WO2002020593A1 - A novel polypeptide - homo nucleoprotein matrix antigen 115.29 and polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide - HOMO nucleoprotein matrix antigen 115.29 and polynucleotide encoding said polypeptide and a process for producing said polypeptide by DNA recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as hemopathy, cancer, dysgenopathy, phlogosis and immune disease, antagonist and the therapeutic use of the polypeptide is also disclosed. In addition, it refers to the use of polynucleotide encoding said HOMO nucleoprotein matrix antigen 115.29.

Description

 A new polypeptide, a mononucleoprotein matrix antigen 115.29, and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a nuclear protein matrix antigen 115.29, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique

 Controlling process of cell growth and differentiation. A variety of different nuclear proteins each play different functions. Some serve as substrates and become scaffold structures where DNA, enzymes, and other molecules adhere at different stages of the cell cycle. Others are regulatory proteins that can instantly bind to the substrate. It can also exist in the nucleus in a dissolved state (Loidl and Eberharter, 1995).

 The nucleoprotein matrix antigen (SA) protein has very little sequence similarity to all other known proteins. SA proteins can also be divided into SA-1 and SA-2 proteins. The cDNAs of SA-1 and SA-2 have 68% similarity and 78% similarity at amino acid levels. However, human and murine nuclear protein matrix antigen 1 (SA-1) is highly homologous and has 92.9% similarity in sequence.

 The SA protein has a REDV sequence, and the REDV sequence is also found in the IIICS selective junction region of fibronectin, and as an adhesion sequence, the REDV sequence interacts with VLA-4 integrin expressed in early hematopoietic cells (Williams et al. al., 1991). However, SA-1 is a nuclear protein and the REDV site is not involved in intracellular recognition, so it can be inferred that it does not play the same role in SA-1 as in fibronectin.

 The expression of SA-1 gene at mRNA level and egg level is very different. SA-1 mRNA is expressed in all tissues and cell lines, while SA-1 protein is mainly found in lymphoid organs. Further research found that it is mainly found in thymic lymphocytes. Not only the SA-1 gene, but also some other genes that show differential expression at the mRNA level and the protein level, that is, mRNA is widely expressed but limited to specific tissues or cells at the protein level in.

 The stromal cells in the blood form an organic scaffold, which facilitates the assembly of hematopoietic cells, and further provides a signal for stem cell seeding, regeneration, reproduction, and differentiation (Dexter and Spooncer, 1987; Zipori, 1992).

Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-fc growth factor stimulation, 1013HT, scar-fc Not stimulated with growth factors, 1013HC; bladder cancer In EJ, bladder cancer, bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunum adenocarcinoma, and cardia cancer, the expression profile of the polypeptide of the present invention and the expression profile of nuclear protein matrix antigen 1 They are very similar, so their functions may be similar. The present invention is named nucleoprotein matrix antigen 115. 29.

 As mentioned above, the nucleoprotein matrix antigen 115. 29 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these The nuclear protein matrix antigen 115. 29 protein of the process, in particular the amino acid sequence of this protein is identified. New nuclear protein matrix antigen 115. The isolation of the protein-encoding genes also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 An object of the present invention is to provide an isolated novel polypeptide-mononucleoprotein matrix antigen 115. 29 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding a nucleoprotein matrix antigen 115. 29.

 Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a nucleoprotein matrix antigen 115. 29.

 Another object of the present invention is to provide a method for producing a nucleoprotein matrix antigen 115. 29.

 Another object of the present invention is to provide antibodies against the polypeptide-mononucleoprotein matrix antigen 11 5. 29 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-mononucleoprotein matrix antigen 11 5. 29 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of nucleoprotein matrix antigen 115. 29.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a); (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b). More preferably, the sequence of the polynucleotide is one selected from: (a) a sequence having positions 359-778 in SEQ ID NO: 1; and (b) a sequence having 1-1669 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit nucleoprotein matrix antigen 1 15.29 protein activity, which comprises utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a nucleoprotein matrix antigen 1 15.29 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of nucleoprotein matrix antigen 1 15. 29.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated otherwise.

"Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan. "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with a nucleoprotein matrix antigen 1 15.29, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a nucleoprotein matrix antigen 1 15.29.

 An "antagonist" or "inhibitor" refers to a molecule that can block or modulate the biological or immunological activity of the nucleoprotein matrix antigen 1 15.29 when combined with the nucleoprotein matrix antigen 1 1 5.29. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to a nucleoprotein matrix antigen 11 5. 29.

 "Regulation" refers to a change in the function of nucleoprotein matrix antigen 1 15.29, including an increase or decrease in protein activity, a change in binding properties, and any other biological property, function, or function of nucleoprotein matrix antigen 1 1 5. 29. Changes in immune properties.

^"11 Substantially pure" means that it is essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify nuclear protein matrix antigens using standard protein purification techniques 1 1 5. 29. The substantially pure nucleoprotein matrix antigen 115. 29 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the nucleoprotein matrix antigen 115. 29 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Sou thern blot or

Nor t hern blot etc.) to detect. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require the binding of two sequences to each other. Combined into specific or selective interactions;

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALTGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods well known in the art such as Jotun Hein ^ "Score (He in J., (1990) Methods in emzology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. The "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and Fv, which can specifically bind to the epitope of nucleoprotein matrix antigen 115. 29.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide coexists with some or all of it in a natural system. The separation of matter is separation. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated nucleoprotein matrix antigen 115. 29" means nucleoprotein matrix antigen 115. 29 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify nucleoprotein matrix antigen 115. 29 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Nucleoprotein matrix antigen 115. 29 The purity of the polypeptide can be analyzed by amino acid sequence.

 The present invention provides a novel polypeptide-mononucleoprotein matrix antigen 115. 29, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of the nucleoprotein matrix antigen 115. 29. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity as the nucleoprotein-based antigen 115.29 of the invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (ΙΠ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as leader sequences or secretory sequences or sequences used to purify this polypeptide or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes a nucleoside of SEQ ID NO: 1 Acid sequence. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1669 bases in length and its open reading frames 359-778 encode 139 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to nucleoprotein matrix antigen 1, and it can be inferred that the nucleoprotein matrix antigen 115. 29 has similar functions to nucleoprotein matrix antigen 1.

 The polynucleotide of the present invention may be in the form of DM or RNA. DNA forms include cDNA, genome

DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be a coding or non-coding strand. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, the "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences The hybridization occurs only when the identity between them is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and Active.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding nucleoprotein matrix antigens 15.29. The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.

 The specific polynucleotide sequence encoding the nucleoprotein matrix antigen 115.29 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating a double-stranded DNA sequence from genomic DM; 2) chemically synthesizing a DNA sequence to obtain the double-stranded DM of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDM of interest is to isolate the raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of the transcript of nucleoprotein matrix antigen 115.29; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2,000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the nucleoprotein matrix antigen 115.29 gene.

 Amplification of DNA / RNA by PCR (Saiki, et al. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain a full-length CDM from a library, the RACE method (RACE- rapid cDNA end amplification method) can be preferably used. The primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis. The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a nucleoprotein matrix antigen 115.29 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .

 In the present invention, a polynucleotide sequence encoding a nucleoprotein matrix antigen 115.29 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a nucleoprotein matrix antigen 115.29 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli. Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a nucleoprotein matrix antigen 115. 29 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method _12, using the procedure well known in the art. Alternative is MgC l _2. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce a recombinant nuclear protein matrix antigen 1 15. 29 (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding the human nucleoprotein matrix antigen 1 15.29 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of nucleoprotein matrix antigen 115. 29 and nucleoprotein matrix antigen 1 of the present invention. The upper graph is a histogram of the expression profile of nucleoprotein matrix antigen 115. 29, and the lower graph is a histogram of the expression profile of nucleoprotein matrix antigen 1. Among them, 1-bladder mucosa, 2-PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6_ scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin , 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated nucleoprotein matrix antigen 115. 29.

15kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally described in the conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spr ing Harbor Laboraty Pres s, 1 989) Conditions, or as recommended by the manufacturer. Example 1: Cloning of nucleoprotein matrix antigen 115. 29

Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isol at ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smar t cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the 5 'and y-terminus sequences of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the CDM sequence of one of the clones 0746C01 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full-length cDNA contained in the 0746C01 clone is 1669bp (as shown in Seq ID N0: 1), and there is a 419bp open reading frame (0RF) from 359bp to 778bp, which encodes a new protein (such as Seq ID N0 : Shown in 2). We named this clone PBS-0746C01, and the encoded protein was named nucleoprotein matrix antigen 115. 29. Example 2: Cloning of a gene encoding nucleoprotein matrix antigen 115. 29 by RT-PCR CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primerl: 5,-GACATTATTGTCCTCTTTTTACAG -3, (SEQ ID NO: 3)

 Primer 2: 5'- TCCAGTGCTTTCCAGATCCTCACC -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

 Amplification reaction conditions: 50 mmol / L KC1, 10 mmol / L in a 50 μ1 reaction volume

Tris-Cl, (pH 8.5), 1.5 ol / L MgCl ₂ , 200 μmol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30s ec; 72 ° C 2min ₀ Set β-act in at Positive control and template blank are negative controls. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1669bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of the expression of the nucleoprotein matrix antigen 115.29 gene:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ^{32 Ρ-} DNA probe labeled with a- ³² P dATP by random priming method. 115.29 nucleoprotein coding sequence matrix antigen (35 ^ to DNA probes used for PCR amplification of FIG. 1 7785 The 32P- labeled probe (about 2x l0 ⁶ cpm / ml) and the RNA transferred The nitrocellulose membrane was hybridized overnight at 42 ° C in a solution containing 50% formamide-25 mM KH ₂ PO ₄ (pH 7.4)-5 SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1 ° /. SDS for 30 min at 55 ° C. Then, analysis and quantification were performed using a Phosphor Imager. Example 4: In vitro expression, isolation and isolation of recombinant nucleoprotein matrix antigen 115.29 purification

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer3: 5 '-CCCCATATGATGAATAAATTCACTCTTCCCTTT- 3' (Seq ID No: 5) Primer4: 5'-CATGGATCCTCAAACCCAGAGACCTGTCCCAGA-3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively. The Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). The PCR reaction was performed using the pBS-0746C01 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0746C01 plasmid, primers Primer-3 and Primer-4 were included in a total volume of 50 μ1; j was 10 pmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into colibacillus DH5a by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 () μ _β / ηι1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0746C01) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host bacteria BL21 '(pET-0746C01) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). The purified protein nuclear protein matrix antigen 115.29 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 15 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of Antinuclein Matrix Antigen 115.29 Antibody

Polypeptide synthesizer (product of PE company) was used to synthesize the following nucleoprotein matrix antigen 115.29-specific peptides: NH2-Met-Asn-Lys-Phe-Thr-Leu-Pro-Phe-Pro-Leu-Gly-Val-Leu- Cys-Leu-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see-Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex with complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sephar _0Se 4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to nucleoprotein matrix antigen 115.29. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

The selection of suitable oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes is versatile For example, if the probe can be used to hybridize to a genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting,

Northern blotting and photocopying methods, etc., all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30¾-70%, and the non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

Probe l (prob _e l), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID N0: 1 (41Nt): 5'-TG AAT AAATTCACTCTTCCCTTTCCACTGGGAGTGCTGTGT- 3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41M ):

 5'-TGAATAAATTCACTCTTCCCCTTCCACTGGGAGTGCTGTGT-3 '(SEQ ID NO: 9) For other common reagents not listed in the following specific experimental procedures and their preparation methods, please refer to the literature:

DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning experiment manuals such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Scientific Publishing Agency.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a level orphan immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenization buffer (0.25mol / L sucrose; 25mraol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25cryptol / L MgCl ₂ ) to suspend the pellet (about 10ml / g) _o 4) in The tissue suspension was homogenized at 4 ° C with an electric homogenizer at full speed until the tissue was completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the original tissue sample) and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x ^{10 8} cells / ml). Use a minimum of 100 ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification of DNA and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DM solution and mix well. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Use 500ul cold Wash the pellet with ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper, and gradually increase TE, mix until the DNA is fully dissolved, and add approximately 1 ul for each 1- 5 x 10 ^δ cells extracted.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

⁸ ) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well-20 ^{DC for} 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

 1) Take 4 X 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 "C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi y- ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) The combined solution after the first peak was collected as ³² P-Probe (second peak to prepare the desired free γ- ³² Ρ- dATP). Pre-hybridization

The sample membrane was placed in a plastic bag, and 3-lQnig prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml) was added. CT DNA (calf thymus DNA). ), After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight.

 Wash film:

 High-intensity washing film:.

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1 SDS at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 '1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 ° / oSDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 4) 0. lxSSC, 0.1. /. Wash in SDS at 40 ° C for 15 minutes (twice) and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot). ·

 Experimental results:

 的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.

Example 7 DNA Mi croarray

Gene chip or microarray is a new technology that many national laboratories and large pharmaceutical companies are currently working on. It refers to the orderly and high-density arrangement of a large number of target gene pieces. The data is compared and analyzed on a carrier such as glass, silicon, and the like by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and with high throughput. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps are in the literature There have been many reports, see, for example, DeRisi, JL, Lyer, V. & Brown, P.0.

(1997) Science 278, 680-686. And Helle, R. A., Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μπι. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking apparatus. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. 0.2 ° /. SDS wash for 1 minute; '

 7. dd 0 flush twice;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP was separately reverse-transcribed. (5-Araino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'- Deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye (purchased from Amersham Pharaacia Biotech) was used to label mRM of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification. For specific steps and methods, see:

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Sc hena, M., Shalon, Dari., Davis, RW (1995) Science. 270. (20): 467-480.

 (Three) cross

Combine the probes from the two tissues with the chips in UniHyb ™ Hybridization Solut ion (purchased from Tel eChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from Genera Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, F i brobl as t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios. (figure 1 ). It can be seen from the figure that the expression profile of nucleoprotein matrix antigen 115. 29 and nucleoprotein matrix antigen 1 according to the present invention are very similar. Industrial applicability

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Nuclear proteins are involved in the control of cell growth and differentiation. A variety of different nuclear proteins each play different functions. Some serve as substrates and become scaffold structures where DNA, enzymes, and other molecules adhere at different stages of the cell cycle. Others are regulatory proteins that can instantly bind to the substrate. It can also exist in the nucleus in a dissolved state.

 Nucleoprotein Matrix Antigen (SA) protein is a nuclear protein, which has a REDV sequence, and the REDV sequence is also found in the II ICS selective junction region of fibronectin, and as an adhesion sequence, the REDV sequence can interact with VLA-4 integrins expressed in hematopoietic cells interact. However, SA-1 is a nuclear protein, and the REDV site is not involved in intracellular recognition, so it can be inferred that it does not play the same role in SA-1 as in fibronectin.

 The stromal cells in the blood form an organic scaffold, which facilitates the assembly of hematopoietic cells, and further provides a signal for the seeding, regeneration, reproduction, and differentiation of stem cells.

 The expression profile of the 'polypeptide' of the present invention is consistent with the expression profile of human nucleoprotein matrix antigen 1, and both have similar biological functions. The polypeptide of the present invention relates to the process of controlling cell growth and differentiation in vivo, and especially relates to the interaction with proteins expressed by early hematopoietic cells. It is extremely important for the migration of blood stromal cells and the proliferation and differentiation of hematopoietic stem cells. The occurrence of pathological processes such as related substance metabolism disorders, protein dysfunction, and tumors of related tissues are closely related, and related diseases occur.

It can be seen that abnormal expression of the nucleoprotein matrix antigen 115. 29 of the present invention will cause various diseases, especially Hematopathy, various tumors, developmental disorders, inflammation, immune diseases, these diseases include but are not limited to: Hematology: Leukopenia and agranulocytosis, leukemia, lymphoma, multiple myeloma, malignant tissue cells Disease, anemia, erythrocytosis, hereditary oval red blood cells

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, (ependymoma, glioblastoma, Neurofibromas, Colon Cancer, Endometrial Cancer, Fibroma, Fibrosarcoma

 Developmental disorders: congenital abortion, cleft palate, lack of limbs, limb differentiation disorders, atrial septal defect, neural tube defects, congenital hydrocephalus, mental retardation, brain development disorders, skin, fat and muscular dysplasia, Bone and joint dysplasia, various metabolic defects, sexual retardation

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease The primary B-lymphocyte immunodeficiency disease, the acquired immunodeficiency syndrome, the abnormal expression of the nucleoprotein matrix antigen 1 1 5. 29 of the present invention will also produce certain genetic diseases and the like. The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially blood diseases, various tumors, developmental disorders, inflammation, and immune diseases. Some hereditary diseases.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the nucleoprotein matrix antigen 1 1 5. 29. Agonists increase the nuclear protein matrix antigen 11 5. 29 stimulate cell proliferation and other biological functions, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing nucleoprotein matrix antigen 1 1 5. 29 can be cultured with labeled nucleoprotein matrix antigen 115. 29—in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.

Antagonists of nucleoprotein matrix antigen 115. 29 include screened antibodies, compounds, receptor deletions and the like. The nucleoprotein matrix antigen 115. 29 antagonist can bind to the nucleoprotein matrix antigen 1 1 5. 29 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function. biological functions. In screening compounds that act as antagonists, nucleoprotein matrix antigen 115. 29 can be added to the bioanalytical assay to determine whether the compound is an Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to nucleoprotein matrix antigen 1 15.29 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the nucleoprotein matrix antigen 115. 29 molecules should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against a nucleoprotein matrix antigen 115. 29 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by direct injection of nucleoprotein matrix antigen 1 15. 29 into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies against nucleoprotein matrix antigen 115. 29 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc. The chimeric human antibody constant region and the variable region of non-human origin may be used in combination Pat some production techniques (Morr i son etal, PNAS, 1985, 81: 6851) 0 only some technical production of single chain antibodies (US Pa t No. 4946778) can also be used to produce single-chain antibodies against nuclear protein 115. 29.

 Antibodies against nucleoprotein matrix antigen 115. 29 can be used in immunohistochemical techniques to detect nucleoprotein matrix antigen 115. 29 in biopsy specimens.

 Monoclonal antibodies that bind to nucleoprotein matrix antigen 115. 29 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, the nucleoprotein matrix antigen '115. 29 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill the nucleoprotein matrix antigen 115. 29 positive cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to nucleoprotein matrix antigen 115. 29. Administration of an appropriate dose of antibody can stimulate or block the production or activity of nucleoprotein matrix antigen 115. 29.

The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of nucleoprotein matrix antigen 115. 29. These tests are well known in the art and include FI SH assays and radioimmunoassays. Tested during the test The level of nucleoprotein matrix antigen 115.29 can be used to explain the importance of nucleoprotein matrix antigen 115.29 in various diseases and to diagnose diseases where nucleoprotein matrix antigen 115.29 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

 The polynucleotide encoding the nucleoprotein matrix antigen 115.29 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of nucleoprotein matrix antigen 115.29. Recombinant gene therapy vectors (such as viral vectors) can be designed to express the mutated nucleoprotein matrix antigen 115.29 to inhibit endogenous nucleoprotein matrix antigen 115.29 activity. For example, a mutated nuclear protein matrix antigen 115.29 may be a shortened nuclear protein matrix antigen 115.29 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of nuclear protein matrix antigen 115.29. Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a nuclear protein matrix antigen 115.29 into a cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a nucleoprotein matrix antigen 115.29 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding the nucleoprotein matrix antigen 115.29 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RM and DNA) and ribozymes that inhibit nucleoprotein matrix antigen 115.29 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA, DM, and ribozymes can be obtained by any RNA or DNA synthesis technology. For example, solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding the nucleoprotein matrix antigen 115.29 can be used for the diagnosis of diseases related to the nucleoprotein matrix antigen 115.29. The polynucleotide encoding the nucleoprotein matrix antigen 115.29 can be used to detect the expression of the nucleoprotein matrix antigen 115.29 or the abnormal expression of the nucleoprotein matrix antigen 115.29 in a disease state. For example, the DNA sequence encoding the nucleoprotein matrix antigen 115.29 can be used to hybridize biopsy specimens to determine the expression of the nucleoprotein matrix antigen 115.29. Hybridization techniques include Southern blotting, Northern blotting, In situ hybridization, etc. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. The nucleoprotein matrix antigen 115. 29 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the nucleoprotein matrix antigen 115. 29 transcription products.

 Detection of nucleoprotein matrix antigen 115. 29 mutations can also be used to diagnose nucleoprotein matrix antigen 115. 29-related diseases. Nucleoprotein matrix antigen 115. 29 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type nucleoprotein matrix antigen 115. 29 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeat polymorphisms) are available for labeling chromosomal positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mendel i an Inher i tance in Man (available online with Johns Hopkins University Welch Medi Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individual, then the Mutations may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping) Resolving power and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Nucleoprotein matrix antigen 115. 29 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of nucleoprotein matrix antigen 115.29 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Rights

I. An isolated polypeptide-nucleoprotein matrix antigen 115. 29, characterized in that it comprises: a polypeptide having the amino sequence of SEQ ID NO: 2, or an active fragment, analog, or derivative of a polypeptide thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. '

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide having at least 7 W identity with (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 359-778 in SEQ ID NO: 1 or the sequence of positions 1-1669 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 with a plasmid, virus or a carrier expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having nucleoprotein matrix antigen 11 5.29 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing nucleoprotein matrix antigen 115.29;

 (b) Isolating a polypeptide having nucleoprotein matrix antigen 115. 29 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to a nucleoprotein matrix antigen 115. 29.

II. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of a nucleoprotein matrix antigen 115. 29.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 1 3. A use of the compound according to claim 11, characterized in that the compound is used for regulating the activity of nucleoprotein matrix antigen 115. 29 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimic, agonist, antagonist or inhibitor of nuclear protein matrix antigen 115. 29; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for the production of a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormalities of the nucleoprotein matrix antigen 115. 29.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.