WO2002014521A2 - Plants having modified growth properties - Google Patents

Plants having modified growth properties Download PDF

Info

Publication number
WO2002014521A2
WO2002014521A2 PCT/DE2001/003216 DE0103216W WO0214521A2 WO 2002014521 A2 WO2002014521 A2 WO 2002014521A2 DE 0103216 W DE0103216 W DE 0103216W WO 0214521 A2 WO0214521 A2 WO 0214521A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid sequence
promoter
seq
plant
Prior art date
Application number
PCT/DE2001/003216
Other languages
German (de)
French (fr)
Other versions
WO2002014521A3 (en
Inventor
Jeff Schell
Bernd Reiss
Elke Kemper
Ellen Mahlow
Kerstin KÖPCHEN
Ernesto Olmos
Sabine Steiner-Lange
Original Assignee
MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. filed Critical MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority to DE10193390T priority Critical patent/DE10193390D2/en
Priority to AU2001289571A priority patent/AU2001289571A1/en
Publication of WO2002014521A2 publication Critical patent/WO2002014521A2/en
Publication of WO2002014521A3 publication Critical patent/WO2002014521A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8291—Hormone-influenced development
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Abstract

The invention relates to transgenic plants comprising a regulatory nucleic acid sequence according to SEQ ID NO:1, which is integrated into the genome in a stable manner, or comprising a fragment or derivative or homologue of said sequence having the biological function of a promoter. The inventive transgenic plants also comprise a nucleic acid sequence, particularly the nucleic acid sequence according to SEQ ID NO:2, which is functionally bound to the first nucleic acid sequence and which codes for a gene product, or comprise a fragment or derivative or homologue of this sequence having the biological activity of regulating growth.

Description

Pflanzen mit veränderten Wachstumseigenschaften Plants with changed growth properties
Die vorliegende Erfindung betrifft transgene Pflanzen mit einer stabil in das Genom integrierten regulatorischen Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, und einer mit dieser Nukleinsauresequenz funktionell verbundenen flir ein Genprodukt codierenden Nukleinsauresequenz, insbesondere der Nukleinsauresequenz gemäß SEQ ID NO:2, oder deren Fragment oder Derivat oder Homolog mit der biologischen Aktivität der Wachstumsregulierung.The present invention relates to transgenic plants with a regulatory nucleic acid sequence according to SEQ ID NO: 1 which is stably integrated into the genome, or its fragment or derivative or homolog with the biological function of a promoter, and a nucleic acid sequence which is functionally linked to a nucleic acid coding for a gene product, in particular the nucleic acid sequence according to SEQ ID NO: 2, or its fragment or derivative or homologue with the biological activity of the growth regulation.
Verändertes Größenwachstum beruht bei Pflanzen häufig auf Störungen des Hormonstoffwechsels. Dabei kann entweder die Hormonproduktion oder aber die Sensitivität Hormonen gegenüber beeinflußt sein. Bislang . sind drei Hormonklassen bekannt, die bei Defekten verringertes Größenwachstum verursachen: Gibberelline (z. B. Peng, J. et al. (1999): Green revolution genes encode mutant gibberellin response modulators. Nature 400, 256-261.), Auxine (z. B. Mirza, J.I. et al. (1984): The growth and gravitropic responses of wildtype and auxin-resistant mutants of Arabidopsis thaliana. Physiol. Plant. 60, 516-522.) und Brassinosteroide (z. B Li, J. und Chory, J. (1999): Brassinosteroid action in plants. J. Exp. Bot. 50, 275-282.). Des weiteren sind bei größenreduzierten Pflanzen neben Hormondefekten auch Gendefekte, die eine eingeschränkte Nährstoffaufi ahme/verwertung zur Folge haben, vorstellbar. Viele Mutanten zeigen außer dem Zwergwuchs noch weitere, oft unerwünschte Eigenschaften wie z.B. eine reduzierte Fertilität.Changes in size growth in plants are often due to disturbances in hormone metabolism. Either hormone production or sensitivity to hormones can be affected. So far . Three classes of hormones are known which cause reduced size growth in the case of defects: Gibberellins (e.g. Peng, J. et al. (1999): Green revolution genes encode mutant gibberellin response modulators. Nature 400, 256-261.), Auxins (e.g. B. Mirza, JI et al. (1984): The growth and gravitropic responses of wildtype and auxin-resistant mutants of Arabidopsis thaliana. Physiol. Plant. 60, 516-522.) And brassinosteroids (e.g. Li, J. and Chory, J. (1999): Brassinosteroid action in plants. J. Exp. Bot. 50, 275-282.). In addition to hormone defects, gene defects that result in restricted nutrient uptake / utilization are also conceivable for size-reduced plants. In addition to dwarfism, many mutants show other, often undesirable properties, such as reduced fertility.
Die Grundversorgung der rasch anwachsenden Weltbevölkerung mit Nahrungsmitteln und pflanzlichen Rohstoffen stellt hohe Anforderungen an die moderne Agrarwirtschaft. Bemüliungen zur Nerbesserung des pflanzlichen Ertrages oder zur Anpassung der Pflanzen an bestimmte Umweltbedingungen stoßen mittlerweile an die Grenzen der traditionellen Züchtung und sind zudem sehr zeit- und arbeitsintensiv. Einen Ausweg zeigt die moderne Gentechnik auf. Diese erlaubt eine gezielte Modifikation bestimmter Stoffwechselwege durch die Einführung neuer Gensequenzen oder Manipulation von bereits im Organismus vorhandenen Genen. Da bei den gentechnologischen Verfahren die Veränderungen im Erbgut in der Regel genau bekannt sind, lassen sich diese Verfahren zudem meist auf weitere Pflanzenarten übertragen. Dieser Vorteil besteht bei auf klassische Weise gezüchteten Pflanzen nicht. Für entsprechende übertragbare Verfahren besteht demnach ein erhöhter Bedarf. Eine Veränderung der Wachstumseigenschaften bei Pflanzen kann so z.B. zur Ertragssteigerung oder zur Verbesserung der Widerstandskraft gegenüber mechanischen Umwelteinflüssen wie z.B. Wind oder Regen verwendet werden, ein Ansatz, der beispielsweise bereits in WO 9729123 - über eine Manipulation der Expression von GAI-Genen - verfolgt wurde. Auch ästhetische Neuschöpfungen, beispielsweise die Entwicklung von Zwergformen verschiedenster Zier- oder Nutzpflanzen, sind damit möglich.The basic supply of the rapidly growing world population with food and vegetable raw materials places high demands on modern agriculture. Efforts to improve plant yield or to adapt plants to certain environmental conditions are now reaching the limits of traditional breeding and are also very time-consuming and labor-intensive. Modern genetic engineering shows one way out. This allows a specific modification of certain metabolic pathways by introducing new gene sequences or manipulating genes that already exist in the organism. There with The genetic engineering processes, as a rule, are well aware of the changes in the genetic material, and these processes can usually also be transferred to other plant species. This advantage does not exist with plants grown in the classical way. Accordingly, there is an increased need for corresponding transferable processes. A change in the growth properties of plants can thus be used, for example, to increase yield or to improve the resistance to mechanical environmental influences, such as wind or rain, an approach which has already been followed, for example, in WO 9729123 - by manipulating the expression of GAI genes. Also aesthetic new creations, for example the development of dwarf forms of different ornamental or useful plants, are possible with it.
Der vorliegenden Erfindung liegt somit die Aufgabe zugrunde, Pflanzen mit veränderten Wachstumseigenschaften sowie ein Verfahren zu ihrer Herstellung bereitzustellen.The present invention is therefore based on the object of providing plants with modified growth properties and a process for their production.
Die Aufgabe wird durch den in den Patentansprüchen definierten Gegenstand gelöst.The object is achieved by the subject-matter defined in the patent claims.
Die Erfindung wird durch die folgenden Figuren erläutert.The invention is illustrated by the following figures.
Figur 1 (SEQ ID NO:l) zeigt die genomische Nukleinsauresequenz der Promotorregion von Sul 4.1. Der Kernbereich des Promotors ist fett gedruckt, eine TATA-Box doppelt unterstrichen dargestellt. Die Vorhersage dieser Region erfolgte unter Vorgabe eines cutoff-Wertes von 0.8 mittels „Promoter Prediction by Neural Network", verfügbar unter http://whitefly.lbl.gov/seq_tools/promoter.html. Bei diesem cutoff-Wert liegt der Prozentsatz der falsch positiv erkannten eukaryontischen Promotoren bei unter 0,4 %. Der Transkriptionsstartpunkt ist unterstrichen dargestellt und gibt den Anfang von Volllänge-EST- Klonen vor.Figure 1 (SEQ ID NO: 1) shows the genomic nucleic acid sequence of the promoter region of Sul 4.1. The core area of the promoter is printed in bold, a TATA box is underlined twice. This region was predicted using a cutoff value of 0.8 using the "Promoter Prediction by Neural Network", available at http://whitefly.lbl.gov/seq_tools/promoter.html. The percentage of the cutoff value is wrong positively recognized eukaryotic promoters below 0.4%. The transcription start point is underlined and indicates the start of full-length EST clones.
Figur 2 (SEQ ID NO:2) zeigt die Nukleinsauresequenz eines EST-Klons (cDNA) von Sul 4.1. Die Numerierung setzt die Numerierung aus Figur 1 fort, wobei die letzten 6 Nukleotide von Figur 1 mit den ersten 6 Nukleotiden von Figur 2 überlappen. Start-ATG und Stop-Codon des längsten offenen Leserahmens dieses EST-Klons sind fett dargestellt.Figure 2 (SEQ ID NO: 2) shows the nucleic acid sequence of an EST clone (cDNA) from Sul 4.1. The numbering continues the numbering from FIG. 1, the last 6 nucleotides from FIG. 1 overlapping with the first 6 nucleotides from FIG. 2. The start ATG and stop codon of the longest open reading frame of this EST clone are shown in bold.
Figur 3 zeigt die aus dem offenen Leserahmen gemäß Figur 2 abgeleitete Aminosäuresequenz von Sul 4.1. Die Numerierung beginnt mit dem Start-ATG.FIG. 3 shows the amino acid sequence derived from the open reading frame according to FIG. 2 from Sul 4.1. The numbering begins with the start ATG.
Figur 4a zeigt die Entwicklungsunterschiede von Arabidopsis thaliana Sul 4.1 -Mutanten und Wildtyppflanzen zum Zeitpunkt der Blüte des Wildtyps.FIG. 4a shows the developmental differences between Arabidopsis thaliana Sul 4.1 mutants and wild type plants at the time the wild type bloomed.
Figur 4b zeigt die Endgröße von Arabidopsis thaliana Sul 4.1 -Mutanten im Vergleich zu Wildtyppflanzen.Figure 4b shows the final size of Arabidopsis thaliana Sul 4.1 mutants compared to wild type plants.
Figur 5a zeigt Sul 4.1-Retransformanten mit verlangsamter Entwicklung/Zwergwuchs im Vergleich zu Wildtyp-Pflanzen und Sul 4.1-Mutanten.Figure 5a shows Sul 4.1 retransformants with slow development / dwarfism compared to wild-type plants and Sul 4.1 mutants.
Figur 5b zeigt Sul 4.1-Retransformanten mit beschleunigter Entwicklung/Riesenwuchs im Vergleich zu Wildtyp-Pflanzen und Sul 4.1 -Mutanten.FIG. 5b shows Sul 4.1 retransformants with accelerated development / giant growth in comparison to wild-type plants and Sul 4.1 mutants.
Figur 6 zeigt schematisch die Restriktionskarte des verwendeten Vektors pAC102.FIG. 6 schematically shows the restriction map of the vector pAC102 used.
Figur 7 zeigt schematisch die Restriktionskarte des verwendeten Vektors pSEXOOl-VS.FIG. 7 schematically shows the restriction map of the vector pSEXOOl-VS used.
Figur 8 zeigt das Ergebnis einer Northern- Analyse Sul 4.1 überexprimierender Pflanzen im Vergleich mit Wildtyppflanzen (C24).FIG. 8 shows the result of a Northern analysis of Sul 4.1 overexpressing plants in comparison with wild type plants (C24).
Der hier verwendete Ausdruck „homologe Sequenz" oder "Homolog" bezeichnet eine Nukleinsäure- oder Aminosäuresequenz mit signifikanter Ähnlichkeit zur Vergleichssequenz oder Teilen davon. Als homologe Sequenzen gelten somit Nukleinsäuresequenzen, die mit den Vergleichssequenzen oder Teilen dieser Sequenzen unter wenig stringenten Bedingungen, besonders bevorzugt unter stringenten Bedingungen hybridisieren (zu stringenten und wenig stringenten Bedingungen siehe Sambrook et al, Molecular Cloning, Cold Spring Harbour Laboratory (1989), ISBN 0-87969-309-6). Ein Beispiel für stringente Hybridisierungsbedingungen ist: Hybridisierung in 4 x SSC bei 65° C (alternativ in 50% Formamid und 4 X SSC bei 42° C), gefolgt von mehreren Waschschritten in 0,1 x SSC bei 65°C für insgesamt etwa eine Stunde. Ein Beispiel für wenig stringente Hybridisierungsbedingungen ist Hybridisierung in 4 x SSC bei 37° C, gefolgt von mehreren Waschritten in 1 x SSC bei Raumtemperatur. Als homologe Sequenzen sollen des weiteren Nukleinsäure- oder Aminosäuresequenzen oder Teile davon gelten, die mit Vergleichssequenzen zu 70%, vorzugsweise zu 80%, besonders bevorzugt zu 85%, ferner besonders bevorzugt zu 90%, ferner besonders bevorzugt zu 95%», und insbesondere bevorzugt zu 99% identisch sind.The term "homologous sequence" or "homolog" used here denotes a nucleic acid or amino acid sequence with significant similarity to the comparison sequence or parts thereof. The homologous sequences are therefore nucleic acid sequences which are compatible with the comparison sequences or parts of these sequences under conditions which are not very stringent, particularly preferably under hybridize stringent conditions (for stringent and less stringent conditions see Sambrook et al, Molecular Cloning, Cold Spring Harbor Laboratory (1989), ISBN 0-87969-309-6) An example of stringent hybridization conditions is: Hybridization in 4 x SSC at 65 ° C (alternatively in 50% formamide and 4 X SSC at 42 ° C), followed by several washing steps in 0.1 x SSC at 65 ° C for a total of about one hour.An example of less stringent hybridization conditions is hybridization in 4 x SSC at 37 ° C., followed by several washing steps in 1 x SSC at room temperature ollen furthermore nucleic acid or Amino acid sequences or parts thereof are valid which are 70%, preferably 80%, particularly preferably 85%, further particularly preferably 90%, further particularly preferably 95%, and particularly preferably 99% identical to comparison sequences.
Der hier verwendete Ausdruck "Derivate" bezeichnet Nukleinsäuresequenzen, die Modifikationen in Form von einer oder mehreren Deletionen, Substitutionen, Additionen, Insertionen und/oder Inversionen aufweisen. Als Derivate sind auch Introns beinhaltende genomische Äquivalente von EST- bzw. cDNA-Sequenzen anzusehen. Derivat bedeutet ferner, daß eine Nukleinsauresequenz zusammengesetzt ist aus einem oder mehreren Nukleinsäurefragmenten eines Gens und einem oder mehreren Nukleinsäurefragmenten eines oder mehrerer anderer Gene. Die einzelnen Domänen können dabei sowohl unmodifiziert als auch modifiziert sein.The term “derivatives” used here denotes nucleic acid sequences which have modifications in the form of one or more deletions, substitutions, additions, insertions and / or inversions. Genomic equivalents of EST or cDNA sequences containing introns are also to be regarded as derivatives. Derivative also means that a nucleic acid sequence is composed of one or more nucleic acid fragments of a gene and one or more nucleic acid fragments of one or more other genes. The individual domains can be both unmodified and modified.
Der hier verwendete Ausdruck „Fragment" bezeichnet Teile der ursprünglichen Nukleinsauresequenz mit einer Länge von mindestens 100 Nukleotiden.The term “fragment” used here denotes parts of the original nucleic acid sequence with a length of at least 100 nucleotides.
Der hier verwendete Ausdruck "funktionell verbunden" bedeutet, daß eine regulatorische Sequenz wie ein Promotor die Expression eines Gens steuert oder das eine Nukleinsauresequenz von dem Promotor ausgehend exprimiert wird.The term "functionally linked" used here means that a regulatory sequence such as a promoter controls the expression of a gene or that a nucleic acid sequence is expressed starting from the promoter.
Der hier verwendete Ausdruck "Vektor" bezeichnet natürlich vorkommende oder künstlich erschaffene Konstrukte zur Aufnahme, Vermehrung, Expression oder Übertragung von Nukleinsäuren, z.B. Plasmide, Phagemide, Cosmide, künstliche Chromosomen, Bakteriophagen, Viren, Retroviren.The term "vector" as used herein denotes naturally occurring or artificially created constructs for the uptake, multiplication, expression or transfer of nucleic acids, e.g. Plasmids, phagemids, cosmids, artificial chromosomes, bacteriophages, viruses, retroviruses.
Der hier verwendete Ausdruck "Expressionssystem" bezeichnet jedwede Kombination von Vektoren, Restriktionsenzymen, Transformationsmethoden, Zellextrakten, lebenden Zellen z.B. prokaryontischen oder eukaryontischen Zellen oder Organismen mit dem Zweck der endogenen oder exogenen Expression von Genen.The term "expression system" as used herein means any combination of vectors, restriction enzymes, transformation methods, cell extracts, living cells e.g. prokaryotic or eukaryotic cells or organisms for the purpose of endogenous or exogenous expression of genes.
Der hier verwendete Ausdruck "transgene Pflanze" betrifft Pflanzen, die mittels rekombinanter Gentechnik und/oder mikrobiologischen Verfahren und nicht mittels herkömmlicher Züchtungsverfahren hergestellt wurden. Die vorliegende Erfindung betrifft die regulatorische Nukleinsauresequenz (im folgenden auch Promotor bezeichnet), die natürlicherweise in Arabidopsis thaliana die Transkription des Sul 4.1 -Gens steuert. Diese erfindungsgemäße Nukleinsauresequenz ist in SEQ ID NO:l aufgeführt. Femer betrifft die Erfindung Fragmente oder Homologe oder Derivate der Nukleinsauresequenz gemäß SEQ ID NO:l, die die biologische Funktion eines Promotors besitzen. Femer betrifft die Erfindung Nukleinsäuresequenzen, die mit der Nukleinsauresequenz gemäß SEQ ID NO:l hybridisieren und die die biologische Funktion eines Promotors besitzen. Bevorzugt sind Nukleinsäuresequenzen, die unter stringenten Bedingungen mit der Nukleinsauresequenz gemäß SEQ ID NO:l hybridisieren und die die biologische Funktion eines Promotors besitzen. Bevorzugte Homologe der SEQ ID NO:l sind regulatorische Nukleinsäuresequenzen der folgenden Pflanzen: Soja, Reis, Baumwolle, Zuckerrübe, Sonnenblume, Flachs, Hanf, Kartoffel, Tabak, Tomate, Sommerraps, Winterraps, Alfalfa (Luzerne), Salat, Erbse, Bohne, Karotte, Zwiebel, die verschiedenen Baum, Nuß- und Weinspezies, femer Getreide z.B. Gerste, Weizen, Roggen, Hafer, Mais, Futtergräser, femer Obstsorten z.B. Mango, Apfel, Pfirsich, Stachelbeere, Johannisbeere, Banane, Melone, Kürbis und diverse Zitrasfrüchte z.B. Zitrone, Apfelsine, Pampelmuse oder Mandarine. Bevorzugt sind ebenfalls Zierpflanzen wie z.B. Alpenveilchen,The term "transgenic plant" used here refers to plants which were produced by means of recombinant genetic engineering and / or microbiological processes and not by means of conventional breeding processes. The present invention relates to the regulatory nucleic acid sequence (hereinafter also referred to as promoter) which naturally controls the transcription of the Sul 4.1 gene in Arabidopsis thaliana. This nucleic acid sequence according to the invention is listed in SEQ ID NO: 1. The invention further relates to fragments or homologs or derivatives of the nucleic acid sequence according to SEQ ID NO: 1, which have the biological function of a promoter. The invention further relates to nucleic acid sequences which hybridize with the nucleic acid sequence according to SEQ ID NO: 1 and which have the biological function of a promoter. Preferred are nucleic acid sequences which hybridize under stringent conditions with the nucleic acid sequence according to SEQ ID NO: 1 and which have the biological function of a promoter. Preferred homologues of SEQ ID NO: 1 are regulatory nucleic acid sequences of the following plants: soy, rice, cotton, sugar beet, sunflower, flax, hemp, potato, tobacco, tomato, summer rape, winter rape, alfalfa (lucerne), lettuce, pea, bean, Carrot, onion, the various tree, nut and wine species, also cereals such as barley, wheat, rye, oats, maize, feed grasses, and other types of fruit such as mango, apple, peach, gooseberry, currant, banana, melon, pumpkin and various citrus fruits, for example Lemon, orange, grapefruit or tangerine. Ornamental plants such as cyclamen are also preferred,
Aster, Bougainvillea, Chrysantheme, Petunie, Margerite, Narzisse, Schneeglöckchen, Rittersporn, Sonnenblume, Geranie, Gänsekresse, Gerbera, Gladiole, Iris, Hyazinthe, Lilie, Magnolie, Orchidee, Rhododendron, Rose, Tränendes Herz, Tulpe, Weihnachtsstern.Aster, Bougainvillea, Chrysanthemum, Petunia, Marguerite, Daffodil, Snowdrop, Larkspur, Sunflower, Geranium, Goose Cress, Gerbera, Gladiolus, Iris, Hyacinth, Lily, Magnolia, Orchid, Rhododendron, Rose, Bleeding Heart, Tulip, Poinsettia.
Die erfindungsgemäße Nukleinsauresequenz gemäß SEQ ID NO:l oder deren Fragment oder Homolog oder Derivat eignet sich z.B. zur Identifizierung und Isolierung von zum Sul 4.1 -Gen homologen Genen in anderen Organismen oder von verwandten regulatorischen Sequenzen in z.B. Arabidopsis thaliana mit Hilfe spezieller Hybridisierungs- oder Screening- Verfahren, z.B. als Sonde für das Screening in DNA-Bibliotheken mit Hilfe der Hybridisierung an einzelsträngige Nukleinsäuren.The nucleic acid sequence according to the invention according to SEQ ID NO: 1 or its fragment or homolog or derivative is suitable for example for the identification and isolation of genes homologous to the Sul 4.1 gene in other organisms or of related regulatory sequences in e.g. Arabidopsis thaliana using special hybridization or screening procedures, e.g. as a probe for screening in DNA libraries using hybridization to single-stranded nucleic acids.
Die erfindungsgemäße Nukleinsauresequenz gemäß SEQ ID NO:l oder deren Fragment oder Homolog oder Derivat eignet sich femer zur spezifischen Steuerung der Expression von Genen in Organismen oder Zellen, bevorzugt zur spezifischen Steuerung der Expression von das Wachstum beeinflussenden oder in den Hormonstoffwechsel eingreifenden Genen. Die Erfindung betrifft somit transgene Pflanzen, die neu hergestellt wurden durch eine stabil in das Genom integrierte regulatorische Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, und einer mit dieser Nukleinsauresequenz funktioneil verbundenen für ein Genprodukt codierenden Nukleinsauresequenz.The nucleic acid sequence according to the invention according to SEQ ID NO: 1 or its fragment or homolog or derivative is furthermore suitable for the specific control of the expression of genes in organisms or cells, preferably for the specific control of the expression of genes which influence growth or interfere with hormone metabolism. The invention thus relates to transgenic plants which have been newly produced by a regulatory nucleic acid sequence according to SEQ ID NO: 1 which is stably integrated into the genome, or its fragment or derivative or homologue with the biological function of a promoter, and a functionally linked to this nucleic acid sequence for a Gene product coding nucleic acid sequence.
Femer betrifft die vorliegende Erfindung ein Verfahren zur Herstellung einer Pflanze mit veränderter Genexpression, umfassend das stabile Integrieren einer regulatorischen Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Homolog oder Derivat mit der biologischen Funktion eines Promotors, und einer mit dieser Nukleinsauresequenz funktioneil verbundenen für ein Genprodukt codierenden Nukleinsauresequenz in das Genom von Pflanzenzellen oder Pflanzengeweben sowie Regeneration der erhaltenen Pflanzenzellen oder Pflanzengeweben zu Pflanzen, vorzugsweise zu fertilen Pflanzen.Furthermore, the present invention relates to a method for producing a plant with modified gene expression, comprising the stable integration of a regulatory nucleic acid sequence according to SEQ ID NO: 1, or its fragment or homolog or derivative with the biological function of a promoter, and a functionally linked to this nucleic acid sequence for a nucleic acid sequence coding for a gene product into the genome of plant cells or plant tissues and regeneration of the plant cells or plant tissues obtained to plants, preferably to fertile plants.
Die mit der erfindungsgemäßen Nukleinsauresequenz gemäß SEQ ID NO: 1 oder deren Fragment oder Homolog oder Derivat funktionell verbundenen Nukleinsäuren können endogene, exogene genomische DNA-Abschnitte oder cDNAs oder deren Fragmente oder Derivate sein. Endogen bedeutet dabei, das die Nukleinsauresequenz aus dem gleichen Organismus stammt, in den sie mit dem erfindungs gemäßen Verfahren integriert wird, z.B. eine Nukleinsauresequenz aus Arabidopsis thaliana wird mit dem erfindungsgemäßen Verfahren in Arabidopsis thaliana integriert. Exogen bedeutet, das die Nukleinsauresequenz aus einem anderen Organismus stammt, z.B. eine Nukleinsauresequenz aus Arabidopsis thaliana wird mit dem erfindungsgemäßen Verfahren in z.B. Weizen integriert. Die Nukleinsäuresequenzen können gegenüber den natürlich vorkommenden Nukleinsäuresequenzen Deletionen, Substitutionen, Additionen, Insertionen und/oder Inversionen aufweisen.The nucleic acids functionally linked to the nucleic acid sequence according to the invention according to SEQ ID NO: 1 or its fragment or homolog or derivative can be endogenous, exogenous genomic DNA segments or cDNAs or their fragments or derivatives. Endogenous means that the nucleic acid sequence originates from the same organism in which it is integrated using the method according to the invention, e.g. a nucleic acid sequence from Arabidopsis thaliana is integrated into Arabidopsis thaliana using the method according to the invention. Exogenous means that the nucleic acid sequence comes from another organism, e.g. a nucleic acid sequence from Arabidopsis thaliana is obtained with the method according to the invention in e.g. Wheat integrated. The nucleic acid sequences can have deletions, substitutions, additions, insertions and / or inversions compared to the naturally occurring nucleic acid sequences.
Beispielsweise kann die erfindungsgemäße Nukleinsauresequenz gemäß SEQ ID NO:l oder deren Fragment oder Homolog oder Derivat für die Regulation der Expression des natürlicherweise mit ihr verbundenen Sul 4.1 -Gens verwendet werden. Femer eignet sich die erfindungsgemäße Nukleinsauresequenz auch für die Regulation der Expression anderer Gensequenzen, insbesondere zur Regulation von anderen das Pflanzenwachstum beeinflussenden Genen, wodurch ebenfalls Pflanzen mit abweichender Wachstumsgeschwindigkeit und Endgröße zu erzielen sind, hl diesem Zusammenhang sind vor allem Gene des Phytohormonstoffwechsels von Auxinen, Gibberellinen, Cytokinen, Abscisinsäure sowie Ethylen zu nennen, die vom Promotor reguliert werden können. Hierfür in Frage kommen besonders Gene für Enzyme aus dem anabolen und katabolen Phytohormonstoffwechsel sowie Gene für Phytohormonrezeptoren. Prinzipiell kann die erfindungsgemäße Nukleinsauresequenz gemäß SEQ ID NO:l oder deren Fragment oder Homolog oder Derivat für die Regulation der Expression jedes beliebigen Gens für jedwede Anwendung, sowohl aus Arabidopsis thaliana als auch aus anderen Organismen, verwendet werden. Dabei kann der Promotor in Kombination mit beliebigen Genen vorliegen, sowohl in einem Vektor als auch in transgenen Organismen, insbesondere Pflanzen.For example, the nucleic acid sequence according to SEQ ID NO: 1 or its fragment or homolog or derivative can be used for regulating the expression of the Sul 4.1 gene which is naturally connected to it. Furthermore, the nucleic acid sequence according to the invention is also suitable for the regulation of the expression of other gene sequences, in particular for the regulation of other genes influencing plant growth, as a result of which plants with a different growth rate and final size can also be achieved. This is primarily the genes of the phytohormone metabolism of auxins, gibberellins, cytokines, abscisic acid and ethylene, which can be regulated by the promoter. Genes for enzymes from the anabolic and catabolic phytohormone metabolism and genes for phytohormone receptors are particularly suitable for this. In principle, the nucleic acid sequence according to the invention as shown in SEQ ID NO: 1 or its fragment or homolog or derivative can be used for regulating the expression of any gene for any application, both from Arabidopsis thaliana and from other organisms. The promoter can be present in combination with any genes, both in a vector and in transgenic organisms, in particular plants.
Anhand genetischer Veränderungen am Modellorganismus Arabidopsis thaliana wurde überraschenderweise gefunden, daß eine Veränderung der Expression einer endogenen Nukleinsauresequenz bis dato unbekannter Funktion das pflanzliche Wachstum beeinflußt. Bei diesem Gen handelt es sich um das Sul 4.1 -Gen. Pflanzen mit einer Mutation im Sul 4.1 -Gen haben ein verringertes Größenwachstum gegenüber den Wildtyppflanzen. Die Nukleinsauresequenz des Sul 4.1-Gens (im folgenden auch als Sul 4.1-cDNA oder Sul 4.1-EST bezeichnet) ist als SEQ ID NO:2 aufgeführt. Zum Sul 4.1 -Gen aus Arabidopsis thaliana ist ein EST-Klon (Genbank Accession Nummer H76408) verfügbar, jedoch war hierzu bislang keine Funktion bekannt. Ein BAC-Klon mit der entsprechenden Genregion ist unter der Genbank Accession Nummer ALI 62508 registriert. Ähnlichkeiten von Sul 4.1 zu anderen ' wachstumsregulierenden Genen bestehen nicht. Ein Gen mit entfernter Ähnlichkeit zu Sul 4.1, aber ebenfalls unbekannter Funktion befindet sich auf Chromosom 3 von Arabidopsis thaliana (Genbank Accession Nummer AL 096859).On the basis of genetic changes to the model organism Arabidopsis thaliana, it has surprisingly been found that a change in the expression of an endogenous nucleic acid sequence influences hitherto unknown function in plant growth. This gene is the Sul 4.1 gene. Plants with a mutation in the Sul 4.1 gene have a reduced size growth compared to the wild type plants. The nucleic acid sequence of the Sul 4.1 gene (hereinafter also referred to as Sul 4.1 cDNA or Sul 4.1 EST) is listed as SEQ ID NO: 2. An EST clone (Genbank Accession number H76408) is available for the Arabidopsis thaliana Sul 4.1 gene, but no function has been known to date. A BAC clone with the corresponding gene region is registered under the gene bank accession number ALI 62508. There are no similarities between Sul 4.1 and other growth-regulating genes. A gene with distant similarity to Sul 4.1, but also unknown function, is located on chromosome 3 of Arabidopsis thaliana (Genbank Accession number AL 096859).
Die vorliegende Erfindung betrifft somit femer transgene Pflanzen, die neu hergestellt wurden durch eine stabil in das Genom integrierte Nukleinsauresequenz gemäß SEQ ID NO:2, oder deren Fragment oder Derivat mit der biologischen Aktivität der Wachstumsregulierung, und einer mit dieser Nukleinsauresequenz funktioneil verbundenen regulatorischen Nukleinsauresequenz.The present invention thus also relates to transgenic plants which have been newly produced by a nucleic acid sequence according to SEQ ID NO: 2 which is stably integrated into the genome, or its fragment or derivative with the biological activity of growth regulation, and a regulatory nucleic acid sequence which is functionally linked to this nucleic acid sequence.
Femer betrifft die vorliegende Erfindung transgene Pflanzen, die neu hergestellt wurden durch eine stabil in das Genom integrierte Nukleinsauresequenz, die mit der Nukleinsauresequenz gemäß SEQ ID NO:2 hybridisiert und die biologische Aktivität der Wachstumsregulierung aufweist, und einer mit dieser Nukleinsauresequenz funktionell verbundenen regulatorischen Nukleinsauresequenz. Bevorzugt sind transgene Pflanzen mit einer stabil in das Genom integrierten Nukleinsauresequenz, die mit der Nukleinsauresequenz gemäß SEQ ID NO:2 unter stringenten Bedingungen hybridisiert und die biologische Aktivität der Wachstumsregulierung aufweist, und einer mit dieser Nukleinsauresequenz fünktionell verbundenen regulatorischen Nukleinsauresequenz.Furthermore, the present invention relates to transgenic plants which have been newly produced by a nucleic acid sequence stably integrated into the genome, which hybridizes with the nucleic acid sequence according to SEQ ID NO: 2 and has the biological activity of growth regulation, and a regulatory functionally linked to this nucleic acid sequence Nucleic acid sequence. Preferred are transgenic plants with a nucleic acid sequence stably integrated into the genome, which hybridizes with the nucleic acid sequence according to SEQ ID NO: 2 under stringent conditions and has the biological activity of growth regulation, and a regulatory nucleic acid sequence which is functionally linked to this nucleic acid sequence.
Bei der Nukleinsauresequenz gemäß SEQ ID NO:2 oder deren Fragment oder Derivat oder Homolog kann es sich erfindungsgemäß um jede beliebige Sul 4.1-Sequenz oder deren Fragment oder Derivat oder Homolog handeln, beispielsweise um eine solche aus Pflanzen, Algen oder Cyanobakterien.According to the invention, the nucleic acid sequence according to SEQ ID NO: 2 or its fragment or derivative or homolog can be any Sul 4.1 sequence or its fragment or derivative or homolog, for example one from plants, algae or cyanobacteria.
Die Nukleinsauresequenz gemäß SEQ ID NO:2 oder deren Fragment oder Homolog oder Derivat eignet sich weiterhin z.B. zur Identifizierung und Isolierung von zum Sul 4.1-Gen homologen Genen in anderen Organismen oder von verwandten Sequenzen in z.B. Arabidopsis thaliana mit Hilfe spezieller Hybridisierungs- oder Screening- Verfahren, z.B. als Sonde für das Screening in DNA-Bibliotheken mit Hilfe der Hybridisierung an einzelsträngige Nukleinsäuren. Die mit der Nukleinsauresequenz gemäß SEQ ID NO:2 oder deren Fragment oder Derivat oder Homolog fünktionell verbundene regulatorische DNA-Sequenz, z.B. ein Promotor, kann sowohl die mit der Nukleinsauresequenz endogen vorliegende regulatorische DNA-Sequenz gemäß SEQ ID NO:l als auch jede andere regulatorische DNA-Sequenz sein. Die regulatorische DNA- Sequenz kann sowohl ein endogener Promotor des zu transformierenden Organismus oder ein exogener Promotor sein, der sich z.B. auf dem verwendeten Vektor befindet. Als Promotor ist dabei grundsätzlich jede regulatorische Sequenz geeignet, die die Expression von Fremdgenen in Organsimen, z.B. Pflanzen, steuern kann, z.B. der CaMV 35S-Promotor aus dem Blumenkohl- Mosaik-Virus; vgl. Franck et al., Cell 21, 285-294 (1980). Die Expression der Nukleinsäuresequenzen kann auch durch einen chemisch induzierbaren Promotor erreicht werden. Beispiele für chemisch induzierbare Promotoren sind der PRPI-Promotor (Ward et al, Plant Molecular Biology 22, 361-366 (1993)), ein durch Salizylsäure induzierbarer Promotor (WO 95/19443), ein durch Benzolsulfonamid induzierbarer Promotor (EP-A 388186), ein durch Tetrazyklin induzierbarer Promotor (Gatz et al., Plant Journal 2, 397-404 (1992)), ein durch Abscisinsäure induzierbarer Promotor (EP-A 335528) oder ein durch Ethanol oder Cyclohexanon induzierbarer Promotor (WO 93/21334). Je nach gewünschtem Expressionsort können auch Promotoren verwendet werden, die z.B. in bestimmten Pflanzengeweben oder Pflanzenteilen aktiv sind. Beispiele fiir entsprechende Promotoren sind der Phaseolin-Promotor (US 5504200), der Isoflavon-Reduktase-Promotor (US 5750399), ein samenspezifischer Promotor, z.B. aus Tabak (US 5824863) oder der ST-LSI Promotor aus Kartoffel (Stockhaus et al., (1989), EMBO JS, 2445-2452).The nucleic acid sequence according to SEQ ID NO: 2 or its fragment or homolog or derivative is further suitable, for example, for the identification and isolation of genes homologous to the Sul 4.1 gene in other organisms or of related sequences in, for example, Arabidopsis thaliana with the aid of special hybridization or screening Methods, for example as a probe for screening in DNA libraries with the aid of hybridization to single-stranded nucleic acids. The regulatory DNA sequence functionally linked to the nucleic acid sequence according to SEQ ID NO: 2 or its fragment or derivative or homolog, for example a promoter, can be the regulatory DNA sequence according to SEQ ID NO: 1 endogenously present with the nucleic acid sequence as well as any other regulatory DNA sequence. The regulatory DNA sequence can be either an endogenous promoter of the organism to be transformed or an exogenous promoter which is located, for example, on the vector used. In principle, any regulatory sequence that can control the expression of foreign genes in organisms, for example plants, is suitable as a promoter, for example the CaMV 35S promoter from the cauliflower mosaic virus; see. Franck et al., Cell 21: 285-294 (1980). The expression of the nucleic acid sequences can also be achieved by a chemically inducible promoter. Examples of chemically inducible promoters are the PRPI promoter (Ward et al, Plant Molecular Biology 22, 361-366 (1993)), a promoter induced by salicylic acid (WO 95/19443), a promoter inducible by benzenesulfonamide (EP-A 388186 ), a promoter inducible by tetracycline (Gatz et al., Plant Journal 2, 397-404 (1992)), a promoter inducible by abscisic acid (EP-A 335528) or a promoter inducible by ethanol or cyclohexanone (WO 93/21334) , Depending on the desired expression site, promoters can also be used, for example in certain plant tissues or Plant parts are active. Examples of corresponding promoters are the phaseolin promoter (US 5504200), the isoflavone reductase promoter (US 5750399), a seed-specific promoter, for example from tobacco (US 5824863) or the ST-LSI promoter from potato (Stockhaus et al., (1989) EMBO JS, 2445-2452).
Die Nukleinsäuresequenzen gemäß SEQ ID NO:l und SEQ ID NO:2 oder deren Fragmente oder Homologe oder Derivate können natürlichen Ursprungs sein oder künstlich hergestellt worden sein. Die Nukleinsauresequenz gemäß SEQ ID NO:l liegt dabei in Sense-Orientierung vor, die Nukleinsauresequenz gemäß SEQ ID NO:2 kann sowohl in Sense- als auch in Antisense- Orientierung vorliegen.The nucleic acid sequences according to SEQ ID NO: 1 and SEQ ID NO: 2 or their fragments or homologs or derivatives can be of natural origin or have been produced artificially. The nucleic acid sequence according to SEQ ID NO: 1 is present in a sense orientation, the nucleic acid sequence according to SEQ ID NO: 2 can be present both in a sense and in an antisense orientation.
Die Nukleinsäuresequenzen gemäß SEQ ID NO:l oder SEQ ID NO:2 oder deren Fragmente oder Homologe oder Derivate können in Vektoren, Expressionssystemen oder Pflanzen, Pflanzengeweben oder Pflanzenzellen oder tierischen Zellen oder Mikroorganismen zur Veränderung der Expressionsmuster verschiedenster Genprodukte verwendet werden. Die Expression der Genprodukte kann dabei gegenüber Ihrer natürlichen Expression sowohl verstärkt als auch verringert sein.The nucleic acid sequences according to SEQ ID NO: 1 or SEQ ID NO: 2 or their fragments or homologs or derivatives can be used in vectors, expression systems or plants, plant tissues or plant cells or animal cells or microorganisms to change the expression patterns of a wide variety of gene products. The expression of the gene products can be both increased and reduced compared to their natural expression.
Femer betrifft die vorliegende Erfindung ein Verfahren zur Herstellung von Pflanzen mit veränderten Wachstumseigenschaften, umfassend das stabile Integrieren einer dasFurthermore, the present invention relates to a method for producing plants with modified growth properties, comprising the stable integration of a
Pflanzenwachstum beeinflussenden Nukleinsauresequenz gemäß SEQ ID NO:2, oder derenPlant growth influencing nucleic acid sequence according to SEQ ID NO: 2, or their
Fragment oder Derivat mit der biologischen Aktivität der Wachstumsregulierung, in das Genom von Pflanzenzellen oder Pflanzengeweben. Femer betrifft die Erfindung ein Verfahren zurFragment or derivative with the biological activity of growth regulation, in the genome of plant cells or plant tissues. The invention further relates to a method for
Herstellung von Pflanzen mit veränderten Wachstumseigenschaften, umfassend das stabile Integrieren einer mit der Nukleinsauresequenz gemäß SEQ ID NO:2 hybridisierendenProduction of plants with changed growth properties, comprising the stable integration of a hybridizing with the nucleic acid sequence according to SEQ ID NO: 2
Nukleinsauresequenz mit der biologischen Aktivität der Wachstumsregulierung. Bevorzugt sindNucleic acid sequence with the biological activity of growth regulation. Are preferred
Nukleinsäuresequenzen, die unter stringenten Bedingungen mit der Nukleinsauresequenz gemäßNucleic acid sequences which according to stringent conditions with the nucleic acid sequence
SEQ ID NO:2 hybridisieren. Bevorzugt ist ein Verfahren, wobei die Nukleinsauresequenz gemäßHybridize SEQ ID NO: 2. A method is preferred, the nucleic acid sequence according to
SEQ ID NO:2, oder deren Fragment oder Derivat mit der biologischen Aktivität der Wachstumsregulierung, funktioneil mit einer regulatorischen Nukleinsauresequenz z.B. derSEQ ID NO: 2, or its fragment or derivative with the biological activity of growth regulation, functional with a regulatory nucleic acid sequence e.g. the
Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, verbunden ist. Ein weiterer Aspekt der Erfindung betrifft ein Verfahren zur Herstellung von Pflanzen mit veränderten Wachstumseigenschaften, umfassend das stabile Integrieren einer Nukleinsauresequenz gemäß SEQ ID NO:l und/oder SEQ ID NO:2 oder deren Fragment oder Derivat oder Homolog in das Genom von Pflanzenzellen und Regeneration der erhaltenen Pflanzenzellen oder Pflanzengeweben zu Pflanzen, vorzugsweise zu fertilen Pflanzen. Aufgrund des veränderten Wachstums kann eine erhöhte Biomasseproduktion und somit eine Steigerung des pflanzlichen Ertrages erreicht werden. Experimente legen die Vermutung nahe, daß Sul4.1 am Phloem-Transport und somit am Sink-Source-Metabolismus beteiligt ist. Transport Untersuchungen mit Fluorochromen wie Cascade blue (Molecular Probes, Leiden, Niederlande) und HPTS (8-Hydroxypyren-l,3,6-trisulfonsäure-trinatrium-salz; Molecular Probes, Leiden, Niederlande) weisen auf veränderte Transportparameter in Sul4.1 Pflanzen hin. Daher ist davon auszugehen, daß das Sul4.1 Gen vorzugsweise an dem Transport löslicher Substanzen in Pflanzen beteiligt ist. Diese Daten zusammen mit dem Expressionsmuster des Sul4.1 Gens im Wildtyp deuten auf eine Rolle bei der Verteilung von Assimilaten hin. Das erfindungsgemäße Verfahren kann z.B. zur Steigerung der Produktivität von Nutzpflanzen eingesetzt werden: Eine verbesserte Verteilung der Assimilate im Phloem von ihren Produktionsorten (source) zu den Abnehmern (sink) wie Samen, z.B. von Hafer, Reis, oder Erbsen; Blätter, z.B. Spinat oder Kohl; Stengel, z.B. Zuckerrohr, Bambus oder Spargel; Knollen, z.B. Kartoffeln; Rüben, z.B. Futterrüben oder Zuckerrüben; und Früchten, z.B. Gurken fuhrt zu einem höheren Ertrag der Pflanze. Ebenfalls können kurzstiehge Varietäten mit gesteigerter Widerstandskraft gegen mechanische Umwelteinflüsse wie Wind oder Regen, z.B. durch die Einführung der entsprechenden Gene in Antisense-Orientierung, erzeugt werden. Auch ästhetisch ansprechende Wuchsformen, z.B. Minipflanzen, sind herstellbar.Nucleic acid sequence according to SEQ ID NO: 1, or its fragment or derivative or homologue with the biological function of a promoter. Another aspect of the invention relates to a method for producing plants with modified growth properties, comprising the stable integration of a nucleic acid sequence according to SEQ ID NO: 1 and / or SEQ ID NO: 2 or its fragment or derivative or homologue into the genome of plant cells and regeneration the plant cells or plant tissues obtained to plants, preferably to fertile plants. Due to the changed growth, increased biomass production and thus an increase in plant yield can be achieved. Experiments suggest that Sul4.1 is involved in phloem transport and thus in sink-source metabolism. Transport Studies with fluorochromes such as Cascade blue (Molecular Probes, Leiden, The Netherlands) and HPTS (8-hydroxypyrene-l, 3,6-trisulfonic acid trisodium salt; Molecular Probes, Leiden, The Netherlands) indicate changes in transport parameters in Sul4.1 plants out. It can therefore be assumed that the Sul4.1 gene is preferably involved in the transport of soluble substances in plants. These data together with the expression pattern of the Sul4.1 gene in the wild type indicate a role in the distribution of assimilates. The method according to the invention can be used, for example, to increase the productivity of useful plants: an improved distribution of the assimilates in the phloem from their production sites (source) to the buyers (sink), such as seeds, for example from oats, rice or peas; Leaves, eg spinach or cabbage; Stems, eg sugar cane, bamboo or asparagus; Tubers, eg potatoes; Beets, such as fodder beets or sugar beets; and fruits, such as cucumbers lead to a higher yield of the plant. It is also possible to produce short-range varieties with increased resistance to mechanical environmental influences such as wind or rain, for example by introducing the appropriate genes in an antisense orientation. Aesthetically appealing growth forms, such as mini plants, can also be produced.
Für das erfindungsgemäße Verfahren können endogene oder exogene Nukleinsäuresequenzen gemäß SEQ ID NO:l und/oder SEQ HD NO:2 oder deren Fragmente oder Derivate oder Homologe verwendet werden. Endogen bedeutet, das die Nukleinsauresequenz aus dem gleichen Organismus stammt, in den sie mit dem erfindungsgemäßen Verfahren integriert wird, z.B. ein Sul 4.1 Gen aus Arabidopsis thaliana wird mit dem erfindungsgemäßen Verfahren in Arabidopsis thaliana integriert. Exogen bedeutet, das die Nukleinsauresequenz aus einem anderen Organismus stammt, z.B. eine Nukleinsauresequenz aus Arabidopsis thaliana wird mit dem erfindungsgemäßen Verfahren in z.B. Weizen integriert. Nach der stabilen Integration der transformierten Nukleinsauresequenz können dann eins, zwei oder mehr Sul 4.1 -Gene oder Promotoren im Genom vorliegen, was zu einer gesteigerten Expression der entsprechenden Gene fuhrt, fii einer bevorzugten Ausfuhrungsform weisen die Nukleinsäuresequenzen gegenüber den natürlich vorkommenden Nukleinsäuresequenzen Deletionen, Substitutionen, Additionen, hisertionen und/oder Inversionen auf.Endogenous or exogenous nucleic acid sequences according to SEQ ID NO: 1 and / or SEQ HD NO: 2 or their fragments or derivatives or homologs can be used for the method according to the invention. Endogenously means that the nucleic acid sequence comes from the same organism into which it is integrated using the method according to the invention, for example a Sul 4.1 gene from Arabidopsis thaliana is integrated using the method according to the invention in Arabidopsis thaliana. Exogenous means that the nucleic acid sequence comes from another organism, for example a nucleic acid sequence from Arabidopsis thaliana is integrated into, for example, wheat using the method according to the invention. After the stable integration of the transformed nucleic acid sequence, one, two or more Sul 4.1 genes or Promoters are present in the genome, which leads to an increased expression of the corresponding genes. For a preferred embodiment, the nucleic acid sequences have deletions, substitutions, additions, hisertions and / or inversions compared to the naturally occurring nucleic acid sequences.
Die vorliegende Erfindung betrifft femer eine transformierte Zelle, insbesondere eine transformierte Pflanzenzelle oder ein transformiertes Pflanzengewebe, in der die erfindungsgemäßen Nukleinsäuresequenzen gemäß SEQ ID NO:l und/oder SEQ ID NO:2 oder deren Fragmente oder Homologe oder Derivate stabil integriert sind. Femer betrifft die vorliegende Erfindung eine mit den erfindungsgemäßen Nukleinsäuresequenzen gemäß SEQ ID NO:l und/oder SEQ ID NO:2 oder deren Fragmenten oder Homologen oder Derivaten transformierte Pflanzenzelle oder ein transformiertes Pflanzengewebe, die oder das zu einer Pflanze, insbesondere einer fertilen Pflanze, regenerierbar ist. Insbesondere betrifft die vorliegende Erfindung eine Pflanze, die nach dem erfindungsgemäßen Verfahren erhältlich ist. Ferner betrifft die vorliegende Erfindung Saatgut, das von Pflanzen erhalten wird, die nach dem erfindungsgemäßen Verfahren erhalten werden. Die Erfindung betrifft femer die von den Pflanzen produzierten Früchte, z.B. Obst, Beeren, Kartoffeln und Trauben.The present invention further relates to a transformed cell, in particular a transformed plant cell or a transformed plant tissue, in which the nucleic acid sequences according to the invention according to SEQ ID NO: 1 and / or SEQ ID NO: 2 or their fragments or homologs or derivatives are stably integrated. Furthermore, the present invention relates to a plant cell or plant tissue transformed with the nucleic acid sequences according to the invention according to SEQ ID NO: 1 and / or SEQ ID NO: 2 or their fragments or homologs or derivatives, or a transformed plant tissue, which or to a plant, especially a fertile plant is regenerable. In particular, the present invention relates to a plant which can be obtained by the process according to the invention. The present invention further relates to seed obtained from plants obtained by the process according to the invention. The invention further relates to the fruits produced by the plants, e.g. Fruit, berries, potatoes and grapes.
In einer bevorzugten Ausfuhrungsform der erfindungsgemäßen transgenen Pflanze bzw. des erfindungsgemäßen Verfahrens wird eine Nukleinsauresequenz verwendet, die aus Fragmenten verschiedener Sul 4.1 -Gene zusammengesetzt ist. Diese zusammengesetzte Nukleinsauresequenz kann ferner ebenfalls Modifikationen wie Deletionen, Additionen oder Substitutionen enthalten. Die Verfahren zur Herstellung solcher Nukleinsäuresequenzen sind Stand der Technik, dem Fachmann unter dem Begriff „Chimären" vertraut und von ihm leicht durchzuführen.In a preferred embodiment of the transgenic plant according to the invention or of the method according to the invention, a nucleic acid sequence is used which is composed of fragments of different Sul 4.1 genes. This composite nucleic acid sequence can also contain modifications such as deletions, additions or substitutions. The methods for producing such nucleic acid sequences are state of the art, familiar to the person skilled in the art under the term “chimeras” and can be carried out easily by him.
Das erfindungsgemäße Verfahren läßt sich auf alle beliebigen Organismen anwenden. Insbesondere ist das erfindungsgemäße Verfahren zur Steigerung des Ertrags sowie zur Wachstumsregulation von mono- und dikotylen Pflanzen sowie Algen und Cyanobakterien einsetzbar. Besonders bevorzugte Pflanzen sind dabei Kulturpflanzen z.B., Soja, Reis, Baumwolle, Zuckerrübe, Sonnenblume, Flachs, Hanf, Kartoffel, Tabak, Tomate, Sommerraps, Winterraps, Alfalfa (Luzerne), Salat, Erbse, Bohne, Karotte, Zwiebel, die verschiedenen Baum, Nuß- und Weinspezies, femer Getreide z.B. Gerste, Weizen, Roggen, Hafer, Mais, femer Obstsorten z.B. Mango, Apfel, Pfirsich, Stachelbeere, Johannisbeere, Banane, Melone, Kürbis und Zitrusfrüchte z.B. Zitrone, Apfelsine, Pampelmuse oder Mandarine. Besonders bevorzugt sind ebenfalls Zierpflanzen wie z.B. Alpenveilchen, Aster, Bougainvillea, Chrysantheme, Petunie, Margerite, Narzisse, Schneeglöckchen, Rittersporn, Sonnenblume, Geranie, Gänsekresse, Gerbera, Gladiole, Ms, Hyazinthe, Lilie, Magnolie, Orchidee, Rhododendron, Rose, Tränendes Herz, Tulpe, Weihnachtsstern. Die mit der Nukleinsauresequenz transformierten Pflanzen können Wildtyppflanzen, durch Züchtung erhaltene Pflanzen oder transgene Pflanzen sein. Das erfindungsgemäße Verfahren kann ferner nicht nur in Pflanzen oder Pflanzengeweben sondern auch in Pflanzenzellen z.B. in einer Zellkultur oder in Expressionssystemen zur Veränderung der Expressionsmuster von Sul 4.1 -Genen oder Derivaten oder Homologen dieser Gene verwendet werden, oder zur Expression von Genen, die mit der regulatorischen Sequenz gemäß SEQ ID NO:l fünktionell verbunden sind.The method according to the invention can be applied to any organisms. In particular, the method according to the invention can be used to increase the yield and to regulate the growth of mono- and dicotyledonous plants as well as algae and cyanobacteria. Particularly preferred plants are cultivated plants, for example, soybean, rice, cotton, sugar beet, sunflower, flax, hemp, potato, tobacco, tomato, summer rape, winter rape, alfalfa (lucerne), lettuce, pea, bean, carrot, onion, the various trees , Nut and wine species, furthermore cereals eg barley, wheat, rye, oats, corn, furthermore fruit types eg mango, apple, peach, gooseberry, currant, banana, melon, pumpkin and citrus fruits such as lemon, orange, grapefruit or tangerine. Ornamental plants such as cyclamen, aster, bougainvillea, chrysanthemum, petunia, marguerite, narcissus, snowdrop, delphinium, sunflower, geranium, geese cress, gerbera, gladiolus, brass, hyacinth, lily, magnolia, orchid, rhododendron, rose are also particularly preferred Heart, tulip, poinsettia. The plants transformed with the nucleic acid sequence can be wild type plants, plants obtained by breeding or transgenic plants. The method according to the invention can also be used not only in plants or plant tissues but also in plant cells, for example in a cell culture or in expression systems for changing the expression pattern of Sul 4.1 genes or derivatives or homologues of these genes, or for expression of genes which are related to the regulatory Sequence according to SEQ ID NO: 1 are functionally linked.
Außerdem ist das erfindungsgemäße Verfahren zur temporären Wachstumsregulation geeignet, indem der Sul 4.1 -spezifische Promotor gegen einen induzierbaren Promotor ausgetauscht wird. Durch eine entsprechende Induktion des Wachstums kann z.B. auf besondere Umweltbedingungen, z.B. extreme Trockenperioden oder lange Kältephasen reagiert werden.In addition, the method according to the invention is suitable for temporary growth regulation in that the Sul 4.1 -specific promoter is exchanged for an inducible promoter. By appropriate induction of growth e.g. to special environmental conditions, e.g. extreme dry periods or long periods of cold are reacted to.
Die vorliegende Erfindung betrifft femer Vektoren, umfassend eine Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog, und einer mit dieser Sequenz fünktionell verbundenen für ein Genprodukt codierenden Nukleinsauresequenz. Die vorliegende Erfindung betrifft femer Vektoren, umfassend eine Nukleinsauresequenz gemäß SEQ ID NO:2, oder deren Fragment oder Derivat oder Homolog und eine regulatorische DNA-Sequenz.The present invention further relates to vectors comprising a nucleic acid sequence according to SEQ ID NO: 1, or its fragment or derivative or homolog, and a nucleic acid sequence which is functionally linked to this sequence and which codes for a gene product. The present invention further relates to vectors comprising a nucleic acid sequence according to SEQ ID NO: 2, or its fragment or derivative or homolog and a regulatory DNA sequence.
Geeignete Vektoren zur Aufnahme und Überführung der Nukleinsäuresequenzen können die Vermehrung und/oder die Expression der aufgenommenen Nukleinsäuren in Einzellern wie z.B. Escherichia coli oder Agrobacterium tumefaciens oder in Pflanzenzellen, Pflanzengeweben oder Pflanzen gewährleisten. Entsprechende Vektoren können natürlich vorkommen oder aber künstlich hergestellt sein. Die Vektoren können Selektionsmarker, Terminatorsequenzen, Polylinker, Promotorelemente, Enhancer, Polyadenylierungsstellen und andere genetische Elemente umfassen. Zur Klonierung geeignete Vektoren sind z.B. pBluescript, Plasmide der pUC-Serie, Plasmide der pGEM-Reihe oder auf dem Bakteriophagen λ basierende Vektoren. Ein zur Verwendung in Agrobacterium benutzter Plasmidvektor ist z.B. pBinl9 vgl. Bevan et al., (1984), Nucleic Acids Research 12, 8711-8721. Zur Transformation und Expression in Pflanzen stellen auf dem Ti-Plasmid von Agrobacterium- Arten oder auf Pflanzenviren aufbauende Konstrukte verwendungsfähige Vektoren dar und sind dem Fachmann bekannt. Des weiteren werden bei bestimmten Transformationsmethoden wie z.B. Mikroinjektion, Protoplasten- Transformation und Einschießen (microprojectile bombardment) anstelle von Ti-Plasmiden auch obengenannte Klonierungsvektoren oder linearisierte DNA eingesetzt. Eine zusammenfassende Beschreibung bislang häufig und standardmäßig benutzter Vektoren findet sich in Guerineau und Mullineaux, Plant Transformation and Expression Vectors, in: Plant Molecular Biology Labfax, herausgegeben von Croy, Oxford, BIOS Scientific Publishers, 121-148 (1993).Suitable vectors for the uptake and transfer of the nucleic acid sequences can ensure the multiplication and / or the expression of the uptake nucleic acids in single cells such as Escherichia coli or Agrobacterium tumefaciens or in plant cells, plant tissues or plants. Corresponding vectors can of course occur or can be produced artificially. The vectors can include selection markers, terminator sequences, polylinkers, promoter elements, enhancers, polyadenylation sites and other genetic elements. Vectors suitable for cloning are, for example, pBluescript, plasmids of the pUC series, plasmids of the pGEM series or vectors based on the bacteriophage λ. A plasmid vector used for use in Agrobacterium is, for example, pBinl9 cf. Bevan et al., (1984), Nucleic Acids Research 12, 8711-8721. For transformation and expression in plants represent usable vectors on the Ti plasmid of Agrobacterium species or constructs based on plant viruses and are known to the person skilled in the art. Furthermore, in certain transformation methods such as microinjection, protoplast transformation and microprojectile bombardment, the abovementioned cloning vectors or linearized DNA are also used instead of Ti plasmids. A summary description of vectors that have been used frequently and by default can be found in Guerineau and Mullineaux, Plant Transformation and Expression Vectors, in: Plant Molecular Biology Labfax, published by Croy, Oxford, BIOS Scientific Publishers, 121-148 (1993).
Einige der in handelsüblichen Transformations- und Expressionssystemen angewendeten Transformationsmethoden zur Übertragung von Fremdgenen in das Genom von Pflanzen werden im folgenden vorgestellt. Die Wahl der Methode zur Einbringung der erfindungsgemäßen Nukleinsauresequenz und der mit ihr funktional verbundenen für ein Genprodukt kodierenden Nukleinsäuresequenzen in pflanzliche Zellen ist jedoch nicht auf diese Liste beschränkt. Bislang eingesetzte Transformationsverfahren bei Pflanzen sind z.B. der Gentransfer mittels Agrobacterium tumefaciens (z.B durch Baden von Samen oder Blattstückchen in einer Agrobakterienlösung), mittels pflanzlicher Viren, durch Elektroporation, durch Einschießen (microprojectile bombardment) oder Einspritzen (Mikroinjektion) sowie die Inkubation von trockenen Embryonen in DNA-haltigen Flüssigkeiten und die Transformation von Protoplasten unter Zuhilfenahme von Polyethylenglykol. Genauere Beschreibungen der angesprochenen Verfahren finden sich z.B. in Jens et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, herausgegeben von Kung und Wu, Academic Press 128-143 (1993).Some of the transformation methods used in commercial transformation and expression systems for the transfer of foreign genes into the genome of plants are presented below. However, the choice of the method for introducing the nucleic acid sequence according to the invention and the nucleic acid sequences which are functionally linked thereto and which code for a gene product into plant cells is not restricted to this list. Transformation methods used to date in plants are e.g. gene transfer by means of Agrobacterium tumefaciens (e.g. by bathing seeds or leaf pieces in an Agrobacterial solution), by means of plant viruses, by electroporation, by injection (microprojectile bombardment) or injection (microinjection) as well as the incubation of dry embryos in DNA-containing liquids and the transformation of protoplasts with the help of polyethylene glycol. More detailed descriptions of the methods mentioned can be found e.g. in Jens et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by Kung and Wu, Academic Press 128-143 (1993).
Die Erfindung wird durch die nun folgenden Beispiele erläutert, ist aber nicht auf diese beschränkt:The invention is illustrated by the following examples, but is not limited to these:
Beispiel 1: Allgemeine Klomerungsverfahren Die im Rahmen der vorliegenden Erfindung durchgeführten Kllonierungsschritte wie z.B. Restriktionsspaltungen, Agarose-Gelelektrophorese, Reinigung von Nukleinsäurefragmenten, Transfer von Nukleinsäuren auf Filtermaterialien, Transformation und Anzucht von Bakterienzellen, Sequenzierungen, PCR etc. wurden analog den bei Sambrook et al, (1989), Molecular Cloning, Cold Spring Harbour Laboratory, ISBN 0-87969-309-6 beschriebenen Verfahren durchgeführt.Example 1: General Clomeration Processes The cloning steps carried out in the context of the present invention, such as restriction cleavages, agarose gel electrophoresis, purification of nucleic acid fragments, transfer of nucleic acids to filter materials, transformation and cultivation of bacterial cells, sequencing, PCR etc. were carried out analogously to those in Sambrook et al. (1989) Molecular Cloning, Cold Spring Harbor Laboratory, ISBN 0-87969-309-6 Procedure carried out.
Beispiel 2: Herstellung einer T-DNA Population von Arabidopsis thaliana Arabidopsis Pflanzen des Ökotyps C24 wurden durch Vakuuminfiltration nach Bechtold et al. (1993), N. Bechtold, J. Ellis, G. Pelletier, In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants, C.R. Acad. Sei., Paris, Sciences de la vie, 1993, 316, 1184-9, mit dem Agrobacteriumstamm GV3101ρMP90RK::pAC102transformiert. Der Stamm GV3101pMP90RK ist in Koncz & Schell, (1986), Mol. Gen. Genet. 204, 383-396 beschrieben. Das Plasmid pAC102 ist in Fig. 6 dargestellt. Das in den Agrobacterien enthaltene pAC102 vermittelt unter anderem Resistenz gegen das Antibiotikum Sulfadiazin und besitzt darüber hinaus die Eigenschaft, nach der Integration am rechten Grenzfragment liegende genomische Sequenzabschnitte überzuexprimieren. Durch Selektion auf Resistenz gegen Sulfadiazin wurde eine ca. 500 Individuen umfassende Population von Transformanten erhalten.Example 2: Production of a T-DNA population of Arabidopsis thaliana Arabidopsis plants of the ecotype C24 were by vacuum infiltration according to Bechtold et al. (1993), N. Bechtold, J. Ellis, G. Pelletier, In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants, C.R. Acad. Sei., Paris, Sciences de la vie, 1993, 316, 1184-9, transformed with the Agrobacterium strain GV3101ρMP90RK :: pAC102. The strain GV3101pMP90RK is in Koncz & Schell, (1986), Mol. Gen. Genet. 204, 383-396. The plasmid pAC102 is shown in FIG. 6. The pAC102 contained in the Agrobacteria mediates resistance to the antibiotic sulfadiazine, among other things, and also has the property of over-expressing genomic sequence segments located on the right border fragment after integration. A population of approximately 500 individuals comprising transformants was obtained by selection for resistance to sulfadiazine.
Beispiel 3: Screening nach Mutanten mit verändertem WachstumExample 3: Screening for mutants with altered growth
Die Sul 4.1-Mutante wurde durch Screening der mit Ti-Plasmid pAC102 transformierten Population von Arabidopsis thaliana Pflanzen nach visueller Auswahl von Individuen mit veränderten Wachstumseigenschaften detektiert. Die Samen der durch Vakuum-Infiltration behandelten Arabidopsis Pflanzen wurden dazu zur Selektion von Transformanten auf ein Perlit/Sand Gemisch, das Sulfadiazin enthielt, aufgebracht. Nach Inkubation bei 2-5°C im Dunkeln für 3 Tage zur Überwindung der Samenruhe wurden die Keimlinge im Kurztag (8 Stunden Licht, 16 Stunden Dunkel, 22°C) in der Klimakammer angezogen. Transformanten, d.h. in diesem Fall Keimlinge, die unter Selektion das Vier-Blatt-Stadium erreichten, wurden pickiert dann in Plastikbehältern auf „Minitray"-Erde (Gebr. Patzer GmbH & Co KG, D-36391 Sinntal- Jossa, Deutschland) weiter im Kurztag wachsen gelassen. Nach Ausbildung der Blattrosette wurden die Pflanzen im Langtag (16 Stunden Licht, 8 Stunden Dunkel) im nicht klimatisierten Gewächshaus zur Samenreife gebracht. Zur Identifizierung von phänotypisch auffälligen Mutanten der entstandenen T-DNA Population wurden ca. 500 Pflanzen per Auge nach Auffälligkeiten durchmustert. Dabei konnte eine Linie (Sul 4.1) identifiziert werden, die sich dadurch von den Normalpflanzen abhob, daß sie auf Erde unter normalen Gewächshausbedingungen ein stark verzögertes Wachstum zeigte und nur in Sterilkultur am Leben erhalten werden konnte. Beispiel 4: Vermehrung der PflanzenThe Sul 4.1 mutant was detected by screening the population of Arabidopsis thaliana plants transformed with Ti plasmid pAC102 after visual selection of individuals with changed growth properties. For this purpose, the seeds of the Arabidopsis plants treated by vacuum infiltration were applied to a pearlite / sand mixture containing sulfadiazine in order to select transformants. After incubation at 2-5 ° C in the dark for 3 days to overcome the dormancy, the seedlings were grown in the climatic chamber on short day (8 hours light, 16 hours dark, 22 ° C). Transformants, ie in this case seedlings, which reached the four-leaf stage under selection, were then picked in plastic containers on "mini-tray" earth (Gebr. Patzer GmbH & Co KG, D-36391 Sinntal-Jossa, Germany) After formation of the rosette of leaves, the plants were brought to seed maturity in the long day (16 hours light, 8 hours dark) in a non-air-conditioned greenhouse .. To identify phenotypically conspicuous mutants of the resulting T-DNA population, approximately 500 plants were followed up by eye A line (Sul 4.1) was identified, which stood out from the normal plants in that it showed a strongly retarded growth on soil under normal greenhouse conditions and could only be kept alive in sterile culture. Example 4: Propagation of plants
Sterilkulturpflanzen wurden in Reagenzglasröhrchen mit Watteverschluß zur Samenreife gebracht. Samen dieser Pflanzen wurden in Steril^ltur auf Sulfadiazin-haltigem Medium ausgekeimt und resistente Keimlinge im Gewächshaus auf mini-tray Erde vermehrt. Die Fertilisation mit „Osmocote Plus" (15% N, 11% P2O5, 13% K2O, 2% MgO; Scotts Deutschland GmbH, D-48527 Nordhorn, Deutschland) erfolgte gemäß den Angaben des Herstellers.Sterile culture plants were brought to seed ripeness in test tube tubes with a cotton swab. Seeds of these plants were sterilized in a sterile manner on a medium containing sulfadiazine and resistant seedlings were propagated in a greenhouse on mini-tray soil. Fertilization with "Osmocote Plus" (15% N, 11% P 2 O 5 , 13% K 2 O, 2% MgO; Scotts Deutschland GmbH, D-48527 Nordhorn, Germany) was carried out according to the manufacturer's instructions.
Beispiel 5: Identifizierung von r- N^-flankierenden SequenzenExample 5: Identification of r-N ^ -flanking sequences
Die die Sul 4.1 T-DΝA flankierenden genomischen Sequenzen wurden durch die sogenannte Plasmid-rescue-Technik isoliert. Dazu wurde DNA von Sul 4.1 Pflanzen mit der CTAB Methode präpariert, mit EcoRI geschnitten, die so entstandenen Enden mit T4 Ligase ligiert, und der Ligaseansatz in DH10B Zellen nach Hersteller Angaben (Gibco/Brl) transformiert. Die auf die auf diesem Wege erhaltenen genomischen Sequenzen wurden durch DNA- Sequenzierung nach der Didesoxy-Methode von Sanger analysiert. Dazu wurden die Oligonukleotide 1046 und pucli3 verwendet.The genomic sequences flanking the Sul 4.1 T-DΝA were isolated by the so-called plasmid rescue technique. For this purpose, DNA from Sul 4.1 plants was prepared using the CTAB method, cut with EcoRI, the resulting ends ligated with T4 ligase, and the ligase batch was transformed into DH10B cells according to the manufacturer's instructions (Gibco / Brl). The genomic sequences obtained in this way were analyzed by DNA sequencing using the Sanger dideoxy method. The oligonucleotides 1046 and pucli3 were used for this.
Beispiel 6: Spezifische Oligonukleotide und Adaptersequenzen (5' - 31 Orientierung)Example 6: Specific oligonucleotides and adapter sequences (5 '- 3 1 orientation)
pucli3: CCGGGTACCGAGCTCGAATTC (SEQ ID NO:5)pucli3: CCGGGTACCGAGCTCGAATTC (SEQ ID NO: 5)
1046: GATCAGATTG TCGTTTCCCG CCTTCAGTTT (SEQ ID NO:6)1046: GATCAGATTG TCGTTTCCCG CCTTCAGTTT (SEQ ID NO: 6)
Beispiel 7: SequenzierungExample 7: Sequencing
Die DNA Sequenzierung wurde von der ADIS Servicegruppe des MPIZ mit PE Biosystems Abi Prism 377 and 3700 Geräten und der BigDye-terminator Chemie durchgeführt. Die DNA Sequenzen wurden mit Hilfe des „University of Wisconsin Genetic Computer Group" Sequenzanalysepacketes oder mit Hilfe von FASTA verglichen. Diese Homologiesuche ergab, daß die aus Sul 4.1 erhaltene genomische Sequenz signifikante Homologie zu EST 194D3T7 (Genbank Acc. Nummer H76408) aufweist. Beispiel 8: WachstumsmessungenDNA sequencing was performed by the MPIZ ADIS service group with PE Biosystems Abi Prism 377 and 3700 devices and the BigDye terminator chemistry. The DNA sequences were compared using the "University of Wisconsin Genetic Computer Group" sequence analysis package or using FASTA. This homology search revealed that the genomic sequence obtained from Sul 4.1 has significant homology to EST 194D3T7 (Genbank Acc. Number H76408). Example 8: Growth measurements
Homozygote Sul4.1 Pflanzen und Wildtyp C24 Pflanzen wurden in parallelen Reihen in einer Pflanzschale unter verschiedenen Aufzuchtbedingungen im Gewächshaus kultiviert und nach mehreren Zeitpunkten die Schlüsselparameter Stengellänge und Blattrosettengröße durch Ausmessen mit einem Lineal bestimmt. Das Wachstum von Sul 4.1 Pflanzen ist gegenüber dem Wildtyp ab dem Zeitpunkt des Blütenansatzes deutlich verlangsamt. Zur Samenreife beträgt die Größe von Sul 4.1 Pflanzen im Durchschnitt nur die Hälfte der Größe von Wildtyp Pflanzen.Homozygous Sul4.1 plants and wild type C24 plants were cultivated in parallel rows in a planting bowl under different growing conditions in the greenhouse and after several points in time the key parameters stem length and leaf rosette size were determined by measuring with a ruler. The growth of Sul 4.1 plants has slowed significantly compared to the wild type from the time the flowers begin to bloom. At seed maturity, the size of Sul 4.1 plants is on average only half the size of wild-type plants.
Beispiel 9: Genetische CharakterisierungExample 9: Genetic characterization
Durch Southern Blotting und Co-Segregationsanalyse wurde die Kopplung der Sul 4.1 T-DNA hisertion mit dem Phänotyp des verkürzten Wachstums nachgewiesen. Durch Northem Blotting und Vergleich mit Wildtyp konnte gezeigt werden, daß das Sul 4.1 (194D3T7) Gen in Sul 4.1 Pflanzen stark überexprimiert wird. Ein entsprechendes Transkript konnte mit Northem Blotting in Wildtyp nicht nachgewiesen werden. Des weiteren wurden Northem Blot Analysen verschiedener Entwicklungsstadien dTirchgeführt: Von Arabidopsis Pflanzen (Ökotyp C24 und Sul4.1) im Rosettenstadium wurde RNA aus Blättern isoliert, von Pflanzen im Längenwachstum aus dem Stengel und Blättern, von Pflanzen im Blühstadium aus Blüten, Stengel und Blättern und von Pflanzen im Schotenstadium aus Schoten, Blüten, Stengel und Blättern. So konnte gezeigt werden, daß das Sul4.1-Gen entwicklungsabhängig - erst ab dem Blühstadium der Pflanze - exprimiert wird. Elementare molekularbiologische Methoden wie z.B. Southern und Northem Blotting wurden wie bei Sambrook et al., (1989), Molecular Cloning, Cold Spring Harbour Laboratory, ISBN 0-87969-309-6 beschrieben, diirchgeführt.Southern blotting and co-segregation analysis demonstrated the coupling of the Sul 4.1 T-DNA hisertion with the phenotype of the shortened growth. Northem blotting and comparison with wild type showed that the Sul 4.1 (194D3T7) gene is strongly overexpressed in Sul 4.1 plants. A corresponding transcript could not be detected with wild-type Northem blotting. Furthermore, Northem blot analyzes were carried out at various stages of development: RNA was isolated from leaves from Arabidopsis plants (ecotype C24 and Sul4.1) in the rosette stage, from plants in length growth from the stems and leaves, from plants in the flowering stage from flowers, stems and leaves and of plants in the pod stage from pods, flowers, stems and leaves. It could be shown that the Sul4.1 gene is expressed depending on development - only from the flowering stage of the plant. Elementary molecular biological methods such as Southern and Northem blotting were performed as described in Sambrook et al., (1989) Molecular Cloning, Cold Spring Harbor Laboratory, ISBN 0-87969-309-6.
Beispiel 10: RetransformationExample 10: Retransformation
Der EST Klon 194D3T7 wurde zwischen dem CaMV 35S Promotor und Terminator des Plasmides pSEXOOl-VS (vgl. Figur 7 und SEQ ID NO:4) inseriert und das entstandene Plasmid pSEX146 in Agrobacterium Stamm GV3101pMP90RK durch Elekroporation transformiert. Dieser Agrobacterium Stamm wurde für eine Transformation durch Vakuuminfiltration von Arabidopsis Wildtyp C24 benutzt. Transformanten wurden auf Resistenz gegen Sulfadiazin selektiert (Primärtransformanten). Die Nachkommen dieser Primärtransformanten wurden wie für Beispiel 8 durch Wachstumstests im direkten Vergleich mit Wildtyp C24 und Sul4.1 charakterisiert. Diese Tests ergaben, daß 194D3T7 RNA überexpimierende Retransformanten den Phänotyp von Sul 4.1 zeigten. Es wurden jedoch auch Retransformanten erhalten, die den gegenteiligen Phänotyp, erhöhtes Wachstum im Vergleich zu Wildtyp, zeigten. Dieser Effekt ist vermutlich auf Co-Suppressions-Phänomene zurückzuführen. EST clone 194D3T7 was inserted between the CaMV 35S promoter and terminator of the plasmid pSEXOOl-VS (see FIG. 7 and SEQ ID NO: 4) and the resulting plasmid pSEX146 was transformed into Agrobacterium strain GV3101pMP90RK by electroporation. This Agrobacterium strain was used for transformation by vacuum infiltration of Arabidopsis wild type C24. Transformants were tested for resistance to sulfadiazine selected (primary transformants). The progeny of these primary transformants were characterized as for example 8 by growth tests in direct comparison with wild type C24 and Sul4.1. These tests indicated that 194D3T7 RNA overexpanding retransformants showed the phenotype of Sul 4.1. However, retransformants were also obtained which showed the opposite phenotype, increased growth compared to wild type. This effect is probably due to co-suppression phenomena.

Claims

Patentansprüche claims
1. Transgene Pflanze mit einer stabil in das Genom integrierten regulatorischen Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, und einer mit dieser Nukleinsauresequenz fünktionell verbundenen für ein Genprodukt codierenden Nukleinsauresequenz.1. Transgenic plant with a regulatory nucleic acid sequence according to SEQ ID NO: 1 which is stably integrated into the genome, or its fragment or derivative or homolog with the biological function of a promoter, and a nucleic acid sequence which is functionally linked to a nucleic acid coding for a gene product.
2. Transgene Pflanze gemäß Ansprach 1, wobei für die für ein Genprodukt codierende Nukleinsauresequenz eine endogene oder exogene Nukleinsauresequenz verwendet wird.2. Transgenic plant according to spoke 1, wherein an endogenous or exogenous nucleic acid sequence is used for the nucleic acid sequence coding for a gene product.
3. Transgene Pflanze gemäß Ansprach 1 oder 2, wobei für die für ein Genprodukt codierende Nukleinsauresequenz ausgewählt ist aus Genen des Phytohormonstoffwechsels von Auxinen, Gibberellinen, Cytokinen, Abscisinsäure oder Ethylen.3. Transgenic plant according to spoke 1 or 2, wherein for the nucleic acid sequence coding for a gene product is selected from genes of the phytohormone metabolism of auxins, gibberellins, cytokines, abscisic acid or ethylene.
4. Transgene Pflanze mit einer stabil in das Genom integrierten Nukleinsauresequenz gemäß SEQ ID NO:2, oder deren Fragment oder Derivat oder Homolog mit der biologischen Aktivität der Wachstumsregulierung, und einer mit dieser Nukleinsauresequenz fünktionell verbundenen regulatorischen Nukleinsauresequenz.4. Transgenic plant with a nucleic acid sequence according to SEQ ID NO: 2 which is stably integrated into the genome, or its fragment or derivative or homologue with the biological activity of the growth regulation, and a regulatory nucleic acid sequence which is functionally linked to this nucleic acid sequence.
5. Transgene Pflanze gemäß Ansprach 4, wobei die regulatorische Nukleinsauresequenz ausgewählt ist aus der Gruppe der Promotoren CaMV 35S-Promotor, PRPI-Promotor, Phaseolin- Promotor, Isoflavon-Reduktase Promotor, ST-LSI Promotor, durch Salizylsäure induzierbarer Promotor, durch Benzenesufonamid induzierbarer Promotor, durch Tetrazyklin induzierbarer Promotor, durch Abscisinsäure induzierbarer Promotor, durch Ethanol oder Cyclohexanon induzierbarer Promotor, Promotor gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, oder ein samenspezifischer Promotor. f 6. Transgene Pflanze nach Ansprach 4 oder 5, wobei die für ein Genprodukt codierende5. Transgenic plant according spoke 4, wherein the regulatory nucleic acid sequence is selected from the group of promoters CaMV 35S promoter, PRPI promoter, phaseolin promoter, isoflavone reductase promoter, ST-LSI promoter, promoter inducible by salicylic acid, inducible by benzenesufonamide Promoter, tetracycline-inducible promoter, abscisic acid-inducible promoter, ethanol or cyclohexanone-inducible promoter, promoter according to SEQ ID NO: 1, or its fragment or derivative or homolog with the biological function of a promoter, or a seed-specific promoter. f 6. Transgenic plant according to spoke 4 or 5, wherein the coding for a gene product
Nukleinsauresequenz gemäß SEQ ID NO:2 in Sense- oder Antisense-Orientierung vorliegt.Nucleic acid sequence according to SEQ ID NO: 2 is in sense or antisense orientation.
7. Transgene Pflanze nach einem der Ansprüche 1 bis 6, wobei die Expression der stabil ins Genom integrierten für ein Genprodukt codierenden Nukleinsauresequenz gegenüber ihrer natürlichen Expression erhöht oder verringert ist. 7. The transgenic plant according to one of claims 1 to 6, wherein the expression of the nucleic acid sequence which is stably integrated into the genome and which codes for a gene product is increased or decreased compared to its natural expression.
8. Transgene Pflanze nach einem der Ansprüche 4 bis 7, wobei die Nukleinsauresequenz gemäß SEQ ID NO:2 aus Fragmenten verschiedener Sul 4.1 -Gene zusammengesetzt ist und gegebenenfalls Deletionen, Additionen oder Substitutionen aufweist.8. Transgenic plant according to one of claims 4 to 7, wherein the nucleic acid sequence according to SEQ ID NO: 2 is composed of fragments of different Sul 4.1 genes and optionally has deletions, additions or substitutions.
9. Verfahren zur Herstellung einer Pflanze nach einem der Ansprüche 1 bis 8, umfassend das stabile Integrieren einer regulatorischen Nukleinsauresequenz, insbesondere einer Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, und einer mit dieser Nukleinsauresequenz fünktionell verbundenen für ein Genprodukt codierenden Nukleinsauresequenz, insbesondere der Nukleinsauresequenz gemäß SEQ ID NO:2, oder deren Fragment oder Derivat oder Homolog mit der biologischen Aktivität der Wachstumsregulierung, in das Genom von Pflanzenzellen oder Pflanzengeweben und Regeneration der erhaltenen Pflanzenzellen oder Pflanzengeweben zu fertilen Pflanzen.9. A method for producing a plant according to one of claims 1 to 8, comprising the stable integration of a regulatory nucleic acid sequence, in particular a nucleic acid sequence according to SEQ ID NO: 1, or its fragment or derivative or homolog with the biological function of a promoter, and one with this nucleic acid sequence functionally linked nucleic acid sequence coding for a gene product, in particular the nucleic acid sequence according to SEQ ID NO: 2, or its fragment or derivative or homologue with the biological activity of the growth regulation, into the genome of plant cells or plant tissues and the regeneration of the plant cells or plant tissues obtained Plants.
10. Transformierte Pflanzenzelle oder transformiertes Pflanzengewebe, dadurch gekennzeichnet, daß eine regulatorische Nukleinsauresequenz, insbesondere einer Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, und eine mit dieser Nukleinsauresequenz fünktionell verbundenen für ein Genprodukt codierenden Nukleinsauresequenz, insbesondere der Nukleinsauresequenz gemäß SEQ ID NO:2, oder deren Fragment oder Derivat oder Homolog mit der biologischen Aktivität der Wachstumsregulierung, stabil in das Genom der Pflanzenzelle oder des Pflanzengewebes integriert ist.10. Transformed plant cell or transformed plant tissue, characterized in that a regulatory nucleic acid sequence, in particular a nucleic acid sequence according to SEQ ID NO: 1, or its fragment or derivative or homolog with the biological function of a promoter, and a functionally linked to this nucleic acid sequence for a gene product coding nucleic acid sequence, in particular the nucleic acid sequence according to SEQ ID NO: 2, or its fragment or derivative or homologue with the biological activity of the growth regulation, is stably integrated into the genome of the plant cell or plant tissue.
11. Pflanzenzelle oder Pflanzengewebe nach Anspruch 10, regenerierbar zu einer fertilen Pflanze.11. Plant cell or plant tissue according to claim 10, regenerable to a fertile plant.
12. Saatgut, erhalten von Pflanzen nach einem der Ansprüche 1 bis 8.12. Seed obtained from plants according to one of claims 1 to 8.
13. Nukleinsauresequenz gemäß SEQ ID NO:l, oder deren Fragment oder Derivat oder Homolog mit der biologischen Funktion eines Promotors, oder eine Nukleinsauresequenz, die mit der Nukleinsauresequenz gemäß SEQ ID NO:l hybridisiert und die biologische Funktion eines Promotors aufweist. 13. Nucleic acid sequence according to SEQ ID NO: 1, or its fragment or derivative or homolog with the biological function of a promoter, or a nucleic acid sequence that hybridizes with the nucleic acid sequence according to SEQ ID NO: 1 and has the biological function of a promoter.
14. Nukleinsauresequenz nach Ansprach 13, wobei die hybridisierende Nukleinsauresequenz unter stringenten Bedingungen mit der Nukleinsauresequenz gemäß SEQ ID NO:l hybridisiert.14. Nucleic acid sequence according to spoke 13, wherein the hybridizing nucleic acid sequence hybridizes under stringent conditions with the nucleic acid sequence according to SEQ ID NO: 1.
15. Vektor, umfassend eine Nukleinsauresequenz nach einem der Ansprüche 13 oder 14. 15. Vector comprising a nucleic acid sequence according to one of claims 13 or 14.
PCT/DE2001/003216 2000-08-18 2001-08-17 Plants having modified growth properties WO2002014521A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DE10193390T DE10193390D2 (en) 2000-08-18 2001-08-17 Plants with changed growth properties
AU2001289571A AU2001289571A1 (en) 2000-08-18 2001-08-17 Plants having modified growth properties

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10040379A DE10040379A1 (en) 2000-08-18 2000-08-18 Plants with changed growth properties
DE10040379.4 2000-08-18

Publications (2)

Publication Number Publication Date
WO2002014521A2 true WO2002014521A2 (en) 2002-02-21
WO2002014521A3 WO2002014521A3 (en) 2002-06-27

Family

ID=7652859

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2001/003216 WO2002014521A2 (en) 2000-08-18 2001-08-17 Plants having modified growth properties

Country Status (3)

Country Link
AU (1) AU2001289571A1 (en)
DE (2) DE10040379A1 (en)
WO (1) WO2002014521A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8053184B2 (en) 2005-05-27 2011-11-08 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] Accession Number AL162508, 28. März 2000 (2000-03-28) BEVAN M, ET AL.: "Arabidopsis thaliana DNA chromosome 5" XP002189243 *
MATHUR JAIDEEP ET AL: "Gene identification with sequenced T-DNA tags generated by transformation of Arabidopsis cell suspension." PLANT JOURNAL, Bd. 13, Nr. 5, M{rz 1998 (1998-03), Seiten 707-716, XP002189242 ISSN: 0960-7412 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8053184B2 (en) 2005-05-27 2011-11-08 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US9017947B2 (en) 2005-05-27 2015-04-28 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US9944945B2 (en) 2005-05-27 2018-04-17 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US10738320B2 (en) 2005-05-27 2020-08-11 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US11390881B2 (en) 2005-05-27 2022-07-19 Monsanto Technology, Llc Soybean event MON89788 and methods for detection thereof

Also Published As

Publication number Publication date
DE10040379A1 (en) 2002-02-28
AU2001289571A1 (en) 2002-02-25
WO2002014521A3 (en) 2002-06-27
DE10193390D2 (en) 2003-07-03

Similar Documents

Publication Publication Date Title
DE69735484T2 (en) GENETIC CONTROL OF FLOWERING
DE69834192T2 (en) WHEAT RHT GEN FOR GENETIC CONTROL OF PLANT GROWTH AND DEVELOPMENT
Zheng et al. Modification of plant architecture in chrysanthemum by ectopic expression of the tobacco phytochrome B1 gene
DE112008001730T5 (en) Plants with improved yield-related traits and methods for their production
DE112009000705T5 (en) Plants with enhanced yield-related traits and methods of making the same
DE69433424T2 (en) PLANTS WITH MODIFIED RESPONSE TO ETHYLENE
DE102016106656A1 (en) Nuclear encoded male sterility by mutation in cytochrome P450 oxidase
DE112008001837T5 (en) Plants with improved yield-related traits and methods for their production
DE60035509T2 (en) REGULATION OF THE BRANCHING OF PLANTS
WO2016156583A1 (en) Male-sterile plant of the genus triticum
CN102421793A (en) Polypeptide having function for delaying anthesis or suppressing growth, polynucleotide encoding the same, and use thereof
DE19852757A1 (en) Promoters for gene expression in the roots of plants
DE69837396T2 (en) GENETIC PROCEDURE
DE19940270C2 (en) Process for the production of plants with increased photosynthesis rate
DE4439748A1 (en) Method for changing the flowering behavior in plants
DE60223293T2 (en) Regulatory sequences from rice for gene expression in defined tissues of wheat
WO2002014521A2 (en) Plants having modified growth properties
DE112010002884T5 (en) Rock2 and rock3, two new gain-of-function variants of the cytokinin receptors AHK2 and AHK3
KR101531923B1 (en) Transcriptional regulatory element which induces sporophytic tissue or central cell-specific expression of foreign gene in plant and uses thereof
DE10034729A1 (en) Regulatory sequences from meristematic cells
EP1190081B1 (en) Plants with modified gene expression
DE112011100641T5 (en) Plants with enhanced yield-related traits and methods for their production
DE10063879B4 (en) Nucleic acids encoding vacuolar invertases, plant cells and plants containing them and their use
DE60128796T2 (en) PROCESS FOR PRODUCING PLANTS WITH INCREASED RESISTANCE TO WATER STRESS
WO2003014364A1 (en) Method for influencing the acceptance of minerals in transgenic plants

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

WD Withdrawal of designations after international publication

Free format text: DE

REF Corresponds to

Ref document number: 10193390

Country of ref document: DE

Date of ref document: 20030703

Kind code of ref document: P

WWE Wipo information: entry into national phase

Ref document number: 10193390

Country of ref document: DE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP