WO2001090363A1 - Chimeric arterivirus-like particles - Google Patents

Chimeric arterivirus-like particles Download PDF

Info

Publication number
WO2001090363A1
WO2001090363A1 PCT/NL2001/000382 NL0100382W WO0190363A1 WO 2001090363 A1 WO2001090363 A1 WO 2001090363A1 NL 0100382 W NL0100382 W NL 0100382W WO 0190363 A1 WO0190363 A1 WO 0190363A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
arterivirus
virus
structural protein
structural
Prior art date
Application number
PCT/NL2001/000382
Other languages
French (fr)
Inventor
Monique Helene Verheije
Johanna Jacoba Maria Meulenberg
Original Assignee
Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. filed Critical Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V.
Priority to CA2409209A priority Critical patent/CA2409209C/en
Priority to JP2001587157A priority patent/JP4875274B2/en
Priority to DK01932411T priority patent/DK1283887T3/en
Priority to DE60138014T priority patent/DE60138014D1/en
Priority to KR1020027015538A priority patent/KR100916883B1/en
Priority to MXPA02011415A priority patent/MXPA02011415A/en
Priority to EP01932411A priority patent/EP1283887B1/en
Priority to AU2001258938A priority patent/AU2001258938A1/en
Publication of WO2001090363A1 publication Critical patent/WO2001090363A1/en
Priority to US10/300,699 priority patent/US7122347B2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/10011Arteriviridae
    • C12N2770/10022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/10011Arteriviridae
    • C12N2770/10023Virus like particles [VLP]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/10011Arteriviridae
    • C12N2770/10061Methods of inactivation or attenuation

Definitions

  • the invention relates to the field of Arteriviruses and vaccines directed against infections caused by these viruses.
  • PRRSV Porcine reproductive and respiratory syndrome virus
  • EAV equine arteritis virus
  • LDV lactate dehydrogenase-elevating virus
  • SHFN14 simian hemorrhagic fever virus
  • PRRSV causes reproductive failure in pregnant sows and respiratory problems in piglets (20). It causes huge economic losses in pig populations world wide. EAV causes reproductive failure and abortions in mares, and leads to persistently infected stallions. Infections with LDV or SHFV are mainly of importance as infections of experimental animals in the laboratory.
  • Vaccination against these Arterivirus infections is often cumbersome. Killed ,. vaccines in general are not effective enough for most purposes, and although live- attenuated Arterivirus vaccines are available, it has been shown that some of these are not safe and still spread. Furthermore, these vaccines can not be distinguished from wild type field virus.
  • the genome of PRRSN as an example of an Arterivirus genome is 15.1 kb in length and contains genes encoding the R ⁇ A dependent R ⁇ A polymerase (ORFla and ORFlb) and genes encoding structural proteins (ORFs 2 to 7; (14), (11)).
  • Other Arterivirus genomes are somewhat smaller, but share the same genomic build-up, in that all synthesise subgenomic messenger R ⁇ A encoding the structural proteins.
  • the ORFs 2, 3, and 4 encode glycoproteins designated GP2, GP3, and GP4, respectively.
  • ORF5 encodes the major envelope glycoprotein, designated GP5
  • ORF6 encodes the membrane protein M
  • ORF7 encodes the nucleocapsid protein ⁇ .
  • the invention provides an Arterivirus-like particle comprising at least a first structural protein derived from a first Arterivirus and a second structural protein wherein said second structural protein is at least partly not derived from said first Arterivirus.
  • the invention provides a chimeric Arterivirus that is composed of parts originating from at least two different arteriviruses.
  • Said parts are encoded by genes (or parts thereof) originating from said different arteriviruses, and that are preferably at least partly exchanged or substituted for each other. (Note that substitution does nor comprise a mere addition of a second structural protein (such as is disclosed in de Vries et al Virol. 270:84-97) where a stretch of nucleic acids encoding a non-Arteriviris protein fragment is inserted in the full genome of an Arterivirus, thereby extending said genome without an exchange of parts as provided herein.
  • said chimeric arterivirus as provided exhibits distinct characteristics of the composing arteriviruses.
  • Said second part that is not derived from the first Arterivirus can for example comprise a fully but preferably only partially artificial or synthetic sequence, encoding in frame a stretch of amino acids of distinct length allowing for functional dimerisation with said first structural protein as shown herein, thereby allowing heterodimerisation.
  • a heterodimer is a composition of two different interacting peptide chains. The interaction may for example consist of both Van derWaals forces or covalent disulfi.de bonds, but are not limited to this.
  • said heterodimerisation preferably of two glycoproteins, or of a glycoprotein and the matrix or membrane protein, enhances the structural integrity of the resulting chimeric virus particle, thereby allowing a better presentation of immunologically important domains on the particle and making it a better vaccine constituent.
  • said part being involved in heterodimerisation should be a structural protein (non-structural proteins are no part of the particle) it is thus preferred that said part that is not derived from a first Arterivirus at least has a certain measure of homology with said second Arterivirus, e.g. to allow for functional dimerisation.
  • a further condition relevant for heterodimerisation is that in general the nucleoprotein (N) should not be involved, the nucleoprotein of particles as provided in EP 0 839 912 does not contribute to the phenomenon.
  • a particle as provided herein can for example be based on an infectious cDNA clone of an Arterivirus (13; EP 0 839 912), as also described in WO 98/55626 where a recombinant virus is described comprising a combination of non-structural proteins (from genes encoding open reading frames la and lb, such as the viral poymerase) of a first Arterivirus with the structural proteins (from genes encoding open reading frames 2 to 7) of a second.
  • An infectious clone is an excellent tool for site-directed mutagenesis and is important for projects whose aim is to construct new live vaccines against Arteriviruses.
  • vaccinated pigs i.e. vaccinated with a vaccine as provided herein
  • vaccinated pigs can be distinguished or discriminated from field virus-infected pigs on the basis of differences in serum antibodies, and vice-versa, on the basis of differences in serum antibodies.
  • said second structural protein is at least partly not derived from said first Arterivirus, and antibodies directed against said artificial, synthetic or heterologous part can thus be detected, or, alternatively, vaccinated animals are detectable in diagnostic tests by the absence of antibodies directed against the homologous, now absent, structural protein or part thereof.
  • said second structural protein is the nucleocapsid (N) protein since antibodies directed against N are often overabundant, especially in natural infections, and allow for discrimination of vaccinated from non- vaccinated but infected animals.
  • the invention provides a particle wherein said second structural protein is at last partly derived from a second Arterivirus, or at least has a certain measure (e.g.
  • a particle as provided herein is also called an inter-Arterivirus or -virus-like chimeric particle, and can of course also comprise stretches on nucleic acid that are not Arterivirus derived, for example encoding non-Arterivirus pathogens or antigens thereof.
  • Particularly useful is such a particle wherein said first and second structural protein comprise a heterodimer, e.g. linked by a disulfide bridge between two cysteines.
  • said first or second structural protein comprises a integral membrane protein (M) or part thereof.
  • the M protein (18 kDa) is non-glycosylated and is the most conserved structural protein of arteriviruses.
  • PRRSV its topology and membrane- associated function is first suggested by Meulenberg et al (14).
  • the N-terminal half of the protein is suggested to have three potential membrane-spanning regions, the N- terminus comprises an ectodomain part, the C-terminus comprises an endodomain part.
  • a stretch of 16 amino acids is exposed at the virion surface.
  • LDV the M protein has been identified as class III membrane protein (5).
  • the M protein is assumed to play an important role in virus assembly and budding.
  • the invention provides a particle wherein said first or second structural protein comprises a glycoprotein (GP) or part thereof, such as GP2, GP2b, GP3, GP4 or, preferably, GP5.
  • GP5 is the major glycoprotein of arteriviruses and is suggested to be a class I glycoprotein (5).
  • the protein contains a signal peptide and after processing the protein consists of a short N-terminal ectodomain, a segment that crosses the membrane three times, and a C-terminal endodomain.
  • the ectodomain contains N-glycosylation sites (12).
  • the major neutralisation epitope of LDV was mapped to the putative ectodomain (30 aa) of the ORF5 glycoprotein (8).
  • the ectodomain of GP5 which is somewhat larger than with LDV, also contains a neutralization epitope.
  • the invention provides for a close to native chimeric particle wherein said first structural protein comprises GP5 or part thereof and said second structural protein comprises a membrane protein (M) or part thereof.
  • said invention provides a PRRSV-like particle for the generation of vaccines against PRRS, thus the invention provides a particle wherein said first Arterivirus comprises porcine reproductive and respiratory syndrome virus (PRRSV).
  • said second Arterivirus comprises lactate dehydrogenase-elevating virus (LDV), however, it can also be turned around, in that the GP5, or part thereof, preferred is the above identified ectodomain, is LDV derived and the M, or part thereof, preferred is the above identified ectodomain, is PRRSV derived, as long as the heterodimer ca be established by for example disulfide bridge formation.
  • LDV lactate dehydrogenase-elevating virus
  • PRRSV lactate dehydrogenase-elevating virus
  • the invention also provides nucleic acid encoding at least a first structural protein derived from a first Arterivirus and a second structural protein wherein said second structural protein is at least partly not derived from said first Arterivirus wherein said first and second structural protein allow for incorporation in an Arterivirus-like particle.
  • nucleic acid or transcripts thereof as provided herein allow the production in a host cell, such as a BHK-21 cell, or a macrophage, of a particle according to the invention.
  • Particles according to the invention provided with a nucleic acid according to the invention are herewith also provided, see for example tables 2 and 3 wherein infection of macrophages with chimeric particles as provided herein is shown.
  • the invention also provides a vaccine comprising such a particle, nucleic acid, or host cell according to the invention.
  • the invention provides a method for attenuation of the virus and one of the accomplishments is reduced viral infectivity.
  • an attenuated Arterivirus comprising a first Arterivirus with a structural protein that is at least partly not derived from said first Arterivirus, preferably, although not necessarily, as shown herein above, a method wherein said structural protein is at least partly derived from a second Arterivirus, such as wherein said structural protein comprises a heterodimer with another structural protein.
  • one of said structural proteins comprises a membrane protein (M) or part thereof such dimerisation is particularly useful, at least in those case wherein another one of said structural proteins comprises a glycoprotein, such as GP5, or part thereof. This is done by reducing the stability of the interaction between the M protein and the GP5 protein, thereby reducing infectivity.
  • the first cysteine residue (in PRRSV at position 8, see figure 1) of the ectodomain of the M protein of Arterivirus is essential for the viral life cycle, since no infectious virus was produced from mutants lacking this cysteine.
  • This residue is essential for the disulfide bond between the M protein and GP5 and heterodimerisation between these two structural proteins is essential either for proper virus assembly or for virus entry for example by the interaction of the virus with a receptor. Therefore, we show that the cysteine residue at position 8 (or a similar position relative to the position shown herein for PRRSV) of the ectodomain of the M protein is essential to maintain full infectivity.
  • RNA transcripts of these so-called mutant full-length cDNA constructs were tested on their ability to express the viral proteins after transfection into BHK-21 cells, and on their ability to generate infectious virus.
  • wild-type or parent particles can be differentiated from chimeric particles by comparing distinct patterns of reactivity with antibodies; likewise animals infected with field virus can be differentiated from animals vaccinated with such chimeric particles can be differentiated with diagnostic tests utilising such distinct patterns of reactivity.
  • Suitable antigen for such a diagnostic test would be an antigenic part of the wild-type virus that is not or only partly present in the vaccine.
  • an 16-18 amino acid stretch, or antigenic parts thereof of the ectodomain of M can be used, in combination with antibodies having similar specificity as Mabs 126.3 or 126.4.
  • the invention thus also provides a method for controlling or eradicating an Arterivirus infection in a population of animals comprising testing samples (e.g. bloodsamples) of animals vaccinated with a vaccine according to the invention for the presence or absence of antibodies differentiating such animals from animals infected with a wild-type Arterivirus, e.g. by applying routine cull and control measures.
  • the invention is further explained in the detailed description herein without limiting the invention.
  • FIG. 1 Comparison of the amino acid sequences of the M proteins of the arteriviruses EAV, LDV-P, PRRSV-Ter Huurne, PRRSV-VR2332, and SHFV.
  • BHK-21 cells were grown in BHK-21 medium (Gibco BRL), completed with 5% FBS, 10% tryptose phosphate broth (Gibco BRL), 20 mM Hepes pH 7.4 (Gibco BRL) and 200 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin.
  • Porcine alveolar lung macrophages (PAMs) were maintained in MCA-RPMI-1640 medium, containing 10% FBS, 100 ⁇ g/ml kanamycin, 50 U/ml penicillin and 50 ⁇ g/ml streptomycin.
  • Virus stocks were produced by serial passage of recombinant LV viruses secreted in the culture supernatant of tranfected BHK-21 cells on PAMs. Virus was harvested when PAMs displayed cytopathic effect (cpe) usually 48 hours after infection. Virus titers (expressed as 50% tissue culture infective doses [TCID50] per ml) were determined on PAMs using end point dilution (19).
  • PCR-mutagenesis was used to mutate amino acids of the ectodomain of the M protein in the Pad-mutant of the genome-length cDNA clone of LV (pABV437) (13).
  • the primers used are listed in Table 1.
  • the PCR fragments were digested with Stul and Hpal and ligated into these sites of pABV651, a subclone of pABV437 containing the region encoding the structural proteins of PRRSV. Standard cloning procedures were performed essentially as described by (17). Transformation conditions were used as described by Sambrook et al. (17). Sequence analysis was performed to confirm the inserted mutations.
  • Clones containing the correct inserts were digested with Aatll and Hpal and ligated into the appropriate sites of pABV437.
  • the cysteine residue at position 8 in the ectodomain of the M protein was substituted by a serine residue by PCR-mutagenesis with primers LV21 and LV93, resulting in subclone pABV702 and full-length clone pABV705.
  • this cysteine residue was deleted from the ectodomain of M by PCR-directed mutagenesis with primers LV227 and LV93. This resulted in subclone pABV703 and full-length cDNA clone pABV706.
  • the regions of the subclones originating from the PCR products were analyzed by nucleotide sequencing. Sequences were determined with the PRISM Ready Dye Deoxy Terminator cycle sequencing kit and the ABI PRISM 310 Genetic Analyzer (Perkin Elmer).
  • BHK-21 cells In vitro transcription and transfection of BHK-21 cells.
  • the constructed full-length genomic cDNA clones and derivatives thereof were linearized with Pvul and in vitro transcribed using T7 RNA polymerase (9).
  • BHK-21 cells were transfected with the resulting RNA by electroporation as described before (13).
  • the medium was harvested 24 h after transfection, and BHK-21 cells were washed with PBS, dried and stored at -20°Cuntil the IPMA was performed.
  • the culture supernatant of BHK-21 cells was harvested 24 hours after transfection and used to inoculate PAMs. After 1 hour the inoculum was removed and fresh culture medium was added. Approximately 24 hours after infection the culture supernatant was harvested and PAMs were washed with PBS, dried and stored at -20°C until the im uno peroxidase monolayer assay was performed.
  • IPMA Immuno peroxidase monolayer assay
  • PCR was performed with primers LV35 and LV7 to amplify fragments comprising the region in which the mutations were introduced. Sequence analysis was performed to determine whether the mutations introduced in the cDNA clone were also present in the isolated viral RNA.
  • GP5 and the M protein were analyzed by metabolic labeling of transfected BHK-21 cells, followed by immunoprecipitation using peptide sera or MAbs directed against GP5 or the M protein, respectively, essentially as described by Meulenberg et al [Meulenberg, 1996 #10].
  • the co-precipitation of both proteins was investigated by lyzing the cells under non-reducing conditions. The samples were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using a 14% denaturing acrylamide gel.
  • SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
  • the ectodomain of the M protein can be replaced by the ectodomain of LDV, resulting in the production of a chimeric virus, which still infects porcine alveolar macrophages.
  • Studies on coronaviruses suggest that all domains of the M protein are important for coronavirus assembly (1).
  • the amino- terminal domain of the M protein which is exposed on the outside of the virus, plays a role in virus assembly.
  • the carboxy-terminal domain, located inside the virus envelope is also important for virus assembly by interacting with the nucleocapsid. This domain is also crucial for the assembly of the viral envelope.
  • cysteine residues at position 50, 111, and 117 in GP5 were substituted by serine residues.
  • PCR-mutagenesis was performed with primers LV32 and LV303 for the first fragment and with primers LV302 and LV182 for the second fragment.
  • PCR- mutagenesis was performed with primers LV32 and LV311 for the first fragment and with primers LV310 and LV182 for the second fragment.
  • PCR-mutagenesis was performed with primers LV32 and LV313 for the first fragment and with primers LV312 and LV182 for the second fragment.
  • the fragments were fused and. amplified using the most 5 1 and 3' primers.
  • the resulting fragments were cloned using BstXl and Nbel in pABV651, and from the resulting clones, the A ⁇ tH-Hp l fragment was cloned into the appropriate sites of pABV437. This resulted in pABV858, 861, and 859 for the cysteine residues 50, 111, and 117, respectively.
  • the region encoding the ectodomain of the M protein of LV was substituted by that of other arteriviruses.
  • two sequential PCRs were performed with primers LV32 and PRRSV57 and with primers LV32 and PRRSV58. Cloning of the PCR fragment with Bst ⁇ I and Nhel into pABV651 and from this resulting clone with Aatll and Hpal into pABV437 resulted in the full-length clone pABV857.
  • For introduction of the ectodomain of M of EAN we performed sequential PCRs with primers LV32 and PRRSV59 and with primers LV32 and PRRSV60.
  • the resulting fragment was cloned with .BstXI and Nhel into pABV651, and from the resulting clone with Aatll and Hp ⁇ l into pABV437, resulting in pABV856.
  • PCR fragments were fused and amplified with primers LN32 and 118U250. Both PCR fragments were digested with BstXl and Hpal, and ligated into these sites of pABN651. The resulting clones were digested with Aatll and Hpal, and the fragments were Ugated into these sites of pABV437.
  • the primers used are listed in Table 4.
  • RNA transcripts of pABV738 (aa 15&16 deletion), pABV739 (aa 15 deletion), pABV740 (aa 15 Q to E), pABV741 (aa 9 deletion), and pABV742 (aa 5 deletion) were transfected into BHK-21 cells and tested for the expression of the structural proteins 24 hours after transfection in IPMA. For all mutants, expression of GP3, GP4, and N was detected. Two MAbs against the M protein (126.3 and 126.4) did not stain the transfected cells, in contrast to another Mab against the M protein (126.12), which stained the cells positive. The culture supernatant of the transfected cells was used to infect PAMs. Staining 24 hours after infection showed expression of the N protein for all mutants. This indicates that all mutants produced viable virus.
  • RNA transcripts 50, 111, and 117 of GP5 were changed into serine residues, resulting in the fuU-length cDNA clones pABV858, pABV 861, and in pABV 859, respectively.
  • Transfection of RNA transcripts in BHK-21 cells showed for all mutants expression of the structural proteins, as detected in IPMA 24 hours after transfection.
  • PAMs were inoculated with the culture supernatant of the transfected cells and stained in IPMA 24 hours after infection.
  • cysteine residue at position 50 of GP5 is essential for the production of viable virus, and residues 111 and 117 are not.
  • the viruses generated from pABV707, 738, 741, and 742, 871, 872 and pABV873 were serially passaged on PAMs.
  • the viral RNA was isolated from the culture supernatant after 5 passages, and studied by genetic analysis.
  • the viral RNA was reversely transcribed and the region flanking the introduced deletions was amplified by PCR. Sequence analysis of the fragment showed that for each mutant the introduced mutations were still present and that no additional mutations had been introduced in the flanking regions during in vitro passages.
  • vABV707, vABV741, and vABV742 Growth characteristics were determined for vABV707, vABV741, and vABV742 in a growth curve and compared with those of wild type vABV437.
  • PAMs were infected with passage 5 at a multiplicity of infection of 0.05, and the culture medium was harvested at various time intervals.
  • Virus titers were determined by end point dilution on macrophages. In all cases, we observed that the growth rates were similar, however, the amount of viable virus inclined faster after reaching its highest titer. This result might indicate that the generated viruses are thermolabile which may be a further useful property for vaccine purposes.
  • Table 2 Staining of BHK-21 transfected with transcripts from pABV437, 705, 706, and 707.
  • Table 3 Staining of PAMs infected with supernatant of transfected BHK-21 cells with pABV437, 705, 706, and 707.
  • PRRSV Porcine Reproductive and Respiratory Syndrome Virus
  • Two distinct antigenic types can be distinguished, i.e. the European and the American type.
  • Clinical effects after a PRRSV infection depend on the type of strain involved.
  • Vaccination of pigs with a PRRS vaccine influences the way a PRRSV-challenge works out on an animal and a farm level. The level and duration of viraemia, and shedding of the field- virus is reduced by this vaccination.
  • PRRSV mutants Four PRRSV mutants were tested which all full-filled the following criteria: -genetic stability after 5 passages in-vitro (cell cultures) -genetic stability after 3 weeks of exposure to animals -immunogenicity (as determined by IDEXX elisa)
  • vABV707 LDV-PRRS chimeric virus (ectodomain of M exchange)
  • VABV741 aa9 deletion of the M-protein of PRRSV
  • VABV746 18 nucleotide deletions at the C-terminal part of ORF7
  • VABV688 mutations at position 88-95 of ORF2
  • vABV437 wild-type recombinant of Lelystad virus
  • Each mutant was tested in two groups each consisting of 5 SPF-pigs of 8 weeks old. All groups were completely segregated without any contact with each other. Two naive sentinel pigs (so, one per each mutant-group) were united with these vaccinated pigs 24 hours after vaccination and removed and killed 28 days thereafter.
  • Each mutant group consisted of 5 vaccinated pigs and 1 sentinel (*so each PRRSV-mutant had two groups).
  • Groups 11 and 12 served as challenge control groups (**) consisting of 5 animals per group;only two of these pigs were intranasally exposed to LV-tH or SDSU#73. All mutant groups were housed in isolation recombinant facilities, whereas the wild-type groups were housed in standard isolation facilities.
  • the vaccines were administered intramuscularly according to a SOP (2 ml deep intramuscularly in the neck halfway between the shoulder and the right ear; min titer 10 5 TCIDso/ml). All inoculae were titrated before and after usage and were stored on melting ice at all times.
  • the studied recombinant mutant PRRS viruses show a reduced virulence as determined by a reduction of viraemia (length and height) as compared to wild- type (vABv437). All mutants instigate an effective immune response for the protection of pigs against a wild-type field PRRSV. The homologous protection seems to be somewhat more effective than the heterologous one. vABV707 seems to be the most suitable vaccine from among tested viruses. The humoral response is measurable by a commercial ELISA (IDEXX) in all cases. No adverse reactions are elicited.
  • IDEXX commercial ELISA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Pulmonology (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Oncology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention relates to the field for Arteriviruses and vaccines directed against infections caused by these viruses. The invention provides an Arteriviruses-like particle comprising at least a first structural protein derived from a first Arterivirus and a second structural protein wherein said second structural protein is at least partly not derived from said first Arterivirus.

Description

Title: Chimeric Arterivirus-like particles
The invention relates to the field of Arteriviruses and vaccines directed against infections caused by these viruses.
Porcine reproductive and respiratory syndrome virus (PRRSV) is a positive- strand RNA virus that belongs to the family of arteriviruses together with equine arteritis virus (EAV), lactate dehydrogenase-elevating virus (LDV) and simian hemorrhagic fever virus (SHFN14). PRRSV causes reproductive failure in pregnant sows and respiratory problems in piglets (20). It causes huge economic losses in pig populations world wide. EAV causes reproductive failure and abortions in mares, and leads to persistently infected stallions. Infections with LDV or SHFV are mainly of importance as infections of experimental animals in the laboratory.
Vaccination against these Arterivirus infections is often cumbersome. Killed ,. vaccines in general are not effective enough for most purposes, and although live- attenuated Arterivirus vaccines are available, it has been shown that some of these are not safe and still spread. Furthermore, these vaccines can not be distinguished from wild type field virus.
The genome of PRRSN as an example of an Arterivirus genome, is 15.1 kb in length and contains genes encoding the RΝA dependent RΝA polymerase (ORFla and ORFlb) and genes encoding structural proteins (ORFs 2 to 7; (14), (11)). Other Arterivirus genomes are somewhat smaller, but share the same genomic build-up, in that all synthesise subgenomic messenger RΝA encoding the structural proteins. The ORFs 2, 3, and 4 encode glycoproteins designated GP2, GP3, and GP4, respectively. ORF5 encodes the major envelope glycoprotein, designated GP5, ORF6 encodes the membrane protein M, and ORF7 encodes the nucleocapsid protein Ν. An additional structural protein (GP2b) is encoded by a small OFR, ORF2b.The analysis of the genome sequence of PRRSV isolates from Europe and North America, and their reactivity with monoclonal antibodies has indicated that isolates from these continents are genetically distinct and must have diverged from a common ancestor relatively long ago (15). The invention provides an Arterivirus-like particle comprising at least a first structural protein derived from a first Arterivirus and a second structural protein wherein said second structural protein is at least partly not derived from said first Arterivirus. In a preferred embodiment, the invention provides a chimeric Arterivirus that is composed of parts originating from at least two different arteriviruses. Said parts are encoded by genes (or parts thereof) originating from said different arteriviruses, and that are preferably at least partly exchanged or substituted for each other. (Note that substitution does nor comprise a mere addition of a second structural protein (such as is disclosed in de Vries et al Virol. 270:84-97) where a stretch of nucleic acids encoding a non-Arteriviris protein fragment is inserted in the full genome of an Arterivirus, thereby extending said genome without an exchange of parts as provided herein. In a preferred embodiment of the invention said chimeric arterivirus as provided exhibits distinct characteristics of the composing arteriviruses. Said second part that is not derived from the first Arterivirus can for example comprise a fully but preferably only partially artificial or synthetic sequence, encoding in frame a stretch of amino acids of distinct length allowing for functional dimerisation with said first structural protein as shown herein, thereby allowing heterodimerisation. A heterodimer is a composition of two different interacting peptide chains. The interaction may for example consist of both Van derWaals forces or covalent disulfi.de bonds, but are not limited to this. It was found that said heterodimerisation, preferably of two glycoproteins, or of a glycoprotein and the matrix or membrane protein, enhances the structural integrity of the resulting chimeric virus particle, thereby allowing a better presentation of immunologically important domains on the particle and making it a better vaccine constituent. Besides that said part being involved in heterodimerisation should be a structural protein (non-structural proteins are no part of the particle) it is thus preferred that said part that is not derived from a first Arterivirus at least has a certain measure of homology with said second Arterivirus, e.g. to allow for functional dimerisation. A further condition relevant for heterodimerisation is that in general the nucleoprotein (N) should not be involved, the nucleoprotein of particles as provided in EP 0 839 912 does not contribute to the phenomenon. However, such a particle as provided herein can for example be based on an infectious cDNA clone of an Arterivirus (13; EP 0 839 912), as also described in WO 98/55626 where a recombinant virus is described comprising a combination of non-structural proteins (from genes encoding open reading frames la and lb, such as the viral poymerase) of a first Arterivirus with the structural proteins (from genes encoding open reading frames 2 to 7) of a second. An infectious clone is an excellent tool for site-directed mutagenesis and is important for projects whose aim is to construct new live vaccines against Arteriviruses. Herein we for example provide a so-called marker vaccine by mutagenesis of the genome, so that, in the case of for example PRRSV, vaccinated pigs (i.e. vaccinated with a vaccine as provided herein) can be distinguished or discriminated from field virus-infected pigs on the basis of differences in serum antibodies, and vice-versa, on the basis of differences in serum antibodies. Such discrimination can in particular well be done when said second structural protein is at least partly not derived from said first Arterivirus, and antibodies directed against said artificial, synthetic or heterologous part can thus be detected, or, alternatively, vaccinated animals are detectable in diagnostic tests by the absence of antibodies directed against the homologous, now absent, structural protein or part thereof. It is preferred that said second structural protein is the nucleocapsid (N) protein since antibodies directed against N are often overabundant, especially in natural infections, and allow for discrimination of vaccinated from non- vaccinated but infected animals. In particular the invention provides a particle wherein said second structural protein is at last partly derived from a second Arterivirus, or at least has a certain measure (e.g. > 50%) of homology with said second Arterivirus. A particle as provided herein is also called an inter-Arterivirus or -virus-like chimeric particle, and can of course also comprise stretches on nucleic acid that are not Arterivirus derived, for example encoding non-Arterivirus pathogens or antigens thereof. Particularly useful is such a particle wherein said first and second structural protein comprise a heterodimer, e.g. linked by a disulfide bridge between two cysteines. Most preferred is a particle according to the invention wherein said first or second structural protein comprises a integral membrane protein (M) or part thereof.
The M protein (18 kDa) is non-glycosylated and is the most conserved structural protein of arteriviruses. For PRRSV, its topology and membrane- associated function is first suggested by Meulenberg et al (14). The N-terminal half of the protein is suggested to have three potential membrane-spanning regions, the N- terminus comprises an ectodomain part, the C-terminus comprises an endodomain part. A stretch of 16 amino acids is exposed at the virion surface. For LDV, the M protein has been identified as class III membrane protein (5). The M protein is assumed to play an important role in virus assembly and budding. In the ER, it forms disulfide-linked heterodimers (3, 4, 10) with the major glycoprotein GP5 (25-42 kDa), encoded by ORF5. In addition, disulfide-linked M protein homodimers can also be formed, however, they are in general thought not to be incorporated into virions (3). In another embodiment, the invention provides a particle wherein said first or second structural protein comprises a glycoprotein (GP) or part thereof, such as GP2, GP2b, GP3, GP4 or, preferably, GP5. GP5 is the major glycoprotein of arteriviruses and is suggested to be a class I glycoprotein (5). It contains a signal peptide and after processing the protein consists of a short N-terminal ectodomain, a segment that crosses the membrane three times, and a C-terminal endodomain. In addition, the ectodomain contains N-glycosylation sites (12). Recently, the major neutralisation epitope of LDV was mapped to the putative ectodomain (30 aa) of the ORF5 glycoprotein (8). For EA , the ectodomain of GP5, which is somewhat larger than with LDV, also contains a neutralization epitope. Since the cysteine residue in the short N-terminal ectodomain of the M protein is naturally involved in the formation of an intermolecular chsulfi.de bridge with a cysteine residue in the ectodomain of the glycoprotein encoded by ORF5, thereby providing a heterodimer, the invention provides for a close to native chimeric particle wherein said first structural protein comprises GP5 or part thereof and said second structural protein comprises a membrane protein (M) or part thereof. Preferably, the invention provides a PRRSV-like particle for the generation of vaccines against PRRS, thus the invention provides a particle wherein said first Arterivirus comprises porcine reproductive and respiratory syndrome virus (PRRSV). In the detailed description a particle according to the invention is provided wherein said second Arterivirus comprises lactate dehydrogenase-elevating virus (LDV), however, it can also be turned around, in that the GP5, or part thereof, preferred is the above identified ectodomain, is LDV derived and the M, or part thereof, preferred is the above identified ectodomain, is PRRSV derived, as long as the heterodimer ca be established by for example disulfide bridge formation. Of course, other Arteriviruses can be used as first and/or second Arterivirus as explained herein, whereby said second Arterivirus may be of the same genus but of another strain or serotype of said first Arterivirus. For PRRSV, it has also been shown that a disulfide bond between the M protein and the GP5 protein is formed (10). This cysteine residue of the M protein is highly conserved between all arteriviruses. For LDV, it has been shown that virions, after treatment with 5-10 mM DTT to disrupt disulfide bonds, lost their infectivity (4). For EAV, the same results were observed (3). The invention also provides nucleic acid encoding at least a first structural protein derived from a first Arterivirus and a second structural protein wherein said second structural protein is at least partly not derived from said first Arterivirus wherein said first and second structural protein allow for incorporation in an Arterivirus-like particle. Such nucleic acid or transcripts thereof as provided herein allow the production in a host cell, such as a BHK-21 cell, or a macrophage, of a particle according to the invention. Particles according to the invention provided with a nucleic acid according to the invention are herewith also provided, see for example tables 2 and 3 wherein infection of macrophages with chimeric particles as provided herein is shown. The invention also provides a vaccine comprising such a particle, nucleic acid, or host cell according to the invention. For the purpose of vaccine development, the invention provides a method for attenuation of the virus and one of the accomplishments is reduced viral infectivity. In particular a method is provided obtaining an attenuated Arterivirus (a vaccine) comprising a first Arterivirus with a structural protein that is at least partly not derived from said first Arterivirus, preferably, although not necessarily, as shown herein above, a method wherein said structural protein is at least partly derived from a second Arterivirus, such as wherein said structural protein comprises a heterodimer with another structural protein. When one of said structural proteins comprises a membrane protein (M) or part thereof such dimerisation is particularly useful, at least in those case wherein another one of said structural proteins comprises a glycoprotein, such as GP5, or part thereof. This is done by reducing the stability of the interaction between the M protein and the GP5 protein, thereby reducing infectivity. In particular, we have determined that the first cysteine residue (in PRRSV at position 8, see figure 1) of the ectodomain of the M protein of Arterivirus is essential for the viral life cycle, since no infectious virus was produced from mutants lacking this cysteine. This residue is essential for the disulfide bond between the M protein and GP5 and heterodimerisation between these two structural proteins is essential either for proper virus assembly or for virus entry for example by the interaction of the virus with a receptor. Therefore, we show that the cysteine residue at position 8 (or a similar position relative to the position shown herein for PRRSV) of the ectodomain of the M protein is essential to maintain full infectivity. For this purpose, we substituted this cysteine residue by a serine residue and secondly, we deleted this residue, both by using the infectious cDNA clone of PRRSV (13). RNA transcripts of these so-called mutant full-length cDNA constructs were tested on their ability to express the viral proteins after transfection into BHK-21 cells, and on their ability to generate infectious virus. In addition, several other mutations of the ectodomain of the M protein were introduced in the infectious cDNA clone of LV, including the exchange of the ectodomain of LV by that of LDV, a related arterivirus (fig.l) As can be seen from for example tables 2 and 3, wild-type or parent particles can be differentiated from chimeric particles by comparing distinct patterns of reactivity with antibodies; likewise animals infected with field virus can be differentiated from animals vaccinated with such chimeric particles can be differentiated with diagnostic tests utilising such distinct patterns of reactivity. Suitable antigen for such a diagnostic test would be an antigenic part of the wild-type virus that is not or only partly present in the vaccine. For example, for the vaccines described in the detailed description, an 16-18 amino acid stretch, or antigenic parts thereof of the ectodomain of M can be used, in combination with antibodies having similar specificity as Mabs 126.3 or 126.4. The invention thus also provides a method for controlling or eradicating an Arterivirus infection in a population of animals comprising testing samples (e.g. bloodsamples) of animals vaccinated with a vaccine according to the invention for the presence or absence of antibodies differentiating such animals from animals infected with a wild-type Arterivirus, e.g. by applying routine cull and control measures. The invention is further explained in the detailed description herein without limiting the invention.
LEGENDS
Figure 1. Comparison of the amino acid sequences of the M proteins of the arteriviruses EAV, LDV-P, PRRSV-Ter Huurne, PRRSV-VR2332, and SHFV.
Figure 2 GP5-Mprotein costructs
Figure 3 Growth curves of deletion mutants
Detailed description
MATERIALS & METHODS
Cells and viruses.
BHK-21 cells were grown in BHK-21 medium (Gibco BRL), completed with 5% FBS, 10% tryptose phosphate broth (Gibco BRL), 20 mM Hepes pH 7.4 (Gibco BRL) and 200 mM glutamine, 10 U/ml penicillin and 10 μg/ml streptomycin. Porcine alveolar lung macrophages (PAMs) were maintained in MCA-RPMI-1640 medium, containing 10% FBS, 100 μg/ml kanamycin, 50 U/ml penicillin and 50 μg/ml streptomycin. Virus stocks were produced by serial passage of recombinant LV viruses secreted in the culture supernatant of tranfected BHK-21 cells on PAMs. Virus was harvested when PAMs displayed cytopathic effect (cpe) usually 48 hours after infection. Virus titers (expressed as 50% tissue culture infective doses [TCID50] per ml) were determined on PAMs using end point dilution (19).
Construction of mutations in the ectodomain of the M protein of PRRSV.
PCR-mutagenesis was used to mutate amino acids of the ectodomain of the M protein in the Pad-mutant of the genome-length cDNA clone of LV (pABV437) (13). The primers used are listed in Table 1. The PCR fragments were digested with Stul and Hpal and ligated into these sites of pABV651, a subclone of pABV437 containing the region encoding the structural proteins of PRRSV. Standard cloning procedures were performed essentially as described by (17). Transformation conditions were used as described by Sambrook et al. (17). Sequence analysis was performed to confirm the inserted mutations. Clones containing the correct inserts were digested with Aatll and Hpal and ligated into the appropriate sites of pABV437. First, the cysteine residue at position 8 in the ectodomain of the M protein was substituted by a serine residue by PCR-mutagenesis with primers LV21 and LV93, resulting in subclone pABV702 and full-length clone pABV705. In addition, this cysteine residue was deleted from the ectodomain of M by PCR-directed mutagenesis with primers LV227 and LV93. This resulted in subclone pABV703 and full-length cDNA clone pABV706. Second, the complete ectodomain of the M protein (amino acids 1 to 16) was replaced by the ectodomain of LDV using primers LV218 and LV93. The designed clones were named pABV704 (subclone) and pABV707 (full-length cDNA clone). Third, several other amino acid substitutions and deletions in the ectodomain of ORF6 were created, using LV 219 to LV226 as forward primers and LV93 as reversed primer, resulting in subclones pABV732 till pABV736 and full- length cDNA clones pABV737 till pAB743.
Sequence analysis.
The regions of the subclones originating from the PCR products were analyzed by nucleotide sequencing. Sequences were determined with the PRISM Ready Dye Deoxy Terminator cycle sequencing kit and the ABI PRISM 310 Genetic Analyzer (Perkin Elmer).
In vitro transcription and transfection of BHK-21 cells. The constructed full-length genomic cDNA clones and derivatives thereof were linearized with Pvul and in vitro transcribed using T7 RNA polymerase (9). BHK-21 cells were transfected with the resulting RNA by electroporation as described before (13). The medium was harvested 24 h after transfection, and BHK-21 cells were washed with PBS, dried and stored at -20°Cuntil the IPMA was performed.
Infection of PAMs
To rescue infectious virus, the culture supernatant of BHK-21 cells was harvested 24 hours after transfection and used to inoculate PAMs. After 1 hour the inoculum was removed and fresh culture medium was added. Approximately 24 hours after infection the culture supernatant was harvested and PAMs were washed with PBS, dried and stored at -20°C until the im uno peroxidase monolayer assay was performed.
Immuno peroxidase monolayer assay (IPMA). Immunostaining of BHK-21 cells and PAMs was performed by the methods described by Wensvoort et al. (19), in order to determine transient expression and infectious virus, respectively. A panel of monoclonal antibodies (MAbs) (126.3, 126.4, 122.9, 126.12, 126.6 (18)) directed to unknown antigenic sites of the M protein were used to study the expression of the M protein and the presence of antigenic sites thereon. MAbs 122.14, 122.1, and 122.17 (18) (directed against GP3, GP4, and the N protein respectively), were used to detect the expression of other PRRSV proteins.
Analysis of the production of non-infectious virus of the recombinant RNA transcripts.
From the culture supernatant of transfected BHK-21 cells, viral RNA was isolated to determine whether the full-length cDNA recombinants were packaged into viruses or virus-like particles, which were non-infectious. A volume of 500 μl proteinase K buffer (100 mM Tris-HCl fipH 7.2], 25 M EDTA, 300 M NaCl, 2% [wt/vol] sodium dodecyl sulfate) and 0.2 mg Proteinase K was added to 500 μl supernatant. After incubation for 30 minutes at 37°C, the RNA was extracted with phenol-chloroform and precipitated with ethanol. The RNA was reverse transcribed with primer LV76. Then, PCR was performed with primers LV35 and LV7 to amplify fragments comprising the region in which the mutations were introduced. Sequence analysis was performed to determine whether the mutations introduced in the cDNA clone were also present in the isolated viral RNA.
Radio Immuno Precipitation (RIP).
The expression of GP5 and the M protein were analyzed by metabolic labeling of transfected BHK-21 cells, followed by immunoprecipitation using peptide sera or MAbs directed against GP5 or the M protein, respectively, essentially as described by Meulenberg et al [Meulenberg, 1996 #10]. In addition, the co-precipitation of both proteins was investigated by lyzing the cells under non-reducing conditions. The samples were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using a 14% denaturing acrylamide gel. RESULTS
In order to test whether the disulfide bond between the ectodomains of GP5 and the M protein of PRRSV is essential for viral infection, we substituted amino acid residue 8 of the M protein (10), by a serine residue. In addition, this cysteine residue was deleted from the ectodomain of the M protein. The cysteine substitution and deletion mutations were subsequently introduced in the infectious clone pABV437 of the Lelystad virus isolate of PRRSV, resulting in plasmids pABV705 (C->S) and pABV706 (C->deletion). The RNA transcripts of these full-length cDNA clones were transfected into BHK-21 cells and the expression of the viral proteins was examined. In both cases, the cells stained positive in IPMA with the GP3, GP4, and N specific MAbs (table 2). In addition, MAb 126.12 directed against the M protein resulted in positive staining. Two other MAbs directed against the M protein, 126.3 and 126.4, stained BHK-21 cells transfected with transcripts from pABV705, but not those transfected with transcripts from pABV706 (table 2). This indicated that these MAbs were directed against the ectodomain of the M protein, or at least directed against (a) peptide fragment(s) comprising some of the 18 amino acids comprising said domain. The supernatants of the transfected cells were used to infect PAMs to rescue infectious virus. However, no staining of any of the MAbs could be detected on PAMs 24 hours after transfection (table 3). In addition, no cytopathogenic effect (cpe) could be induced. In conclusion, full-length cDNA transcripts of PRRSV lacking the cysteine residue at position 8 of the M protein, either by substitution or deletion, were able to replicate and express the viral proteins in BHK-21 cells, but unable to produce infectious virus. Second, the ectodomain of the M protein was exchanged by the ectodomain of
LDV, resulting in the fuU-length cDNA clone pABV707. BHK-21 ceUs transfected with transcripts from this PRRS recombinant could be stained with MAbs against GP3, GP4, and the N protein, MAb 126.12 directed against the M protein, but not with the MAbs 126.3 and 126.4 (table 2). This confirmed the above described results, that these MAbs reacted with the ectodomain of the M protein. To test the production of infectious chimeric virus, PAMs were infected with the supernatant of the transfected BHK-21 cells. In IPMA, PAMs could be stained with all but MAbs 126.3 and 126.4 (table 3). In conclusion, the ectodomain of the M protein can be replaced by the ectodomain of LDV, resulting in the production of a chimeric virus, which still infects porcine alveolar macrophages. Studies on coronaviruses suggest that all domains of the M protein are important for coronavirus assembly (1). The amino- terminal domain of the M protein, which is exposed on the outside of the virus, plays a role in virus assembly. In addition, the carboxy-terminal domain, located inside the virus envelope, is also important for virus assembly by interacting with the nucleocapsid. This domain is also crucial for the assembly of the viral envelope. However, they showed that the amino-terminal domain of the M protein was not involved in the interaction between the M protein and the S protein (2). This indicates that the association between the proteins takes place at the level of the membrane, possibly also involving part of the M proteins carboxy-terminal domain. For another coronavirus, TGEV, MAbs against the carboxyterminus of the M protein have been described to neutralise virus infectivity (16), indicating that the C-terminal domain of the M protein is exposed on the outside of the virus particle. This topology of the M protein probably coexists with the structure currently described for the M protein of coronaviruses, which consists of an exposed amino terminus and an intravirion carboxy-terminal domain. In our recent study, we are mutating other amino acids in the ectodomain of the M protein. We show that distinct deletions or mutations result in a weakening of the disulfide bond between the M protein and GP5. These constructs show in general normal replication and expression of the structural proteins, resulting in an immune response comparable to wild type. However, fewer virus particles will be produced. Also it results in the production of virus particles, which are impaired in the infection of the macrophage. In both cases, it results in a virus, which is considered to be a safe vaccine for protection of pigs against for example PRRSV. Our results also showed that mutations in the ectodomain of the M protein can result in the generation of a marker vaccine, since replacement with the LDV ectodomain, as well as deletion of some of its amino acids, such as the deletion of the cysteine residue resulted in the loss of the binding of two MAbs. So mutation of the virus at this epitope results in the generation of a marker vaccine. In this study we also showed that PRRSV transcripts containing the ectodomain of the M protein of LDV, generated an infectious, chimeric virus, also useful as a (marker) vaccine.
Materials and Methods
Further construction of mutations in the ectodomain of the M protein of PRRSV.
First, the cysteine residues at position 50, 111, and 117 in GP5 were substituted by serine residues. For subsitution of amino acid 50, PCR-mutagenesis was performed with primers LV32 and LV303 for the first fragment and with primers LV302 and LV182 for the second fragment. For subsitution of amino acid 111, PCR- mutagenesis was performed with primers LV32 and LV311 for the first fragment and with primers LV310 and LV182 for the second fragment. For subsitution of amino acid 117, PCR-mutagenesis was performed with primers LV32 and LV313 for the first fragment and with primers LV312 and LV182 for the second fragment. The fragments were fused and. amplified using the most 51 and 3' primers. The resulting fragments were cloned using BstXl and Nbel in pABV651, and from the resulting clones, the AαtH-Hp l fragment was cloned into the appropriate sites of pABV437. This resulted in pABV858, 861, and 859 for the cysteine residues 50, 111, and 117, respectively.
Second, the region from amino acid 9 till 16 was deleted from the ectodomain of the M protein. PCR was performed using primers LV32 and LV306. The fragment was digested with BstXl-Nhel and cloned into these sites of pABV651. From this clone, the Aatϊ -Hpal fragment was cloned into the corresponding sites of pABV437, resulting in pABV855.
Third, the region encoding the ectodomain of the M protein of LV was substituted by that of other arteriviruses. For introduction of the VR2332 ectodomain, two sequential PCRs were performed with primers LV32 and PRRSV57 and with primers LV32 and PRRSV58. Cloning of the PCR fragment with BstΕI and Nhel into pABV651 and from this resulting clone with Aatll and Hpal into pABV437 resulted in the full-length clone pABV857. For introduction of the ectodomain of M of EAN we performed sequential PCRs with primers LV32 and PRRSV59 and with primers LV32 and PRRSV60. The resulting fragment was cloned with .BstXI and Nhel into pABV651, and from the resulting clone with Aatll and Hpαl into pABV437, resulting in pABV856.
Forth, the overlap between LV ORF5 and 6 was removed by performing PCR with primers LV32 and LV358. The resulting PCR fragment was cloned into the
BstXl and Stul sites of pABV651. From the resulting clone, the Aatϊ -Hpaϊ fragment was introduced into pABV437, resulting in pABV871. In this clone, the ectodomains of other arteriviruses were introduced. For introduction of the ectodomain of the M protein of VR2332, two PCR fragments were generated, one using LV32 and LV357 and one using LV356 and 118U250. For introduction of the ectodomain of the M protein of EAV, PCR fragments were generated with primers LV32 and LV361 and with primers LV360 and 118U250. The PCR fragments were fused and amplified with primers LN32 and 118U250. Both PCR fragments were digested with BstXl and Hpal, and ligated into these sites of pABN651. The resulting clones were digested with Aatll and Hpal, and the fragments were Ugated into these sites of pABV437.
This resulted in clone pABN872 for the ectodomain of the M protein of VR2332 and in pABV873 for the ectodomain of the M protein of EAV.
The primers used are listed in Table 4.
Results
Full-length cDNA clones containing deletions in the ectodomain of the M protein. RNA transcripts of pABV738 (aa 15&16 deletion), pABV739 (aa 15 deletion), pABV740 (aa 15 Q to E), pABV741 (aa 9 deletion), and pABV742 (aa 5 deletion) were transfected into BHK-21 cells and tested for the expression of the structural proteins 24 hours after transfection in IPMA. For all mutants, expression of GP3, GP4, and N was detected. Two MAbs against the M protein (126.3 and 126.4) did not stain the transfected cells, in contrast to another Mab against the M protein (126.12), which stained the cells positive. The culture supernatant of the transfected cells was used to infect PAMs. Staining 24 hours after infection showed expression of the N protein for all mutants. This indicates that all mutants produced viable virus.
In addition, a mutant in which the coding region for amino acid 9 till 16 from the M protein was deleted waa constructed, resulting in pABV855. Transfection of its RNA transcripts into BHK-21 cells showed expression of all the structural proteins of LV. MAbs 126.3 and 126.4, however, did not stain the transfected cells. After inoculation of PAMs with the culture supernatant of the transfected cells, no expression of the structural proteins was detected. In conclusion, no viable virus was produced.
Mutations of cysteine residues in the GP5 protein.
Cysteine residues 50, 111, and 117 of GP5 were changed into serine residues, resulting in the fuU-length cDNA clones pABV858, pABV 861, and in pABV 859, respectively. Transfection of RNA transcripts in BHK-21 cells showed for all mutants expression of the structural proteins, as detected in IPMA 24 hours after transfection. PAMs were inoculated with the culture supernatant of the transfected cells and stained in IPMA 24 hours after infection. Cells stained positive when PAMs were inoculated with culture supernatant of BHK-21 cells transfected with RNA transcripts of pABV861 and 859, in contrast to PAMs inoculated with culture supernatant of BHK-21 cells transfected with RNA transcripts of pABV858, for which no positive staining was observed. In conclusion, the cysteine residue at position 50 of GP5 is essential for the production of viable virus, and residues 111 and 117 are not.
Introduction of the ectodomain of the M protein of other arteriviruses. Since introduction of the ectodomain of the M protein of LDV resulted in the production of viable virus, we now inserted the ectodomain of the M protein of VR2332 and that of EAV into the infectious cDNA clone of LV, resulting in pABV857 and pABV856, respectively (Figure 2A). However, both introductions of these sequences introduced mutations in the C-terminus of the GP5 protein, since the coding sequences for GP5 and M, ORF5 and 6, respectively, overlap. Transfection of their RNA transcripts showed for both mutants expression of the structural proteins. However, staining of PAMs infected with the culture supernatant of transfected BHK-21 cells was negative. In conclusion, no viable virus is produced from these chimeric arteriviruses.
Removal of the overlap between ORF5 and 6 and introduction of chimeric sequences.
Since introduction of the ectodomain of M of VR2332 and EAV also introduced mutations in the region encoding the C-terminus of GP5, we removed the overlap between ORFsδ and 6 from the infectious cDNA clone of LV. In this way, we wanted to create a region in ORF6 at which arterivirus sequences could be introduced without disturbing the coding sequence of ORF5. First, the overlap between ORF5 and 6 was removed in the infectious cDNA clone, resulting in pABV871 (Figure 2B). Transfection of its RNA transcripts into BHK-21 cells revealed that the structural proteins were expressed, indicating that both replication and transcription were not disturbed. Infection of PAMs with the culture supernatant of transfected BHK-21 cells showed that infectious virus was produced since structural protein expression was detected by IPMA and cpe was observed. Second, the ectodomain of the M protein of VR2332 and that of EAV were introducted in this construct, resulting in pABV872 and pABV873 (Figure 2B). Their RNA transcripts were transfected into BHK-21 cells. All, but 126.3 and 126.4, MAbs stained the transfected cells positive. PAMs infected with the culture supernatant of transfected BHK-21 cells showed expression of all structural proteins in IPMA. These results indicate that the ectodomain of the M protein of other arteriviruses, providing that the C-terminus of the GP5 was left intact, could be functionally exchanged by that of the ectodomain of the LV M protein.
Genetic stability of chimeric arteriviruses.
In order to investigate whether the viruses generated from pABV707, 738, 741, and 742, 871, 872 and pABV873 were stably maintained in vitro, they were serially passaged on PAMs. The viral RNA was isolated from the culture supernatant after 5 passages, and studied by genetic analysis. The viral RNA was reversely transcribed and the region flanking the introduced deletions was amplified by PCR. Sequence analysis of the fragment showed that for each mutant the introduced mutations were still present and that no additional mutations had been introduced in the flanking regions during in vitro passages. These results indicate that the deletions were maintained stably during in vitro passaging on PAMs.
Growth characteristics were determined for vABV707, vABV741, and vABV742 in a growth curve and compared with those of wild type vABV437. PAMs were infected with passage 5 at a multiplicity of infection of 0.05, and the culture medium was harvested at various time intervals. Virus titers were determined by end point dilution on macrophages. In all cases, we observed that the growth rates were similar, however, the amount of viable virus inclined faster after reaching its highest titer. This result might indicate that the generated viruses are thermolabile which may be a further useful property for vaccine purposes.
Figure imgf000019_0001
Figure imgf000020_0001
a Restriction sites are underlined, foreign sequences are in itahc
Table 2: Staining of BHK-21 transfected with transcripts from pABV437, 705, 706, and 707.
Figure imgf000021_0001
+: positive staining - : no staining
Table 3: Staining of PAMs infected with supernatant of transfected BHK-21 cells with pABV437, 705, 706, and 707.
Figure imgf000021_0002
+: positive staining - : no staining
TABLE 4: Sequences of the primers used to introduce deletions by PCR, and primers used to sequence the introduced mutations. Primer Sequence of the primer3 OrienPurpose Location tation (pABV)
39U247 5' GCCAAGGCAACACAATCTGC 3' . sequencing 14368 118U250 5' CAGCCAGGGGAAAATGTGGC 3' - sequencing / PCR 14745 LV17 5' CCCTTGACGAGCTCTTCGGC 3' + sequencing / PCR 14045 LV32 5' GATTGGATCCATTCTCTTGGCAATATG 3' + sequencing / PCR 13466 LV75 5' TCTAGGAATTCTAGACGATCG 3' - PCR 15088 LV76 5' TCTAGGAATTCTAGACGATCG(T)40 3' - RT-PCR 15088
LV93 5' ACTTTATCATTGGATCCAGCA 3' - PCR 14581 LV182 5' GGATTGAAAATGCAATTAATTCATGTAT 3' - PCR 14257 LV198 5' TTTTCCCGGGCATACTTGAC 3' + Sequencing 14086 PRRSV57 5' TGCTATCATGACAGAAGTCATCTAAGGACGACCCCATTGCTCAG 3' -' 857 14132 PRRSV58 5' GCTAAAGGCFAGCACGAGC TTTGTGGAGCCGTGCTATCATGAC 3' - 857 14132 PRRSV59 5' ATCCCGTCACCACAAAATGAATCTATGGCTCCCATFGCTCAG 3' - 856 14132 PRRSV60 5' GCTAAAGGCTAGCACGAGCΓCACCΓJ A AΓC'CCGΓCACCA 3' - 856 14132 LV302 5' CTTGACGATATCAGAGCTGAATGGG 3' + 858 13630 LV303 5' CCCATTCAGCTCTGATATCGTCAAG 3' - 858 13630 LV306 5' GCTAAGGCTAGCACGAGGCAAAAATCGTC 22 - 855 14132 LV310 5' GTACGTACTCTCMAGCGTC 3' + 861 13814 LV311 5' GACGCTTGAGAGTACGTAC 3' - 861 13814 LV312 5' CTACGGCGCTTCAGCTTTCG 3' + 859 13832 LV313 5' CGAAAGCTGAAGCGCCGTAG 3' - 859 13832 LV356 5' GCAGTGGGAGGCCTGATGGGGTCGTCCTTAG 3' + 872 14083 LV357 5' CTAAGGACGACCCCATCAGGCCTCCCACTGC 3' - 872 14083 V358 5' CGTCTAGGCCTCCCATCAAGCTTCCCACTGC 3' - 871 14083 LV360 5' GCAGTGGGAGGCCTGATGGGAGCCATAGATTC 3' + 873 14083 LV361 5' GAATCTATGGCTCCCATCAGGCCTCCCACTGC 3' - 873 14083
a The restriction sites are underlined, foreign sequences are in italic
Vaccination examples
Intranasal inoculation of wild-type PRRSV (EU en US-type) after vaccination of 8-week old pigs with specified PRRSV-mutants; virus kinetics and antibody response
Introduction The Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) causes abortion and poor litter quality in third trimester pregnant sows. Moreover, it may cause respiratory disease in young pigs. Infection of late term pregnant sows (80-95 days) with PRRSV can cause profound reproductive failure, especially due to a high level of mortality among the off-spring of these sows at birth and during the first week after birth. PRRSV is a ubiquitous pathogen.
Two distinct antigenic types can be distinguished, i.e. the European and the American type. Clinical effects after a PRRSV infection depend on the type of strain involved. Vaccination of pigs with a PRRS vaccine influences the way a PRRSV-challenge works out on an animal and a farm level. The level and duration of viraemia, and shedding of the field- virus is reduced by this vaccination.
For the development of a second generation PRRS vaccine, new candidates are to be tested. Therefore, 8-week old pigs were vaccinated with a number of specified PRRSV-mutants (recombinant viruses), after which a PRRSV-challenge was given. Kinetics of this virus exposure is scored in terms of level and duration of viremia and booster responses, both in a homologous and heterologous set-up.
Aims of the study The determination of the immunological efficacy and safety of defined PRRSV- mutants used as a vaccine in a vaccination- (homologous and heterologous) challenge model. Along with this, mutant immunogenicity was tested. Study design
Four PRRSV mutants were tested which all full-filled the following criteria: -genetic stability after 5 passages in-vitro (cell cultures) -genetic stability after 3 weeks of exposure to animals -immunogenicity (as determined by IDEXX elisa)
The following mutants were tested: vABV707: LDV-PRRS chimeric virus (ectodomain of M exchange) VABV741: aa9 deletion of the M-protein of PRRSV VABV746: 18 nucleotide deletions at the C-terminal part of ORF7 VABV688: mutations at position 88-95 of ORF2
As a positive control, the following virus was used.- vABV437: wild-type recombinant of Lelystad virus
Each mutant was tested in two groups each consisting of 5 SPF-pigs of 8 weeks old. All groups were completely segregated without any contact with each other. Two naive sentinel pigs (so, one per each mutant-group) were united with these vaccinated pigs 24 hours after vaccination and removed and killed 28 days thereafter.
In the 2 groups (per mutant) each consisting of 5 vaccinates, two animals were challenged with wild-type virus (i.e. Lelystad virus (LV-tH) as a representative of an European strain of PRRSV or SDSU#73 as a representative of an American (US) strain of PRRSV), at day 28 post- vaccination. The other three vaccinates were separated from these challenged animals for 24 hours and re-united thereafter. 28 days after challenge, all pigs were removed and destroyed. vABV437 served as a positive control. A challenge control was included for 14 days starting at the moment of challenge in order to control challenge efficacy with LV-tH and SDSU#73, Animals were treated as described for the other animals during the challenge phase. The allocation of the pigs is outlined in Table 1.
Table 1. Allocation of pigs to designated groups. Each mutant group consisted of 5 vaccinated pigs and 1 sentinel (*so each PRRSV-mutant had two groups). Groups 11 and 12 served as challenge control groups (**) consisting of 5 animals per group;only two of these pigs were intranasally exposed to LV-tH or SDSU#73. All mutant groups were housed in isolation recombinant facilities, whereas the wild-type groups were housed in standard isolation facilities.
Figure imgf000025_0001
The vaccines were administered intramuscularly according to a SOP (2 ml deep intramuscularly in the neck halfway between the shoulder and the right ear; min titer 105 TCIDso/ml). All inoculae were titrated before and after usage and were stored on melting ice at all times. Experimental animals
70 SPF pigs of 8-weeks old, tested free of PRRSV.
Execution of the study (Table 2)
Table 2. Course of the study valid for each of the mutant groups.
Figure imgf000026_0001
Results
No adverse reactions were noted after exposure of the mutant virus or wild-type viruses to the pigs in each of the groups.
Tables 3 and 4 show the results of the PRRS virus isolation from serum and calculated viraemia scores. Incidences of viraemia at defined sampling points were determined by virus isolation on porcine alveolar macrophages using routine and pubhshed techniques; Virus positivity at a serum sample dilution of 1:10 was designated (+), and (++) means virus positivity at a serum sample dilution of 1:100. These results were used to calculate a group total "viraemia score" as (type 1) the percentage of the virus-exposed animals in each group (each virus positive animal at each time- point = 1 point, so a max score of 100% (=12/12) can be obtained, and (type 2) as the. percentage of maximal viraemia of the exposed animals. In the latter case, a max score of 100% (=24/24) can be obtained based upon the fact that max viraemia is scored as 2 points (1:100 dilution of the samples) for each individual animal. All mutant virus groups showed a reduced type 1 and type 2 viremia score as compared to vABV437. vABV707 vaccinated pigs showed a reduced type
1 and type 2 viraemia score prior to challenge as compared to the score of the pigs in all other groups. At the moment of challenge no animals were shown to be viraemic any more. All sentinels became viraemic and sero-converted, meaning that the viruses shedded from the exposed pigs to the sentinels. It is shown that primary exposure of the mutant viruses to the pigs renders an effective immunological response as determined by a near complete prevention of viraemia after homologous wild- type challenge and a firm reduction of viraemia after heteroogous challenge as compared to challenge controls. Vaccinated sentinels were effectively protected. No differences could be documented in serological responses after vaccination and challenge between each of the groups studied.
Challenge controls all show viraemia during the course of the 14-day study, where the viraemia is most predominant in the intranasally exposed pigs.
Table 3. Type 1 viraemia score. A group total "viraemia score" was calculated as the percentage of the virus-exposed animals in each group. Each virus positive animal at each time-point = 1 point, so a max score of 100% (=12/12) can be obtained.
Figure imgf000028_0001
Table 4. Type 2 viraemia score, calculated as the percentage of maximal viraemia of the exposed animals. A max score of 100% (=24/24) can be obtained based upon the fact that max viraemia is scored as 2 points (1:100 dilution of the samples) for each individual animal at each time point.
Figure imgf000029_0001
Conclusion
The studied recombinant mutant PRRS viruses show a reduced virulence as determined by a reduction of viraemia (length and height) as compared to wild- type (vABv437). All mutants instigate an effective immune response for the protection of pigs against a wild-type field PRRSV. The homologous protection seems to be somewhat more effective than the heterologous one. vABV707 seems to be the most suitable vaccine from among tested viruses. The humoral response is measurable by a commercial ELISA (IDEXX) in all cases. No adverse reactions are elicited.
REFERENCES
1. de Haan, C. A, L. Kuo, P. S. Masters, H. Vennema, and P. J. Rottier. 1998. Coronavirus particle assembly: primary structure requirements of the membrane protein. J Virol. 72:6838-50.
2. de Haan, C. A, M. Smeets, F. Vernooij, H. Vennema, and P. J. Rottier. 1999. Mapping of the coronavirus membrane protein domains involved in interaction with the spike protein. J Virol. 73:7441-52.
3. de Vries, A. A., S. M. Post, M. J. Raamsman, M. C. Horzinek, and P. J. Rottier. 1995. The two major envelope proteins of equine arteritis virus associate into disulfide-linked heterodimers. J Virol. 69:4668-74.
4. Faaberg, K. S., C. Even, G. A. Palmer, and P. G. Plagemann. 1995. Disulfide bonds between two envelope proteins of lactate dehydrogenase-elevating virus are essential for viral infectivity. J Virol. 69:613-7. 5. Faaberg, K. S., and P. G. Plagemann. 1995. The envelope proteins of lactate dehydrogenase-elevating virus and their membrane topography. Virology. 212:512-25. 6. Godeke, G. J., C. A. de Haan, J. W. Rossen, H. Vennema, and P. J. Rottier.
2000. Assembly of spikes into coronavirus particles is mediated by the carboxy- terminal domain of the spike protein. J Virol. 74:1566-71. 7. Kuo, L., G. J. Godeke, M. J. Raamsman, P. S. Masters, and P. J. Rottier. 2000.
Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier. J Virol. 74:1393-406.
8. Li, K., Z. Chen, and P. Plagemann. 1998. The neutralization epitope of lactate dehydrogenase-elevating virus is located on the short ectodomain of the primary envelope glycoprotein. Virology. 242:239-45.
9. Liljestrom, P., and H. Garoff. 1991. A new generation of animal cell expression vectors based on the Semliki Forest virus replicon. Biotechnology N Y. 9:1356-61.
10. Mardassi, H., B. Massie, and S. Dea. 1996. Intracellular synthesis, processing, and transport of proteins encoded by ORFs 5 to 7 of porcine reproductive and respiratory syndrome virus. Virology. 221:98-112. 11. Meulenberg, J. J.M., and A. Petersen den Besten. 1996. Identification and characterization of a sixth structural protein of Lelystad virus: the glycoprotein GP2 encoded by ORF2 is incorporated in virus particles. Virology. 225:44-51.
12. Meulenberg, J. J. M., A. Petersen-Den Besten, E. P. De Kluyver, R. J. M. Moormann, W. M. M. Schaaper, and G. Wensvoort. 1995. Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology. 206:155-163.
13. Meulenberg, J. J. M., J. N. A. BosDeRuijter, R. vandeGraaf, G. Wensvoort, and R. J. M. Moormann. 1998. Infectious transcripts from cloned genome-length cDNA of porcine reproductive and respiratory syndrome virus. Journal Of Virology. Jan. 72:380-387.
14. Meulenberg, J. J. M., M. M. Hulst, E. J. De Meijer, P. L. J. M. Moonen, A. Den Besten, E. P. De Kluyver, G. Wensvoort, and R. J. M. Moormann. 1993. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology. 192:62-72. 15. Murtaugh, M. P., M. R. Elam, and L. T. Kakach. 1995. Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus. Arch Virol. 140:1451-60.
16. Risco, O, I. M. Anton, C. Sune, A. M. Pedregosa, J. M. Martin Alonso, F. Parra, J. L. Carrascosa, and L. Enjuanes. 1995. Membrane protein molecules of transmissible gastroenteritis coronavirus also expose the carboxy-terminal region on the external surface of the virion. J Virol. 69:5269-77.
17. Sambrook, J., Fritsch, E.F., Maniatis, T. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
18. van Nieuwstadt, A. P., J. J. Meulenberg, A. van Essen Zanbergen, A. Petersen den Besten, R. J. Bende, R. J. Moormann, and G. Wensvoort. 1996. Proteins encoded by open reading frames 3 and 4 of the genome of Lelystad virus (Arteriviridae) are structural proteins of the virion. J Virol. 70:4767-72.
19. Wensvoort, G., C. Terpstra, J. Boonstra, M. Bloemraad, and D. Van Zaane. 1986. Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis. Vet Microbiol. 12:101-8.
20. Wensvoort, G., C. Terpstra, J. M. Pol, E. A. ter Laak, M. Bloemraad, E. P. de Kluyver, C. Kragten, L. van Buiten, A. den Besten, F. Wagenaar, and et al. 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q. 13:121-30.

Claims

Claims
1. An Arterivirus-like particle comprising at least a first structural protein derived from a first Arterivirus and a second structural protein wherein said second structural protein is at least partly not derived from said first Arterivirus.
2. A particle according to claim 1 wherein said second structural protein is at least partly derived from a second Arterivirus.
3. A particle according to claim 1 or 2 wherein said first and second structural protein comprise a heterodimer.
4. A particle according to anyone of claims 1 to 3 wherein said first or second structural protein comprises a membrane protein (M) or part thereof.
5. A particle according to anyone of claims 1 to 3 wherein said first or second structural protein comprises a glycoprotein (GP) or part thereof.
6. A particle according to claim 5 wherein said glycoprotein comprises GP5.
7. A particle according to anyone. of claims 1 to 3 wherein said first structural protein comprises GP5 or part thereof and said second structural protein comprises a matrix protein (M) or part thereof.
8. A particle according to anyone of claims 1 to 7 wherein said first Arterivirus comprises porcine reproductive and respiratory syndrome virus (PRRSV).
9. A particle according to anyone of claims 2 to 8 wherein said second Arterivirus comprises lactate dehydrogenase-elevating virus (LDV).
10. A nucleic acid encoding at least a first structural protein derived from a first Arterivirus and a second structural protein wherein said second structural protein is at least partly not derived from said first Arterivirus wherein said first and second structural protein allow for incorporation in an Arterivirus-like particle.
11. A particle according to anyone of claims 1 to 9 comprising a nucleic acid according to claim 10.
12. A host cell comprising a particle according to anyone of claims 1 to 9 or 11 or comprising a nucleic acid according to claim 10.
13. A vaccine comprising a particle according to anyone of claims 1 to 9 or 11, comprising a nucleic acid according to claim 10, or a host cell according to claim 12.
14. A method for obtaining an attenuated Arterivirus comprising providing a first Arterivirus with a structural protein that is at least partly not derived from said first Arterivirus.
15. A method according to claim 14 wherein said structural protein is at least partly derived from a second Arterivirus.
16. A method according to claim 14 or 15 wherein said structural protein comprises a heterodimer with another structural protein.
17. A method according to claim 16 wherein one of said structural proteins comprises a membrane protein (M) or part thereof.
18. A method according to claim 16 or 17 wherein one of said structural proteins comprises a glycoprotein (GP) or part thereof.
19. A method according to claim 18 wherein said glycoprotein comprises GP5.
20. A method according to anyone of claims 16 to 19 wherein one of said structural proteins comprises GP5 or part thereof and said other structural protein comprises a matrix protein (M) or part thereof.
21. A method according to anyone of claims 14 to 20 wherein said first Arterivirus comprises porcine reproductive and respiratory syndrome virus (PRRSV).
22. A method according to anyone of claims 15 to 21 wherein said second Arterivirus comprises lactate dehydrogenase-elevating virus (LDV).
PCT/NL2001/000382 2000-05-19 2001-05-21 Chimeric arterivirus-like particles WO2001090363A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CA2409209A CA2409209C (en) 2000-05-19 2001-05-21 Chimeric arterivirus-like particles
JP2001587157A JP4875274B2 (en) 2000-05-19 2001-05-21 Chimera Arterivirus-like particle
DK01932411T DK1283887T3 (en) 2000-05-19 2001-05-21 Chimeric Arterivirus-like particles
DE60138014T DE60138014D1 (en) 2000-05-19 2001-05-21 CHIMERIC ARTERIVIRUS-SIMILAR PARTICLES
KR1020027015538A KR100916883B1 (en) 2000-05-19 2001-05-21 Chimeric arterivirus-like particles
MXPA02011415A MXPA02011415A (en) 2000-05-19 2001-05-21 Chimeric arterivirus like particles.
EP01932411A EP1283887B1 (en) 2000-05-19 2001-05-21 Chimeric arterivirus-like particles
AU2001258938A AU2001258938A1 (en) 2000-05-19 2001-05-21 Chimeric arterivirus-like particles
US10/300,699 US7122347B2 (en) 2000-05-19 2002-11-19 Chimeric Arterivirus-like particles

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP00201780A EP1156111A1 (en) 2000-05-19 2000-05-19 Chimeric arterivirus-like particles
EP00201780.4 2000-05-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/300,699 Continuation US7122347B2 (en) 2000-05-19 2002-11-19 Chimeric Arterivirus-like particles

Publications (1)

Publication Number Publication Date
WO2001090363A1 true WO2001090363A1 (en) 2001-11-29

Family

ID=8171523

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2001/000382 WO2001090363A1 (en) 2000-05-19 2001-05-21 Chimeric arterivirus-like particles

Country Status (14)

Country Link
US (1) US7122347B2 (en)
EP (2) EP1156111A1 (en)
JP (1) JP4875274B2 (en)
KR (1) KR100916883B1 (en)
AT (1) ATE426026T1 (en)
AU (1) AU2001258938A1 (en)
CA (1) CA2409209C (en)
CY (1) CY1109141T1 (en)
DE (1) DE60138014D1 (en)
DK (1) DK1283887T3 (en)
ES (1) ES2322237T3 (en)
MX (1) MXPA02011415A (en)
PT (1) PT1283887E (en)
WO (1) WO2001090363A1 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8383131B2 (en) 2004-09-21 2013-02-26 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome isolates and methods of use
US8399187B2 (en) 2004-06-18 2013-03-19 Regents Of The University Of Minnesota Identifying virally infected and vaccinated organisms
US8546124B2 (en) 1996-10-30 2013-10-01 Boehringer Ingelheim Vetmedica Gmbh Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US8741309B2 (en) 1999-04-22 2014-06-03 The United States Of America As Represented By The Secretary Of Agriculture Porcine reproductive and respiratory syndrome vaccine based on isolate JA-142
US8765142B2 (en) 2011-02-17 2014-07-01 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US8790656B2 (en) 1996-10-30 2014-07-29 Boehringer Ingelheim Vetmedica Gmbh PRRSV vaccines
US9080143B2 (en) 2005-06-24 2015-07-14 University Of Minnesota PRRS viruses, infectious clones, mutants thereof, and method of use
US9187731B2 (en) 2011-07-29 2015-11-17 Boehringer Ingelheim Vetmedica Gmbh PRRS virus inducing type I interferon in susceptible cells
US9315781B2 (en) 2011-07-29 2016-04-19 Boehringer Ingelheim Vetmedica Gmbh Infectious CDNA clone of european PRRS virus and uses thereof
US9561270B2 (en) 2009-09-02 2017-02-07 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in PCV-2 compositions and PCV-2 compositions with an improved immunogenicity
US9579373B2 (en) 2013-03-15 2017-02-28 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome virus, compositions, vaccine and methods of use
US9944902B2 (en) 2011-02-17 2018-04-17 Boehringer Ingelheim Vetmedica Gmbh Commercial scale process for production of PRRSV
US10010601B2 (en) 2013-12-20 2018-07-03 Boehringer Ingelheim Vetmedica Gmbh PRRS virus variant, European PRRS virus cDNA clone, and uses thereof

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040224327A1 (en) * 1996-10-30 2004-11-11 Meulenberg Johanna Jacoba Maria Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
KR20030082960A (en) * 2001-03-09 2003-10-23 베링거잉겔하임베트메디카게엠베하 Life attenuated strains of PRRS virus
EP1438969A1 (en) * 2003-01-14 2004-07-21 Universiteit Utrecht Arterivirus marker vaccine
US9216212B2 (en) * 2005-08-05 2015-12-22 University Of Massachusetts Virus-like particles as vaccines for paramyxovirus
US7951384B2 (en) * 2005-08-05 2011-05-31 University Of Massachusetts Virus-like particles as vaccines for paramyxovirus
CA2630648C (en) * 2005-11-29 2016-01-19 Iowa State University Research Foundation, Inc. Identification of protective antigenic determinants of porcine reproductive and respiratory syndrome virus (prrsv) and uses thereof
TW201605471A (en) * 2007-04-30 2016-02-16 Mj生物股份有限公司 PRRSV GP5 based compositions and methods
US7666585B2 (en) * 2007-06-15 2010-02-23 Protatek International, Inc. Construction of chimera PRRSV, compositions and vaccine preparations
EP2328612A4 (en) * 2008-08-25 2012-11-14 Boehringer Ingelheim Vetmed Vaccine against highly pathogenic porcine reproductive and respiratory syndrome (hp prrs)
US8580270B2 (en) * 2008-09-30 2013-11-12 University Of Massachusetts Respiratory synctial virus (RSV) sequences for protein expression and vaccines
EP2230246A1 (en) * 2009-03-19 2010-09-22 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Arterivirus glycoprotein 5 virus-like particles
CN102908617A (en) * 2011-08-04 2013-02-06 广州格拉姆生物科技有限公司 Porcine reproductive and respiratory syndrome virus M protein and CD40L fusion vaccine and preparation method
JPWO2016021276A1 (en) 2014-08-08 2017-05-25 出光興産株式会社 Pig breeding / breathing disorder syndrome control agent

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0835929A1 (en) * 1996-01-25 1998-04-15 Laboratorios Hipra, S.A. New attenuated strain of the virus causing the porcine reproductive respiratory syndrome (prrs), vaccines and diagnostic means obtainable with said strain, and production process
EP0839912A1 (en) * 1996-10-30 1998-05-06 Instituut Voor Dierhouderij En Diergezondheid (Id-Dlo) Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
WO1998055626A2 (en) * 1997-06-05 1998-12-10 Origen, Inc. Recombinant porcine reproductive and respiratory syndrome virus (prrsv) for use as a vaccine
WO2000053787A1 (en) * 1999-03-08 2000-09-14 Id-Lelystad, Instituut Voor Dierhouderij En Dierg Ezondheid B.V. Prrsv vaccines

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0835929A1 (en) * 1996-01-25 1998-04-15 Laboratorios Hipra, S.A. New attenuated strain of the virus causing the porcine reproductive respiratory syndrome (prrs), vaccines and diagnostic means obtainable with said strain, and production process
EP0839912A1 (en) * 1996-10-30 1998-05-06 Instituut Voor Dierhouderij En Diergezondheid (Id-Dlo) Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
WO1998055626A2 (en) * 1997-06-05 1998-12-10 Origen, Inc. Recombinant porcine reproductive and respiratory syndrome virus (prrsv) for use as a vaccine
WO2000053787A1 (en) * 1999-03-08 2000-09-14 Id-Lelystad, Instituut Voor Dierhouderij En Dierg Ezondheid B.V. Prrsv vaccines

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DE VRIES A. A. ET AL.: "Genetic manipulation of equine arteritis virus using full-length cDNA clones: separation of overlapping genes and expression of a foreign epitope.", VIROLOGY, vol. 270, no. 1, 25 April 2000 (2000-04-25), pages 84 - 97, XP002150339 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8546124B2 (en) 1996-10-30 2013-10-01 Boehringer Ingelheim Vetmedica Gmbh Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US8790656B2 (en) 1996-10-30 2014-07-29 Boehringer Ingelheim Vetmedica Gmbh PRRSV vaccines
US8741309B2 (en) 1999-04-22 2014-06-03 The United States Of America As Represented By The Secretary Of Agriculture Porcine reproductive and respiratory syndrome vaccine based on isolate JA-142
US8747859B2 (en) 1999-04-22 2014-06-10 The United States Of America, As Represented By The Secretary Of Agriculture Porcine reproductive and respiratory syndrome vaccine based on isolate JA-142
US8399187B2 (en) 2004-06-18 2013-03-19 Regents Of The University Of Minnesota Identifying virally infected and vaccinated organisms
US8383131B2 (en) 2004-09-21 2013-02-26 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome isolates and methods of use
US9080143B2 (en) 2005-06-24 2015-07-14 University Of Minnesota PRRS viruses, infectious clones, mutants thereof, and method of use
US9561270B2 (en) 2009-09-02 2017-02-07 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in PCV-2 compositions and PCV-2 compositions with an improved immunogenicity
US9944902B2 (en) 2011-02-17 2018-04-17 Boehringer Ingelheim Vetmedica Gmbh Commercial scale process for production of PRRSV
US8765142B2 (en) 2011-02-17 2014-07-01 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US10039821B2 (en) 2011-02-17 2018-08-07 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US10668144B2 (en) 2011-02-17 2020-06-02 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US9315781B2 (en) 2011-07-29 2016-04-19 Boehringer Ingelheim Vetmedica Gmbh Infectious CDNA clone of european PRRS virus and uses thereof
US9187731B2 (en) 2011-07-29 2015-11-17 Boehringer Ingelheim Vetmedica Gmbh PRRS virus inducing type I interferon in susceptible cells
US9579373B2 (en) 2013-03-15 2017-02-28 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome virus, compositions, vaccine and methods of use
US10010601B2 (en) 2013-12-20 2018-07-03 Boehringer Ingelheim Vetmedica Gmbh PRRS virus variant, European PRRS virus cDNA clone, and uses thereof
US10639364B2 (en) 2013-12-20 2020-05-05 Boehringer Ingelheim Vetmedica Gmbh PRRS virus variant, european PRRS virus cDNA clone, and uses thereof

Also Published As

Publication number Publication date
CY1109141T1 (en) 2014-07-02
JP2004506411A (en) 2004-03-04
ATE426026T1 (en) 2009-04-15
US20030161845A1 (en) 2003-08-28
EP1283887B1 (en) 2009-03-18
EP1156111A1 (en) 2001-11-21
EP1283887A1 (en) 2003-02-19
KR20030026931A (en) 2003-04-03
JP4875274B2 (en) 2012-02-15
KR100916883B1 (en) 2009-09-09
CA2409209C (en) 2011-08-09
AU2001258938A1 (en) 2001-12-03
MXPA02011415A (en) 2004-02-26
DE60138014D1 (en) 2009-04-30
CA2409209A1 (en) 2001-11-29
DK1283887T3 (en) 2009-06-22
US7122347B2 (en) 2006-10-17
ES2322237T3 (en) 2009-06-18
PT1283887E (en) 2009-03-31

Similar Documents

Publication Publication Date Title
US7122347B2 (en) Chimeric Arterivirus-like particles
US8790656B2 (en) PRRSV vaccines
AU719991B2 (en) Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US7273617B2 (en) Infectious cDNA clones of porcine reproductive and respiratory syndrome virus and expression vectors thereof
AU754938B2 (en) PRRSV antigenic sites identifying peptide sequences of PRRS virus for use in vaccines or diagnostic assays
EP2181189B1 (en) Recombinant north american type 1 porcine reproductive and respiratory syndrome virus and methods of use
US20040213805A1 (en) Deletions in arterivirus replicons
CA2424400C (en) Adaptation sites of prrsv
Verheije et al. Safety and protective efficacy of porcine reproductive and respiratory syndrome recombinant virus vaccines in young pigs
WO2012069638A1 (en) Nucleic acids encoding prrsv gp5-ecto domain and m protein
Kwon Use of reverse genetics to study porcine reproductive and respiratory syndrome virus virulence
Liu In vivo evaluation of a candidate live marker vaccine for porcine reproductive and respiratory syndrome virus
MXPA99003967A (en) Infectious clones of rna viruses and vaccines and diagnostic assays derived thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2409209

Country of ref document: CA

Ref document number: 1020027015538

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: PA/a/2002/011415

Country of ref document: MX

Ref document number: 10300699

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2001932411

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2001932411

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020027015538

Country of ref document: KR