WO2002017947A2 - Use of t proteins for the differential characterization and treatment of lesions and tumors of the nervous system - Google Patents

Abstract

The invention relates to the use of T proteins or of the nucleic acid sequences that code therefor and of antibodies directed against the T proteins for the differential characterization and treatment of lesions and tumors of the nervous system.

Description

Use of T-proteins for the differential characterization and therapy of injuries and tumors of the nervous system

The present invention relates to the use of T proteins or the nucleic acid sequences coding therefor and antibodies to the T proteins for the differential characterization and therapy of injuries and tumors of the nervous system.

So far, it has been a major problem in the treatment of tumors of the nervous system, in particular brain tumors, that very similar-looking tumors often have fundamental differences in the genetic changes that have led to the development of the tumor. This heterogeneity of the molecular changes in different tumors of an apparently identical tumor type often has a very negative effect on the treatment of these tumors, with drastic, often fatal consequences for cancer patients. For example, the amplification of the N-Myc gene in neuroblastomas is of great importance for the survival of the patients. Because of this fact, neuroblastoma patients are tested for amplification of the N-Myc gene and the subsequent treatment is targeted, i.e. if amplification is present, more rigid therapy is used than if there had been no amplification. This shows how important it is to be able to understand the molecular processes that led to or contributed to the development of the tumor. However, there are not enough markers of the information quality of the N-Myc gene.

The object of the present invention is therefore to provide diagnostic and therapeutic agents which make it possible to identify and treat the different molecular changes in different tumors and injuries to the nervous system. This is supposed to be a differential diagnosis and therapy of injuries and tumors of the nervous system be made possible.

This object is achieved by providing the embodiments characterized in the patent claims.

The present invention relates to the use of at least one DNA sequence for the differential identification and therapy of molecular changes in injuries and tumors of the nervous system, the DNA sequence comprising the following DNA sequences:

(a) the DNA sequence of Fig. 1, Fig. 2 or Fig. 3;

(b) variants, derivatives, precursors or fragments of the DNA sequence of (a); or

(c) a DNA sequence that differs from the DNA sequence of (a) or (b) due to the degeneration of the genetic code.

The sequences shown in FIGS. 1 to 3 are fragments or variants of the T genes (T1, T2, T3) which are described in detail in the earlier applications DE 199 08 423.8 and PCT / DE00 / 00583.

It was found by the inventors that the T1 protein, after an injury to the brain, is increasingly formed in the cells - mainly astrocytes - that surround the scar. No increased expression is found in the neurons and glial cells in the zone of anterograde degeneration in the early phase of degeneration. The central nervous system responds to injuries and illnesses through strong proliferation of astrocytes, which leads to the formation of a neural / glial scar. This process is subject to precise control mechanisms, since a CNS injury does not lead to an uncontrolled proliferation of astrocytes, as is the case with glial tumors, for example. Errors in regenerative processes after an injury to the nervous system or disturbances in the control of these processes can lead to tumor diseases of the nervous system. The inventors therefore developed the control mechanisms and those involved Proteins identified. Through the targeted characterization and influencing of these mechanisms and proteins, a positive influence on healing processes of the nervous system and the therapy of tumors of the nervous system can be achieved.

It was further recognized by the inventors that not all astrocytes proliferate after an injury to the nervous system and that those that proliferate proliferate in a very defined manner, which can cause cancer in certain cases. The mechanisms that control astrocyte proliferation are poorly understood. The identification of the T1 protein as a component in this regeneration process now allows targeted intervention in these processes and the development of therapies for the treatment of traumatic injuries and tumors.

Differentially spliced exons identified by the underlines in the sequences of FIGS. 1, 2 and 3 were identified by the inventors. These represent the decisive identification parameters for the classification of the various injuries and tumors of the nervous system. The existence or absence of the necessary conclusions can be drawn about the disease. With the help of these differentially spliced exons, it is possible to identify proteins or other molecules that interact with these sequences. These in turn can be used for the diagnosis and therapy of injuries and tumors of the nervous system as well as the sequences of Figures 1, 2 or 3 identified above.

The inventors have found that genes T1, T2 and T3 are differentially expressed in tumors of the nervous system. The genes T1 and T2 are expressed in the glioblastoma cell lines H4 and A172, whereas the expression of T3 is absent. All members of the T gene family are expressed in the four of seven glioblastoma cell lines tested (U118MG, U373-MG, U87MG and HS683). No expression of the T gene family was detectable in the U343MG glioblastoma cell line. The medulloblastoma cellemia DAOY showed a reduced T1 and T2 expression while the T3 expression was missing. No expression of the T gene family could be detected in the leukemia cell line. In the primitive neuroectodermal tumor cell line MHH-PNET there is only expression of the T3 gene. This analysis shows that the three T genes are differentially expressed in tumor cell lines. Furthermore, analysis of the expression of T1 in primary tumors shows that expression in neuroblastomas is reduced. In 4 out of 10 neuroblastomas tested (NB-T3, NB-T4m, NB-T7, NB-T8) a reduced or almost absent expression of T1 was found. The extent of the reduction in expression is much stronger, since the tumors have a normal tissue proportion (approx. 20-50%). In primary neuroblastomas, the malignant phenotype is associated with a reduced expression of T1. These results are confirmed in Fig. 4.

The T1, T2 and T3 genes are regulated at the transcriptional level. A further complexity of the regulation of these genes could be shown, since multiple splice variants of the T genes could be isolated. The exons marked with underlines in FIGS. 1, 2 and 3 could be identified. The size of two of these alternatively spliced exons is 42 and 24 bp. The third differential exon has a different size within the T gene family. In T1, the third differentially spliced exon is 21 bp, while in T2 and T3 it is only 9 bp long. Differential splicing of these three exons results in eight different protein isoforms, 24 different protein isoforms within the T gene family, and 512 protein isoform combinations in total. All three differentially spliced exons are located in an area flanked by the leucine zipper and the PXXP motif at T1. Leucine zippers and PXXP motifs are well-studied protein motifs that enable protein-protein binding. The three differentially spliced exons are located exactly in this area and specifically change the interaction of the T proteins with other proteins.

The terms “variants” or “fragment” used in the present invention encompass DNA sequences which differ from those shown in the figures. differentiate sequences by deletion (s), insertion (s), exchange (s) and / or other modifications known in the art or comprise a fragment of the original nucleic acid molecule, the protein or peptide encoded by these DNA sequences still has the above-mentioned properties. It is preferred that the variants still have a homology of at least 80%, preferably at least 90% and very preferably 95%. Functional equivalents, derivatives and precursors (bioprecursors) are therefore included. Derivatives are, for example, mutation derivatives (generated by, for example, deletions or insertions), fusions, allele variants, muteins and splice variants. Methods for generating the above changes in the nucleic acid sequence are known to the person skilled in the art and are described in standard works in molecular biology, for example in Sambrook et al., Supra. The person skilled in the art is also able to determine whether a protein encoded by a nucleic acid sequence modified in this way still has the properties mentioned above. Preferred fragments are the sequences highlighted by underlining in FIGS. 1, 2 and 3.

In a preferred embodiment, the present invention relates to the use of a DNA sequence which encodes a protein which comprises the amino acid sequence of FIG. 1, 2 or 3 or parts thereof, the protein having the biological activity defined above and can be used to diagnose and treat injuries and tumors of the nervous system. The parts of the sequences are preferably the fragments highlighted in the figures by underlining.

The DNA sequences to be used according to the invention can also be inserted into a vector or expression vector. Thus, vectors or expression vectors containing these DNA sequences can also be used according to the invention. The term "vector" refers to a plasmid (eg pUC18, pBR322, pBlueScript), a virus or another suitable vehicle. In a preferred embodiment, the DNA molecule in the vector is functionally linked to regulatory elements that express it in prokaryotic or allow eukaryotic host cells. In addition to the regulatory elements, for example a promoter, such vectors typically contain an origin of replication and specific genes which allow the phenotypic selection of a transformed host cell. The regulatory elements for expression in prokaryotes, for example E. coli, include the lac, trp promoter or T7 promoter, and for expression in eukaryotes the AOX1 or GAL1 promoter in yeast, and the CMV, SV40 , RVS-40 promoter, CMV or SV40 enhancer for expression in animal cells. Further examples of suitable promoters are the metallothionein I and the polyhedrin promoter. In a preferred embodiment, the vector contains the promoter of the human T gene or an orthologist of the T gene. Suitable expression vectors for E. coli include, for example, pGEMEX, pUC derivatives, pGEX-2T, pET3b and pQE-8, the latter being preferred. Vectors suitable for expression in yeast include pY100 and Ycpadl, pMSXND, pKCR, pEFBOS, cDM8 and pCEV4 for expression in mammalian cells. The expression vectors according to the invention also include vectors derived from baculovirus for expression in insect cells, for example pAcSGHisNT-A. General methods known in the art can be used to construct expression vectors containing the DNA sequences to be used according to the invention and suitable control sequences. These methods include, for example, in vitro recombination techniques, synthetic methods and in vivo recombination methods, as are described, for example, in Sambrook et al., Supra. The DNA sequences to be used according to the invention can also be inserted in connection with a DNA coding for another protein or peptide, so that the DNA sequences can be expressed, for example, in the form of a fusion protein. These other DNAs are preferred reporter sequences which encode a reporter molecule which comprises a detectable protein, for example a dye, an antibiotic resistance, β-galactosidase or a substance which can be detected by spectroscopic hotometric, spectrofluorometric, luminescent or radioactive assays.

The DNA sequences inserted into a vector can be brought into host cells become. These host cells include bacteria (for example the E. coli strains HB101, DH1, x1776, JM101, JM109, BL21 and SG13009), fungi, for example yeasts, preferably S. cerevisiae, plant cells, insect cells, preferably sf9 cells, and animal cells, preferably vertebrate or mammalian cells. Preferred mammalian cells are CHO, VERO, BHK, HeLa, COS, MDCK, 293 and WI38 cells. Methods for transforming these host cells, for phenotypically selecting transformants, and for expressing the DNA molecules using the vectors described above are known in the art.

The proteins to be used according to the invention preferably have the amino acid sequences shown in FIGS. 1, 2 or 3 or represent fusions, fragments, derivatives or precursors (bioprecursors) thereof, the properties mentioned above being retained in the sense of functional equivalents stay. With regard to the definitions of these terms, reference is made to the respective explanations above. Derivatives are to be understood in particular as those modified proteins or peptides that differ from the sequences shown in the figures by conservative amino acid exchanges or contain non-conservative amino acid exchanges that do not significantly change the function of the T proteins. Preferred fragments are the sequences highlighted by underlining in FIGS. 1, 2 or 3.

For the diagnostic or therapeutic purposes according to the invention, antibodies against the proteins described above or against fragments thereof, in particular against the sequences underlined in FIGS. 1, 2 or 3, can also be used instead of the above-described DNA molecules or proteins. These antibodies can be monoclonal, polyclonal or synthetic antibodies or fragments thereof. In this context, the term “fragment” means all parts of the monoclonal antibody (for example Fab, Fv or “single chain Fv” fragments) which have the same epitope specificity as the complete antibody. The production of such fragments is known to the person skilled in the art. The antibodies are preferably monoclonal antibodies. The antibodies can be prepared according to standard procedures the protein encoded by the DNA sequences or a synthetic fragment thereof serving as an immunogen. Methods for obtaining monoclonal antibodies are known to the person skilled in the art and include, for example, as a first step the production of polyclonal antibodies using the proteins according to the invention or fragments thereof (for example synthetic peptides) as immunogen for immunizing suitable animals, for example rabbits or chickens, and the production of the polyclonal Antibodies from the serum or egg yolk. Then, for example, Zeil hybrids are produced and cloned from antibody-producing cells and bone marrow tumor cells. A clone is then selected which produces an antibody which is specific for the antigen used. This antibody is then made. Examples of cells that produce antibodies are spleen cells, lymph node cells, B-lymphocytes, etc. Examples of animals that can be immunized for this purpose are mice, rats, horses, goats and rabbits. The myeloma cells can be obtained from mice, rats, humans or other sources. Cell fusion can be carried out, for example, by the well-known Köhler and Milstein method. The hybridomas obtained by cell fusion are screened by means of the antigen by the enzyme-antibody method or by a similar method. For example, clones are obtained using the limit dilution method. The clones obtained are, for example, implanted intraperitoneally in BALB / c mice, the ascites are removed from the mouse after 10 to 14 days, and the monoclonal antibody is purified by known methods (for example ammonium sulfate fractionation, PEG fractionation, ion exchange chromatography, gel chromatography or affinity chromatography). In a particularly preferred embodiment, the monoclonal antibody mentioned is an antibody derived from an animal (for example a mouse), a humanized antibody or a chimeric antibody or a fragment thereof. Chimeric, human antibody-like or humanized antibodies have a reduced potential antigenicity, but their affinity for the target is not reduced. The production of chimeras and humanized antibodies or of antibodies similar to human antibodies has been described in detail (see for example Queen et al., Proc. Natl. Acad. Sci. USA 86: 10029 (1989) and Verhoeyan et al. (1988) Science 239: 1534). Humanized immunoglobulins have variable scaffold areas, which essentially come from a human immunoglobulin (with the name acceptor immunoglobulin) and the complementarity of the determining areas, which essentially come from a non-human immunoglobulin (eg from the mouse) (with the name donor immunoglobulin). The constant region (s), if any, also originate essentially from a human immunoglobulin. When administered to human patients, humanized (as well as human) antibodies offer a number of advantages over antibodies from mice or other species: (a) the human immune system should not recognize the backbone or constant region of the humanized antibody as foreign and therefore should Antibody response against such an injected antibody is lower than against a completely foreign mouse antibody or a partially foreign chimeric antibody; (b) since the effector area of the humanized antibody is human, it is likely to interact better with other parts of the human immune system, and (c) injected humanized antibodies have a half-life that is essentially equivalent to that of naturally occurring human antibodies, which it is allows smaller and less frequent doses to be administered compared to antibodies from other species. The antibodies can be used, for example, for the immunoprecipitation of the proteins discussed above in the context of the differential diagnosis and therapy of tumors of the nervous system. By providing the antibodies, it is possible to examine sections or smears of tumors or other patient material and to determine whether there are protein isoforms of the T protein family that are specific for tumors or injuries. Furthermore, it is also possible to identify protein isoforms that are of prognostic importance for the treatment of patients.

The invention enables the differential diagnosis and treatment of cancer, including tumors of the nervous system, such as neuroblastoma, astrocytoma, glioblastoma, medulloblastoma. This diagnosis can be made not only postnatally, but already prenatally. With a DNA sequence as defined above or derived from it Probes or primers can be determined in mammals, in particular humans, whether they contain a gene which encodes and / or expresses the protein according to the invention or whether this gene leads to a mutated form of the protein which is no longer biologically active. To this end, the person skilled in the art can carry out customary methods, such as reverse transcription, PCR, LCR, hybridization and sequencing. The antibodies according to the invention are also suitable for diagnostics, ie for example for the detection of the presence and / or the concentration of the protein according to the invention, a shortened or extended form of the protein etc. in a sample. The antibodies can be bound, for example, in liquid phase immunoassays or to a solid support. The antibodies can be labeled in different ways. Suitable markers and labeling methods are known in the art. Examples of immunoassays are ELISA and RIA.

The differentially spliced exon sequences and the protein isoform-specific amino acid sequences encoded therein can also be used to develop new methods and drugs. For this, e.g. the protein isoform-specific amino acid sequences are used as binding partners for other proteins or substances in general (chemicals, substance libraries) in order to identify molecules or other proteins which bind to the protein isoform-specific amino acid sequences. This method enables new molecules or proteins to be found that specifically block or enhance the action of individual protein isoforms. The new molecules found can then also influence other proteins that start elsewhere in the signal cascade.

Injuries to the nervous system include, for example, traumatic brain injuries or paraplegia.

Thus, within the scope of the present invention, a diagnostic method for the detection of a disturbed expression of the protein according to the invention or for the detection of a modified form of this protein (splicing variant) takes place, in which brings a sample into contact with the DNA or protein sequences or the antibody or fragment thereof and then, for example, directly or indirectly determines whether the concentration of the protein and / or its amino acid sequence differs in comparison to a protein obtained from a healthy patient.

The present invention also allows therapeutic measures to be performed on the disorders discussed above, i.e. The DNA sequences, proteins and antibodies according to the invention described above can also be used for the production of a medicament, for example for controlling the expression of the protein according to the invention or for exchanging a mutated form of the gene for a functional form and thus also for the production of a medicament for prevention or the treatment of tumor diseases of the nervous system. For example, the protein according to the invention can be introduced into mammals, in particular humans, by customary measures. For this purpose, it may be beneficial to attach the protein to a protein that is not considered foreign by the respective body, e.g. Pair transferrin or bovine serum albumin (BSA). The expression of the protein or the related proteins can be controlled and regulated with the antibody mentioned.

The therapy according to the invention is carried out with a medicament which contains the DNA sequences described above, the expression vector, the protein or the antibody or fragments thereof. This drug may also contain a pharmaceutically acceptable carrier. Suitable carriers and the formulation of such medicaments are known to the person skilled in the art. Suitable carriers include, for example, phosphate-buffered saline solutions, water, emulsions, for example oil / water emulsions, wetting agents, sterile solutions, etc. The medicaments can be administered orally or parenterally. Methods for parenteral administration include topical, intra-arterial, intramuscular, subcutaneous, intramedullary, intrathecal, intravenous, intravenous, intraperitoneal, or intranasal. The appropriate dosage is determined by the attending physician and depends on various factors, for example the age, gender, weight of the patient, the stage of the disease, the type of administration, etc.

The nucleic acids described above are preferably inserted into a vector suitable for gene therapy and introduced into the cells, for example under the control of a tissue-specific vector. In a preferred embodiment, the vector containing the nucleic acids described above is a virus, for example an adenovirus, vaccinia virus or adenovirus. Retroviruses are particularly preferred. Examples of suitable retroviruses are MoMuLV, HaMuSV, MuMTV, RSV or GaLV. For the purposes of gene therapy, the nucleic acids according to the invention can also be transported to the target cells in the form of colloidal dispersions. These include, for example, liposomes or lipoplexes (Mannino et al., Biotechniques 6 (1988), 682).

Finally, to carry out the present invention, a diagnostic kit for carrying out the diagnostic method described above is also provided, which contains at least one of the above-described DNA sequences, the protein or the above-described antibody or fragments thereof. Depending on the design of the diagnostic kit, the DNA sequence, protein sequence or the antibody or fragments thereof can be immobilized.

Sequences of the T genes can be applied to nylon membranes or glass supports and hybridized with samples (DNA, cDNA or RNA) from tumors and associated normal tissues, or sick and associated healthy tissues. This enables the (fully automated) detection of the expression of these genes. The sequences used for this can be, for example, the entire cDNA sequence or short sequence sections, for example 10-15 bp oligomers. After determining the expression of the T genes, the therapy, including cancer therapy, can then be specifically selected or adapted according to the individual situation of the patient. Hybridization with the T genes makes it possible to express the individual T genes and T gene partial sequences. to determine zen. This makes it possible to carry out a very quick diagnosis and to adapt a therapy to the molecular genetic peculiarities. This is associated with a significantly increased therapy or healing rate.

The isolation and characterization of the above sequences, in particular the different splice variants, allow the establishment of an animal model, which is very valuable for the further study of injuries to the nervous system and cancer at the molecular level. A non-human mammal is also being developed for diagnostic purposes, the T1 gene or the T2 or T3 gene of which has been altered, e.g. by inserting a heterologous sequence, in particular a selection marker sequence.

The term "non-human mammal" includes any mammal whose T gene, or T2 or T3 gene, may be altered. Examples of such mammals are mouse, rat, rabbit, horse, cattle, sheep, goat, monkey, pig, dog and cat, with mouse being preferred.

The expression “T gene or T2 or T3 gene that has been changed” means that the gene which occurs naturally in the non-human mammal is modified by standard methods by means of standard methods to change the gene structure or the gene sequence. This can be achieved, inter alia, by introducing a deletion of approximately 1-2 kb, in the place of which a heterologous sequence, for example a construct for mediating antibiotic resistance (for example a “neo-cassette”), is introduced. Furthermore, heterologous sequences can be introduced into the T gene, which allow time and tissue-specific deletions to be carried out in vivo. Furthermore, heterologous sequences can be introduced into the T gene, which make it possible to follow the expression of the T gene in vivo. This can be carried out, inter alia, by inserting a sequence coding for the GFP (green fluorescent protein) protein within an exon or as an independent exon. These methods are generally described in Schwartzberg et al., Proc. Natl. Acad. Be. USA, Vol. 87, pp. 3210-3214, 1990, to which reference is made here. In particular, "non-human Mammals "in which individual differentially spliced exon sequences are deleted. This leads to the failure of individual protein isoforms, but without preventing the formation of the other protein isoforms. In this way, three different" knock-outs "can be carried out for each individual T gene with a differentially spliced exon deleted, resulting in three different "knock-out" types per T gene and a total of nine "knock-out" types for all three T genes. By crossing these nine "knock -out "types can then be formed from all 512 possible genotypes. These animals can be used as an animal model to examine the effects of the lack of individual protein isoforms. At the same time, the animals can be used to develop new drugs for the symptoms that have occurred.

In particular, the change can be carried out as described below. For example, you can delete the underlined exon sequences or change them so that the gene is spliced in a different way than usual. Furthermore, by inserting a splice acceptor sequence of another exon of the T gene into the intron sequence, a sequence can be inserted into this intron which is recognized as an exon and which is spliced to the exons of the T gene located in front of it. This inserted sequence can be, for example, an exon that encodes the EGFP protein (Enhanced Green Fluorescent Protein). This turns the original T gene into a fusion protein that contains the EGFP protein. In this way, a mouse can preferably be generated which allows the expression of the T gene to be monitored in vivo. The inserted sequence can be designed in the end (eg polyA signal, splice signals, etc.) such that no further exons of the T gene are spliced to the inserted exon or the spliced exons are no longer translated. This results in a deletion of the mouse T protein at the C-terminal end or a premature termination of the reading frame and an (at least partial) inactivation of the protein function of the mouse T gene can be achieved. Furthermore, such sequences can also be inserted as current exon sequences which result in an mRNA sequence in which this new mRNA sequence is located at the 3 'end. Suitable sequences can then be used to change the stability of the mRNA or to change its location in the cell. The the associated phenotype of the mice modified in this way can then provide important conclusions about the function of the T gene. These mice can then also be used to find new active substances that compensate for the loss of function of the T gene.

Cells from the above non-human mammal can also be obtained. These cells can be in any form, e.g. in a primary or long-term culture.

A non-human mammal can be provided by conventional methods. A method is favorable which comprises the following steps:

(a) Production of a DNA fragment, in particular a vector, containing an altered T, T2 or T3 gene, the gene having been altered by inserting a heterologous sequence, in particular a selectable marker;

(b) preparation of embryonic stem cells from a non-human mammal (preferably mouse);

(c) transforming the embryonic stem cells from step (b) with the DNA fragment from step (a), the T gene in the embryonic stem cells being changed by homologous recombination with the DNA fragment from (a),

(d) culturing the cells of step (c),

(e) selection of the cultured cells from step (d) for the presence of the heterologous sequence, in particular the selectable marker,

(f) generating chimeric non-human mammals from the cells of step (e) by injecting these cells into mammalian blastocysts (preferably mouse Blastocysts), transfer of the blastocysts into pseudo-pregnant female mammals (preferably mouse) and analysis of the progeny obtained for a change in the T gene.

In step (c), the mechanism of homologous recombination (see R.M. Torres, R. Kühn, Laboratory Protocols for Conditional Gene Targeting, Oxford University Press, 1997) is used to transfect embryonic stem cells. The homologous recombination between the DNA sequences present in a chromosome and new, added cloned DNA sequences enables the insertion of a cloned gene into the genome of a living cell instead of the original gene. With this method, embryonic germ cells can be used to obtain via chimeras animals that are homozygous for the desired gene or the desired gene part or the desired mutation.

The term "embryonic stem cells" refers to any embryonic stem cells from a non-human mammal that are suitable for mutating the T gene. The embryonic stem cells are preferably from the mouse, in particular the cells E14 / 1 or 129 / SV.

The term "vector" encompasses any vector which, by recombination with the DNA of embryonic stem cells, enables a change in the T1, T2 or T3 gene. The vector preferably has a marker which can be used to select for existing stem cells in which the desired recombination has taken place. Such a marker is e.g. the loxP / tk neo-cassette, which can be removed from the genome again using the Cre / loxP system.

Furthermore, the person skilled in the art knows conditions and materials in order to carry out steps (a) - (f).

The present invention provides a non-human mammal whose T1, T2 or T3 gene is altered. This change can be a switching off of the gene expression regulating function. With such a mammal or cells from them, the gene expression-controlling function of the T protein can be examined selectively. It is also possible to find substances, drugs and therapeutic approaches that can be used to selectively influence the controlling function. The present invention therefore provides a basis for acting on a wide variety of diseases. Such diseases are, for example, restrictions on the CNS functions due to injury or the induction of cancer due to errors in the control of cell proliferation.

The invention is further described with reference to the figures, which show:

Figure 1: human cDNA sequence (gene T1) and deduced amino acid sequence underlined sequences: exon

Figure 2: human cDNA sequence (gene T2) and deduced amino acid sequence underlined sequences: exon

Figure 3: human cDNA sequence (gene T3) and deduced amino acid sequence underlined sequences: exon

Figure 4: Differential expression of the T genes in tumor cell lines

The following clones were deposited in accordance with the Budapest Treaty with the DSMZ (German Collection for Microorganisms and Cell Cultures GmbH), Mascheroder Weg 1b, Braunschweig, on August 18, 1998:

Clone JFC277 (DSM12371); human cDNA; represents the human cDNA sequence of Bp 1218-3690 clone JFC N2112 (DSM12376); human genomic clone; has been fully sequenced. The sequence is shown in FIG. shows and contains the sequence of bp 1756-4228 of the human cDNA sequence.

On February 2, 1999 the following clone was deposited with the DSMZ in accordance with the Budapest Treaty:

Clone JFC-BN27 (DSM 12659); contains the sequence of Bp

4370-8690 of the human cDNA sequence

On February 19, 1999 the following clone was deposited with the DSMZ in accordance with the Budapest Treaty:

Clone JFC-BN20 (DSM 12698); contains the sequence of Bp

2025-6280 of the human cDNA sequence

On February 1, 2000, the following clone was deposited with the DSMZ in accordance with the Budapest Treaty:

cDNA clone pL70 (DSM13270); represents essential parts of the T3 gene.

The sequence shown in Fig. 1 comes from the clones JFC277 (DSM 12371), JFC405 (DSM 12372) and JFC-BN27 (DSM 12659) and JFC-BN20 (DSM 12698).

The invention is further described on the basis of the exemplary embodiment below.

EXAMPLES

Regarding the methods used, Sambrook, J., Fritsch, EF and Maniatis, T. (Molecular cloning; a laboratory manual; second edition; Cold Spring Harbor Laboratory Press, 1989) and Current Protocols in Molecular Biology (John Wiley and Sons , 1994-1998), the ones mentioned below Techniques, in particular preparation of DNA or RNA and PCR, are sufficiently known to the person skilled in the art and are mastered.

EXAMPLE 1: Performing RT-PCR

Total RNA was isolated from the following him tumor cell lines: H4; DAOY; U343MG; U118MG; U373MG; U87MG; U937; Hs683; A172 and MHH-PNET.

The first strand cDNA was synthesized using 250 ng hexanucleotides (from Pharmacia) per 1 μg total RNA. The PCR reactions were carried out with gene-specific primers and first-strand cDNA. The following primers and combinations of primers were used:

POMFIL 1-1 + POMFIL 1-2 + TFR2 + TFR4: for primary neuroblastomas POMFIL 1-1 + POMFIL 1-2 + TFR1 + TFR4: for tumor cell line analysis POMFIL 2-1 + POMFIL 2-2 + POMFIL 3-1 + POMFIL 3 -2: for tumor cell line analysis

T1 gene:

POMFIL 1-1: CTCCTTGTCTGGACTGACCACAG

POMFIL 1-2: GCCTTCAGCATTTCAATGGTTTCTC

T3 gene:

POMFIL 2-1: TCAGAGTCTCAAGGCAGTGG

POMFIL 2-2: GCCAGGTAGGTTTTCCCAG

T2 gene:

POMFIL 3-1: CAGTGCAGAATGTCCTGGATCTC

POMFIL 3-2: GATGAATCATCACAGCTCTCAGG

Transferin Receptor (TFR):

TFR1: TCTTTGGACATGCTCATCTGGGG

TFR2: ACAGGTGACCCTTACACACCTGG TFR4: CAAAGTCTCCAGCACTCCAACTG

Of the POMFIL primers, 300 ng were used per 50 μl PCR reaction, whereas 38 ng were used for the transferin receptor primers.

PCR Bedinαunαen:

35 cycles: 1 min. 94 ° C, 1 min. 60 ° C, 4 min. 72 ° C.

Duplex PCRs were performed with primers that amplified an independent control. 4A above: POMFIL1 and as a control TFR and POMFIL2 and POMFIL3 as a mutual control. The same applies to Fig. 4B.

5 μl aliquots of the PCR batches were applied to a 1% agarose gel and separated by electrophoresis. The result can be seen in FIG. 4. It follows from this that genes T1 and T2 are expressed in glioblastoma cell lines H4 and A172, whereas expression of T3 is absent. All members of the T gene family are expressed in the four of seven glioblastoma cell lines tested (U118MG, U373MG, U87MG and HS683). No expression of the T gene family was detectable in the U343MG glioblastoma cell line. The medulloblastoma cellemia DAOY showed reduced T1 and T2 expression, while T3 expression was absent. No expression of the T gene family could be detected in the leukemia cell line. In the primitive neuroectodermal tumor cell line MHH-PNET there is only expression of the T3 gene. This analysis shows that the three T genes are differentially expressed in tumor cell lines. Furthermore, analysis of the expression of T1 in primary tumors shows that expression in neuroblastomas is reduced. In 4 out of 10 tested neuroblastomas (NB-T3, NB-T4m, NB-T7, NB-T8) a reduced or almost absent expression of T1 was found. The extent of the reduction in expression is much stronger, since the tumors have a normal tissue proportion (approx. 20-50%). In primary neuroblastomas, the malignant phenotype is associated with a reduced expression of T1. EXAMPLE 2: Preparation of Antibodies

Animals are immunized with a synthetically produced peptide of the sequence "EKGEDPETRRMRTVKNIAD" to generate antibodies against the T protein as follows:

Immunization protocol for polyclonal antibodies in rabbits

For each immunization, 600 μg of purified KLH-coupled peptide in 0.7 ml

PBS and 0.7 ml complete or incomplete Freund's adjuvant.

Day O: 1st immunization (Freund's complete adjuvant)

Day 14: 2nd immunization (incomplete Freund's adjuvant; icFA)

Day 28: 3rd immunization (icFA)

Day 56: 4th immunization (icFA)

Day 80: bleeding

The rabbit's serum is tested in an immunoblot. For this purpose, the peptide used for the immunization is subjected to SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose filter (cf. Khyse-Andersen, J., J. Biochem. Biophys. Meth. 10, (1984), 203-209). Western blot analysis was performed as described in Bock, C.-T., et al., Virus Genes 8, (1994), 215-229. For this purpose, the nitrocellulose filter is incubated for one hour at 37 ° C. with a first antibody. This antibody is rabbit serum (1: 10000 in PBS). After several washing steps with PBS, the nitrocellulose filter is incubated with a second antibody. This antibody is a goat anti-rabbit IgG antibody (Dianova) (1: 5000) coupled with alkaline phosphatase in PBS. After 30 minutes of incubation at 37 ° C, there are several washing steps with PBS and then the alkaline phosphatase detection reaction with developer solution (36μM 5 'bromo-4-chloro-3-indolylphosphate, 400μM nitroblue tetrazolium, 100mM Tris-HCl, pH 9.5, 100 mM NaCI, 5 mM MgCI ₂ ) at room temperature until bands become visible.

It can be seen that polyclonal antibodies according to the invention are produced can.

Immunization protocol for chicken polyclonal antibodies

For each immunization, 100 μg of purified KLH-coupled peptide in 0.8 ml

PBS and 0.8 ml complete or incomplete Freund's adjuvant.

Day O. 1. Immunization (Freund's Complete Adjuvant)

Day 28: 2nd immunization (incomplete Freund's adjuvant; icFA)

Day 50: 3rd immunization (icFA)

Antibodies are extracted from egg yolk and tested in a Western blot. Polyclonal antibodies according to the invention are detected.

Immunization protocol for mouse monoclonal antibodies For each immunization, 250 μg of purified KLH-coupled peptide are used in 0.25 ml of PBS and 0.25 ml of complete or incomplete Freund's adjuvant; at the 4th immunization the peptide is dissolved in 0.5 ml (without adjuvant).

Day O. 1. Immunization (Freund's Complete Adjuvant)

Day 28 2nd immunization (incomplete Freund's adjuvant; icFA) day 56 3rd immunization (icFA) day 84; 4. Immunization (PBS) day 87 fusion

Supernatants from hybridomas are tested in a Western blot. Monoclonal antibodies according to the invention are detected.

The analysis of the T gene family has shown that, for example, previously indistinguishable brain tumors can be distinguished by recording the expression of the three T genes in different brain tumor subtypes. This represents an excellent one Possibility of how a molecular genetic classification of tumors can be carried out. The expression of these genes is recorded using PCR. It is particularly important here that each of these three genes not only encodes a protein, but that many splicing variants lead to different protein isoforms. Not just the expression of the individual T-

Genes, but also the individual protein isoforms, can thus be used as tumor-relevant markers. This makes it e.g. It is possible to classify previously indistinguishable forms of brain tumors from molecular genetics into subclasses. This opens up the possibility of optimally adapting the therapy of these tumors to the molecular genetic conditions. This makes it possible to

Increase therapy success significantly.

With the help of the gene-specific primers, the expression of any member of the T gene family can be recorded. For this purpose, there are sequences that are present in all T-gene transcripts (non-differentially spliced sequences). In this way it can be determined whether all three T genes are expressed or only one or two. The tumors can be classified by determining the combinations and the level of expression of the individual T genes. In this way, previously undistinguishable brain tumors can be distinguished on a molecular-genetic basis. Furthermore, the expression of the differentially spliced exons, which for

Encode amino acid sequences that occur in different protein isoforms. With the help of, for example, PCR primers flanking such exon sequences, it is possible to determine whether the corresponding exon sequence is expressed. So far, three differentially spliced exons have been detected. The different splicing options allow eight different protein isoforms for each individual T protein, since there are three different T genes, 512 possible protein isoform combinations result from this. This means that without considering the quantitative expression level, each cell has a large variety of possibilities to assemble the T proteins and isoforms. The procedure described above makes it possible to determine which of these protein isoform combinations is present. Furthermore, it is also possible to convert the individual mRNAs or protein isoform quantify quantities. The qualitative and quantitative determination of the protein isoform combinations makes it possible to classify the diseases at the mRNA level and protein level.

Claims

claims

1. Use of at least one DNA sequence for the differential identification and therapy of molecular changes in injuries and tumors of the nervous system, the DNA sequence comprising the following DNA sequences:

(a) the DNA sequence of Fig. 1, Fig. 2 or Fig. 3; (b) Variants, derivatives, precursors or fragments of the DNA sequence of

(A); or (c) a DNA sequence that differs from the DNA sequence of (a) or (b) due to the degeneration of the genetic code.

2. Use of a DNA sequence according to claim 1, which is a protein or

Encodes peptide comprising the amino acid sequence of FIG. 1, FIG. 2, or FIG. 3.

3. Use according to claim 1 or 2, wherein the DNA sequence is present in an expression vector.

4. Use according to claim 3, wherein the expression vector additionally contains the promoter of the human T gene or an orthologist of the T gene.

5. Use according to claim 3 or 4, wherein the expression vector encodes the T1, T2 or T3 protein or fragments thereof in the form of a reporter fusion protein.

6. Use of a protein or fusion proteins, fragments, variants,

Derivatives or precursors of the protein encoded by the DNA sequence according to claim 1 or 2 for differential identification and therapy Pie molecular changes in injuries and tumors of the nervous system.

7. Use of an antibody or fragment thereof, which is directed against the protein according to claim 6, for the differential identification and therapy of molecular changes in injuries and tumors of the nervous system.

8. Use according to claim 1 or 2, wherein the DNA sequence is in a non-human mammal.

9. Diagnostic method for the detection of a disturbed expression of the protein defined in claim 6 or for the detection of an altered form of this protein, in which a sample with the DNA sequence according to claim 1 or 2 or the antibody or the fragment thereof according to claim 7 in

Touches and then directly or indirectly determines whether the concentration of the protein and / or its amino acid sequence differ from a protein obtained from a healthy patient.

10. Diagnostic kit for performing the method according to claim 9, which contains the DNA sequence according to claim 1 or 2 and / or the antibody or the fragment thereof according to claim 7.