DE19940270C2 - Process for the production of plants with increased photosynthesis rate - Google Patents

Abstract

The present invention relates to a process for the production of plants with an increased photosynthesis rate, comprising the stable integration of a nucleic acid sequence coding for a PsaE subunit of Photosystem I, or its fragment or derivative into the genome of plant cells or plant tissues, the nucleic acid sequence or its fragment or derivative is functionally linked to a regulatory DNA sequence that controls the expression of the integrated nucleic acid sequence or its fragment or derivative, and regeneration of the plant cells or plant tissues obtained to plants.

Description

The present invention relates to a method for producing plants with increased Photosynthesis rate comprising the stable integration of a nucleic acid sequence coding for a PsaE subunit of Photosystem I, or its fragment or derivative in the genome of Plant cells or plant tissues, the nucleic acid sequence or its fragment or derivative is operably linked to a regulatory DNA sequence that the Controls expression of the integrated nucleic acid sequence or its fragment or derivative, and Regeneration of the plant cells or plant tissues obtained to plants.

The energy generation through photosynthesis is based on the absorption of electromagnetic Radiation from excitable pigments, such as B. chlorophyll. The radiation absorption leads to Raising an electron to a higher energy level. A subsequent, controlled one Lowering the energy level of the excited electron via a defined oxidation chain can be used by the organism to generate energy.

Two protein complexes, called Photosystem I (PS I) and Photosystem II (PS II), are involved in the photosynthetic electron transport. The electrons released by excitation of PS II are first transferred in the thylakoid lumen by a soluble electron carrier (plastocyanin or cytochrome c ₆ ) to the likewise excited PS I, the electron gap of which can thus be filled. The oxidized PS I takes over the electrons, sends them through the thylakoid membrane and transfers them on the stroma side to the electron carrier ferredoxin or flavodoxin. Flavodoxin is an alternative electron acceptor for most cyanobacteria and algae. A summary description of these photosynthetic light reactions can be found e.g. B. in: Photosynthesis: a comprehensive treatise, AS Raghavendra, ed. (Cambridge University Press, 1998, pages 29-43, He, WZ and Malkin, R .: Photosystems I and II.

Photosystem I consists of at least 11 subunits in cyanobacteria, as follows are referred to: PsaA, PsaB, PsaC, PsaD, PsaE, PsaF, PsaI, PsaJ, PsaK, PsaL and PsaM. In higher plants could do three more in addition to the components already mentioned Subunits are identified, which are referred to as PsaG, PsaH and PsaN; see. Knoetzel, J. and Simpson, D.J., (1993), "The primary structure of a cDNA for PsaN, encoding an extrinsic lumenal polypeptide of barley photosystem I, Plant Mol. Biol. ", 22, 337-345; Okkels, J. et al., (1992) "A cDNA clone from barley encoding the precursor from the photosystem I polypeptide PSI-G: sequence similarity to PSI-K ", Plant Mol. Biol. 18, 989-994; Okkels, J. et al., (1989), "A cDNA clone encoding the precursor for a 10.2 kDa photosystem I polypeptide of barley ", FEBS Letters 250, 575-579.

The PS-I subunit PsaE located on the stroma side of the thylakoid membrane is on cyclic electron transport and involved in ferredoxin binding; see. Klukas, O. et al., (1999), "Photosystem I, an improved model of the stromal subunits PsaC, PsaD, and PsaE", J. Biol. Chem. 274, 7351-7360; Yu, L. et al., (1993), "PsaE is required for in vivo cyclic electron flow around photosystem I in the cyanobacterium Synechococcus sp. PCC 7002 ", Plant Physiology 103, 171-180; Zhao, J. et al., (1993), "Cloning and characterization of the psaE gene of the cyanobacterium Synechococcus sp. PCC 7002: characterization of a psaE mutant and overproduction of the protein in Escherichia coli ", Mol. Microbiol. 9, 183-194; Rousseau, F. et al., (1993), "Evidence for the involvement of PSI-E subunit in the reduction of ferredoxin by photosystem I ", Embo J 12, 1755-1765; Sonoike, K. et al., (1993)," Small subunits of Photosystem I reaction center complexes from Synechococcus elongatus. II. The psaE gene product has a role to promote interaction between the terminal electron acceptor and ferredoxin ", Biochim Biophys Acta 1141, 52-57; Weber, N. and Strotmann, H., (1993), "On the function of subunit PsaE in chloroplast Photosystem I ", Biochim. Biophys. Acta 1143; 204-210.

The growth of cyanobacteria with a lack of PsaE corresponds to that of the wild type under photoautotrophic conditions, while PsaE mutants grow more slowly in low light or CO ₂ compared to the wild type and stop growth completely under photoheterotrophic conditions; see. Zhao, J et al. (1993), supra.

PsaE is encoded in higher plants by nuclear genes and is in multiple copies in the Genome before; see. Obokata, J. et al., (1994), "Microheterogeneity of PSI-E subunit of photosystem I in Nicotiana sylvestris ". Plant Cell. Physiol. 35, 203-209). The nucleic acid sequences of the PsaE-  Genes and the corresponding amino acid sequences are found in different plant species e.g. B. in Nicotiana sylvestris and Hordeum vulgare known. So far there are two in Arabidopsis thaliana psaE genes (psaE1 and psaE2) have been identified. The psaE1 gene is on chromosome 4 and psaE2 localized on chromosome 2. Because of the Arabidopsis genome project that the complete sequencing of the Arabidopsis genome was able to do so genomic sequence with the aid of nucleic acid analysis programs Sequences of the two psaE genes and the amino acid sequences derived therefrom were determined become. The nucleic acid sequence of the psaE1 gene is under the GenBank accession number AL 035353, base numbers 52445 to 53382. The nucleic acid sequence of the psaE2- Gens is under GenBank accession number AC 006569, base number 74016 to 75012, found on the complementary strand of DNA. Functional analyzes regarding the activity of PsaE in higher plants have so far failed because mutants with a defective psaE gene have not were available and a corresponding plant phenotype up to the present time could not be proven. Due to the complexity of the photosystems higher Plants were the effects of an altered PsaE subunit on the Photosynthesis rate still unpredictable.

The basic supply of the rapidly growing world population with food and vegetable raw materials places high demands on modern agriculture. The Improvement in plant yield through traditional breeding is now triggering their limits and is also very time and labor intensive. The modern way shows one way out Genetic engineering. This allows targeted modification of certain metabolic pathways the introduction of new gene sequences or manipulation of existing ones in the organism Genes. As with genetic engineering processes, the changes in the genetic material usually are known exactly, these methods can usually be applied to other plant species transfer. This advantage does not exist with plants grown in the classical way. For Corresponding, transferable processes therefore have an increased need. A Yield increase in plants can, for. B. caused by increasing the rate of photosynthesis become; an approach that, for example, already in WO 96/21737 - on an expression of deregulated fructose-1,6-bisphosphatase - was followed. It was now surprisingly found that an altered expression of an endogenous PsaE gene turned into a strong one Changes in the photosynthesis rate of the changed organism leads. The present The invention is therefore based on the object of a method for increasing the yield in plants by increasing photosynthetic performance.

The object is achieved by the subject-matter defined in the patent claims.

The method according to the invention is illustrated by the following figures.

Fig. 1 shows the nucleic acid sequence of psaE1 cDNA from Arabidopsis thaliana (NCBI Acc No: AJ 245908). The start ATG and stop codon are highlighted in bold.

Figure 2 shows the amino acid sequence derived from Arabidopsis thaliana psaE1 cDNA (NCBI Acc No. CAA 22977).

Fig. 3 shows the nucleic acid sequence of belonging to psaE1 gene of Arabidopsis thaliana promoter. The start ATG of the psaE1 gene belonging to the promoter is highlighted in bold. The numbering corresponds to that of the genomic BAC clone F16A16 (Accession No. AL035353).

FIGS. 4A-D shows schematically the growth behavior of Arabidopsis thaliana PsaE1- mutants compared to wild type plants. The PsaE1 mutants are abbreviated here as pam4 "photosynthesis affected mutant 4". A shows the growth of leaf areas "plant area" in cm ² for the period from day 12 to day 21 after germination. B shows the growth rate, measured as a percentage increase in the leaf area within two days. C shows a frequency distribution of the plants in relation to the leaf area. Figure D shows the frequency distribution of plants in relation to the growth rate.

FIGS. 5A-C schematically shows the light saturation curves of PsaE1 mutants and wild-type plants, measured under various conditions based on the effective quantum yield (ΦII = .DELTA.F / F _{M '=} (F _M' - F _S) / F _{M ')} of photosystem II. The PsaE1 mutants are abbreviated here as pam4 "photosynthesis affected mutant 4". In A you can see the light saturation curve after 20 hours of dark incubation. B shows the light saturation curve after 20 hours of dark incubation plus 4 hours of exposure at 160 µmol photons m ^-2 sec ^-1 , followed by 10 min of dark incubation immediately before the measurement. In C you can see the light saturation curve after 20 hours of dark incubation plus 4 hours of exposure to 160 µmol photons m ^-2 sec ^-1 , followed by 2 hours of dark incubation immediately before the measurement.

Fig. 6 shows schematically the detection of psaE1- and psaE2 transcripts by RT-PCR and subsequent restriction digest. WT denotes the wild type, pam4 the PsaE1 mutant.

FIG. 7 shows in an overview that the pam4 mutation was caused by the insertion of an en element in the psaE1 gene from Arabidopsis thaliana. The insertion site is in intron 1. At the insertion site there is a typical duplication of a 3 base pair long target sequence (bold and large). The figure shows the footprints left by the En element in a total of 13 germinal revertants (REV # 1-13) and one somatic revertant sector (REV # 14). Bases added by the insertion are shown in bold and small. WT denotes the wild type, pam4 the PsaE1 mutant.

Fig. 8 shows schematically a comparison of the amino acid sequences of PSAE proteins from plants, algae and cyanobacteria. The amino acid sequences of A. thaliana PsaE1 and PsaE2 were compared with the amino acid sequences of the Psae subunits of the organisms listed. The comparison is divided into three parts, the first part comprising the domain of the N-terminal chloroplast import sequence. The second part contains the second N-terminal domain, the third part contains the C-terminal domain, which is very similar in higher plants, algae and cyanobacteria. Identical amino acids are highlighted in black; closely related amino acids are highlighted in gray.

NCBI Acc no. A. thaliana E1: CAA22977, A. thaliana E2: AAB21762, Tobacco EA: AAB31704, Tobacco EB: AAB31705, Spinach: CAA32183, Barley: CAA68782, C. reinhardtii: CAA31850, P. purpurea: P29789, C. caldarium: AAB82665, G. theta: AAC35737, O. sinensis: P49482, C. paradoxa: AAA81265, Calothrix 7601: AAB20250, M. laminosus: AAC83370, Nostoc 8009: AAD38024, Synechococcus 7002: AAA27355, Synechococcus 6803: BAA18383.

The term "homologous sequence" used here denotes a nucleic acid or amino acid sequence with significant similarity to the comparison sequence or parts thereof. Homologous sequences are therefore nucleic acid sequences which hybridize with the comparison sequences or parts of these sequences under stringent or less stringent conditions (for stringent and less stringent conditions see Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory (1989), ISBN 0 -87969-309-6). An example of stringent hybridization conditions is: Hybridization in 4 × SSC at 65 ° C (alternatively in 50% formamide and 4 × SSC at 42 ° C), followed by several washing steps in 0.1 × SSC at 65 ° C for a total of about one Hour. An example of less stringent hybridization conditions is hybridization in 4 × SSC at 37 ° C., followed by several washing steps in 1 × SSC at room temperature. The homologous sequences are further to be considered nucleic acid or amino acid sequences or parts thereof which, with the aid of the BLAST similarity algorithm (Basic Local Alignment Search Tool, Altschul et al., "Journal of Molecular Biology", 215, 403-410 (1990)) are significant Similarity as used here refers to sequences which, for example, using standard parameters in the blast service of the NCBI, have a level of significance (probability) of P <10 ^-5 when compared with the comparison sequences be compared.

The term "derivatives" used here denotes nucleic acid sequences that Modifications in the form of one or more deletions, substitutions, additions, Have insertions and / or inversions. Derivative also means that a Nucleic acid sequence is composed of one or more nucleic acid fragments a gene and one or more nucleic acid fragments of one or more others Genes. The individual domains can be both unmodified and modified.

The term "functionally linked" as used herein means that a regulatory Sequence like a promoter controls the expression of a gene or a nucleic acid sequence is expressed starting from the promoter.

The term "vector" used here means naturally occurring or artificial created constructs for the uptake, multiplication, expression or transfer of Nucleic acids, e.g. B. plasmids, phagemids, cosmids, artificial chromosomes, bacteriophages, Viruses, retroviruses.

The term "expression system" as used herein means any combination of Vectors, restriction enzymes, transformation methods, cell extracts, living cells e.g. B. procaryotic or eukaryotic cells or organisms with the purpose of endogenous or exogenous expression of genes.

One aspect of the invention relates to a method for producing plants with an increased photosynthesis rate, the method comprising the steps:
a) stable integration of a nucleic acid sequence coding for a PsaE subunit of PS I, or its fragment or derivative into the genome of plant cells or plant tissues, the nucleic acid sequence or its fragment or derivative being functionally linked to a regulatory DNA sequence which Controls expression of the integrated nucleic acid sequence or its fragment or derivative, and
b) regeneration of the plant cells or plant tissues obtained to plants. Due to the increased photosynthesis rate, the biomass production and thus the yield of the plants is increased.

According to the invention, the nucleic acid sequence can be any psaE gene act, for example from plants, algae or cyanobacteria. preferred Nucleic acid sequences coding for a PsaE subunit of PS I are e.g. B. of the known to the following organisms: Arabidopsis thaliana, psaE1 gene (Genbank Accession Number: AL 035353, base 52445 to 53382), Arabidopsis thaliana, psaE2 gene (Genbank Accession number: AC 006569, base complementary to 74016 to 75012), Glycine max, ESTs with recognized homology to psaE from Spinacia oleracea (Genbank accession numbers: AI 431141, AI 431199, AI 437768, AI 495553), Mesembryanthemum crystallinum, EST with recognized homology to psaE (Genbank Accession Number: AA689212), Spinacia oleracea psaE mRNA (Genbank Accession Number: X14018), Mastigocladus laminosus, psaE gene (Genbank accession number: AF093820, base 291 to 506), Yersinia pseudotuberculosis, psaE gene (Genbank Accession Number: L76301, Base 397 to 1041), Synechococcus elongatus, psaE gene (Genbank Accession Number: Y10290, Base 248 to 478), Hordeum vulgar, psaE mRNA (Genbank Accession Number: Y00966), Porphyra purpurea, psaE gene (Genbank Accession Number: X60434, Base 274 to 462), Synechococcus sp. PCC 7002, psaE- Gen (Genbank Accession Number: M99379), Nostoc PCC 8009, psaE gene (Genbank Accession number: AF148219), Nicotiana sylvestris, psaE A-mRNA (Genbank Accession Number: S72356), Nicotiana sylvestris, psaE-B mRNA (Genbank Accession number: S72358), Chlamydomonas reinhardtii, mRNA for 8.1 kd P30 protein of photosystem I, corresponds to psaE (Genbank Accession Number: X13496), Cyanidium caldarium, psaE gene (Genbank accession number: AF 022186, base 42464 to 42673), Guillardia theta, psaE gene (Genbank accession number: AF 041468, base complementary to 116666 to 116860).

Endogenous or exogenous nucleic acid sequences, encoding a PS I PsaE subunit can be used. Endogenous means that the Nucleic acid sequence comes from the same organism in which it is associated with the the inventive method is integrated, for. B. is a psaE gene from Arabidopsis thaliana integrated with the method according to the invention in Arabidopsis thaliana. Exogenous means that the nucleic acid sequence comes from another organism, e.g. B. a nucleic acid sequence from Arabidopsis thaliana with the method according to the invention in z. B. Wheat integrated. After the stable integration of the transformed nucleic acid sequence there are two or more psaE genes in the genome. Because of the functional with the nucleic acid sequence linked, regulatory DNA sequence there is also an increased expression of the PsaE  Genes before. In a preferred embodiment, the nucleic acid sequences face each other the naturally occurring nucleic acid sequences deletions, substitutions, additions, Insertions and / or inversions. Fragments or derivatives of the naturally occurring psaE genes are used for the method according to the invention become.

A comparison of the amino acid sequences of PsaE subunits of PS I from higher ones Plants, algae and cyanobacteria showed that the proteins are made up of three domains. PsaE from algae (without green algae) and cyanobacteria corresponds to the C-terminal domain higher plants and green algae with about 60 amino acids. They also have higher plants and green algae with a chloroplast import sequence and a second N-terminal domain about 40 amino acids. The C-terminal domain is highly conserved between the two PsaE Proteins in Arabidopsis thaliana and beyond in all known plants, algae and Cyanobacteria PSAE proteins. The second N-terminal domain, however, is relatively variable. In a preferred embodiment of the method according to the invention is a Nucleic acid sequence used that consists of nucleic acid fragments of various psaE genes is composed. The nucleic acid sequence can e.g. B. from the chloroplast import sequence Domain of Arabidopsis thaliana, the second N-terminal domain of maize and the C- terminal domain of Arabidopsis thaliana. The three domains can also come from three different psaE genes. The nucleic acid sequence can also Contain modifications such as deletions, additions or substitutions. The procedures for The preparation of such nucleic acid sequences is state of the art and easy for the person skilled in the art perform.

The regulatory DNA sequence functionally linked to the nucleic acid sequence, e.g. B. a Promoter, both the regulatory endogenously present with the nucleic acid sequence DNA sequence as well as any other regulatory DNA sequence. The regulatory DNA sequence can be a PsaE promoter, especially that for the plant endogenous PsaE promoter or of the psaE genes listed above naturally belonging to the PsaE promoter. The regulatory DNA Sequence can be either an endogenous promoter of the organism to be transformed or a be an exogenous promoter, e.g. B. is on the vector used. As a promoter in principle, any regulatory sequence suitable for the expression of foreign genes in Organisms, e.g. B. plants can control, e.g. B. the CaMV-35S promoter from the cauliflower Mosaic virus; see. Franck et al., "Cell", 21: 285-294 (1980). The expression of the Nucleic acid sequences can also be achieved by a chemically inducible promoter become. Examples of chemically inducible promoters are the PRPI promoter (Ward et al.,  "Plant Molecular Biology", 22, 361-366 (1993)), a salicylic acid inducible promoter (WO 95/19443), a promoter inducible by benzenesulfonamide (EP-A 388186), a by Tetracycline inducible promoter (Gatz et al., "Plant Journal", 2, 397-404 (1992)), a by Abscisic acid inducible promoter (EP-A 335528) or an ethanol or Cyclohexanone inducible promoter (WO 93/21334). Depending on the desired expression location promoters can also be used, e.g. B. in certain plant tissues or Plant parts are active. Examples of corresponding promoters are the phaseolin promoter (US 5504200), the isoflavone reductase promoter (US 5750399), a seed-specific Promoter, e.g. B. from tobacco (US 5824863) or the ST-LSI promoter from potato (Stockhaus et al., (1989) "EMBO" J 8, 2445-2452).

The method according to the invention can be applied to any organisms. In particular, the inventive method for increasing the yield of mono- and dicotyledonous plants as well as algae and cyanobacteria can be used. Particularly preferred plants are crops z. B., soy, rice, cotton, sugar beet, canola, sunflower, Flax, hemp, potato, tobacco, tomato, rapeseed, alfalfa, lettuce, pea, bean, carrot, onion, the various tree, nut and wine species, also cereals z. B. barley, wheat, rye, Oats, corn, and other types of fruit such. B. mango, apple, peach, gooseberry, currant, Banana, melon, pumpkin and citrus z. As lemon, orange, grapefruit or tangerine. The plants transformed with the nucleic acid sequence can be unmodified Wild type plants or plants obtained by breeding or modified plants z. B. be transgenic plants. The inventive method can also not only in plants or Plant tissues but also in plant cells z. B. in a cell culture or in Expression systems for changing the expression pattern of psaE genes or derivatives or homologues of these genes can be used.

Furthermore, the method according to the invention for the production of plants with special stable properties can be used. Examples of this are plants with favorable growth under suboptimal conditions. Corresponding plants can, for example general, abiotic stress, e.g. B. particularly a lot or little light, at extremely high or low temperatures or combinations of these or other stress factors become.

In addition, the method according to the invention is for the temporary regulation of the photosynthesis rate  suitable by the psaE-specific promoter against an inducible promoter is exchanged. By appropriate induction of photosynthesis z. B. on Periods with special lighting conditions are reacted to.

The present invention further relates to a transformed plant cell or a transformed plant tissue in which the nucleic acid sequence coding for a gene product and the functionally connected, regulatory DNA sequence are stably integrated. Further The present invention relates to a modified by the inventive method Plant cell or an altered plant tissue that or that becomes a seed-producing Plant is regenerable. In particular, the present invention relates to a plant according to the method of the invention is available. The present invention further relates to Seed obtained from plants obtained by the process according to the invention become. The invention further relates to the fruits produced by the plants, e.g. B. fruit, Berries, potatoes and grapes.

The present invention further relates to vectors comprising a nucleic acid sequence which encodes a PS I PsaE subunit, or its fragment or derivative and one regulatory DNA sequence.

Suitable vectors for recording and transferring the nucleic acid sequences can be the Propagation and / or expression of the nucleic acids taken up in single cells such as. B. Escherichia coli or Agrobacterium tumefaciens or in plant cells, plant tissues or Ensure plants. Corresponding vectors can of course occur or else be made artificially. The vectors can contain selection markers, terminator sequences, Polylinkers, promoter elements, enhancers, polyadenylation sites and other genetic Include items. Vectors suitable for cloning are e.g. B. pBluescript, plasmids of pUC series, plasmids of the pGEM series or vectors based on the bacteriophage λ. On plasmid vector used in Agrobacterium is e.g. B. pBin19; see. Bevan et al., (1984) "Nucleic Acids Research", 12, 8711-8721. For transformation and expression in plants places on the Ti plasmid of Agrobacterium species or on plant viruses Constructs represent usable vectors and are known to the person skilled in the art. Furthermore are used in certain transformation methods such. B. microinjection, protoplast Transformation and injection (microprojectile bombardment) instead of Ti plasmids too above-mentioned cloning vectors or linearized DNA used. A summary  A description of the vectors used to date can be found in Guerineau and Mullineaux, "Plant Transformation and Expression Vectors, in: Plant Molecular Biology Labfax ", published by Croy, Oxford, BIOS Scientific Publishers, 121-148 (1993).

Some of those used in common transformation and expression systems Transformation methods for the transfer of foreign genes (transformation) into the genome of plants are presented below. Choosing the method of contributing Nucleic acid sequences and the regulatory DNA functionally linked to it However, sequences in plant cells are not limited to this list. So far used Transformation processes in plants are e.g. B. the gene transfer by means of Agrobacterium tumefaciens (e.g. by bathing seeds or pieces of leaves in an agrobacterial solution), by means of plant viruses, by electroporation, by shooting (microprojectile bombardment) or injection (microinjection) and the incubation of dry Embryos in DNA-containing liquids and the transformation of protoplasts underneath With the help of polyethylene glycol. More detailed descriptions of the methods mentioned can be found e.g. B. in Jens et al., "Techniques for Gene Transfer, in: Transgenic Plants", Vol. 1, Engineering and Utilization, edited by Kung and Wu, Academic Press 128-143 (1993).

EXAMPLES

The invention is illustrated by the examples which now follow, but is not limited to these limited:

example 1 General cloning procedures

The cloning steps carried out in the context of the present invention, such as. B. Restriction cleavages, agarose gel electrophoresis, purification of nucleic acid fragments, Transfer of nucleic acids to filter materials, transformation and cultivation of Bacterial cells, sequencing, PCR etc. were described as in Sambrook et al., (1989), "Molecular Cloning, Cold Spring Harbor Laboratory, ISBN 0-87969-309-6.

Example 2 Generation of a knockout population of Arabidopsis thaliana

PsaE1 mutants were obtained by screening a knockout population of plants of the species Arabidopsis thaliana Ecotyp Columbia mutagenized with the transposon En-1 / Spm (Pereira et al., (1986), "EMBO" J 5, 835-841). The integration of the transposable elements into genes of the mother plant often leads to the failure of the corresponding gene function and in many cases to a wild-type appearance of the affected plant. To build up the knockout population, the autonomous En-1 element from Zea mays was transferred to Arabidopsis using Agrobacterium tumefaciens. The corresponding transposon tagging system is described in Cardon et al., (1993), "Plant Molecular Biology", 23, 157-178. The Ti plasmid used, pGV3850HPT :: pkEn2, contained the complete En-1 element. For the selection of hygromycin-resistant transformants, this vector carries the HPT gene under the control of the viral CaMV-35S promoter. Seeds of a transformant with a single T-DNA insert were sown on hygromycin-containing medium. Seeds of the resulting hygromycin-resistant plants (T ₂ generation) were then sown on a medium containing kanamycin. In the plants selected in this way (T ₃ generation), the En-1 element was transposed out of the T-DNA. Those plants of the T ₄ generation were identified by means of PCR which carried one or more transposed En-1 elements but no longer any En-1 elements in the T-DNA. However, these plants still contained the T-DNAs without integrated En-1 elements. To generate En-1-positive, T-DNA-negative plants, the T ₄ generation was crossed with the wild-type Arabidopsis thaliana ecotype Columbia and En-1-positive, T-DNA-negative plants (S ₀ generation) by PCR identified. Seeds from each of these plants were propagated over 6-12 generations (up to the S ₆ or S ₁₂ generation) until a total of 3,000 lines with a total of 15,000 independent En-1 inserts were available; see. Wisman et al., (1998) Plant Molecular Biology, 37, 989-999; Baumann et al., (1998) "Theoretical and Applied Genetics", 97, 729-734.

Example 3 Screening for mutants with altered photosynthetic performance

Seeds of the en-population of Arabidopsis thaliana were sown in plastic containers on "Minitray" soil (Gebr. Patzer GmbH & Co KG, D-36391, Sinntal-Jossa, Germany) and for 3 days at 2-5 ° C. to overcome the dormancy incubated in the dark. The seedlings were grown in the greenhouse under long day conditions (16 hours of light). For the screening for photosynthetic mutants, the plant containers were placed 3-4 weeks after germination in a climatic room with short-day conditions (10.5 hours of light per day at 20 ° C and constant PAR (photosynthetically active radiation) of 200 µmolsec ^-1 m ^-2 ; 13.5 hours night period at 15 ° C) transferred. After at least 2 days under these conditions, the effective PS-II quantum yield was determined. An automated PAM fluorometer was used for these measurements (Schreiber, U. et al., (1986), "Continuous recording of photochemical and non photochemical chlorophyll fluorescence quenching with a new type of modulation fluorometer", Photosyn. Research 10, 51-62) used with a modified sensor to ensure movement and exact positioning within the dimensions of the planters. The determination of the effective quantum yield of PS II (ΦII = ΔF / F _{M '} = (F _M' - F _S ) / F _{M '} ), parameters according to Genty, B. et al., (1989), "The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence ", Biochimica et Biophysica Acta 990, 87-92) was carried out individually for each plant according to a predetermined scheme. Sheets suitable for optimal measurements were automatically identified (autofocus mode) by determining the maximum fluorescence yield (maximum F ₀ ') of individual cells. The final results of the F / F _{M '} measurements were output as a Microsoft Excel table and statistically evaluated.

The screening for plants with deviating (ΦII = ΔF / F _{M '} = (F _M' - F _S ) / F _{M '} ) quotient was carried out in a climatic chamber under low light (100 µmolsec ^-1 m ^-2 ) after 3 to 7 hours Carried out at the beginning of a daily period. 72 plant lines with 12 individuals each were examined per week, a total of about 1,000 plants.

Example 4 Propagation of plants

Fertilization with "Osmocote Plus" (15% N, 11% P ₂ O ₅ , 13% K ₂ O, 2% MgO; Scotts Deutschland GmbH, D-48527, Nordhorn, Germany) was carried out according to the manufacturer's instructions. The Aracon system (Beta Tech, Ghent, Belgium) was used to produce semen and to avoid cross-contamination.

Example 5 Identification of en-flanking sequences

Sequences flanking the 3 'ends of integrated en transposons were generated by PCR Amplification of cut plant DNA provided with adapters obtained. On appropriate protocol for the isolation of mutator element flanking sequences in Frey, M. et al., (1998), "A general method for gene isolation in tagging approaches: Amplification of insertion mutagenized sites (AIMS) ", Plant Journal 13, 717-721. 100 ng of genomic DNA were used to identify the en-flanking sequences Cut Csp6I and ligated overnight at 16 ° C with 12.5 pmol adapter APL1632. 4 µl of the Ligation batches were carried out in a linear PCR with the primer En-8130s (En-230as) used. 1 µl of this approach was used as a template for a PCR with the primers En-8153s  and LR26 used. The resulting PCR products were in a 4% Polyacrylamide gel separated, the bands made visible with the help of silver staining and cut out. The bands were in 50 ml KCl, 10 mM Tris-Cl (pH 9.0), 0.1% Triton-X 100 eluted, reamplified and sequenced after cleaning using an ABI Prism 377.

Example 6 Specific oligonucleotides and adapter sequences (5'-3 'orientation)

The adapters APL1632 (LR32 and APL16) and APL1732 (LR32 and APL17) were used to isolate transposon flanking regions:

LR32: ACTCGATTCTCAACCCGAAAGTATAGATCCCA (SEQ ID NO: 9)
APL16: P-TATGGGATCACATTAA-NH ₂ (SEQ ID NO: 10)
APL17: P-CGTGGGATCACATTAA-NH ₂ (SEQ ID NO: 11).

PCR primer for the isolation of transposon flanking regions:

LR26: ACTCGATTCTCAACCCGAAAGTATAG (SEQ ID NO: 12)
En-8130s: GAGCGTCGGTCCCCACACTTCTATAC (SEQ ID NO: 13)
En-8153s: TACGAATAAGAGCGTCCATTTTAGAGTG (SEQ ID NO: 14)
En-230as: AGAAGCACGACGGCTGTAGAATAGGA (SEQ ID NO: 15)
En-82as: ACCCACACTTTTACTTCGATTAAGAGTGT. (SEQ ID NO: 16).

The following primers were used for the analysis of the psaE genes:
PsaE1 footprints:

E1-41s: CCAATGTCACCTCGGTCGCC (SEQ ID NO: 17)
E1-806as: AGAAACTAAA CAAAACCGGCAT (SEQ ID NO: 18).

Primer for amplification of the psaE1 region (-206/277), flanking the en insertion:

E1-206s: CCACGTCACCACATTATCCTT (SEQ ID NO: 19)
E1-277as: CGGTTTAGGTTAGCTGACCT (SEQ ID NO: 20).

Primer for RT-PCR:

E (91/85) s: GTGTCTTTCT TGCCGATGAGAA (SEQ ID NO: 21)
E (798/868) as: GCGAACCGGACCACAACCGG (SEQ ID NO: 22).

The numbers assigned to the primers describe their hybridization positions in the DNA's of the En-1 element (Genbank accession number: M25427) or psaE1 / psaE2.  

Example 7 growth measurements

The growth of the leaves was determined for the growth measurements; see. Leister, D. et al., (1999), "Large-scale evaluation of plant growth in Arabidopsis thaliana by non-invasive image analysis. Plant Physiology and Biochemistry ", 37, 1-8. Digital photographs of the plant containers (photographed from above) were enlarged according to the real dimensions of the containers and provided with a grid so that each plant was in a separate field. The parameter "Green coloring" allowed a distinction between background and plant parts.

Example 8 Leaf gas exchange measurements

The measurement of the in vivo gas exchange of leaves still on the plant was carried out using a CO ₂ / H ₂ O porometer (model CQP-130, Heinz Walz GmbH, Germany), as described in the manufacturer's instructions for use. The data obtained were analyzed using the DIAGAS analysis program (Heinz Walz GmbH, Germany) and that in Von Caemmerer, S. and Farquhar, GD, (1981), "Some relationships between the biochemistry of photosynthesis and gas exchange of leaves, Planta 153 ", 376-387, specified calculation formula for calculating the photosynthetic parameters (CO ₂ assimilation rate or transpiration rate).

Example 9 Measurements of the chlorophyll a / b ratio

The pigments were made from 3 to 4 week old wild type plants and pam4 mutants 80% acetone extracted. The concentrations of chlorophyll a and chlorophyll b were then spectroscopically (UVIKON 930, Kontron Instruments) as in Porra, J. et al., (1989), "Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophyll a and chlorophyll b extracted with 4 different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy, Biochimica et Biophysica Acta ", 975, 384-394. It was found that the chlorophyll a / b ratio in pam4 is significantly reduced compared to wild type plants; see. Table 1. The finding can be due to the proven (see Example 11), reduced PS-I content be explained.  

Table 1

Example 10 2-D PAGE of proteins of the thylakoid membrane

The preparation of thylakoid membranes from chloroplasts of mesophyll was carried out according to Bassi, R. et al., (1987) "Chlorophyll proteins of the photosystem II antenna system", J. Biol. Chem. 262, 13333-13334. The membranes were dissolved in 1% dodecyl-β-D-maltoside. The PAGE separation in the first dimension was carried out at 4 ° C in a 4-12% Gradient angel using the method described by Peter, G.F. and Thornber, J.P., (1991), "Biochemical composition and organization of higher plant photosystem II light-harvesting pigment-proteins ", J. Biol. Chem., 266, 16745-16754. In the upper buffer tank the The deriphat-160 used by Peter and Thornber, supra, became electrophoresis apparatus replaced by Li-dodecyl sulfate. For the separation in the second dimension, a 10-16% gradient gel used at room temperature. The buffer used is at Schagger, H. and von Jagow, G., (1987), "Tricine sodium dodecylsulfate polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 kDa to 100 kDa ", Analytical Biochemistry 166, 368-379.

Example 11 Western blot

Western blot analysis was carried out using the usual method. It has showed that the PsaE content in protein fractions of the mutant plants compared to the Wild type plants is significantly reduced. Were equal amounts of mutant and protein Wild type plants per lane were added in addition to reducing the PsaE content Reduction of all examined PS-I polypeptides was found. It follows that the Inactivation of psaE1 both the accumulation of the entire photosystem I and the Accumulation of PsaE1 in the PS-I complex influenced.

Claims (10)

1. A process for the production of plants with an increased photosynthesis rate, the process comprising the steps:

• a) stable integration of a nucleic acid sequence coding for a PsaE subunit of photosystem I or its fragment or derivative into the genome of plant cells or plant tissues, the nucleic acid sequence or its fragment or derivative being functionally linked to a regulatory DNA sequence which Controls expression of the integrated nucleic acid sequence or its fragment or derivative, and
• b) Regeneration of the plant cells or plant tissue obtained to plants.

2. The method according to claim 1, wherein the nucleic acid sequence or its fragment or Derivative derived from plants, cyanobacteria or algae. 3. The method according to claim 1 or 2, wherein the nucleic acid sequence Genbank Accession- Numbers AL 035353 (base 52445 to 53382), AC 006569 (base complementary to 74016 to 75012), AI 431141, AI 431199, AI 437768, AI 495553, AA689212, X14018, AF093820 (base 291 to 506), L76301 (base 397 to 1041), Y10290 (base 248 to 478), Y00966, X60434 (Base 274 to 462), M99379, AF 148219, S72356, S72358, X13496, AF 022186 (base 42464 to 42673) or AF 041468 (base complementary to 116666 to 116860). 4. The method according to any one of claims 1 to 3, wherein the regulatory DNA sequence PsaE promoter, in particular the PsaE promoter endogenous to the plant or to PsaE promoter naturally belonging to the nucleic acid sequences according to claim 2 is. 5. The method according to any one of claims 1 to 3, wherein the regulatory DNA sequence of the CaMV-35S promoter from the cauliflower mosaic virus, PRPI promoter, a through Salicylic acid inducible promoter, an inducible by benzenesulfonamide Promoter, a tetracycline inducible promoter, an abscisic acid inducible promoter, a promoter inducible by ethanol or cyclohexanone,  Phaseolin promoter, isoflavone reductase promoter, a seed-specific promoter or is the ST-LSI promoter. 6. The method according to any one of claims 1 to 5, wherein in the nucleic acid sequence second N-terminal domain from a different gene than the chloroplast Import sequence domain and the C-terminal domain comes from. 7. Vector containing the nucleic acid sequence or its fragment or derivative and the regulatory DNA sequence as defined in any one of claims 1 to 6. 8. Transformed plant cell or transformed plant tissue, thereby characterized in that the nucleic acid sequence or its fragment or derivative and the regulatory DNA sequence as defined in any one of claims 1 to 6 or the Vector according to claim 7 stable in the genome of the plant cell or Plant tissue is integrated. 9. Plant obtainable according to one of claims 1 to 6. 10. Seeds obtained from plants according to claim 9.