CN102908617A - Porcine reproductive and respiratory syndrome virus M protein and CD40L fusion vaccine and preparation method - Google Patents

Abstract

The invention relates to a porcine reproductive and respiratory syndrome virus (PRRSV) M protein and CD40L fusion vaccine and a preparation method. The porcine reproductive and respiratory syndrome virus M protein and CD40L fusion vaccine is a gene recombinant fusion polypeptide; the polypeptide contains M protein of PRRSV and a main amino acid sequence of CD40L; M gene and immune co-stimulatory molecule CD40 ligand (CD40L) are bonded by using a gene recombination technology to form recombinant fusion protein; the fusion gene is cloned to prokaryotic expression vector pET-30a(+); the recombinant fusion protein is induced and expressed by IPTG (Isopropyl-beta-d-Thiogalactoside); and the recombinant protein is purified through an inclusion body. The fusion protein and the preparation method have the beneficial effect that the recombination fusion protein can be used for prevention and treatment of PRRSV infection.

Description

The breeding of one boar and breathing syndrome virus M albumen and CD40L fusion bacterin and preparation method

Technical field

The invention belongs to biological medicine gene recombinaton field, be specifically related to boar breeding and breathing syndrome virus M albumen and CD40L fusion bacterin and preparation method.

Background technology

M albumen is the most conservative albumen in the PRRSV structural protein, and it has a small peptide section (18aa) to be exposed to the virion surface, may be with the gathering of virus with in conjunction with relevant.The M protein aggregation and forms heterodimer with GP5 on the rough surface endoplasmic reticulum, virus pulmonary alveolar macrophage is adhered to the virus infection process in play an important role.M albumen has very strong immunogenicity, and 10d can excite and produce detectable antibody response after infecting, and the recombinant M protein of expression can be used as target antigen and the subunit vaccine of serological test, plays an important role in the comfortable cellular immunization of M egg.CD40L has the T lymphocyte of stimulation and bone-marrow-derived lymphocyte propagation, induces the bone-marrow-derived lymphocyte differentiation.In addition, it also acts on antigen-presenting cell (APC), promotes the expression of the co-stimulators such as CD28, B7-1 and B7-2, improves the antigen presentation ability of APC, strengthens immune response.

Summary of the invention

The purpose of this invention is to provide boar breeding and breathing syndrome virus M albumen and CD40L fusion bacterin and preparation method, be used for prevention and treatment that PRRSV infects.

The objective of the invention is to be achieved through the following technical solutions:

The breeding of one boar and breathing syndrome virus M albumen and CD40L fusion bacterin are a kind of gene recombinaton fused polypeptide, and this polypeptide contains the M albumen of PRRSV and the main aminoacid sequence of CD40L.

The preparation method of above-mentioned pig breeding and breathing syndrome virus M albumen and CD40L fusion bacterin may further comprise the steps:

1) adopt gene recombination technology that the M gene of PRRSV and the cDNA gene of CD40L are connected to form fusion gene;

2) with fusion gene cloning to the cloning site of prokaryotic expression carrier pET30a, by the IPTG abduction delivering, liquid chromatograph purification of Recombinant fusion rotein.

Beneficial effect of the present invention is: with the mixing Fu Shi immunological adjuvant notch graft boar of recombination fusion protein, detection specificity IgG antibody and NAT, and the humoral immunity level of checking recombination fusion protein; Cellular immunization is the principal mode of infection immunity in the anti-cell, and this restructuring PRRSV vaccine can stimulate body to produce the cellular immunization of anti-PRRSV by the fusion with M albumen and CD40L; Carry out the counteracting toxic substances experiment after the immunity, the result confirms effectively to suppress PRRSV and infects, and reduces the mortality rate of infected pig; In addition, this fusion rotein antigenic specificity is high, can not cause nonspecific immune reaction, can be used as prevention and therapeutic vaccine in clinical application.

Description of drawings

Fig. 1 is the M protein amino acid sequence of the described boar breeding of the embodiment of the invention and breathing syndrome virus M albumen and CD40L fusion bacterin;

Fig. 2 is the M gene nucleotide series of the described boar breeding of the embodiment of the invention and breathing syndrome virus M albumen and CD40L fusion bacterin;

Fig. 3 is the CD40L protein amino acid sequence of the described boar breeding of the embodiment of the invention and breathing syndrome virus M albumen and CD40L fusion bacterin;

Fig. 4 is the CD40L gene nucleotide series of the described boar breeding of the embodiment of the invention and breathing syndrome virus M albumen and CD40L fusion bacterin;

Fig. 5 is the M-CD40L fused protein aminoacid sequence of the described boar breeding of the embodiment of the invention and breathing syndrome virus M albumen and CD40L fusion bacterin;

Fig. 6 is the M-CD40L fusion gene nucleotide sequence of the described boar breeding of the embodiment of the invention and breathing syndrome virus M albumen and CD40L fusion bacterin.

The specific embodiment

The described boar breeding of the embodiment of the invention and breathing syndrome virus M albumen and CD40L fusion bacterin, it is a kind of gene recombinaton fused polypeptide, this polypeptide contains the M albumen of PRRSV and the main aminoacid sequence of CD40L, described M Argine Monohydrochloride sequence as shown in Figure 1, the main aminoacid sequence of described CD40L is as shown in Figure 3; The M gene nucleotide series as shown in Figure 2, the CD40L gene nucleotide series as shown in Figure 4, M-CD40L fusion rotein aminoacid sequence as shown in Figure 5, M-CD40L fusion gene nucleotide sequence is as shown in Figure 6.

Embodiment 1M gene clone is to prokaryotic expression carrier pET30a

1, design M gene primer

With reference to the M gene order of PRRSV (GenBank number: DQ379480) the M gene primer of design amplification PRRSV virus is as follows, and introducing restriction enzyme site is EcoR I and Xho I (representing with italic):

M-F-E：GC

ATGGGGTCGTCCTTAGATGA，

M-R-X：GC TTATTTGGCATATTTGACAAG。

2, extract the PRRS viral RNA

Marc-145 cell infection PRRSV strain is VR2332, and after 48 hours (48hpi), the RNA extraction test kit according to invitrogen company extracts total RNA from the Marc-145 cell that infects virus.

3, reverse transcription and the PCR of the M gene of PRRSV

RT-PCR test kit according to invitrogen company carries out reverse transcription, obtains the cDNA of M-mRNA.Then be pcr amplification M gene according to above-mentioned primer.

The PCR reaction condition is as follows: 94 ℃ 4 minutes; 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 45 seconds; Totally 30 circulations; 72 ℃ 10 minutes.The result gets the purpose fragment that the PCR product is about 525bp.

4, positive recombiant plasmid pET30a-M's obtains

Behind 1% agarose gel electrophoresis, reclaim the purpose band, reclaim PCR product and carrier pET30a plasmid by following system with EcoR I and Xho I double digestion:

PCR product (M gene) or pET30a plasmid	30μL
		EcoR I	1μL
Xho I	1μL
		10×H buffer	4μL
H 2O	4

37 ℃ of endonuclease reactions are after 2 hours, and electrophoresis reclaims the purpose band, press following system connection carrier and PCR fragment:

PCR product (M gene)	7μL
		The pET30a plasmid	1μL
T4 ligase	1μL
		10×T4buffer	1μL

16 ℃ were reacted after 5 hours, the transformed competence colibacillus bacillus coli DH 5 alpha, and the picking positive monoclonal carries out gene sequencing, order-checking is shown the carrier called after pET30a-M that contains the M gene.

Embodiment 2CD40L gene clone is to prokaryotic expression carrier pET30a

1, design CD40L gene primer

With reference to pig CD40L gene order (GenBank number: AB040443) design amplification CD40L gene primer is as follows, and introducing restriction enzyme site is EcoR I and Xho I (representing with italic):

CD40L-F-E：GC

ATGATCGAAACGTACAGC；

CD40L-R-X：GC

TCAGAGTTTGAGGAGGCC。

2, extract the total RNA of CD40L

RNA according to invitrogen company extracts test kit, extracts total RNA from porcine kidney cell line PK15 cell.

3, the reverse transcription of CD40L gene and PCR

RT-PCR test kit according to invitrogen company carries out reverse transcription, obtains the cDNA of M-mRNA.Then be pcr amplification CD40L gene according to above-mentioned primer.

The PCR reaction condition is as follows: 94 ℃ 4 minutes; 94 ℃ 45 seconds, 55 ℃ 45 seconds, 72 ℃ 60 seconds; Totally 30 circulations; 72 ℃ 10 minutes.The result gets the purpose fragment that the PCR product is about 786bp.

4, positive recombiant plasmid pET30a-CD40L's obtains

Behind 1% agarose gel electrophoresis, reclaim the purpose band, reclaim PCR product and carrier pET30a plasmid by following system with EcoR I and Xho I double digestion:

PCR product (CD40L gene) or pET30a plasmid	30μL
		EcoR I	1μL
XhoI	1μL
		10×H buffer	4μL
H 2O	4

37 ℃ of endonuclease reactions are after 2 hours, and electrophoresis reclaims the purpose band, press following system connection carrier and PCR fragment:

PCR product (CD40L gene)	7μL
		The pET30a plasmid	1μL
T4 ligase	1μL
		10×T4buffer	1μL

16 ℃ were reacted after 5 hours, the transformed competence colibacillus bacillus coli DH 5 alpha, and the picking positive monoclonal carries out gene sequencing, order-checking is shown the carrier called after pET30a-CD40L that contains the M gene.

Embodiment 3M-CD40L fusion gene cloning is to prokaryotic expression carrier pET30a

1, design of primers

By design Linker sequence (5 sections repetitive sequence GGGGS) M and CD40L gene are coupled together, design following primer:

M-F-E：GCGAATTCATGGGGTCGTCCTTAGATGA；

M-R-GGGGS：

GGACCCGCCTCCACCGGACCCGCCTCCACCGGACCCGCCTCCACCTTTGGCATATTTG；

GGGGS-CD40L-F：

GGTGGAGGCGGGTCCGGTGGAGGCGGGTCCGGTGGAGGCGGGTCCATCGAAACGTACAG；

CD40L-R-X：GCCTCGAGTCAGAGTTTGAGGAGGCC。

2, pcr amplification fusion gene M-CD40L

Take the PCR product of M and CD40L as template, obtain fusion gene M-CD40L by above-mentioned 4 primer amplifications, the PCR reaction condition is as follows: 94 ℃ 4 minutes; 94 ℃ 45 seconds, 55 ℃ 45 seconds, 72 ℃ 90 seconds; Totally 30 circulations; 72 ℃ 10 minutes.The result gets the fusion gene M-CD40L purpose fragment that the PCR product is about 1350bp.

3, positive recombiant plasmid pET30a-M-CD40L's obtains

Behind 1% agarose gel electrophoresis, reclaim the purpose band, reclaim PCR product and carrier pET30a plasmid by following system with EcoR I and Xho I double digestion:

M-CD40L gene or pET30a plasmid	30μL
		EcoR I	1μL
Xho I	1μL
		10×H buffer	4μL
H 2O	4

37 ℃ of endonuclease reactions are after 2 hours, and electrophoresis reclaims the purpose band, press following system connection carrier and PCR fragment:

The M-CD40L gene	7μL
		The pET30a plasmid	1μL
T4 ligase	1μL
		10×T4buffer	1μL

16 ℃ were reacted after 5 hours, the transformed competence colibacillus bacillus coli DH 5 alpha, and the picking positive monoclonal carries out gene sequencing, order-checking is shown the carrier called after pET30a-M-CD40L that contains the M gene.

Abduction delivering and the purification of embodiment 4 albumen (M, CD40L, M-CD40L)

With pET30a-M, the positive recombinant plasmid transformed expression strain-e. coli bl21 (DE3) of pET30a-CD40L and pET30a-M-CD40L, what obtain contains pET30a-M, positive colony called after BL21-pET30a-M, BL21-pET30a-CD40L and the BL21-pET30a-M-CD40L of pET30a-CD40L and pET30a-M-CD40L.

Amplification cultivation engineering bacteria BL21-pET30a-M, BL21-pET30a-CD40L and BL21-pET30a-M-CD40L, 37 ℃, bacterium liquid OD600 to 1.0 is cultivated in 200 rev/mins of (radius of turn is 13mm) joltings, induces 10～14 hours at 16 ℃ of lower adding IPTG (0.25mM).After cultivating end, be handled as follows: it is resuspended through PBS that 10000g, centrifugal 10 minutes collect thalline, carrying out ultrasonic bacteria breaking, carry out the SDS-PAGE electrophoresis detection, testing result shows, 26,33, locate to occur a protein band about 55kDa, conform to M-CD40L albumen size with M, CD40L respectively, show restructuring M, CD40L and M-CD40L albumen correction in escherichia coli.

After in addition precipitation being carried out a series of purification, SDS-PAGE electrophoresis detection, testing result as shown in Figure 3, band is single, shows restructuring M, the CD40L and the M-CD40L albumen that obtain based on very high purity, can carry out next step animal immune experiment.

Embodiment 5 zooperies---immune swine and counteracting toxic substances

Choose 50 the 4 negative and negative antibody pigletss of PRRSV virus in age in week as laboratory animal, be divided at random following 5 groups:

Behind each histone and Freund adjuvant (be Freund's complete adjuvant for the first time, second and third time is incomplete Freunds adjuvant) mixing and emulsifying, by top method immunity piglets.1～4 group in immunity after 3 times the 14th day gather whole blood 15ml, counteracting toxic substances VR2332-PRRSV simultaneously, dosage is 10 ⁶The TCID50/ head, the 0th, 3,7,11,14,21 day Sanguis sus domestica behind the collection counteracting toxic substances, separation of serum, and record pig death condition.

Embodiment 6 humoral immunity level test experience---IgG antibody and neutralizing antibody detect

The 14th day Sanguis sus domestica after collection 3 is exempted from, separation of serum detects the M-specific antibody and tests detection PRRSV-NAT with serum-virus neutralization with ELISA, determines the humoral immunity level of this vaccine.

The result shows that M albumen can excite pig to produce specific antibody and PRRSV-neutralizing antibody, and CD40L can significantly improve 3～4 times of antibody titers, illustrates that this vaccine M-CD40L can significantly bring out the humoral immunization of body.

Embodiment 7 cellular immune level test experience---peripheral blood mononuclear lymphocyte (PBMC) proliferation experiment

The 14th day Sanguis sus domestica after collection 3 is exempted from separates peripheral blood mononuclear lymphocyte (PBMC), does lymphocyte proliferation assay, detects the cellular immune level of this vaccine.

The result shows that independent M protein immunization can produce specific cellular immunity, and it is stronger that the M-CD40L fusion protein immunization produces the specific cellular immunity effect, illustrates that this vaccine M-CD40L can significantly bring out the cellular immunization of body.

Behind embodiment 8 counteracting toxic substances, pig body inner virus titre detects

The the 0th, 3,7,11,14,21 day Sanguis sus domestica behind the collection counteracting toxic substances, separation of serum extracts RNA, uses the rna level of the N gene of Real-timeRT-PCR detection by quantitative virus, in order to represent the viral level in the pig body:

Primer-5 ': AAT AACAACGGCAAGCAGCAG;

Primer-3 ': CCT CTGGACTGGTTTTGTTGG.

The result shows, immunity the pig body inner virus content of vaccine M-CD40L be starkly lower than vaccine M group, and these two groups of pig body inner virus content are starkly lower than PBS and CD40L group, illustrate that this vaccine M-CD40L can protect piglets to avoid virus attack.

Behind embodiment 9 counteracting toxic substances, pig mortality rate/survival rate detects

Record pig death condition behind the counteracting toxic substances, result such as table 1, immunity the mortality rate of vaccine M-CD40L group only be that 10%, PBS and CD40L group is that 90%, M group is 50%, illustrate that the vaccine based on albumen M can significantly reduce mortality rate, raising piglets survival rate.

Table 1 detects pig mortality rate and survival rate behind the counteracting toxic substances

Claims (2)

1. boar breeding and breathing syndrome virus M albumen and CD40L fusion bacterin, it is a kind of gene recombinaton fused polypeptide, it is characterized in that: this polypeptide contains the M albumen of PRRSV and the main aminoacid sequence of CD40L, described M Argine Monohydrochloride sequence as shown in Figure 1, the main aminoacid sequence of described CD40L is as shown in Figure 3.

2. the preparation method of pig breeding claimed in claim 1 and breathing syndrome virus M albumen and CD40L fusion bacterin is characterized in that, may further comprise the steps:

1) adopt gene recombination technology that the M gene of PRRSV and the cDNA gene of CD40L are connected to form fusion gene;

2) with fusion gene cloning to the cloning site of prokaryotic expression carrier pET30a, by the IPTG abduction delivering, liquid chromatograph purification of Recombinant fusion rotein.

Images