WO2002022138A1 - Agents antibacteriens et methodes d'identification - Google Patents

Agents antibacteriens et methodes d'identification Download PDF

Info

Publication number
WO2002022138A1
WO2002022138A1 PCT/US2001/028913 US0128913W WO0222138A1 WO 2002022138 A1 WO2002022138 A1 WO 2002022138A1 US 0128913 W US0128913 W US 0128913W WO 0222138 A1 WO0222138 A1 WO 0222138A1
Authority
WO
WIPO (PCT)
Prior art keywords
streptomyces
bacteria
compound
growth
compounds
Prior art date
Application number
PCT/US2001/028913
Other languages
English (en)
Other versions
WO2002022138A9 (fr
Inventor
Julian E. Davies
Barbara Waters
Original Assignee
Cubist Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cubist Pharmaceuticals, Inc. filed Critical Cubist Pharmaceuticals, Inc.
Priority to AU2001296253A priority Critical patent/AU2001296253A1/en
Publication of WO2002022138A1 publication Critical patent/WO2002022138A1/fr
Publication of WO2002022138A9 publication Critical patent/WO2002022138A9/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12—Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Definitions

  • the field of the invention relates to methods and compositions for the discovery of compounds which inhibit the growth of a range of bacteria, especially 0 mycobacteria.
  • Compounds identified by the methods of the invention are useful as antibacterial agents.
  • eukaryotic and prokaryotic cells In both eukaryotic and prokaryotic cells a large repertoire of regulatory systems is modulated by a variety of extracellular signals. In eukaryotic cells, the control of proliferation and differentiation is achieved by multiple signal transduction pathways, which are regulated by the co-ordinated action of protein kinases and phosphatases.
  • the protein kinases fall primarily into two classes, those which phosphorylate tyrosine residues and Q those which target serine and threonine residues. Specificity of response is insured tlirough a variety of strategies.
  • Mycobacterium tuberculosis (Mtb) infections which continue to result in very significant morbidity and mortality world-wide. It is estimated that one third of the world's population is infected and that around three million people die from tuberculosis infections every year. Although there are reliable effective drugs for the treatment of tuberculosis, the increase in multiple antibotic resistant strains, especially in industrialized nations, is of considerable concern. There has been no new treatment for tuberculosis for three decades.
  • the present invention as described herein provides a novel method for identifying antibacterial compounds that are particularly effective against Mycobacterium species.
  • the present invention relates to methods for screening for antibacterial compounds, and methods for treating bacterial diseases or preventing infections by bacteria.
  • the antibacterial screening method of the invention comprises two step: (a) contacting a growing culture of Streptomyces griseus or Streptomyces 85E with a test compound for a time sufficient to allow the test compound to alter aerial mycelial development or spore formation, and (b) contacting mycobacterium cells with the test compound of step (a) for a time sufficient to allow the test compound to inhibit growth of the mycobacterium.
  • Test compounds that tested positive in both step (a) and step (b) are antibacterial compounds of the invention.
  • the antibacterial compounds of the invention can be used for inhibiting the growth of a bacteria or for treating or preventing a disease caused by a bacteria in a subject in need of the treatment or prevention comprising administering to the subject a therapeutically or prophylactically effective amount of the antibacterial compound.
  • the antibacterial compounds of the invention can also be used in combination with existing antibacterial compounds for treatment or prevention of a. disease.
  • the antibacterial compounds can also be used to sterilize contaminated items or to inhibit growth of bacteria on an item by contacting the item with the compounds.
  • target bacteria that are sensitive to the compounds of the invention contain phosphoproteins, such as those that binds an anti-phosphotyrosine antibody.
  • Target bacteria include mycobacteria, myxobacteria and cyanobacteria, such as but not limited to
  • the exemplary antibacterial compounds of the invention include but are not limited to cyclomarin A, pyridomycin, surfactin, viscosin, XR336, XR339 and XR774, and their derivatives.
  • composition comprising the antibacterial compounds of the invention are also contemplated.
  • Figure 1 shows the results of a typical Streptomyces 85E sporulation inhibition assay.
  • Figure 2 gives the chemical structure of compounds newly identified to be active in the sporulation assay and subsequently found to effectively inhibit the growth of mycobacterial strains.
  • the present invention relates to methods for screening compounds with antibacterial activity. Specifically, the invention relates to assays for identifying compounds that interfere with phosphorylation and dephosphorylation pathways of bacteria. The invention also encompasses the uses of these compounds to inhibit growth of bacteria and to treat infectious diseases.
  • One of the most common form of post-translational modification of protein is phosphorylation on histidine, tyrosine, serine, and threonine. Gene regulation through histidine modification is common in bacteria and was thought to be characteristic of prokaryotes. Similarly, it was considered that modification on tyrosine, serine, and threonine residues were eukaryotic functions. However, it appears that some prokaryotes rely on phosphorylation cascades for adaptive responses, such as nitrogen fixation, and chemotaxis.
  • the present invention is based in part on the discovery by the inventors that some compounds that altered the development of aerial mycelia and sporulation in certain
  • Streptomycete species are also potent inhibitors of growth of mycobacterial cells.
  • the inventor recognized that phosphoproteins and related kinases and phosphatases present in bacteria can serve effectively as a target for antibacterial drug screening.
  • the compounds of the invention interfere with phosphrylation and dephosphorylation pathways of bacteria either by inhibiting the functions of bacterial kinases and/or phosphatases. Because phosphoprotein-related targets in bacteria are distinct from known antibacterial targets, the antibacterials that are identified through the methods of the present invention are likely to be structurally novel, and without pre-existing resistance.
  • the invention provides a method for identifying antibacterial compounds that comprises two steps. The first step comprises contacting a test compound with a prokaryotic organism that possesses enzyme activity in its developmental processes that is effective to phosphorylate tyrosine, serine and/or threonine.
  • test compound is allowed to contact the organism for a time sufficient for the compound to alter development of the organism.
  • alteration of development is physically detectable, and most preferably visually observable.
  • Compounds that scored positive in the first assay are tested in a second assay by contacting a test Mycobacterium species, and scoring for the ability of the compounds to inhibit mycobacterial cell growth.
  • the various methods for screening of the invention are described in Section 5.1 hereinbelow.
  • the present invention provides the use of compounds that interfere with phosphorylation and dephosphorylation pathways of bacteria as antibacterial compounds. Such compounds are expected to inhibit the growth of bacteria that possesses enzyme activity that phosphorylates tyrosine, serine, and/or threonine residues.
  • compounds that are shown to alter aerial mycelial development and/or inhibition of spore formation in a Streptomycete-based screening assay as described in U.S. Patent No. 5,770,392 are useful, not only as eukaryotic kinase inhibitors, but also as antibacterial compounds for inhibiting the growth of bacteria that possesses enzyme activity that phosphorylates tyrosine, serine, and/or threonine residues.
  • the methods are particularly useful against Mycobacterium species, especially pathogenic strains of Mycobacterium species. According to the invention, such compounds, their analogs and derivatives are antimycobacterial agents.
  • the test compound are present in a mixture with other molecules.
  • the present invention also encompasses the use of such mixtures in the first Streptomycete-based assay and the second Mycobacterium assay.
  • Such mixtures include but are not limited to microbial culture supernatants, microbial cell extracts, and fractions enriched for antibacterial activity.
  • a test compound which affected aerial hyphae development and/or sporulation in the first Streptomycete- based assay may optionally be enriched or purified from the mixture prior to the second Mycobacterium assay.
  • the invention provides uses of the antibacterial compounds of the invention, including but not limited to, uses as a sterilizing agent, and as a pharmaceutical for treatment or prevention of human and animal diseases.
  • the bacterial species that are sensitive to such extracts and compounds, referred to herein as target organisms, such as Mycobacterium species, are described in Section 5.3.
  • the various uses and methods of the antibacterial compounds are described in details in Section 5.4.
  • the ability of several purified natural products in inhibiting mycobacterial cell growth is described in detail in the example in Section 6. 5.1 METHOD OF IDENTIFICATION OF ANTIBACTERIAL COMPOUNDS
  • the present invention provides a method to identify antibacterial compounds, comprising testing a compound in a Streptomyces-based assay first followed by an assay that is based on the viability of one or more bacterial species in the presence of the compound.
  • the bacteria used in the second test is one that comprises one or more protein(s) that comprises phosphorylated amino acid residues, such as phosphorylated serine, phosphorylated threonine, and phosphorylated tyrosine. Positive results in both assays indicate that the compound is an antibacterial compound.
  • One advantage of this approach is the reduction of number of assays that is to be performed with a target bacteria, 0 which are pathogenic and possibly highly infectious. For Mycobacterium species, the growth inhibition assay takes many days to complete.
  • a preliminary screen using the relatively safe Streptomyces-based assay can eliminate a large number of non- active compounds, hence reducing the number of candidate compounds that are to be tested with a target bacteria, such as M. tuberculosis, which can take up to 3 weeks to complete.
  • the first step used in the method of the invention is based on the methods provided in U.S. Patent No. 5,770,392, the disclosure of which is incorporated herein by reference in its entirety.
  • Preferred prokaryotic organisms are Streptomyces griseus and Streptomyces 85E.
  • the term "Streptomyces-based assay” encompasses any Q assay based on the methodology disclosed in the U.S. Patent No. 5,770,392, and may involve the use of other non-Streptomyces species of prokaryotic organism which possesses enzymes effective at phosphorylating tyrosine, serine, or threonine residues in a protein.
  • Suitable prokaryotic test organisms for use in the assay of the invention are streptomycetes, particularly strains of Streptomyces griseus, and a number of wild stains 5 (e.g., strains designated as WEC93-17A, WEC188-31C, WEC362-68A and WEC403-73F) demonstrated to be distinct by sequencing of the 16S rDNA.
  • a particularly preferred prokaryotic organism is a wild strain oi Streptomyces isolated from soil and designated Streptomyces WEC478-85E (hereinafter strain 85E). This strain has been deposited with the American Type Culture Collection in accordance with the provisions of the Budapest 0 treaty and has been assigned Accession Number ATCC 55824.
  • the material comprising a test compound to be tested can be applied to a filter paper disk and then placed on a plate which has been freshly seeded with the prokaryotic test organism.
  • the prokaryotic test organism is then allowed to contact and grow in the presence of the filter paper disk for a period of time, usually 24 to 36 hours, after which the organism is evaluated for altered development in the zone around the disk.
  • the effects observed may include overall growth inhibition, but at least in the case of streptomycetes, an observation of an inhibition of the formation of aerial mycelia and/or spores, without inhibition of the growth of vegetative mycelia is particularly indicative of the presence of an inhibitor of post-translational phosphorylation.
  • the growth medium employed may need to be a minimal media or a rich medium. This is the case because it appears that the metabolic pathways facilitating 0 growth on minimal media are different from those operational during growth on rich media, and it may be the case that different kinases and phosphatases may be regulating development and metabolism under different growth conditions. Accordingly, it may also be advantageous to test materials using both a rich and a minimal medium.
  • the method of the invention is performed using a minimal medium such as ISP4, an inorganic salts/starch agar available from Difco, because this strain sporulates readily when grown on this medium.
  • a minimal medium such as ISP4, an inorganic salts/starch agar available from Difco, because this strain sporulates readily when grown on this medium.
  • the relative ease to induce sporulation in this strain facilitates visual evaluation for differences in sporulation.
  • strains (such as 17A and 31 C) which Q sporulate on rich medium, for example tryptic soy medium, can be used in the this step of the invention.
  • the second step of the method of the invention is a standard viability test using a bacterial strain that comprises one or more proteins that comprise amino acid residues that are phosphorylated, such as phosphorylated serines, threonines, and tyrosines. 5 Such bacterial strains can readily be identified, for example, by detecting the presence of phosphorylated serines, threonines, and/or tyrosines using immunological methods well known in the art.
  • a preferred group of bacteria for this step of the method is Mycobacteriuam. Mycobacterium cells, such as but not limited to M. tuberculosis, M. phlei, and M. aurum can be used.
  • test mycobacterial cells The viability of the mycobacterial cells in the presence of 0 one or more concentrations of the test compound is scored and compared to that without the test compound.
  • Other bacteria that can be used include myxobacteria and cyanobacteria.
  • Test mycobacteria may be obtained from private laboratory deposits, public culture collections such as the American Type Culture Collection, or from commercial suppliers. It is preferable that the test mycobacteria is reasonably well characterized biochemically, physiologically, and/or genetically. It is desirable to use mycobacterial strains which have been developed for drug screening processes, and that conditions for their growth, maintenance, and manipulations' are known.
  • the test mycobacterial cells may be cultured under standard conditions of temperature, incubation time, optical density, and media composition corresponding to the nutritional and physiological requirements of the particular strain. However, conditions for maintenance and growth of the test cell maybe 0 different from those for assaying candidate test compounds in the screening methods of the invention. Any techniques known in the art may be applied to establish the optimal conditions. See section 6.1.6
  • the properties of the antibacterial compound can be determined by the following assays:
  • the minimum inhibitory concentration (MIC) against bacterial organisms is determined for each test compound that is positive in the assays of the invention. Methods known in the art may be used such as broth microdilution testing, using a range of Q concentrations of each test compound (1993, National Committee for Clinical Laboratory
  • Pathogenic species to be tested generally include: E. coli, Enterococcus faecium, Enterococcus faecalis, Streptococcus 5 pneumoniae, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus epidermis, Shigella flexneri, and Salmonella typhimurium.
  • Cytotoxicity can be measured by methods known in the art.
  • One such method is assessing growth of mammalian cells in the presence of the test compound, using a protein binding dye, sulforhodamine B (SRB).
  • SRB binds electrostatically to basic amino 0 acids. Binding and solubilization of the dye can be controlled by changes in pH. SRB binds stoichiometrically to proteins in one pH range but can be solubihzed and extracted for measurement in another. An increase in total protein is correlated to cell growth. Cell growth in the presence of compound is compared to growth without added compound to establish a growth inhibitory concentration (GI 50 ) (Skehan et al., 1990, J. Natl. Cancer.
  • GI 50 growth inhibitory concentration
  • the methods of the invention are also suited to high throughput screening and miniaturization.
  • the screening assays can be automated by the
  • test compounds of the invention encompass numerous classes of chemical molecules, though typically they are organic molecules, and preferentially of low molecular weight. Typically, these compounds have a molecular weight of more than about
  • Test compounds comprise functional chemical groups necessary for interactions with the target transcription factor(s) and/or target nucleic acid molecules.
  • Test compounds often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more functional groups, including but not limited to alkyl, carbonyl, amine, hydroxyl or 25 carboxyl groups.
  • the compounds tested in the methods of the invention can be obtained from a wide variety of sources including collections of natural products in the form of bacterial, fungal, lichen, plant and animal extracts; and synthetic chemical libraries. Numerous means known in the art are available for the random, directed and combinatorial synthesis of a
  • Test compounds that score positive in the screening assays of the invention are putative agents that interfere with the phosphorylation and dephosphorylation pathways of bacteria, and are useful as antibacterial agents or as leads for the development of therapeutic agents for the treatment of infectious diseases caused by such bacteria. Many are inhibitors of eukaryotic signal transduction processes.
  • test compounds of the invention can be present in a composition or 0 mixture with other molecules, such as natural products, chemically-related derivatives, syntheic intermediates or precurors of the test compound. There is no requirement that the test compound be isolated or purifed. However, the test compound in a mixture can be enriched, fractionated, or isolated by methods known in the art after the Streptomyces-based assay for use in the second step of the method.
  • the composition comprising one or more test compound is a microbial cell culture, microbial cell culture supernatant, microbial cell extract, and fractions thereof enriched for a particular biological or biochemcial property.
  • the inventors identified a number of extracts and compounds that scored positive in the Strpetomyces 85E assay and in the Mycobacterium assay using M. phlei and/or M. aurum as the test species.
  • the following compounds are effective as antimycobacterial agents: cyclomarin A, pyridomycin, surfactin, viscosin,
  • Cyclomarin A has been known to be useful as an anti-inflammatory agent (see U.S. Patent No. 5,444,043) and as an antiviral agent (U.S. Patent No. 5,759,995). The disclosures of these two U.S. patents are incorporated herein in their entireties. Cyclomarin A was not previously known to be produced by a terrestrial streptomycete and possess 0 antimycobacterial activity. Accordingly, the invention provides the production of cyclomarin A by culturing Streptomyces D22-7B and isolating cyclomarin A from the culture or the culture supernantant. The invention also provides the use of cyclomarin A as an antimycobacterial agent or as a lead compound for further modification and derivatization to improve its property as an antibacterial agent or antimycobacterial agent.
  • Viscosin has independently been demonstrated to possess antimycobacterial activity (1997, Gerard et al., J Nat Prod 60:223-229). Thus, it is useful as a positive control in the assays of the invention.
  • antibacterial compound that scored positive in the Streptomyces assay 0 and in the Mycobacterium assay of the invention, with the exception of viscosin, are encompassed as antimycobacterial agents of the invention.
  • Many of the compounds are peptides that are not made via the ribosome but by peptide synthases, and they may contain unusual amino acids and lipids.
  • antibacterial compounds that scored positive in the Streptomyces assay and are candidate antimycobacterial agents include vulpinic acid and usnic acid, and their respective analogs or derivatives as described in PCT publication no. WO 99/20793 which is incorporated herein by reference in its entirety.
  • Such extracts encompassed by the invention, are prepared from isolates of soil bacteria of the genus Pseudomonas, Bacillus, Streptomyces, Acinetobacter, Acidosphaera, Tsukamurella, Streptoverticillium, Kitasatosporia, Nocardia, Gordona, and Micromonospora, by standard techniques.
  • the species that appear most closely related to 5 the bacteria present in the various isolates are listed in Table 1 below:
  • the use of microbial cell culture or compositions comprising materials derived from cell culture of the microbial species listed in Table I in the methods of the invention is specifically provided.
  • the methods of the invention include the testing of cultures of Pseudomonas fluorescens, Pseudomonas putida, Bacillus licheniformis, Bacillus subtilis, Bacillus myloliquefaciens, Bacillus pumilis, Bacillus simplex, Bacillus megaterium, Bacillus illinoisensis, Bacillus pabuli, Bacillus viscosus, Acientobacter calcoaceticus, Acidosphaera rubrifaciens, Tsukamurella paurometabolum, Streptomyces acidiscabies, Streptomyces purpureus,
  • Streptomyces caelestris Streptomyces thermocarboxydus, Streptomyces subrutilis,
  • Other compounds that can be tested and used in the methods of the invention are described in United States Patent Nos. 5,306,732; 6,057,315; 5,565,486; and 6,197,811, and PCT publications WO92/16517 and WO 98/17661, which are incorporated herein in their entireties.
  • the antibacterial compounds identified by the methods of the infection can be used to treat or prevent a variety of infectious diseases in animals, including humans, companion animals (e.g., dogs and cats), livestock animals (e.g., sheep, cattle, goats, pigs, and horses), laboratory animals (e.g., mice, rats, and rabbits), and captive or wild animals.
  • infectious diseases are caused by a variety of target bacteria, including
  • tuberculosis Although most cases of tuberculosis are caused by Mycobacterium tuberculosis, two additional species, Mycobacterium bovis and Mycobacterium africanum, also cause tuberculosis in humans. Anther species of Mycobacteria that is significantly harmful to humans is M. ulcerans produces a destructive, preliminarily tropical skin disease that, if not treated early, produces chronic ulcer with necrotic centers. Leprosy is another disease caused by Mycobacteria, M. leprae. Leprosy is an ancient disease that still continues to threaten the quality of life of over 12 million people in all parts of the world.
  • Mycobacteria not only effects humans, but also animals.
  • An example is M. paratuberculosis, causing chronic enteritis in ruminants, such as cattle and sheep.
  • the disease is of major economic concern, which can infect a whole heard.
  • veterinary applications of the antibacterial compounds and methods of the invention are included
  • Mycobacteria species that are contemplated include but are not limited to M. africanum, M. asiaticum, M. avium, M. bovis, M. chelonei, M. diphtheriae, M. 0 flavescens, M. fortuitum, M. gastri, M. gordonae, M. haemophilum, M. hominis, M. intercellulare, M. kansaii, M. leprae, M. lepraemurium, M. malmoense, M. marinum, M mictroti, M. paratuberculosis, M. phlei, M.scrofulaceum, M. simiae, M. smegmatis, M. szulgai, M. terrae, M. trivale, M. tuberculosis, M. uclerans, and M. xenopi.
  • target bacteria which are sensitive to the inhibitory compounds of the invention are characterized by the presence of phosphoproteins, in particular, those comprising phosphorylated serine, threonine, and tyrosine residues such as those that can bind to anti-phosphotyrosine antibodies.
  • Target bacteria can thus be identified by immunological methods commonly known in the art, such as Western blotting using Q antiphosphoprotein antibodies.
  • Many species of myxobacteria and cyanobacteria are contemplated to be target bacteria.
  • Other examples of target bacteria may include gram negative bacteria such as Yersinia, Pseudomonas, and Salmonella species.
  • the invention features novel antibacterial compounds discovered by the methods described above. These antibacterial compounds are putative inhibitors of kinase and/or phosphatase enzymes in a target organism, including infectious pathogenic microorganism.
  • the invention also encompasses novel pharmaceutical compositions comprising antibacterial compounds discovered as described above in various 0 pharmaceutically acceptable formulations.
  • the invention features a method for treating a subject infected with an infectious bacterium comprising administering to that subject a therapeutically effective amount of an antibacterial agent which scored positive in both assays of the invention.
  • administration can be by any method known to those skilled in the art, for example, by topical application or by systemic administration.
  • the antibacterial compounds of the invention can also be used in combination with other antibiotics.
  • antibacterial compounds of the present invention can be used to sterilize or to treat contaminated items, such as crops, wood, metal or plastic and the like, by methods such as, but not limited to, spraying or dusting of that agent onto the contaminated item.
  • the antibacterial compounds can also be used to inhibit growth of 0 bacteria on an item by contacting the item with the compounds or impregnating the compound into the item.
  • terapéuticaally effective amount is meant an amount that relieves to some extent one or more symptoms of the disease or condition in the patient. Additionally, by “therapeutically effective amount” is meant an amount that returns to normal, either partially or completely, physiological or biochemical parameters associated with or causative of a bacterial disease or condition.
  • compositions comprising a compound of the invention formulated in a compatible pharmaceutical carrier may be prepared, packaged, labeled for treatment of and used for the treatment of the indicated infectious diseases caused by 5 microorganisms.
  • the antibacterial compound is water-soluble, then it maybe formulated in an appropriate buffer, for example, phosphate buffered saline or other physiologically compatible solutions. Alternatively, if the resulting complex has poor solubility in aqueous solvents, then it may be formulated with a non-ionic surfactant such as Tween, polyethylene 0 glycol or glycerine.
  • a non-ionic surfactant such as Tween, polyethylene 0 glycol or glycerine.
  • the compounds and their physiologically acceptable solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral, topical, dermal, vaginal, rectal administration and drug delivery device, e.g., porous or viscous material, such as lipofoam.
  • the pharmaceutical preparation may be in liquid form, for example, solutions, syrups or suspensions, or may be presented as a drug product for reconstitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, or fractionated vegetable oils); and preservatives (e.g., methyl or 0 propyl-p-hydroxybenzoates or sorbic acid).
  • suspending agents e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats
  • emulsifying agents e.g., lecithin or acacia
  • non-aqueous vehicles e.g., almond oil, oily esters, or fractionated vegetable oils
  • preservatives e
  • compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinized maize starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate).
  • binding agents e.g., pregelatinized maize starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc or silica
  • disintegrants e.g., potato starch
  • Preparations for oral administration may be suitably formulated to give Q controlled release of the active compound.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation 5 from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide
  • the compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the antibacterial compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the antibacterial 0 compounds may also be formulated as a depot preparation.
  • Such long acting formulations may be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection.
  • the antibacterial compounds may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, 5 as a sparingly soluble salt.
  • suitable polymeric or hydrophobic materials for example, as an emulsion in an acceptable oil
  • ion exchange resins for example, as sparingly soluble derivatives, for example, 5 as a sparingly soluble salt.
  • Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydro
  • the antibacterial compounds and compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing Q the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • compositions of the present invention comprise an antibacterial compound as the active ingredient, or a pharmaceutically acceptable salt 5 thereof, and may also contain a pharmaceutically acceptable carrier, and optionally, other therapeutic ingredients, for example antivirals.
  • pharmaceutically acceptable salts refers to salts prepared from pharmaceutically acceptable non-toxic acids and bases, including inorganic and organic acids and bases.
  • an antibacterial compound can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques.
  • the carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral (including tablets, capsules, powders, intravenous injections or infusions), preparing the compositions for oral dosage form any of the usual pharmaceutical media maybe employed, e.g., water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents, and the like; in the case of oral liquid preparations, e.g., suspensions, solutions, elixirs, liposomes and aerosols; starches, sugars, micro-crystalline cellulose, diluents, granulating agents, 0 lubricants, binders, disintegrating agents, and the like in the case of oral solid preparations e.g., powders, capsules, and tablets, hi preparing the compositions for parenteral dosage form, such as intravenous injection or infusion, similar pharmaceutical media may be employed, e.g., water, glycols, oils, buffers, sugar, pre
  • antibacterial compounds discovered by using Q the assays of the invention are formulated in pharmaceutically acceptable compositions.
  • the compositions can be used alone or in combination with one another, or in combination with other therapeutic or diagnostic agents. These compositions can be utilized in vivo, ordinarily in a mammal, preferably in a human, or in vitro.
  • the newly discovered antibiotic compounds could be used in vitro as a means of sterilization in hospitals or tissue culture 5 labs, by example, by applying the new compounds using standard environmental sterilization techniques.
  • compositions can be administered to the mammal in a variety of ways, including parenterally, intravenously, subcutaneously, intramuscularly, colonically, rectally, vaginally, nasally, orally, transdermally, topically, 0 ocularly, or intraperitoneally.
  • the magnitude of a therapeutic dose of an antibacterial compound in the acute or chronic management of an infectious disease will vary with the severity of the condition to be treated, the particular composition employed, and the route of administration.
  • the dose, and perhaps dose frequency will also vary according to the species of the animal, the age, body weight, condition and response of the individual subject. For example, in an in vitro assay, 20 ⁇ g of cyclomarin A and 10 ⁇ g of BSfH both inhibited growth of M. tuberculosis completely.
  • the determination of effective dosage levels that is the dosage levels necessary to achieve the desired result, will be within the ambit of one skilled in the art.
  • Desirable blood levels may be maintained by a continuous infusion of an antibiotic compound as ascertained by plasma levels. It should be noted that the attending 0 physician would know how to and when to terminate, interrupt or adjust therapy to lower dosage due to toxicity. Conversely, the attending physician would also know how to and when to adjust treatment to higher levels if the clinical response is not adequate (precluding toxic side effects).
  • drug delivery vehicles may be employed for systemic or 5 topical administration. They can be designated to serve as a slow release reservoir, or to deliver their contents directly to the target cell. Such vehicles have been shown to also increase the circulation half-life of drugs which would otherwise be rapidly cleared from the blood stream. Some examples of such specialized drug delivery vehicles which fall into Q this category are liposomes, hydrogels, cyclodextrins, and bioadhesive microspheres. These vehicles have been developed for chemotherapeutic agents.
  • Topical administration of compounds is advantageous when localized concentration at the site of administration with minimal systemic adsorption is desired. This simplifies the delivery strategy of the agent to the disease site and reduces the extent of 5 toxicological characterization. Furthermore, the amount of material to be administered is far less than that required for other administration routes.
  • Antibacterial compounds may also be systemically administered.
  • Systemic absorption refers to the accumulation of compounds in the blood stream followed by distribution throughout the entire body. Administration routes which lead to systemic 0 absorption include: oral, intravenous, subcutaneous, intraperitoneal, intranasal, intrathecal and ocular. 6.
  • Tyrphostins AG 490, AG 1295, and AG 1478 and genistein were obtained from Calbiochem-Novabiochem Corp., San Diego, CA. Each was dissolved in DMSO to 5 mg/ml (tyrphostins) or 20 mg/ml (genistein).
  • Strains of interest were characterized by fatty acid methyl ester (FAME, Sasser, 2001, Technical note #101 available at www.midi-inc.com, MIDI, Inc., Newark, Delaware) and 16S rDNA sequence analyses. Samples were prepared for gas 0 chromatography according to the protocol recommended for the MIDI automated microbial identification system and were chromatographed on a Hewlett-Packard 25m x 0.2mm phenyl methyl silicone fused capillary column on an HP 6890 system. Fatty acid profiles were compared to those in the MIDI aerobic bacteria database (MIDI, Inc., Newark, Delaware).
  • Primers for PCR amplification of 16S rDNA genes were GAGAGTTTGATCCTGGCTCAG (primer 16S.0007.F21) and 5 CGGACTCCTTGTTACGACTTC (primer 16S.1491.R21) derived from primers described by Lane, 16S/23S rRNA sequencing, p. 115-175. In: Stackebrandt, E. & M. Goodfellow (Eds.). Nucleic acid techniques in bacterial systematics. John Wiley & Sons, Chichester: 1991. PCR was carried out in a 50 ⁇ l reaction mix containing each primer at a concentration of 1 ⁇ M, 200 ⁇ M of each dNTP, 20 mM ( LO2SO4, 75 mM Tris-HCl (pH 0
  • PCR conditions included 30 cycles of denaturation (1 min. at 95°C), 5 annealing (2 min. at 55°C), and extension (2 min. at 72°C) in an MJ Research model PTC 100 thermocycler. Products were purified on QIAquick spin columns (Qiagen), and partial sequence was obtained on an automated sequencer using a primer with the sequence TAG(TC)GGCG(AG)ACGGGTGAGTAA (primer 16S.0099F) and ABI Prism dye Q terminator cycle sequencing reaction mix (Perkin Elmer). Sequences were compared by BLAST analysis to available ribosomal DNA sequences.
  • Inhibition of mycobacterial strains was identified by placing compound on sterile sensitivity discs on to lawns of M. aurum or M. phlei on TSA plates. Zones were measured after 2-4 days incubation at 37°C.
  • M. tuberculosis and M. avium a similar procedure was followed, using 7H10 medium (2, 10, or 20 ⁇ g of compound was applied in water, MeOH or DMSO). Plates were incubated at 37°C and scored for inhibition zones after 3 weeks.
  • Selected soil isolates identified by the assay as producers of inhibitors were grown to stationary phase in cultures up to 10 litres in tryptic soy broth (Difco). 0 Supematants and cell pellets were extracted separately with ethyl acetate and 10 - 20% methanol in ethyl acetate respectively. After concentrating both extracts and determining their activity, they were pooled and fractionated on a low mesh silica gel column, eluting with chloroform in an increasing methanol gradient.
  • Inhibitory activity in fractions from Bacillus 60A and Pseudomonas 1 IC was monitored by a thin layer chromatography bioassay method in which silica plates developed in chloroform:methanol (95:5 v/v) were transferred to square culture dishes and overlaid with ISP-4 soft agar (0.6%) containing an inoculum of 10 7 -10 8 cfu from a fresh culture of
  • Streptomyces 85E After incubation at 30°C for 24 to 30 hours, fractions with activity could 0 be identified by inhibition of sporulation in a zone over one or more spots. Active fractions were further purified by column chromatography on Sephadex LH-20, eluting with chloroform:methanol (1 : 1 v/v) or methanol. The active compound from Bacillus 60A was determined by FAB-mass spectroscopy to exhibit M ⁇ at m/z 1036 and high resolution FAB- MS suggested the formula C 53 H 93 N 7 O 13 . This formula and the source suggested surfactin. 5
  • Amino acid analysis confirmed the presence of leucine x 4, aspartic acid x 1, glutamic acid x 1 and valine xl, a composition consistent with surfactin.
  • the pure compound matched an authentic sample (Sigma) by co-TLC and NMR spectroscopy.
  • Streptomyces 171 C had bactericidal activity as well as significant inhibition of Streptomyces development, as evidenced by an inner zone of complete growth inhibition of Streptomyces 85E surrounded by an outer zone of vegetative mycelial growth lacking further development of aerial mycelium formation and sporalation.
  • the crude culture broth also inhibited growth of B. subtilis.
  • the concentrated crude extract from this isolate was chromatographed on reverse phase C-18 HPLC, eluting with a step gradient of methanol in 5 water.
  • 541 was determined to be the macrolide pyridomycin (erizomycin), with the molecular formula C 27 H 32 N 4 O 8 (Herr et al., United States Patent 3,367,833, 1968). 5
  • Streptomyces 154M produced the depsipeptide depsidomycin, with the molecular formula C 3g H 65 N 9 O 9
  • the physico-chemical properties and structure determinants matched those described previously (Isshiki et al., 1990, J. Antibiotics 33: 1195-1198).
  • Streptomyces D22-7B was determined to be a producer of cyclomarin A, molecular weight 1042; C 56 H 82 N 8 O n previously identified from a marine source. This heptapeptide was the compound responsible for sporulation inhibition by the crude culture broth. 5
  • the active fraction was re-chromatographed first on a normal phase silica gel column (chloroform :methanol 99:1 or 98:2 % v/v) and then on a Sephadex LH-20 column in methanol. These purification steps yielded 7 - 8 mg of pure active compound (TDI-12).
  • TDI-12 Low resolution FAB-MS analysis suggested a molecular weight of m/z 791.
  • the molecular formula of TDI-12 was determined to be C 38 H 65 N 9 O 9 by high resolution FAB-MS analysis and by detailed analysis of X H and 13 C NMR data. Comparison of these spectral data with the values published for depsidomycin and amino acid analysis confirmed TDI-12 to be this depsipeptide.
  • Streptomyces 171C had bactericidal activity as well as significant inhibition of Streptomyces development, as evidenced by an inner zone of complete growth inhibition of Streptomyces 85E surrounded by an outer zone of vegetative mycelial growth lacking further development of aerial mycelial formation and sporulation.
  • the crude culture broth also inhibited growth of B. subtilis.
  • a 1.8 litre fermentation of the isolate in tryptic soy broth was generated from a freshly grown seed culture and following centrifugation to remove the mycelial pellet the supernatant was extracted with ethyl acetate.
  • the mycelial pellet was extracted with 10% methanol in ethyl acetate.
  • strain 85E A strain isolated from a wash of a lichen sample collected in British Columbia designated WEC478-85E (hereinafter strain 85E), identified as a novel
  • Streptomyces by 16S ribosomal DNA sequencing was found to be exceptionally sensitive to the effects of compounds which inhibit aerial hyphae formation ( Figure 1). This strain has been deposited with the American Type Culture Collection (ATCC 55824). Streptomyces 85E sporalates very readily when grown on a minimal medium such as ISP4 but does not sporalate on tryptic soy agar.
  • the aerial hyphae assay has been employed to screen over two thousand bacterial culture supematants for inhibitory activity. One hundred strains were found to produce compounds which prevented sporalation of Streptomyces 85E. Similarly, a number of known or suspected kinase inhibitors have been tested for inhibition of 85E sporulation.
  • Isolate 60A is a gram-positive, spore forming rod shaped bacterium.
  • FAME analysis identified the strain as a Bacillus species with a similarity index value of 0.154 to Bacillus subtilis.
  • the analysis of partial 16S rDNA sequence from this strain showed greatest homology to Bacillus licheniformis 16S rDNA (94% identity over 400 bases).
  • the inhibitory compound was determined to be surfactin by comparison with an authentic sample (Sigma).
  • Isolate 1 IC is a gram-negative thin rod shaped bacterium. FAME analysis identified the strain as a Pseudomonas species with a similarity index value of 0.872 to P. chloraphis or 0.719 to P. putida. The analysis of partial 16S rDNA sequence data from this strain showed greatest homology to P. putida (98% identity over 432 bases). This strain and two other Pseudomonads produced the inhibitory compound viscosin. The majority of soil isolates in this study which scored positive as producers of sporalation inhibitors were subsequently identified as strains of Streptomyces. Active compounds isolated from three strains were depsidomycin, pyridomycin and cyclomarin A. The structures of these compounds are shown in Fig. 2.
  • Surfactin purified from a Bacillus isolate was shown to be a very effective sporalation inhibitor, with a zone of sporalation inhibition extending to 20 mm when 10 ⁇ g of the pure compound was applied to a test disc placed on a lawn of Streptomyces 85E.
  • a commercial sample of surfactin (Sigma) showed very similar inhibitory activity.
  • the 5 inhibitory effect on sporulation was persistent, lasting for at least 3 to 4 days after the unaffected areas of the culture had sporalated (Fig. 1).
  • Surfactin at the concentrations tested was inactive against B. subtilis, S. aureus or E. coli tester strains.
  • Viscosin, depsidomycin, pyridomycin and cyclomarin A were also identified o as specific and highly effective inhibitors of Streptomyces 85E development in the absence of generalised bactericidal activity (Table 2).
  • the tyrphostins AG-1478 and AG-1295 were most effective; as little as 10 ⁇ g applied to a culture of Streptomyces 85E delayed the onset of sporalation.
  • the tyrphostins were also active in inhibiting development of S. griseus; comparison of the sizes o of the inhibition zones provides an example of the generally greater degree of inhibition seen when Streptomyces 85E is employed as the indicator strain.
  • a large culture collection of fungi and actinomycetes has been screened for inhibitory activity against isolated enzymes such as a bacterial histidine kinase (Trew et al., Novel streptopyrroles from Streptomyces rimosus with bacterial protein histidine kinase 5 inhibitory and antimicrobial activities. J.
  • a potent inhibitor of a bacterial histidine kinase inhibited growth of Streptomyces 85E with no discernible effect on sporalation.
  • the two compounds most active against 85E were also capable of inhibiting growth of mycobacterial test strains.
  • XR774 the principal inhibitor found in the CD28 signalling assay, was specific in its antimycobacterial activity having no effect on B. subtilis growth, whereas XR379 also inhibited B. subtilis (Table 4).
  • novel reduced benzofluoranthrene metabolite XR774 was a very potent inhibitor of Streptomyces 85E development and an antimycobacterial agent; this compound was detected in a screen for inhibitors of CD28 induced cytokine production and was 0 subsequently shown to inhibit selected protein tyrosine kinases including Fyn, Lck, Abl and
  • EGF-R in in vitro assays with IC 50 values in the range 20-400 nM. Its oxidized derivative
  • XR819 which is not a CD28 signal transduction inhibitor, was inactive in inhibiting sporulation or mycobacterial cell growth, confirming the specificity of the bacterial assay.
  • XR379 Another strong inhibitor of sporalation and mycobacterial cell growth, XR379 was 5 identified as an inhibitor in a macrophage activation assay and was also inhibited the in vitro Src assay.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un essai biologique fondé sur des espèces Streptomyces dans lesquels la sporulation et la formation des hyphes aériens semblent être particulièrement sensibles à inhibition par des inhibiteurs de protéine kinase qui sont également des agents antibactériens. Grâce à l'utilisation de cet essai biologique fondé sur les Streptomyces et d'un essai biologique inhibiteur de croissance, plusieurs cultures bactériennes ont été examinées et plusieurs nouveaux inhibiteurs potentiels des agents antimycobactériens ont été identifiés.
PCT/US2001/028913 2000-09-15 2001-09-17 Agents antibacteriens et methodes d'identification WO2002022138A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001296253A AU2001296253A1 (en) 2000-09-15 2001-09-17 Antibacterial agents and methods of identification

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23300400P 2000-09-15 2000-09-15
US60/233,004 2000-09-15

Publications (2)

Publication Number Publication Date
WO2002022138A1 true WO2002022138A1 (fr) 2002-03-21
WO2002022138A9 WO2002022138A9 (fr) 2003-11-06

Family

ID=22875477

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/028913 WO2002022138A1 (fr) 2000-09-15 2001-09-17 Agents antibacteriens et methodes d'identification

Country Status (2)

Country Link
AU (1) AU2001296253A1 (fr)
WO (1) WO2002022138A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004315386A (ja) * 2003-04-14 2004-11-11 Hayashibara Takeshi 抗微生物剤
KR20160086479A (ko) * 2015-01-09 2016-07-20 한국생명공학연구원 신규한 고리형 뎁시펩타이드계 화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 항균용 약학적 조성물
WO2017053458A1 (fr) * 2015-09-21 2017-03-30 The Trustees Of Columbia University In The City Of New York Conception basée sur la structure d'agents thérapeutiques basés sur des structures haute résolution de nouvelles constructions de phosphatidylinositol-phosphate synthase (pips)
CN109554321A (zh) * 2018-12-03 2019-04-02 清华大学 一种高产脂肽的基因工程菌及其应用
WO2023061961A1 (fr) * 2021-10-11 2023-04-20 Sundew Aps Procédé d'élimination, d'inactivation ou d'inhibition d'algues ou d'algues bleu vert nuisibles susceptibles de provoquer une prolifération d'algues nuisibles (hab)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5770392A (en) * 1996-10-17 1998-06-23 Terragen Diversity Inc. Method and composition for identifying inhibitors of eukaryotic cell processes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5770392A (en) * 1996-10-17 1998-06-23 Terragen Diversity Inc. Method and composition for identifying inhibitors of eukaryotic cell processes

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004315386A (ja) * 2003-04-14 2004-11-11 Hayashibara Takeshi 抗微生物剤
JP4571783B2 (ja) * 2003-04-14 2010-10-27 林原 健 抗微生物剤
KR20160086479A (ko) * 2015-01-09 2016-07-20 한국생명공학연구원 신규한 고리형 뎁시펩타이드계 화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 항균용 약학적 조성물
KR101671325B1 (ko) 2015-01-09 2016-11-02 한국생명공학연구원 신규한 고리형 뎁시펩타이드계 화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 항균용 약학적 조성물
WO2017053458A1 (fr) * 2015-09-21 2017-03-30 The Trustees Of Columbia University In The City Of New York Conception basée sur la structure d'agents thérapeutiques basés sur des structures haute résolution de nouvelles constructions de phosphatidylinositol-phosphate synthase (pips)
CN109554321A (zh) * 2018-12-03 2019-04-02 清华大学 一种高产脂肽的基因工程菌及其应用
CN109554321B (zh) * 2018-12-03 2021-12-31 清华大学 一种高产脂肽的基因工程菌及其应用
WO2023061961A1 (fr) * 2021-10-11 2023-04-20 Sundew Aps Procédé d'élimination, d'inactivation ou d'inhibition d'algues ou d'algues bleu vert nuisibles susceptibles de provoquer une prolifération d'algues nuisibles (hab)

Also Published As

Publication number Publication date
AU2001296253A1 (en) 2002-03-26
WO2002022138A9 (fr) 2003-11-06

Similar Documents

Publication Publication Date Title
Zhu et al. Eliciting antibiotics active against the ESKAPE pathogens in a collection of actinomycetes isolated from mountain soils
Boudjella et al. Taxonomy and chemical characterization of antibiotics of Streptosporangium Sg 10 isolated from a Saharan soil
US9138447B2 (en) Antimicrobial agent and method for the production thereof
Aouiche et al. Saccharothrix sp. PAL54, a new chloramphenicol-producing strain isolated from a Saharan soil
Zhang et al. Inhibitory effects of non-volatiles lipopeptides and volatiles ketones metabolites secreted by Bacillus velezensis C16 against Alternaria solani
Waters et al. Identifying protein kinase inhibitors using an assay based on inhibition of aerial hyphae formation in Streptomyces
Valanarasu et al. Antifungal and antifeedant activities of extracellular product of Streptomyces spp. ERI-04 isolated from Western Ghats of Tamil Nadu
Driche et al. Streptomyces sp. AT37 isolated from a Saharan soil produces a furanone derivative active against multidrug-resistant Staphylococcus aureus
Kariminik et al. Pageantagonistic activity of Actinomycetes on some Gram negative and Gram positive bacteria
WO2002022138A1 (fr) Agents antibacteriens et methodes d'identification
Chandrakar et al. Studies on the production of broad spectrum antimicrobial compound polypeptide (actinomycins) and lipopeptide (fengycin) from Streptomyces sp. K-R1 associated with root of Abutilon indicum against multidrug resistant human pathogens
Rezanka et al. Pharmacologically active sulfur-containing compounds
US8431354B1 (en) Bacterial pheromones and uses therefor
EP0934431B1 (fr) Procede et culture cellulaire permettant d'identifier des inhibiteurs de l'activite des cellules eucaryotes
US6224863B1 (en) Antibiotic composition from alcaligenes species and method for making and using the same
US6713043B2 (en) Antimicrobial activity of gemfibrozil
US6319898B1 (en) Method for inhibiting eukaryotic protein kinases
Wilson et al. SB 205952, a novel semisynthetic monic acid analog with at least two modes of action
Ul-Rahman Taificidin1 and Taificidin2, two anti-microbial agents isolated from the fermentation broth of Streptomyces roseodistaticus TA15 and Streptomyces lavendofoliae TA17
Binod et al. Production of antibiotics by filamentous fungi
Bakheit et al. Antagonistic affects of Actinomycetes isolated from Tuti island farms (Central Sudan) against Fusarium oxysporum f. sp. vasinfectum a phytopathogenic fungus
Mathur et al. Characterization of antimicrobial compounds from Streptomyces isolates
Viswapriya et al. Synergistic Activity of Cyclo (phe-pro) Antibiotic from Streptomyces violascens VS in Reducing the Drug Resistance Burden of Clinically Significant Pathogens
Keramane et al. Antimicrobial screening of Saccharothrix tamanrassetensis DSM 45947 and effect of carbon and nitrogen sources on antibiotic production
Tang et al. Cariogenic Streptococcus mutans produces strain-specific antibiotics that impair commensal colonization

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

COP Corrected version of pamphlet

Free format text: PAGES 1/3-3/3, DRAWINGS, REPLACED BY NEW PAGES 1/3-3/3; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP