 mg of 8H9* blood samples at 0, and approximately 15 min, 30 min, l h, 2h, 4h,
  • Tissue biopsy is recommended for regions of uptake by 8H9 imaging and negative by conventional radiographic techniques.
  • BIOSTATISTICS To measure the level of agreement between conventional imaging modality (CT, MRI, and nuclear scans) and antibody 8H9 imaging in known and occult sites of disease. Index lesions will be confirmed either by surgery or by disease-specific imaging (e.g. MIBG for NB). For each individual, the proportion of sites found by 8H9 imaging will be scored. Given that there will be confirmation by surgery or by disease-specific imaging, sensitivity analysis of 8H9 for each disease can be conducted. The probability of agreement or positive predictive value will be calculated. The 95% confidence intervals can be calculated within +/- 31% for each disease (NB, RMS, ES/PNET, DSRT, brain tumors and other sarcomas). The study will be performed on a total of 60 patients (10 with NB, 10 RMS, 10 osteosacrcoma, 10 ES, 10 DSRT and 10 brain tumors plus other
  • I-8H9 8FI9 is produced under GMP conditions and packaged in glass vials. I is purchased from Amersham Inc. 8H9 will be labeled with radioactive iodine using iodogen T method. The reaction mixture is filtered through an ion exchange (AG1X8) filter (Biorad) to remove free iodine. Protein incorporation is measured using TCA precipitation or thin layer chromatography.
  • Immunoreactivity is measured by 2 separate methods (1) a solid phase microtiter radioimmunoassay technique previously described, 102 and (2) anti-idiotype peak shift method, where anti-idiotypic antibody 2E9 is added at 50 to 1 molar ratio to l31 I-8H9 for 30 minutes on ice with mixing. The percent cpm shifted on HPLC is a measure of immunoreactivity.
  • Radioiodinated 8H9 has a mean trichloroacetic acid precipitability of >90%>, and specific activity of t31 I-8H9 averaging 10 mCi per mg protein. Administration of 131 I-8H9 is undertaken within 1-2 hours of iodination to reduce the possibility of radiolysis.
  • Antibody radiolabeling is carried out in the Central Isotope Laboratory under the supervision of Dr. Ronald Finn, according to FDA guidelines on radiolabeled biologies for human use.
  • radiolabeled MoAb preparations will be injected into patients by a trained research nurse or physician. Strict observance of appropriate radiation safety guidelines will be undertaken. The procedure will be explained to the patient thoroughly prior to the infusion by the physician, and appropriate pre-treatment (eg SSKI drops, perchloracap) checked.
  • the radiolabeled antibody will be transported from the radio labeling facility to the infusion area loaded into the infusion delivery system by the physician. The physician and nurse will be present throughout the infusion and in the post-infusion period.
  • the infusion procedure will consist of the radiolabeled antibody being administered intravenously either through a peripheral intravenous catheter or an indwelling central catheter over a 20 minute period. All patients will have vital signs monitored prior to and following the radiolabeled antibody infusion. Blood samples for pharmacokinetic calculation will be obtained immediately following the infusion, and at various time points thereafter as outlined above. The patient will be seen by a physician daily while hospitalized, and will be available for consultation (with appropriate radiation safety personnel) with an oncologist or nurse regarding issues relating to the radiolabeled antibody infusion or radiation safety. The patient will also be imaged in the Nuclear Medicine Department over the subsequent two week period, and all imaging procedures performed will be supervised by the physician to ensure that appropriate studies are obtained.
  • HAMA HAMA-specific kinase kinase kinase
  • naive patients HAMA is typically undetectable, in patients with prior history of exposure to murine antibodies or to 8H9, the presence of HAMA before and soon after 8H9 injection will need to be monitored.
  • the formation of HAMA was highly correlated with patient survival in the GD2-3F8 system, we plan to measure the serum antibody titer 6 months and 12 months after 8H9 exposure.
  • the ELISA method has been described previously. 1 1 Using F(ab')2 fragments derived from the three anti-idiotypic antibodies (2E9, 1E12, and 1 F1 1), serum Ab3 will also be monitored as previously demonstrated for the GD2-3F8 system. 1 3, 1 °
  • anti-idiotypic antibodies are rat IgGl MoAb purified by acid elution from protein G affinity columns. They have remained stable despite acid treatment, buffer changes and freezing and thawing. Soluble antigens can interfere with tumor targeting. In vitro, patient serum did not inhibit binding of 8H9 to its anti-idiotype. Indirect immunofluorescence of a spectrum of cell lines showed persistence of antigen and antibody on the cell surface at 37°C over days.
  • MoAb injection is rarely observed among our patient population, partly because of the intensity of the chemotherapy they received. However, some are expected to mount a HAMA response when they are imaged a second time. Clearly their HAMA will be monitored before and after injection in order to interpret the biodistribution results. Because of this sensitization, these patients may not be eligible for subsequent MoAb therapies (as stated in the consent form). However, we hypothesize that this HAMA response will help induce the idiotype network, which may have benefit on patient survival, analogous to our success with the murine 3F8-GD2 system we described in preliminary results and progress report.
  • Specific aim #2 To Estimate the radiation dose per mCi of I-8H9 delivered to tumors and to normal organs in patients.
  • patients will be injected, intravenously, with 131 I-8H9 according to their surface area, i.e. 10 mCi/1.73m2.
  • a total of three or four gamma camera images will be obtained within a 1 to 2 week period following injection.
  • the following schedule is recommended but may be altered, if necessary: 1-4 h after injection (day 0) and then again on days 2, day 3, and day 6 or 7. If warranted, due to slow clearance kinetics, imaging on days 9, 10 or 1 1 may also be performed.
  • SPOT and SPECT images will be collected over pre-selected "index" tumor lesions, as identified from previously obtained CT or MR images.
  • Plasma or serum will be collected and counted from each sample and the results will be expressed as per cent of the injected radioactivity per L serum or blood volume.
  • SPOT srarir, pnt view
  • SWEEP whole-body sweep
  • HEHR high-energy, high-resolution
  • Tumor volumes will be determined from CT or MJRJ when available. Patients with known disease at other sites are imaged in additional areas. All CT images will be transferred for display in 3D-ID; images collected at MSKCC will be transferred digitally, film from other institutions will be scanned using a Lumisys digital film scanner. Using 3D-ID, the consulting radiologist will review the images with the research technician. The research technician will then draw contours around the tumor regions; the contours will be reviewed by the consulting radiologist and adjusted, as needed. In some cases, disease may be represented by a collection of very small positive nodes; in those cases a contour around the group will be drawn and used in the volume assessment.
  • Volume determination using 3D-ID is performed by summing the areas of regions that have been defined by the user on all slices making up the tumor. This general approach has been previously validated for CT. Although potentially labor-intensive, such a tumor outline-specific method is significantly more accurate than techniques based upon greater and minor diameters (i.e., ellipsoidal models)). The errors associated with CT-based volume estimation and the factors influencing these errors have been examined and will be considered in the volume determinations described above. A reliable total-body tumor burden will not be achievable for all patients, either because of the small volume of disease, or for cases in which lesions detected by SPECT are not visible by CT.
  • Bone marrow dosimetry will be performed according to the recommended guidelines, described in the AAPM recommendations," 6 i.e. blood time-activity curves will be multiplied by the appropriate factor (0.2 - 0.4) to derive marrow time-activity curves and absorbed dose to red marrow. S-Factors provided in MIRDOSE 3 will be used for the calculations. This data will be compared with direct measurement of the marrow activity from ROI's drawn over marrow Gavities on SPECT images. The quantitative capability of SPECT will allow us to verify the accuracy of bone marrow dosimetry determined from activity levels, and the rate of antibody clearance from marrow, from the standard analysis of serial blood samples.
  • a non-linear least-squares search is used to minimize the sum of the squares of distances from each "hat” point to the nearest point on the "head” surface.
  • the coordinates of the "hat” are translated, rotated and scaled to provide the best fit. Users may control which parameters are varied during the search.
  • the final set of transformations are then used to convert the coordinates of one image into those of the other. Phantom studies indicate that the Pelizzari and Chen technique for registration of SPECT to CT is accurate to within 3mm.
  • the Nuclear Medicine Service at MSKCC has perfonned such registration for over 100 patient studies.
  • the Pellizari and Chen package has also been used for thoraciG and abdominal study registration by Chen and his collaborators at the University of Chicago (personal communication).
  • Correlated serial SPECT images can be used to determine cumulative activity distributions by fitting and integrating an exponential uptake and/or clearance to the specific activity within an ROI over the tumor or organ.
  • the variation in activity within individual voxels can be taken into account, through a weighted sum of the counts/activity within the corresponding voxel over time.
  • a software package, 3D-ID Given such a distribution of the cumulated activity, a software package, 3D-ID, has been developed, to calculate the dose distribution.
  • Target contours are drawn on side-by-side enlarged SPECT and CT/MR image slices that are selected from a scrollable image display. Contours drawn in one modality simultaneously appear in the other. The user may switch between modalities by positioning the Gursor in the appropriate window.
  • This provides for the simultaneous use of both imaging modalities to define tumor (e.g. using SPECT) and nomial organ (using CT/MR) contours.
  • the dose to all voxels within the target volume is obtained by convolving the activity distribution with a point kernel table of absorbed dose versus distance.
  • Patient-specific S-factors may be calculated by defining source organ contours and assigning unit activity to all voxels within each source. The "dose" to a given target is thus the patient-specific S-factor.
  • Dose histograms and patient-specific organ and tumor S-factors generated using 3D-ID in combination with SPECT will provide important information in understanding tumor response and organ toxicity in radioimmunotherapy.
  • a point-kernel based dosimetry calculation has been implemented and several different approaches for displaying the spatial distribution of absorbed dose in a biologically pertinent manner were also described.
  • the dose calculation itself, was carried out in a separate module, so that different calculation schemes including Monte Carlo, may be used with 3D-ID.
  • the methodology implemented in this proposal will yield the spatial distribution of absorbed dose as isodose contours, overlayed upon a 3-D CT image set. This makes it possible to evaluate the anatomical distribution of absorbed dose to tissues and from this, assess the potential impact in terms of toxicity. For example, the dose to surrounding tissue from activity that has concentrated in a tumor contained within a normal organ can be obtained by this means.
  • the average absorbed dose to a tumor may not reflect potential therapeutic efficacy and tumor shrinkage. That portion of a tumor volume receiving the lowest absorbed dose will lead to treatment failure regardless of the dose delivered to other regions of the tumor volume.
  • the 3D-ID software package provides detailed information regarding the spatial distribution of absorbed dose within a target volume. This infonnation is depicted as dose-volume histograms, wherein the fraction of tumor volume receiving a particular absorbed dose is plotted against absorbed dose. Using such information it will be possible to better assess the likelihood of tumor control. For example, if the average dose over a tumor volume is 2 to 3 Gy and a small region within this volume receives only 0.1 Gy, then treatment will be unsuccessful.
  • Tumor specimens, bone marrow samples, and blood from patients will be collected according to the treatment plan. Patients received 131 I-8H9 according to the IRB protocol.
  • the risks to the subjects are acceptable in relation to the anticipated benefits to the subjects and in relation to the importance of knowledge expected to be gained.
  • the proposed research project will involve the use of human subjects.
  • the sera samples obtained from patients are ⁇ 5% blood volume, and only after informed consent under the guidelines of Memorial Sloan-Kettering Cancer Center IRB approved protocols.
  • Risks to the participants are the minimal risk associated with venipuncturc and/or lumbar puncture.
  • the confidentiality of all participants will be protected by the use of code numbers.
  • Cheung NKV Biological and molecular approaches to diagnosis and treatment, section I. Principles of Immunotherapy. In: Pizzo PA, Poplack DG, (eds.): Principles and Practice of Pediatric Oncology, 3rd ed. ed, Philadelphia, J.B. Lippincott Company, 1997, pp 323-342 59. Larson SM, Sgouros G, Cheung NK: Antibodies in cancer therapy;
  • Handgretinger R, Baader P, Dopfer R, et al A phase I study of neuroblastoma with the anti-ganglioside GD2 antibody 14.G2a. Cancer Immunol Immunother 35: 199-204, 1992 85. Cheung NK: Biological and Molecular Approaches to Treatment. Immunotherapy. In; Pizzo PA, Poplack DG, (eds.): Principles and Practice of Pediatric Oncology, 2nd ed. Philadelphia, J.B. Lippincott Company, 1992, pp 357-370 86. Miraldi FD, Nelson AD, Kraly C, et al: Diagnostic imaging of human neuroblastoma with radiolabeled antibody.
  • Cheung IY, Cheung NKV, Kushner BH Induction of Ab3' following anti-GD2 monoclonal antibody 3F8 therapy predicts survival among patients (pts) with advanced neuroblastoma. Proc Am Assoc Cancer Res 40:574, 1999 104. Chen S, Caragine T, Cheung NK, Tomlinson S: Surface antigen expression and complement susceptibility of differentiated neuroblastoma clones. Am J Pathol In press:, 1999
  • Metastatic rhabdomyosarcoma is a chemotherapy-responsive tumor. However, cure is elusive because of the failure to eradicate minimal residual disease (MRD). MoAb may have potential for selective targeting of therapy to MRD. Few MoAb of clinical utility have been described for RMS. We previously reported the broad tumor reactivity of a murine MoAb 8H9 with low/no staining of nomial human tissues. The target antigen was typically expressed in a homogeneous fashion among neuroectodermal (neuroblastoma, Ewing's sarcoma, PNET, brain tumors), mesenchymal (RMS, osteosarcoma, DSRT, STS) and select epithelial tumors. Of 25 RMS tumors, 24 stained positive.
  • Radioimmunolocalization of subcutaneous RMS xenografts in SCID mice was studied using radiolabeled 8H9. Following iv injection of 120 uCi of " I-8H9, selective tumor uptake was evident at 4 to 172 hrs after injection, with a blood T! of 0.8 h and ⁇ Vz of 26 h. Mean tumor/tissue ratios were optimal at 172 h (for lung 4, kidney 1, liver 9, spleen 10, femur 16, muscle 21, brain 45).
  • Quantitative PCR or t(l l ;22) was shown to accurately measure the level of contamination with a sensitivity of 1 : 10 '.
  • Samples were then purged using the Miltneyi Variomax negative selection system selecting for monoclonal antibody 8H9 bound cells.
  • a 2 to 3-log reduction in tumor burden was consistently observed following immunomagnetic selection.
  • Ewing's contamination ranged between 1 : 10 -1 : 10 6 . Therefore 8H9 based purging of clinical samples is predicted to result in a contamination level which is below the limit of detection by sensitive quantitative PCR.
  • Ewing's sarcoma is a systemic disease from the time of onset as demonstrated by the observation that over 90%) of patients with clinically localized disease will recur distantly if treated with local measures alone[Jaffe, 1976 #49]. Indeed, the generally accepted factor responsible for the recent improvement in survival observed in patients with clinically localized disease is control of hematogenously disseminated micrometastasis via neoadjuvant multi-agent chemotherapy ' . Recently, the use of sensitive molecular monitoring to detect circulating Ewing's sarcoma cells has confnmed heniatogenous dissemination in a substantial number of patients with Ewing's sarcoma.
  • PBMCs used in tumor spiking experiments were obtained by ficoll-based density gradient separation of the fresh buffy coat fraction of nonnal healthy donor blood units obtained at the
  • PBMCs were T cell enriched using a negative selection column (R & D Biosystems, Minneapolis) which results in a purity of approximately 80%.
  • Patient apheresis samples analyzed for contamination were obtained as part of NCI POB 97-0052 following infonned consent.
  • Leukapheresis procedures were done using the CS3000 Plus (Fenwal Division, Baxter, Deerfield, IL) which processed 5-15 liters of blood volume.
  • Countercurrent centrifugal elutriation of the apheresis product was perfonned using a Beckman J-6M centrifuge equipped with a JE 5.0 rotor (BeGkman
  • Cell fractions (450-550 ml each) were collected at flow rates of 120, 140, and 190 ml/min. during cciitrifugation and at 190 ml/min. with the rotor off (RO). The first two fractions are typically enriched for lymphocytes while the last two fractions are enriched for monocytes. All fractions were cryopreserved in 10% DMSO (Cryoserv, Research Industries, Salt Lake City, UT), RPMl with penicillin, streptomycin and L-glutanhne and 25% fetal calf serum.
  • DMSO Disoserv, Research Industries, Salt Lake City, UT
  • RPMl with penicillin, streptomycin and L-glutanhne and 25% fetal calf serum.
  • C-D34+ cells used for purging experiments were selected using the Miltenyi Variomax® direct isolation system (Miltenyi, Auburn, CA) from cryopreserved peripheral stem cells from a Ewing's sarcoma patient obtained for therapeutic use at Children's National Medical Center, Washington, DC according to approved protocols and following informed consent. Stem cells were used for research purposes after the patient's death. These cells were not positive by RT-PCR for Ewing's sarcoma and were therefore artificially contaminated for the purging experiments.
  • Miltenyi Variomax® direct isolation system Miltenyi, Auburn, CA
  • Stem cells were used for research purposes after the patient's death. These cells were not positive by RT-PCR for Ewing's sarcoma and were therefore artificially contaminated for the purging experiments.
  • Non-CD34 selected bone marrow used for purging experiments and enriched CD34+ populations used in the CFU assay were obtained from fresh human marrow harvested from normal volunteers according to approved protocols and following informed consent (Poietics Laboratories, Gaithersburg, MD).
  • the mononuclear fraction was obtained by ficoll-based density gradient separation, and subsequently enriched for CD 34+ cells by the Miltenyi Variomax® (Miltenyi, Auburn, CA) direct CD34 selection system.
  • Ewing's sarcoma cell lines used for screening included TC71, 5838, RD-ES, CHP 100, A4573 which have been previously reported 22 and JR and SB which are cell lines derived from patients treated at the National Cancer Institute which have also been previously reported 2 , L was a cell line derived from a patient with isolated intrarenal recurrence of Ewing's sarcoma treated with resection at the University of Maryland.
  • Flow cytometric analysis was performed using the Becton-Dickinson FacsCalibur machine. Briefly, fluorescence data were collected using a 3- decade log amplification on 10,000 viable gated cells as determined by forward and side light scatter intensity. Monoclonal antibodies used for immunofluorescence were: MoAb 8H9, murine IgG 1 isotype, goat anti-mouse IgG l -FITC, CD3 - PE (S4.1 ), CD34 - PE (581 ) Caltag (Burlingame, CA), CD99-FITC (TU12) (Pharmingen, San Diego, CA).
  • X 10 6 cells were analyzed for pre-purged and post-purged PCR.
  • 30-80 X10 (> cells were spiked with TC71 with 10X10 6 cells analyzed for pre-purged and post-purged PCR.
  • cells were incubated at 4°C with monoclonal antibody 8H9 at a concentration of lug/10° total cells for 20 minutes and washed with buffer
  • the positive fraction was pelleted and resuspended in RPMl with 10% FCS, L-glutamine (4uM), penicillin (l OOu/ml) , and streptomycin (l OOug/ml), and placed in an incubator at 37 °C with 5% CO z for 5 days.
  • GDNA was generated from 250ng RNA using a random hexanier
  • PCR was performed with Perkin Elmer GencAmp PCR system 2400 using ESPB l and ESBP2 primers and the following conditions; 40 cycles 95 ⁇ C 30s, 60°C 30s,
  • Hybridization probes spanning the EWS/FLI 1 breakpoint were used to detect target template in the Lightcyler reaction.
  • G6PD was amplified from 5ul of GDNA and analyzed using sequence specific hybridization probes G6PDHP1 and G6PDHP2.
  • the 5' probe (HP1) was labeled at the 3 'end with Fluorescein
  • the 3 ' probe (I-IP2) was labeled at the 5' end with Lightcycler Red 640 and phosphorylated at the 3 ' end.
  • Cycle crossing number was ascertained at the point in which all samples had entered the log linear phase. Cycle crossing number was used to determine log cell concentration according to a standard curve.
  • the standard curve was generated by amplifying 5ul of cDNA derived from lug of RNA from 10 X 10° normal PBMCs spiked with TC71 tumor cells at decreasing concentrations from 1 : 10 to 1 : 10 7 .
  • G6PD1 5'CCGGATCGACCACTACCTGGGCAAG3'
  • CD3 enriched cells were contaminated with Ewing's sarcoma at a level of 1:10.
  • Cells from pre-purged and post-purged samples were added in triplicate to a 96 well plate at a concentration of 2 X 10 s cells/well containing decreasing concentrations of plate bound anti-CD3 antibody OKT3 (Ortho Biotech Inc., Raritan, NJ) from lOOug/ml to 3ug/ml.
  • Cells were incubated with 200ul of RPMl with 10%FCS, L-glutamine, penicillin, and streptomycin for a 48 hours and then pulsed with luCi of [ 3 H] thymidine per well.
  • Cells were harvested after IS hours of pulsing and " H incorporation was enumerated using the TopCount NXT (Packard, Meriden CT). Subtracting background activity with media alone generated net counts.
  • CD34+ cells were enriched from pre- and post-purged samples from fresh human bone marrow using the Miltenyi® direct CD34 - progenitor isolation kit. 35 x 10 bone marrow mononuclear cells from eadi sample were run over a positive selection (MS) column yielding a CD34+ enriched population with estimated purities of >70% 24 1000 cells were plated in triplicate in methylcellulose media supplemented with recombinant cytokines
  • Monoclonal Antibody 8H9 binds all Ewing's Sarcoma Cell Lines tested but not normal lymphocytes or hematopoietic progenitors.
  • Ewing's sarcoma cell lines evaluated (Figure 1). The level of reactivity was variable with some lines showing diminished levels of reactivity compared to CD99 whereas two lines (SB and RD-ES), showed increased reactivity compared to CD99. Importantly, lymphoid and hematopoietic populations showed no reactivity with 8H9 as shown in Figure 2a (CD3 gated PBMC), and
  • Figure 2b (CD34 gated bone marrow cells), whereas CD99 showed significant binding to T cell populations.
  • variable levels of contamination could be quantified using RT-PCR.
  • MoAb 8H9 based immunomagnetic purging yields a 2 to 3-Iog reduction in artificially contaminated peripheral blood and bone marrow populations.
  • variably contaminated 8H9 incubated bone mamow or peripheral blood stem cell populations were run over a Variomax® negative selection column as described in methods.
  • Non-nested PCR evaluation of non-CD34 selected bone marrow from a healthy donor spiked with Ewing's sarcoma cells at a level of 1 : 100 is shown in figure 4a.
  • CD34+ selected cells from G- CSF mobilized peripheral blood were spiked at a level of 1 : 10 3 and purged as shown in figure 4b.
  • PBMC populations was undertaken. Similar to the results observed with CD34+ enriched peripheral blood stem cells, at least a 3-Iog reduction in contamination following 8H9 based purging of PBMCs contaminated at 1 : 100 was attained as shown in figure 4c. Evaluation of purging of PBMCs contaminated at a lower level (1 : 10 ) is shown in figure 4d where a 3-log reduction is again observed. In each of these experiments analysis of the positive fraction demonstrated PCR positivity confinning selection of contaminating Ewing's cells (data not shown). To account for any variation from the expected uniform amounts of starting RNA or cDNA, G6PD amplification was performed from each sample in a quantitative fashion.
  • monoclonal antibody 8H9 may be a suitable candidate for immunomagnetic based purging of contaminated blood, bone marrow, and CD 34+ enriched progenitor populations specimens with the likelihood for purging to PCR negativity being high if the level of contamination present in clinical samples is less than 1 : 10 .
  • Contamination of non-mobilized patient apheresis fractions with Ewing's Sarcoma is between 1 :10 s -1 : 10 6 .
  • Patient C (bottom panel) showed a level of contamination between 1 : 10 and 1 : 10 in multiple fractions. In no instance have we observed levels of contamination greater than 1 : 10 . Therefore, because clinical specimens contaminated with Ewing's sarcoma appears to be in the range of 1 : 10 ⁇ - 1 ; 10 ,
  • Table 1 Contamination of non- mobilized apheresis fractions with Ewing's sarcoma as analyzed by conventional PCR.
  • T cell proliferation is unchanged before and after purging.
  • T cells can contribute to post chemotherapy immune reconstitution ⁇
  • 10 we are currently utilizing autologous T cell infusions harvested prior to initiation of chemotherapy in order to study effects on immune reconstitution.
  • T cell proliferation following anti-CD3 cross linking was evaluated as a measure of T cell function.
  • An ideal purging method should target only tumor cells and show no binding to nomial cell populations.
  • the identification of such a tumor specific antigen has historically posed a challenge in Ewing's sarcoma. While CD99 typically shows high expression on Ewing's sarcoma cells, it is also expressed on T cells (figure 2a) and CD 34 stem cells ⁇ , making it unsuitable for purging hema-o-ogic products.
  • Monoclonal antibody 8H9 was initially developed due to its reactivity with neuroblastoma and was subsequently reported to react with 19/19 fresh Ewing's sarcoma/PNET tumor confirming that 8H9 reactivity is not limited to established cell lines.
  • Ewing's sarcoma cells derived from apheresis or bone marrow samples in patients with metastatic disease which are positively selected and grown in culture could provide a ready source of tumor samples for further biologic study.
  • RT-PCR is a powerfully sensitive tool for use in monitoring minimal residual disease MRD- ⁇ O. It remains unclear, however, whether evidence of small amounts of residual tumor by molecular analysis is predictive for relapse in solid tumors and data in the literature is conflicting, de Alava et al. evaluated MRD in Ewing's sarcoma patients and showed a correlation between PCR positivity and disease relapse, hi this report however, some patients remained
  • Real-time quantitative PCR has been used as a tool to monitor MRD in leukemia patients 31. 32 an rJ may be useful in evaluation of disease response 33 a ⁇ in predicting relapse in patients by the detection of increasing levels of tumor specific transcript. This is the first report of the use of real-time quantitative PCR used to detect and quantify Ewing's sarcoma transcript. It is possible that quantitative PCR could allow for further identification of patients with a high risk of relapse by detection of increasing amounts of Ewing's transcripts over time.
  • the sensitivity of this analysis must be very high in order to allow for the detection of very low levels of circulating tiimor in patients with solid tumors.
  • the level of sensitivity of our technique reached 1 Ewing's sarcoma cell in 10 6 normal cells with nested PCR from 10 X10 6 cells. It is possible that the level of sensitivity would be even higher if higher cell numbers were evaluated since this method appears capable in our hands of amplifying product from 10 contaminating cells.
  • Tumor enrichment using positive selection is another method to increase sensitivity of tumor detection.
  • the positive ininiuno agnetic selection procedure described in this paper for purging could also provide a suitable approach for tumor enrichment in for monitoring MRD or even in contributing to making the correct diagnosis at the time of initial presentation with metastatic disease.
  • cells eluted from the column were positive by PCR analysis, demonstrating the feasibility of this technique for tumor enrichment which would be predicted to increase the sensitivity of PCR detection of contaminating Ewing's sarcoma in patient samples.
  • the quantitative technique relies on the assumption that the level of expression of t (1 1 ;22) is consistent among cell lines and patient samples. This, may not be the case, however, and may lead to under or over estimation of the absolute level of tumor burden when comparing patient samples to a standard curve. Such limitations would not preclude evaluation of changes in the level of PCR positivity of an individual patient over time, wherein substantial changes in the level of expression of t(l 1 ;22) may be less likely.
  • Dyson PG Horvath N, Joshua D, et al. CD34+ selection of autologous peripheral blood stem cells for transplantation following sequential cycles of high-dose therapy and mobilisation in multiple myeloma [In Process Citation]. Bone Marrow Transplant. 2000;25: 1 175-84.
  • Ewing's sarcoma is a childhood tumor characterized by a t( 1 1 ,22) in most patients Because survival remains suboptimal with standard therapy, many patients receive autologous stem cell transplant and trials investigating adoptive transfer of autologous T cells in the context of immune therapy are underway. However, approximately 50% of patiens with advanced disease have PCR detectable disease in peripheral blood and/or bone marrow and administration of contaminated auologous cell preparations may contribute to disease relapse. To date, there is no reported method for purging contaminated hematopoietic cell populations of Ewing's Sarcoma.
  • 8H9 is a mouse monoclonal IgG l antibody previously reported to react with 21/21 Ewing's sarcoma/PNET tumors (Proc ASCO 17:44a, 1998).
  • Peripheral blood T cell and B cell populations and CD34+ cells from bone marrow analyzed by flow cytonietry for binding of 8H9 were negative.
  • Using real-time quantitative nested PCR with Lightcycler we monitored purging efficiency by evaluation of 1(1 1 ,22) by RT-PCR.
  • Desmoplastic small round cell tumor is an aggressive, often misdiagnosed neoplasm of children and young adults. It is chemotherapy- sensitive, yet patients often relapse off therapy because of residual 5 microscopic disease at distant sites: peritoneum, liver, lymph node and lung.
  • MRD minimal residual disease
  • GD2 is a disialoganglioside which is widely expressed among neuroectodemial tumors as well as adult sarcomas.
  • 8H9 recognizes a surface 58kD antigen expressed among neuroectodennal
  • DRCT Desmoplastic small round cell tumor
  • DSRCT is associated with a specific chromosomal translocation
  • the fused gene product aligns the NH2 terminal domain of the EWS gene to the zinc finger DNA-binding domain of the WT 1 gene and is diagnostic of DSRCT (Ladanyi et al., 1994). This fusion results in the induction of endogenous platelet derived growth factor-A which stimulates fibroblast growth and may contribute to the unique fibrosis observed with this
  • the murine IgG 3 monoclonal antibody 3F8 was purified from ascites as previously described (Cheung et al., 1985). Using a similar technique, female BALB/c mice were hyperimmunized with human neuroblastoma.
  • Lymphocytes derived from these mice were fused with SP2/0 mouse myeloma cells line. Clones were selected for specific binding on ELISA. The 8H9 hybridoma secreting an IgGi monoclonal antibody was selected. 8H9 was produced in vitro and purified by protein G (Pharmacia, Piscataway, NJ) affinity chromatography.
  • Sections were incubated with a secondary horse anti-mouse biotinylated antibody (Vector Laboratories, Burlingame, CA) followed by incubation with ABC complex (Vector Laboratories, Burlingame, CA) and stained with Vector VIP peroxidase substrate (Vector Laboratories, Burlingame, CA) or DAB peroxidase substrate kit (Vector Laboratories, Burlingame, CA). A 10% hematoxylin counterstain for 2 minutes was used. Staining was graded as positive or negative and homogenous or heterogenous reactivity noted.
  • DSRCT is characterized by the coexpression of epithelial, mesenchymal and 25 neuroectodemial markers. Recent publications have defined the immunohistochemical and molecular make-up of DSRCT (Ordonez, 1998; Gerald, 1999). However, most of the markets identified cannot be used as targets for antibody mediated immunotherapy either due to crossreactivity with normal tissues or inaccessibility to monoclonal antibodies due to
  • DSRCT 108 localization in the nucleus or cytoplasm.
  • the most commonly expressed markers on DSRCT including desmin, cytokeratin, vimentin, epithelial membrane antigen and neuron-specific enolase are also widely expressed on normal tissues.
  • the MIC2 antigen has been reported to be expressed on 20-35% of DSRCT.
  • immunoreactivity in DSRCT is primarily cytoplasmic (Gerald et al, 1998).
  • MOC31 a monoclonal antibody that recognizes epithelial glycoprotein 2 (EGP-2) has been shown to be reactive with most DSRCT tested (Ordonez, 1998).
  • EGP-2 is overexpressed on epithelial tumors, but is also present on normal epithelial cells (de Leij et al, 1994).
  • Antibodies directed against the WT1 protein have strong, specific, nuclear immunoreactivity with almost all DSRCT tested (Gerald et al, 1998) Table 3: Previously reported antigens on DSRCT
  • Endothelial cells Endothelial cells, hematopoeitic cells
  • Serum GD 2 does not interfere with the biodistribution of specific antibodies and the antigen is not modulated from the cell surface upon binding by antibodies.
  • Successful targeting of the monoclonal antibody 3F8 to GD2 was previously demonstrated in neuroblastoma (Yeh et al., 1991 ) and small cell lung cancer (Grant et al., 1996).
  • 3F8 has also shown efficacy in clinical trials in patients with neuroblastoma (Cheung et al., 1998b) and melanoma (Cheung et al, 1987). Furthermore, 3F8 appeared to induce long-term remissions in patients with Stage 4 neuroblastonia. Reported side effects are short-lived and manageable (Cheung et al., 1998).
  • DSRCT may be a putative tumor for in vivo antibody targeting with 3F8.
  • an anti-idiotypic vaccine approach can be utilized as has been suggested for neuroblastoma. (Cheung et al, 1994)
  • the monoclonal antibody 8H9 is a murine IgG] derived from mice immunized with neuroblastoma. It has been shown to have a broad expression on neuroectodemial, mesenchymal and epithelial tumors with limited expression on normal tissues, (data not shown), Its immunoreactive profile led us to use it for testing DSRCT. 95%, of tumors tested positive with DSRCT. Immunoreactivity with DSRCT was localized to the stroma and cell membrane ( Figure 2) and for most tumors was intense and homogeneous, and in general, stronger than that observed for GD2 (Table 2).
  • the target antigen for 8H9 appears to be a novel 58kD glycoprotein with a unique distribution on cell membranes of tumors of varying lineage, but restricted expression in normal tissues. This tissue distribution makes it likely to be a unique antigen not previously described on DSRCT.
  • the cell membrane localization of 8H9 allows it to be targeted by monoclonal antibodies.
  • 8H9 conjugated with I 131 has been shown to radioininiunolocalize neuroblastoma and rhabdomyosarcoma xenografts in mice without significant ciossreactivity with other organs, (data not shown).
  • ScFv provides a versatile homing unit for novel antibody-fusion constructs.
  • a reliable screening and binding assay is often the limiting step for antigens that are difficult to clone or purify.
  • anti- idiotypic antibodies can be used as surrogate antigens for cloning scFv and their fusion proteins.
  • 8H9 is a murine IgG l monoclonal antibody specific for a novel antigen expressed on the cell surface of a wide spectrum of human solid tumors but not in non al tissues (Cancer Res 61 :4048,2001 )
  • Rat anti- 8H9-idiotypic hybridomas (clones 2E9, 1 E12 and 1 F1 1) were produced by somatic cell fusion between rat lymphocytes and mouse SP2/0 myeloma. In direct binding assays (ELISA) they were specific for the 8H9 idiotope.
  • 2E9 as the surrogate antigen
  • 8H9-scFv was cloned from hybridoma cDNA by phage display.
  • 8H9scFv was then fused to human- 1 -CH2-CH3 cDNA for transduction into CHO and NSO cells.
  • High expressors of mouse scFv-human Fc chimeric antibody were selected.
  • the secreted homodimer reacted specifically with antigen-positive tumor cells by ELISA and by flow cytometry, inhibitable by the anti-idiotypic antibody.
  • the reduced size resulted in a shorter half-life in vivo, while achieving comparable tumor to nontunior ratio as the native antibody 8H9.
  • it Gould not mediate antibody-dependent cell-mediated or complement-mediated cytotoxicities in vitro.
  • scFv can now be cloned from cDNA libraries derived from rodents, immunized volunteers, or patients (Burton and Barbas III, 1994; Winter et al., 1994; Cai and Garen, 1995; Raag and Whitlow, 1995).
  • scFv is the critical first step in the synthesis of various fusion proteins, including scFv-cytokine (Shu et al., 1993), scFv-streptavidin (Kipriyanov et al., 1995), scFv-enzyme (Michael et al., 1996), scFv-toxins
  • ScFv-Ig constructs mimic natural IgG molecules in their homodimerization through the Fc region, as well as their ability to activate complement (CMC) and mediate antibody dependent cell-mediated cytotoxicites (ADCC).
  • SGFV SGFV
  • a reliable antigen preparation both for panning pliages and for binding assays. They often become a rate-limiting step (Lu and Sloan, 1999), particularly for antigens that are difficult to clone or purify.
  • Cell-based phage display (Watters et al., 1997), and enzyme linked immunosorbent assays (ELISA) when optimized, have been successfully applied as alternatives.
  • ELISA enzyme linked immunosorbent assays
  • a reduction in wash pFI is needed for scFv directed at ganglioside GD2 in order to reduce nonspecific adherence of phage particles (Tur et al., 2001).
  • phage binding assay may require membrane preparations to withstand the vigorous washing procedure.
  • Anti-idiotypic antibodies are frequently used as antigen mimics of infectious agents and tumor antigens (Thanavala et ah, 1986; Wagner et al., 1997). When made as MoAb, they are ideal sunOgates when the target antigen is not readily available.
  • the physico-chemical behavior of immunoglobulins as antigens in panning and binding assays is generally known and can be easily standardized.
  • We recently described a novel tumor antigen reactive with a murine MoAb 8H9 Given its lability and glycosylation, this antigen is difficult to purify.
  • an anti-idiotypic antibody as a surrogate antigen for cloning a scFv derived from the 8H9 hybridoma cDNA library, and for the selection of chimeriG mouse scFv- human Fc fusion constructs.
  • mice were purchased from Jackson Laboratories, Bar Harbor, ME.
  • Lou/CN rats were obtained from the National Cancer Institute-Frederick Cancer Center (Bethesda, MD) and maintained in ventilated cages. Experiments were carried out under a protocol approved by the Institutional Animal Care and Use Committee, and guidelines for the proper and humane use of animals in research were followed.
  • Human neuroblastoma cell lines LAN-1 was provided by Dr. Robert Seeger (Children's Hospital of Los Angeles, Los Angeles, CA), and NMB7 by Dr. Shuen-Kuei Liao (McMaster University, Ontario, Canada). Cell lines were cultured in 10% defined calf serum (Hyclone, Logan, UT) in RPMl with 2 mM L-glutamine, 100 U/ml of penicillin (Sigma-Aldrich, St. Louis, MO), 100 ug/ml of streptomycin (Sigma-Aldrich), 5% CO? in a 37°C humidified incubator.
  • Nonnal human mononuclear cells were prepared from heparinized bone marrow samples by centrifugation across a Ficoll-Hypaquc density separation gradient Human AB serum (Gemini Bioproducts, Woodland, CA) was used as the source of human complement.
  • MoAb R24 (anti-GD3), V 1-R24, and K9 (anti-GD3) were gifts from Dr. A. Houghton, OKB7 and M l 95 (anti- CD33) from Dr. D. Scheinberg, and 10-1 1 (anti-GM2) from Dr. P. Livingston of Memorial Sloan Kettering Cancer Center, New York; and 528 (EGF-R) from Dr. J. Mendelsohn of MD Anderson, Houston, TX. 2E6 (rat anti-mouse IgG3) was obtained from hybridomas purchased from American Type Culture
  • NR-Co-04 was provided by Genetics Institute (Cambridge, MA). In our laboratory, 5F9, 8H9, 3A5, 3E7, 1 D7, 1 A7 were produced against human neuroblastoma; 2C9, 2E10 and 3E6 against human breast carcinoma, and 4B6 against glioblastoma multifonne. They were all purified by protein A or protein G (Pharmacia, Piscataway, NJ) affinity chromatography. 2.4 Anti-8H9 anti-idiotypic antibodies
  • LOU/CN rats were immunized intraperitoneally (ip) with 8H9 (400 ug per rat) complexed with rabbit anti-rat serum (in 0. 15 ml), and emulsified with an equal volume (0.15 ml) of Complete Freund's Adjuvant (CFA) (Gibco-BRL,
  • the 8H9-rabbit-IgG complex was prepared by mixing 2 ml (8 mg) of purified 8H9 with 4 ml of a high titer rabbit anti-rat precipitating serum (Jackson I munoresearch Laboratories, West Grove, PA). After incubation at 4°C for 3 hours, the precipitate was isolated by centrifugation at 2500 rpm for 10 minutes, and resuspended in PBS. Three months after primary immunization, the rats were boosted ip with the same antigen in CFA. One month later, a 400 ug boost of 8H9-rabbit-anti-mouse complex was injected intravenously.
  • rat spleen was lemoved ascptically, and purified lymphocytes were hybridized with SP2/0-A l4 (ATCC). Clones selection was based on specific binding to 8H9 and not to control antibody 5F9, a murine IgG l . Repeated subcloning using limiting dilution was done. Isotypes of the rat monoclonal antibodies were determined by Monoclonal Typing Kit (Sigma-Aldrich).
  • Rat anti-idiotypic antibody clones (2E9, 1 E12, I F l l ) were chosen and produced by high density miniPERM bioreactor (Unisyn technologies, Hopkinton, MA), and purified by protein G affinity chromatography (Hitrap G, Pharmacia). The IgG fraction was eluted with pH 2.1 glycine-HCl buffer and neutralized with 1 M Tris buffer pH 9. After dialysis in PBS at 4°C for 18 hours, the purified antibody was filtered through a 0.2 um millipore filter (Millipore, Bedford, MA), and stored frozen at -70°C. Purity was determined by SDS-PAGE electrophoresis using 7.5% acrylamide gel.
  • the "standard” ELISA to detect rat anti-idiotypic antibodies was as follows: Purified 8H9, or irrelevant IgG l myeloma, were diluted to 5 ug/ml in
  • PBS and 50 ul per well was added to 96-well flat-bottomed polyvinylchloride (PVC) microtiter plates and incubated for 1 hour at 37°C. Rows with no antigen were used for background subtraction.
  • Filler protein was 0.5% BSA in PBS and was added at 100 ul per well, and incubated for 30 minutes at 4°C. After washing, 50 ul duplicates of hybridoma supernatant was added to the antigen-coated wells and incubated for 3 hours at 37°C. The plates were washed and a peroxidase-conjugated mouse anti-rat IgG + IgM (Jackson Immunoresearch Laboratory) at 100 ul per well was allowed to react for 1 hour at 4°C.
  • the plate was developed using the substrate o-phenylenediamine (Sigma-Aldrich) (0.5 mg/ml) and hydrogen peroxide (0.03%)) in 0, 1 M citrate phosphate buffer at pH 5. After 30 minutes in the dark, the reaction was quenched with 30 ul of 5 N sulfuric acid and read using an ELISA plate reader. 2.5 Specificity by direct binding assay
  • Poly(A)-RNA was purified by a single fractionation over oligo (dT)-cellulose and eluted from oligo (dT) cellulose in the elution buffer.
  • the mRNA sample was precipitated for 1 hour with 100 ug glycogen, 40 ul of 2M potassium acetate solution and 1 ml of absolute ethanol at -20"C.
  • the nucleic acid was recovered by cenfrifugation at 10,000 xg for 30 min. The sample was evaporated until diy, and dissolved in 20ul RNase-free water.
  • ScFv gene was constructed by recombinant phage display. 5ul of mRNA was reversely transcribed in a total volume of 1 1 ul reaction mixture and 1 ul dithiothreitol (DTT) solution for 1 hour at 37°C.
  • DTT dithiothreitol
  • PCR cycle consisted of a 1 min denaturation step at 94°C, a 2 min annealing step at 55°C and a 2 min extension step at 72°C. After 30 cycles of amplification, PCR derived fragment was purified by the glassmilk beads (BiolOl, Vista, CA) and then separated by 1.5% agarose gel electrophoresis in TAB buffer and detected by ethidium bromide staining.
  • both purified heavy chain and light diain fragments were added to an appropriate PCR mixture containing a 15 amino acid linker-primer for 8H9, dNTPs, PCR buffer and Anipli Taq Gold DNA polymerase. PCR reactions were performed at 94°C for 1 min, followed by a 4 min annealing reaction at 63°C. The heavy and light chain DNA of 8H9 were joined by the linker (GGGS) 3 (Pharmacia) into scFv in a VH-VL orientation after 7 thermocycles.
  • GGGS linker
  • Flelper phage Ml 3 K07 (Pharmacia) was added to rescue the recombinant phagemid.
  • Antigen-positive recombinant phage captured by the anti-idiotype MoAb 2E9 was eluted with 0.1 M glycine-HCl (pH 2.2 containing 0.1 % BSA) and neutralized with 2M Tris solution. This panning procedure was repeated three times. The phagemid 8FIpHM9F7-l was chosen for the rest of the experiments.
  • the selected phage was used to reinfeGt E.coli XL 1 -Blue cells, Colonies were grown in 2xYT medium containing ampicillin ( l OOug/ml) and 1 %> glucose at
  • a single gene encoding scFv8FI9 was generated by PCR method using phagemid 8HpHM9F7-l as the template, Secondary PCR amplification (30 PCR cycles) was carried out to insert the human IgGl leader sequence at the 5'end of the scFv8H9 DNA plus the restriction sites at the two opposite ends, i.e. Hind III and Not I, at the 5' end of human IgG l leader and at the 3' end of scFv8H9, respectively.
  • Amplified human IgGl leader - scFv8H9 DNA was purified by glassmilk beads and digested with Hind III and Not I restriction endonucleases according to manufacturer's instructions.
  • the Hind III - Not I fragment of human IgG 1 leader-scFv8H9 cDNA was purified on agarose gel and ligated into pLNCS23 vector carrying the human- ⁇ l -CH2-CH3 gene (kindly provided by Dr. J. Schlom, National Cancer Institute, NIH, Bethesda, MD) (Shu et al, 1993). Competent E.coli XL 1-Blue cells were transformed with pLNCS23 containing the scFv phagemid. The scFv-CH2-CH3 DNA was primed with appropriate primers and sequenced using the Automated
  • CHO cell or NSO myelomas cells (Lonza Biologies PLC, Bershire, UK) were cultured in RPMl 1640 (Gibco-BRL) supplemented with glutamine, penicillin, streptomycin (Gibco-BRL) and 10% fetal bovine serum (Gibco-BRL).
  • RPMl 1640 Gibco-BRL
  • effectene ti-ansfection reagent Qiagen, Valencia, CA
  • SoFv8H9-human- l -CH2-CH3 was introduced via the pLNCS23 into CHO cell or NSO myelomas cells. Cells were fed every 3 days, and G418 (1 mg/ml; Gibco-BRL) resistant clones were selected.
  • chimeric antibodies were produced by high density miniPERM bioreactor from Unisyn Technologies using 0.5% ULG-FBS in Hydridoma-SFM (Invitrogen Corporation, Carlsbad, CA). The chimeric antibodies were purified by protein G (Pharmacia) affinity chromatography. 2.12 SDS-PAGE and Western Blot Analysis
  • Target NMB7 or LAN- 1 tumor cells were labeled with Na Cr0 4 (Amersham Phannacia) at 100 uCi/l O'' cells at 37 n C for 1 hour, After the cells ere washed, loosely bound 51 Cr was leaked for 1 hour at 37"C. After further washing, 5000 target cells/well were admixed with lymphocytes to a final volume of 200 ⁇ l/well.
  • Antibody dependent cell-mediated cytotoxicity (ADCC) was assayed in the presence of increasing concentrations of chimeric antibody.
  • ADCC antibody dependent cell-mediated cytotoxicity
  • CMC complement mediated cytotoxicity
  • human complement at 1 :5, 1 :15 and 1 :45 final dilution
  • MoAb was reacted for 5 min with 125 I (NEN Life Sciences, Boston, MA ) and chloramine T (1 mg/ml in 0.3M Phosphate buffer, pH 7.2) at room temperature. The reaction was terminated by adding sodium metabisulfite (1 mg/ml in 0.3M Phosphate buffer, pH 7.2) for 2 min. Free iodine was removed with A1 GX8 resin (BioRad, Richmond, CA) saturated with 1 % HSA (New York Blood Center Inc., New York, NY) in PBS, pH 7.4. Radioactive peak was collected and radioactivity (niCi/ml) was measured using a radioisotope calibrator (Squibb, Princeton, NJ). Iodine incorporation and specific activities were calculated. Trichloroacetic acid (TCA) (Fisher Scientific) precipitable activity was generally >90%.
  • mice were purchased from NCI, Frederick MD. They were xenografted subcutaneously with LAN-1 neuroblastoma cell line (2x 10° cells/mouse) suspended in 100 ul of Matiigel (Beckton-Dickinson
  • mice bearing tumors of l-1.5cm in longest dimension were selected.
  • Animals were injected intravenously (retrorbital plexus) with 20 ⁇ Ci of I labeled antibody. They were anesthesized with ketamine (Fort Dodge Animal Health, Fort Dodge, PA) intraperitoneally and imaged at various time intervals with a gamma camera (ADAC, Milpitas, CA) equipped with grid collimators. Serial blood samples were collected at 5 min, 1, 2, 4,8,18,24,48,72, 120h from mice injected with 10-1 1 uCi I labeled antibody.
  • mice were sacrificed at 24h, 48h, and 120h and samples of blood (cardiac sampling), heart, lung, liver, kidney, spleen, stomach, adrenal, small bowel, large bowel, spine, femur, muscle, skin, brain and tumor were weighed and radioactivity measured by a gamma counter. Results were expressed as percent injected dose per gram. Animal experiments were earned out under an IACUC approved protocol, and institutional guidelines for the proper and humane use of animals in research were followed.
  • Rat hybridomas specific for 8H9 and nonreactive with control murine IgG l were selected. After subcloning by limiting dilution, rat antibodies were produced by bulk culture in roller bottles and purified by protein G affinity column. By ELISA, 2E9, 1 E12, and I F l l , all of rat subclass IgG2a, were specific for 8H9, while nonreactive with a large panel of purified monoclonal antibodies (Table I). In contrast, the antibodies 3C2, 4C2 5C7, 7D6 and 8E12 from the same fusions were not specific for 8H9. The rest of the experiments in this study was carried out using antibody 2E9.
  • scFv and scFv-fusion proteins can be conveniently produced.
  • anti-idiotypic antibody to clone scFv from the murine hybridoma cDNA library.
  • the anti-idiotypic antibody was then used to select for scFv-Fc chimeric antibodies, Both the scFv and scFv-Fc fusion protein derived by our method were specific for the natural antigen, comparable to the native antibody 8H9.
  • the SGFV-FG fusion protein could only mediate ADCC poorly and not CMC at all.
  • scFv provides the building block for scFv- usion proteins, it is not the ideal targeting agent by itself. Being a small protein, its clearance is rapid. Moieovcr, it is often retained by the kidney, delivering undesirable side effects if the scFv construct is cytotoxic. Since avidity is a key parameter in tumor targeting in vivo, its biggest limitation is its uni-valcncy and often suboptimal 0 affinity for the antigen. By using VH-VL linkers of decreasing length, spontaneous dimeric, ti ⁇ mcric and polymeric scFv have been produced. However, these oligomers are not bonded by covalcnt linkage, and may dissociate in vivo.
  • Tetravalent scFv (monospecific or bispecific) are natural extensions of the diabody approach to scFv-Fc fusion strategy (Alt et al., 1999; Santos et al., 1999), where a significant increase in avidity can be achieved. More recently, scFv-streptavidin fusion protein has been produced for pretargeted lymphoma therapy (Schultz et al., 2000). Here scFv-streptavidin forms natural tetramers, to which biotinyated ligands can bind with high affinity.
  • Anti-idiotypic antibodies have greatly facilitated clone selection in the construction of soluble scFv-fusion proteins or cell bound surface scFv.
  • We have successfully applied similar technology to anti-GD2 monoclonal antibodies (Cheung et al., 1993). Being iminunoglobulins, their structure, stability, biochemistry, are generally known. Unlike natural antigens where each individual system has its unique and difficult to predict properties. As surrogate antigens, anti-idiotypic antibodies are ideal for standardization and quality control, especially for initial clinical investigations where the nature of the antigen is not fully understood. Potential limitations exist for the anti- idiotype approach. Only those anti-ids (Ab2) that recognize the antigen- binding site of the immunizing MoAb can mimic the original antigen.
  • a reliable test for Ab2 is its ability to induce an antigen-specifiG immune response.
  • antigen specificity of the scFv selected by the anti- idiotype must be validated by binding to cells or membrane picparations. Once validated, the anti-idiotype can be used as antigen surrogate for cloning and assay of other SGFv-fusion proteins.
  • both cell lines may be lacking in the Gnlll enzyme. It is also possible that the absence of the CHI domain in the Fc may modify the accessability of the ASN297 residue to glycosyltransferases in some scFv-Fc constructs such as ours (Wright and Morrison, 1997). On the other hand, an scFv-Fc that lacks binding to Fc receptor may have less nonspecific binding to white cells, thereby decreasing blood pooling in targeted therapy. These findings may have implications in scFv-Fc strategies to improve effector functions.
  • Anti-melanoma antibodies from melanoma patients immunized with genetically modified autologous tumor cells selection of specific antibodies from single-chain Fv fusion phage libraries.
  • America 92, 6537-41 America 92, 6537-41 .
  • Hybridomas 6, 93-101 Hybridomas 6, 93-101.
  • CIR Chimeric immune receptors
  • scFv single chain antibody Fv
  • MoAb 8H9 The murine monoclonal antibody 8H9 reacts with a novel antigen widely expressed on solid tumors (Cancer
  • Rat anti-idiotypic MoAb 2E9 (IgG2a) was used as an antigen surrogate for initial cloning of 8H9scFv from the hybridoma cDNA library.
  • a CIR consisting of human CD8-leader sequence, 8H9scFv, CD28
  • Anti-idiotypic antibody may provide a useful tool, especially for carbohydrate or unstable antigens, in facilitating the cloning of scFv and their CIR fusion constructs, as well as their transduction into human lymphocytes.
  • T-cells proliferate when activated (e.g. anti-CD3) but apoptosc unless a costimulatory signal (e.g. anti-CD28) is provided (1 ).
  • a costimulatory signal e.g. anti-CD28
  • human tumor targets often lack costimulatory molecules (e.g. CD80), or overstimulate inhibitory receptors (e.g. CTL4) such that the CD28 pathway is derailed.
  • T-cell receptor TCR
  • CIR chimeric immune receptors linking tumor-selective scFv to T-cell signal transduction molecules (e.g. TCR-zeta chain and CD28) will activate lymphocytes following tumor recognition, triggering the production of cytokines and tumor lysis (2-7).
  • T-cell can also be genetically engineered to secrete cytotoxic cytokines (8), toxins (9) or to metabolize prodrugs (10, 1 1 ).
  • anti-linker antibody may be useful, although its efficiency depends on the accessibility of the scFv-linker portion.
  • purified antigens can also be used to monitor scFv expression, certain classes (complex carbohydrates or unstable antigens) can be difficult to prepare and their chemistry highly variable. Without a standardized reagent for affinity purification or enrichment of virus producer cells, monitoring and sorting of transduced lymphocytes, CIR technology remains inefficient.
  • Eshhar et al described a dicistronic construct consisting of scFv-
  • GFP green fluorescent protein
  • Anti-idiotypic antibodies are frequently used as antigen-mimics for infectious diseases and cancer ( 14, 15). Internal image rat anti-idiotypic antibodies can be conveniently produced against mouse MoAb. Since large scale production of clinical grade MoAb is now routine, anti-idiotypic antibodies may be ideal surrogates especially if the antigen is not easily available. In addition, the biochemistry of immunoglobulins in positive selection (panning, affinity chromatography, sorting) and binding assays is well-known and is easy to standardize. We recently described a novel tumor antigen reactive with a murine MoAb 8H9 ( 16). The antigen was difficult to purify given its lability and glycosylation.
  • anti-idiotypic MoAb can be used as surrogate antigens for cloning CIR into lymphocytes, i.e. a CIR of 8FI9scFv, human CD28 and human TCR-zeta chain.
  • Anti-idiotypic MoAb allows rapid affinity enrichment of producer cell line, monitoring of scFv expression on cells, and in vitro clonal expansion of transduced lymphocytes. Highly cytotoxic lymphocytes, both in vitro and in vivo, can be produced in bulk. Besides providing an antigen surrogate, anti-idiotypic MoAb appears to have utility for the optimization and quality control of scFv-based gene therapies.

Abstract

Cette invention concerne une composition contenant une dose efficace d'anticorps monoclonal 8H9 ou d'un dérivé de celui-ci et un excipient approprié. Cette invention concerne une composition pharmaceutique contenant une dose efficace d'un anticorps monoclonal 8H9 ou d'un dérivé de celui-ci et un excipient pharmaceutiquement acceptable. Cette invention concerne également un anticorps autre que l'anticorps monoclonal 8H9 contenant les régions déterminantes complémentaires de l'anticorps monoclonal 8H9 ou d'un dérivé de celui-ci, capables de se fixer au même antigène que l'anticorps monoclonal 8H9. Cette invention concerne également une substance capable d'inhiber par compétition la fixation de l'anticorps monoclonal 8H9. De plus, cette invention concerne un scFv isolé d'anticorps monoclonal 8H9 ou d'un dérivé de celui-ci. L'invention a également trait à l'antigène 8H9. En outre, l'invention a trait à une méthode d'inhibition de la croissance de cellules tumorales consistant à mettre lesdites cellules tumorales en contact avec une dose appropriée d'un anticorps monoclonal 8H9 ou d'un dérivé de celui-ci.
PCT/US2001/032565 2000-10-18 2001-10-18 Utilisations d'anticorps monoclonal 8h9 WO2002032375A2 (fr)

Priority Applications (17)

Application Number Priority Date Filing Date Title
CA002423843A CA2423843A1 (fr) 2000-10-18 2001-10-18 Utilisations d'anticorps monoclonal 8h9
AU2002215383A AU2002215383A1 (en) 2000-10-18 2001-10-18 Uses of monoclonal antibody 8h9
EP01983999A EP1399187A4 (fr) 2000-10-18 2001-10-18 Utilisations d'anticorps monoclonal 8h9
US10/097,558 US7737258B2 (en) 2000-10-18 2002-03-08 Uses of monoclonal antibody 8H9
EP02801782A EP1441765A4 (fr) 2001-10-17 2002-10-17 Procede de preparation d'anticorps monocatenaires
CA2463017A CA2463017C (fr) 2001-10-17 2002-10-17 Procede de preparation d'anticorps monocatenaires
PCT/US2002/033331 WO2003033670A2 (fr) 2001-10-17 2002-10-17 Procede de preparation d'anticorps monocatenaires
AU2002362846A AU2002362846A1 (en) 2001-10-17 2002-10-17 Method for preparation of single chain antibodies
US10/273,762 US7666424B2 (en) 2001-10-17 2002-10-17 Methods of preparing and using single chain anti-tumor antibodies
US10/505,658 US7740845B2 (en) 2000-10-18 2003-03-06 Uses of monoclonal antibody 8H9
US12/709,848 US8148154B2 (en) 2001-10-17 2010-02-22 Method for preparation of single chain antibodies
US12/721,798 US8414892B2 (en) 2000-10-18 2010-03-11 Uses of monoclonal antibody 8H9
US12/797,081 US8501471B2 (en) 2000-10-18 2010-06-09 Uses of monoclonal antibody 8H9
US13/858,234 US9062110B2 (en) 2000-10-18 2013-04-08 Uses of monoclonial antibody 8H9
US13/958,902 US20140161814A1 (en) 2000-10-18 2013-08-05 Uses of monoclonal antibody 8h9
US15/365,803 US9938351B2 (en) 2000-10-18 2016-11-30 Uses of monoclonal antibody 8H9
US15/899,801 US20180208673A1 (en) 2000-10-18 2018-02-20 Uses of monoclonal antibody 8h9

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US24134400P 2000-10-18 2000-10-18
US60/241,344 2000-10-18
US33039601P 2001-10-17 2001-10-17
US60/330,396 2001-10-17

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/982,645 Continuation-In-Part US20020102264A1 (en) 2000-10-18 2001-10-18 Uses of monoclonal antibody 8H9

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10/097,558 Continuation-In-Part US7737258B2 (en) 2000-10-18 2002-03-08 Uses of monoclonal antibody 8H9
US10/273,762 Continuation-In-Part US7666424B2 (en) 2000-10-18 2002-10-17 Methods of preparing and using single chain anti-tumor antibodies

Publications (4)

Publication Number Publication Date
WO2002032375A2 true WO2002032375A2 (fr) 2002-04-25
WO2002032375A3 WO2002032375A3 (fr) 2002-06-20
WO2002032375A8 WO2002032375A8 (fr) 2002-09-12
WO2002032375A9 WO2002032375A9 (fr) 2003-01-03

Family

ID=26934217

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/032565 WO2002032375A2 (fr) 2000-10-18 2001-10-18 Utilisations d'anticorps monoclonal 8h9

Country Status (3)

Country Link
EP (1) EP1399187A4 (fr)
CA (1) CA2423843A1 (fr)
WO (1) WO2002032375A2 (fr)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003099868A3 (fr) * 2002-05-28 2004-01-15 Omrix Biopharmaceuticals Inc Methode pour obtenir des anticorps anti-idiotype
EP1441765A2 (fr) * 2001-10-17 2004-08-04 Sloan-Kettering Institute For Cancer Research Procede de preparation d'anticorps monocatenaires
EP1567556A2 (fr) * 2002-12-02 2005-08-31 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Immunotoxine recombinante et son utilisation dans le traitement de tumeurs
US6987270B2 (en) 2003-05-07 2006-01-17 General Electric Company Method to account for event losses due to positron range in positron emission tomography and assay of positron-emitting isotopes
US7666424B2 (en) 2001-10-17 2010-02-23 Sloan-Kettering Institute For Cancer Research Methods of preparing and using single chain anti-tumor antibodies
US7732131B2 (en) 2004-08-03 2010-06-08 Innate Pharma S.A. Therapeutic and diagnostic methods and compositions targeting 4Ig-B7-H3 and its counterpart NK cell receptor
WO2011109400A2 (fr) 2010-03-04 2011-09-09 Macrogenics,Inc. Anticorps réagissant avec b7-h3, fragments immunologiquement actifs associés et utilisations associées
US8779098B2 (en) 2002-06-19 2014-07-15 Macrogenics West, Inc. B7-H3L cell surface antigen and antibodies that bind thereto
US8840889B2 (en) 2009-08-13 2014-09-23 The Johns Hopkins University Methods of modulating immune function
WO2017180813A1 (fr) 2016-04-15 2017-10-19 Macrogenics, Inc. Nouvelles molécules de liaison à b7-h3, leurs conjugués anticorps-médicaments et leurs procédés d'utilisation
US9896508B2 (en) 2010-03-04 2018-02-20 Macrogenics, Inc. Antibodies reactive with B7-H3 and uses thereof
US9963509B2 (en) 2014-12-23 2018-05-08 Full Spectrum Genetics, Inc. Anti-B7H3 binding compounds and uses thereof
US10100115B2 (en) 2014-02-14 2018-10-16 Macrogenics, Inc. Methods for the treatment of vascularizing cancers
WO2019241730A2 (fr) 2018-06-15 2019-12-19 Flagship Pioneering Innovations V, Inc. Augmentation de l'activité immunitaire par modulation de facteurs de signalisation post-cellulaires
WO2020227159A2 (fr) 2019-05-03 2020-11-12 Flagship Pioneering Innovations V, Inc. Métodes de modulation de l'activité immunitaire
US10865245B2 (en) 2014-12-23 2020-12-15 Full Spectrum Genetics, Inc. Anti-B7H3 binding compounds and uses thereof
WO2021037319A1 (fr) 2019-08-30 2021-03-04 Y-Mabs Therapeutics, Inc. Évaluation immunohistochimique de l'expression de b7-h3
WO2021127217A1 (fr) 2019-12-17 2021-06-24 Flagship Pioneering Innovations V, Inc. Polythérapies anticancéreuses ayant des inducteurs de désassemblage cellulaire dépendant du fer
US11174315B2 (en) 2015-10-08 2021-11-16 Macrogenics, Inc. Combination therapy for the treatment of cancer
WO2022006179A1 (fr) 2020-06-29 2022-01-06 Flagship Pioneering Innovations V, Inc. Virus modifiés pour favoriser la thanotransmission et leur utilisation dans le traitement du cancer
WO2022167052A1 (fr) 2021-02-08 2022-08-11 Y-Mabs Therapeutics, Inc. Utilisation d'acide ascorbique comme agent stabilisant pour des anticorps anti-b7-h3
WO2022212784A1 (fr) 2021-03-31 2022-10-06 Flagship Pioneering Innovations V, Inc. Polypeptides de thanotransmission et leur utilisation dans le traitement du cancer
WO2023278641A1 (fr) 2021-06-29 2023-01-05 Flagship Pioneering Innovations V, Inc. Cellules immunitaires modifiées pour favoriser la thanotransmission de phényléthanolamines et leurs utilisations
WO2024077191A1 (fr) 2022-10-05 2024-04-11 Flagship Pioneering Innovations V, Inc. Molécules d'acide nucléique codant pour des trif et des polypeptides supplémentaires et leur utilisation dans le traitement du cancer

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9487587B2 (en) 2013-03-05 2016-11-08 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells of a companion animal that express an activating receptor and cells that express B7-H3 and uses thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001018021A1 (fr) * 1999-09-03 2001-03-15 Human Genome Sciences, Inc. Polynucleotides, polypeptides et anticorps de type b7
WO2002010187A1 (fr) * 2000-07-27 2002-02-07 Mayo Foundation For Medical Education And Research B7-h3 et b7-h4, nouvelles molecules immunoregulatrices

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE PUBMED [Online] XU ET AL.: 'Targeting and therapy of carcinoembryonic antigen-expressing tumors in transgenic mice with an antibody-interleukin 2 fusion protein', XP002908602 Retrieved from NCBI Database accession no. 10969795 & CANCER RES. vol. 60, no. 16, 15 August 2000, pages 4475 - 4476 *
DATABASE PUBMED MODAK ET AL.: 'Monoclonal antibody 8H9 targets a novel cell surface antigen expressed by a wide spectrum of human solid tumors', XP002908601 & CANCER RES. vol. 61, no. 10, 15 May 2001, pages 4048 - 4049 *
JUHL ET AL.: 'Additive cytotoxicity of different monoclonal antibody-cobra venom factor conjugates for human neuroblastoma cells' IMMUNOBIOLOGY vol. 197, November 1997, pages 444 - 459, XP002908499 *
MODAK ET AL.: 'Radioimmunotargeting to human rhabdomyosarcoma (RMS) using monoclonal antibody (MOAB) 8H9' PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING vol. 41, March 2000, page 724, ABSTRACT 4600, XP002908500 *
See also references of EP1399187A2 *

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7666424B2 (en) 2001-10-17 2010-02-23 Sloan-Kettering Institute For Cancer Research Methods of preparing and using single chain anti-tumor antibodies
US8148154B2 (en) 2001-10-17 2012-04-03 Sloan-Kettering Institute For Cancer Research Method for preparation of single chain antibodies
EP1441765A4 (fr) * 2001-10-17 2005-12-07 Sloan Kettering Inst Cancer Procede de preparation d'anticorps monocatenaires
EP1441765A2 (fr) * 2001-10-17 2004-08-04 Sloan-Kettering Institute For Cancer Research Procede de preparation d'anticorps monocatenaires
EP1572077A4 (fr) * 2002-03-08 2005-12-14 Sloan Kettering Inst Cancer Utilisations d'anticorps 8h9 monoclonaux
EP1572077A2 (fr) * 2002-03-08 2005-09-14 Sloan-Kettering Institute For Cancer Research Utilisations d'anticorps 8h9 monoclonaux
WO2003099868A3 (fr) * 2002-05-28 2004-01-15 Omrix Biopharmaceuticals Inc Methode pour obtenir des anticorps anti-idiotype
US10040869B2 (en) 2002-05-28 2018-08-07 Omrix Biopharmaceuticals Ltd. Molecules mimicking an autoantibody idiotype and compositions containing same
US8450067B2 (en) 2002-05-28 2013-05-28 Omrix Biopharmaceuticals Inc. Method for obtaining anti-idiotype antibodies
US8779098B2 (en) 2002-06-19 2014-07-15 Macrogenics West, Inc. B7-H3L cell surface antigen and antibodies that bind thereto
US9574007B2 (en) 2002-06-19 2017-02-21 Macrogenics, Inc. B7-H3L cell surface antigen and antibodies that bind thereto
EP1567556A2 (fr) * 2002-12-02 2005-08-31 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Immunotoxine recombinante et son utilisation dans le traitement de tumeurs
EP1567556A4 (fr) * 2002-12-02 2006-03-22 Us Gov Health & Human Serv Immunotoxine recombinante et son utilisation dans le traitement de tumeurs
US6987270B2 (en) 2003-05-07 2006-01-17 General Electric Company Method to account for event losses due to positron range in positron emission tomography and assay of positron-emitting isotopes
US8465931B2 (en) 2004-08-03 2013-06-18 Innate Pharma S.A. Therapeutic and diagnostic methods and compositions targeting 4Ig-B7-H3 and its counterpart NK cell receptor
US7732131B2 (en) 2004-08-03 2010-06-08 Innate Pharma S.A. Therapeutic and diagnostic methods and compositions targeting 4Ig-B7-H3 and its counterpart NK cell receptor
US8840889B2 (en) 2009-08-13 2014-09-23 The Johns Hopkins University Methods of modulating immune function
US9676856B2 (en) 2009-08-13 2017-06-13 The Johns Hopkins University Methods of modulating immune function
US9714296B2 (en) 2010-03-04 2017-07-25 Macrogenics, Inc. Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof
US10730945B2 (en) 2010-03-04 2020-08-04 Macrogenics, Inc. Antibodies reactive with B7-H3 and users thereof
EP2982380A1 (fr) 2010-03-04 2016-02-10 MacroGenics, Inc. Anticorps réagissant avec b7-h3, fragments immunologiquement actifs associés et utilisations associées
US9714295B2 (en) 2010-03-04 2017-07-25 Macrogenics, Inc. Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof
US9896508B2 (en) 2010-03-04 2018-02-20 Macrogenics, Inc. Antibodies reactive with B7-H3 and uses thereof
WO2011109400A2 (fr) 2010-03-04 2011-09-09 Macrogenics,Inc. Anticorps réagissant avec b7-h3, fragments immunologiquement actifs associés et utilisations associées
US10683364B2 (en) 2010-03-04 2020-06-16 Macrogenics, Inc. Antibodies reactive with B7-H3, immunologically active fragments thereof and uses thereof
US10100115B2 (en) 2014-02-14 2018-10-16 Macrogenics, Inc. Methods for the treatment of vascularizing cancers
US9963509B2 (en) 2014-12-23 2018-05-08 Full Spectrum Genetics, Inc. Anti-B7H3 binding compounds and uses thereof
US10865245B2 (en) 2014-12-23 2020-12-15 Full Spectrum Genetics, Inc. Anti-B7H3 binding compounds and uses thereof
US11174315B2 (en) 2015-10-08 2021-11-16 Macrogenics, Inc. Combination therapy for the treatment of cancer
US10961311B2 (en) 2016-04-15 2021-03-30 Macrogenics, Inc. B7-H3 binding molecules, antibody drug conjugates thereof and methods of use thereof
WO2017180813A1 (fr) 2016-04-15 2017-10-19 Macrogenics, Inc. Nouvelles molécules de liaison à b7-h3, leurs conjugués anticorps-médicaments et leurs procédés d'utilisation
US11591400B2 (en) 2016-04-15 2023-02-28 Macrogenics, Inc. B7-H3 directed antibody drug conjugates
WO2019241730A2 (fr) 2018-06-15 2019-12-19 Flagship Pioneering Innovations V, Inc. Augmentation de l'activité immunitaire par modulation de facteurs de signalisation post-cellulaires
WO2020227159A2 (fr) 2019-05-03 2020-11-12 Flagship Pioneering Innovations V, Inc. Métodes de modulation de l'activité immunitaire
WO2021037319A1 (fr) 2019-08-30 2021-03-04 Y-Mabs Therapeutics, Inc. Évaluation immunohistochimique de l'expression de b7-h3
WO2021127217A1 (fr) 2019-12-17 2021-06-24 Flagship Pioneering Innovations V, Inc. Polythérapies anticancéreuses ayant des inducteurs de désassemblage cellulaire dépendant du fer
WO2022006179A1 (fr) 2020-06-29 2022-01-06 Flagship Pioneering Innovations V, Inc. Virus modifiés pour favoriser la thanotransmission et leur utilisation dans le traitement du cancer
WO2022167052A1 (fr) 2021-02-08 2022-08-11 Y-Mabs Therapeutics, Inc. Utilisation d'acide ascorbique comme agent stabilisant pour des anticorps anti-b7-h3
WO2022212784A1 (fr) 2021-03-31 2022-10-06 Flagship Pioneering Innovations V, Inc. Polypeptides de thanotransmission et leur utilisation dans le traitement du cancer
WO2023278641A1 (fr) 2021-06-29 2023-01-05 Flagship Pioneering Innovations V, Inc. Cellules immunitaires modifiées pour favoriser la thanotransmission de phényléthanolamines et leurs utilisations
WO2024077191A1 (fr) 2022-10-05 2024-04-11 Flagship Pioneering Innovations V, Inc. Molécules d'acide nucléique codant pour des trif et des polypeptides supplémentaires et leur utilisation dans le traitement du cancer

Also Published As

Publication number Publication date
EP1399187A4 (fr) 2005-09-21
WO2002032375A9 (fr) 2003-01-03
WO2002032375A3 (fr) 2002-06-20
WO2002032375A8 (fr) 2002-09-12
EP1399187A2 (fr) 2004-03-24
CA2423843A1 (fr) 2002-04-25

Similar Documents

Publication Publication Date Title
US9938351B2 (en) Uses of monoclonal antibody 8H9
US9062110B2 (en) Uses of monoclonial antibody 8H9
EP1572077B1 (fr) Utilisations d'anticorps 8h9 monoclonaux
US20020102264A1 (en) Uses of monoclonal antibody 8H9
WO2002032375A2 (fr) Utilisations d'anticorps monoclonal 8h9
CA2478082C (fr) Utilisations d'anticorps 8h9 monoclonaux
US7740845B2 (en) Uses of monoclonal antibody 8H9
US8148154B2 (en) Method for preparation of single chain antibodies
Mehren et al. Monoclonal antibody therapy for cancer
JP5335651B2 (ja) インターナライジング抗ｃｄ７４抗体およびその使用方法
RU2139731C1 (ru) Способ лечения, антитела, гибридома
Gorman et al. Humanisation of monoclonal antibodies for therapy
Lutterbuese et al. Potent control of tumor growth by CEA/CD3-bispecific single-chain antibody constructs that are not competitively inhibited by soluble CEA
JP4790831B2 (ja) 抗ｃｄ２０抗体およびその融合タンパク質ならびに使用法
US20040115205A1 (en) Use of antibodies against the MUC18 antigen
Cheung et al. Methods of preparing and using single chain anti-tumor antibodies
Cheung et al. Method for preparation of single chain antibodies
Krauss et al. Application of recombinant antibodies in cancer patients
JP2023523682A (ja) Ｂ細胞急性リンパ芽球性白血病（ｂ－ａｌｌ）の処置のためのｃｄ２２標的化部分
DiJulio Monoclonal antibodies: Overview and use in hematologic malignancies

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
121 Ep: the epo has been informed by wipo that ep was designated in this application
COP Corrected version of pamphlet

Free format text: PAGES 6-11, DESCRIPTION, REPLACED BY NEW PAGES 6-11; PAGES 1/32-32/32, DRAWINGS, REPLACED BY NEW PAGES 1/32-32/32; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2423843

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2001983999

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2001983999

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 2001983999

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: JP