RU2626605C2 - Genetic (recombinant) dna construct comprising codon-optimized glycoprotein gene (protein g) of rabies virus with consensus amino acid sequence which takes into account the amino acid sequence of protein g, isolated from rabies virus strain circulating in the russian federation - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: genetic DNA construct represented by the nucleotide sequence SEQ ID NO 2 containing a codon-optimized gene encoding the glycoprotein (G protein) of rabies virus with the consensus amino acid sequence SEQ ID NO 1, taking into account the variety of the rabies virus strains circulating in the territory of the Russian Federation is proposed. The proposed DNA construct in the pVAX1 vector in the transfected human cell culture, provides an increase in protein G gene expression as compared to the expression of the gene of the Vnukovo-32 strain viral protein G in a similar vector.

EFFECT: proposed DNA construct can be used to create an anti-rabies DNA vaccine that provides efficient glycoprotein synthesis in mammalian cells.

2 dwg

Description

FIELD OF THE INVENTION

The present invention relates to medicine, in particular immunology, and molecular biology and can be used to develop means for the prevention and treatment of viral infectious diseases.

State of the art

Timely and affordable rabies vaccination continues to be an important public health issue both in Russia and around the world. Today, a rabies vaccine (CAV) is used to prevent rabies, which is a preparation of an inactivated rabies virus grown in cell cultures or chicken embryos. Such a vaccine is immunogenic and safe, but requires the observance of strict conditions of transportation, storage (cold chain), and the mode of administration. Violation of these conditions may lead to a decrease in the effectiveness of the respective drugs. Therefore, various recombinant anti-rabies vaccines are being developed, among which an important place is given to DNA vaccines [Starodubova E.S., Preobrazhenskaya O.V., Kuzmenko Yu.V., Latanova A.A., Yarygina E.I., Karpov V. L. 2015. Rabies vaccines: current status and development prospects. Molecular Biology, 49, 1-8]. The obvious advantages of DNA vaccine preparations include fairly simple production technologies and undemanding conditions for storage and transportation, which determines their low cost.

In its simplest form, a DNA vaccine is a plasmid vector containing a pathogen protein gene and the elements necessary for transcription of this gene in mammalian cells. DNA vaccines are used to induce a protective immune response against various infections in both small animals, such as rodents, and larger animals [Powell K. 2004. DNA vaccines-back in the saddle again? Nat Biotechnol, 22, 799-801 .; Breathnach C.C., Clark H.J., Clark R.C., Olsen C.W., Townsend H.G. and Lunn D.P. 2006. Immunization with recombinant modified vaccinia Ankara (rMVA) constructs encoding the HA or NP gene protects ponies from equine influenza virus challenge. Vaccine, 24, 1180-1190 .; Bahloul C., Taieb D., Diouani MF, Ahmed SB, Chtourou Y., B'Chir B I., KTiarmachi H. and Dellagi K. 2006. Field trials of a very potent rabies DNA vaccine which induced long lasting virus neutralizing antibodies and protection in dogs in experimental conditions. Vaccine, 24, 1063-1072.]. A series of trials of prophylactic and therapeutic DNA vaccines against human pathogens such as HIV-1 and HCV [Ulmer J.B., Wahren B. and Liu Μ.Α. 2006. DNA vaccines for HIV / AIDS. Curr Opin HIV AIDS, 1, 309-313 .; Liu Z., Singh D.K., Sheffer D., Smith M.S., Dhillon S., Chebloune Y., Hegde R., Buch S. and Narayan O. 2006. Immunoprophylaxis against AIDS in macaques with a lentiviral DNA vaccine. Virology, 351, 444-454 .; Ahlen G., Soderholm J., Tjelle T., Kjeken R., Frelin L., Hoglund U., Blomberg P., Fons M., Mathiesen I. and Sallberg M. 2007. In vivo electroporation enhances the immunogenicity of hepatitis C virus nonstructural 3 / 4A DNA by increased local DNA uptake, protein expression, inflammation, and infiltration of CD3 + Τ cells. J Immunol, 179, 4741-4753.].

Anti-rabies DNA vaccines are also being developed, some of which are undergoing clinical and preclinical trials [Kaur M., Garg R., Singh S. and Bhatnagar R. 2014. Rabies vaccines: where do we stand, where are we heading ? Expert Rev Vaccines, 1-13 .; Yang D.K., Kim H.H., Lee K.W. and Song J.Y. 2013. The present and future of rabies vaccine in animals. Clin Exp Vaccine Res, 2, 19-25 .; Tuchkov I.V. and Nikiforov A.K. 2010. DNA immunization against rabies. Problems of especially dangerous infections, 104, 74-78.]. To protect the body against rabies, a necessary and sufficient condition is the presence of neutralizing antibodies to the virus glycoprotein (G-protein), so DNA vaccines are developed on the basis of a gene named for this protein. Tests show that rabies DNA vaccines induce an immune response to glycoprotein, but are not always able to provide complete protection against rabies [Ferraro B., Morrow M. P., Hutnick N. A., Shin T. N., Lucke CE. and Weiner D.B. 2011. Clinical applications of DNA vaccines: current progress. Clin Infect Dis, 53, 296-302.].

For example, it was shown that gene immunization of mice with a plasmid encoding the rabies virus Vnukovo-32 rabbit glycoprotein induces antibodies in all animals, but provides protection against the development of the disease with an efficiency of up to 90% [Fodor I., Kucsera L., Fodor Ν ., Palfi V. and Grabko VI 2000. Gene immunization of mice with plasmid DNA expressing rabies virus glycoprotein. Acta Vet Hung, 48, 229-236]. Various approaches are used to increase the effectiveness of DNA vaccines [Hutnick N.A., Myles D.J., Bian C. B., Muthumani K. and Weiner D. B. 2011. Selected approaches for increasing HIV DNA vaccine immunogenicity in vivo. Curr Opin Virol, 1, 233-240 .; Saade F. and Petrovsky Ν. 2012. Technologies for enhanced efficacy of DNA vaccines. Expert Rev Vaccines, 11, 189-209.]. One of them is based on optimizing the representation of codons in the viral gene that forms the basis of the DNA vaccine. This can significantly increase the expression of this gene in mammalian cells and increase the amount of protein-antigen synthesized from a DNA vaccine, which is an important factor in the formation of the immune response. So, it was shown in mice that DNA vaccines with optimized genes for the human papillomavirus [Cheung Y.K., Cheng S.C., Sin F.W. and Xie Y. 2004. Plasmid encoding papillomavirus Type 16 (HPV16) DNA constructed with codon optimization improved the immunogenicity against HPV infection. Vaccine, 23, 629-638], HIV-1 [Megati S., Garcia-Hand D., Cappello S., Roopchand V., Masood Α., Xu R., Luckay Α., Chong SY, Rosati M, Sackitey S. et al. 2008. Modifying the HIV-1 env gpl60 gene to improve pDNA vaccine-elicited cell-mediated immune responses. Vaccine, 26, 5083-5094], a respiratory syncytial virus [Temerte Ν., Tippler B., Uberla K. and Grunwald T. 2007. Immunogenicity and efficacy of codon optimized DNA vaccines encoding the F-protein of respiratory syncytial virus. Vaccine, 25, 7271-7279] and influenza virus [Tenbusch M., Grunwald T., Niezold T., Storcksdieck Genannt Bonsmann M., Hannaman D., Norley S. and Uberla K. 2010. Codon-optimization of the hemagglutinin gene from the novel swine origin H1N1 influenza virus has differential effects on CD4 (+) T-cell responses and immune effector mechanisms following DNA electroporation in mice. Vaccine, 28, 3273-3277] induced a significantly stronger and more effective immune response, both cellular and humoral, and also provided better protection against viruses.

Another modern and effective approach for the modification of viral antigens is to create consensus sequences of viral proteins [Obeng-Adjei Ν., Hutnick N.A., Yan J., Chu J.S., Myles D.J., Morrow M.P., Sardesai N.Y. and Weiner D.B. 2013. DNA vaccine cocktail expressing genotype A and C HBV surface and consensus core antigens generates robust cytotoxic and antibody responses in mice and Rhesus macaques. Cancer Gene Ther, 20, 652-662 .; Yan J., Villarreal D.O., Racine T., Chu J.S., Walters J.N., Morrow M.P., Khan A.S., Sardesai N.Y., Kim J.J., Kobinger G.P. et al. 2014. Protective immunity to H7N9 influenza viruses elicited by synthetic DNA vaccine. Vaccine, 32, 2833-2842; Latimer B., Toporovski R., Yan J., Pankhong P., Morrow M.P., Khan A.S., Sardesai N.Y., Welles SX., Jacobson J.M., Weiner D.B. et al. 2014. Strong HCV NS3 / 4a, NS4b, NS5a, NS5b-specific cellular immune responses induced in Rhesus macaques by a novel HCV genotype la / lb consensus DNA vaccine. Hum. Vaccin. Immunother., 10, 2357-2365]. Protein consensus is an amino acid sequence in each position of which there is an amino acid that is most often found in a selected population.

Consensus sequences are for viruses of the same subtype or for viruses circulating in a particular area. It has been shown that a single isolate HIV-1 protein vaccine is not effective against other HIV-1 isolates present in the population [Yan J., Corbitt Ν., Pankhong P., Shin T., Khan Α., Sardesai Ν.Υ. and Weiner D.B. 2011. Immunogenicity of a novel engineered HIV-1 clade With synthetic consensus-based envelope DNA vaccine. Vaccine, 29, 7173-7181]. At the same time, DNA vaccines based on antigen consensus sequences can elicit an immune response of broad specificity and significant intensity [Almeida RR, Rosa DS, Ribeiro SP, Santana VC, Kallas EG, Sidney J., Sette Α., Kalil J. and Cunha -Neto E. 2012. Broad and cross-clade CD4 + T-cell responses elicited by a DNA vaccine encoding highly conserved and promiscuous HIV-1 M-group consensus peptides. PLoS One, 7, e45267]. Using the consensus sequence of HIV-1 env protein gives a much stronger and wider activation of the immune response [Liao N.Kh., Tsao C.Y., Alam SM, Muldoon M., Vandergrift N., Ma B J., Lu X., Sutherland LL, Scearce RM, Bowman C. et al. 2013. Antigenicity and immunogenicity of transmitted / founder, consensus, and chronic envelope glycoproteins of human immunodeficiency virus type 1. J Virol, 87, 4185-4201].

To date, no consensus DNA vaccine antigens have been proposed for rabies virus. It is important to note that anti-rabies DNA vaccines are not currently being developed in the Russian Federation. You can specify only patent No. 2008355, publ. 02/28/1994, as well as the work [Fodor I., Kucsera L., Fodor Ν., Palfi V. and Grabko V.I. 2000. Gene immunization of mice with plasmid DNA expressing rabies virus glycoprotein. Acta Vet Hung, 48, 229-236], in which it was shown that gene immunization of mice with a plasmid encoding the rabies virus glycoprotein of the Vnukovo-32 strain induces antibodies in all animals, but provides protection against the development of the disease with an efficiency of up to 90%. In their work, the authors used the expression vector pWS4 and phenolic purification of plasmid DNA preparations with which mice were immunized. In the claimed invention, the rabies virus glycoprotein gene was inserted into the expression vector of the new generation pVAX1 and, when the DNA construct was purified, modern plasmid purification technologies using proprietary columns were used to eliminate endotoxins. However, the main advantage of our invention lies in the fact that the proposed DNA construct was created on the basis of an optimized antigen design - rabies virus glycoprotein (protein G). The proposed design includes the creation of a consensus amino acid sequence of the rabies virus glycoprotein and optimization of the codon representation of the nucleotide sequence of the gene encoding this protein.

Our invention is aimed at solving the problem, which consists in creating a highly effective, inexpensive and stable DNA vaccine against rabies. Since the amount of protein-antigen synthesized from the DNA vaccine and the expression of the corresponding gene in mammalian cells are important factors in the formation of the immune response, we have developed a DNA construct, verification of which in transformed human cells has demonstrated that it ensures the achievement of the required conditions. It was shown that in a human cell culture transfected with the pVAX1 vector containing the DNA construct proposed by us, 20 times more protein G is synthesized than in the control experiment.

Disclosure of invention

The present invention provides an optimized design of rabies virus glycoprotein (protein G) for use in DNA vaccines. The proposed modified glycoprotein with a consensus amino acid sequence of SEQ ID NO 1 is a territorially adapted antigen designed taking into account the amino acid sequences of the rabies virus glycoprotein registered in the territory of the Russian Federation and the Vnukovo-32 vaccine strain.

Based on the obtained consensus amino acid sequence, the nucleotide codon-optimized gene sequence of such a modified glycoprotein is compiled — the nucleotide sequence of SEQ ID NO 2. In accordance with the proposed design of the amino acid and nucleotide sequences by genetic engineering, we obtained a recombinant gene with a length of 1575 bp that was cloned into the vector pVAX1 (Invitrogen Cat. No V260-20), allowing expression of this gene in mammalian cells. Verification of the expression of the gene we obtained by assessing the level of m-RNA accumulation showed that the proposed nucleotide sequence in a transfected human cell culture provides a twofold increase in the expression of the optimized gene compared to the expression of the viral glycoprotein gene of the Vnukovo-32 strain in a similar vector. Further, when analyzing the amount of synthesized protein, it was shown that the accumulation of modified protein G is 20 times higher than the amount of the control protein, which is synthesized using a plasmid containing the viral glycoprotein gene of the Vnukovo-32 strain. Thus, the obtained modified glycoprotein with a consensus amino acid sequence is a promising protein for use as a DNA vaccine antigen, and the claimed DNA construct can be used to create rabies DNA vaccines that work effectively in the Russian Federation.

Brief Description of the Drawings

FIG. 1. Shows the relative expression level of m-RNA of glycoprotein genes from plasmids pVAX-G-vn32 and pVAX-G-cons in transfected HeLa cells.

FIG. 2. Shows the accumulation of glycoprotein variants in transfected HeLa cells. The results of immunoblotting of protein lysates of cells transfected with DNA vectors are given: pVAX1 (lane 1), pVAX-gpG-vn-32 (lane 2), pVAX-G-cons (lane 3). The arrow indicates the position of the glycoprotein, the position of the molecular weight markers is indicated on the right. As an internal control, secondary staining with antibodies to actin was performed (lower field).

The implementation of the invention

1. Compilation of the consensus amino acid sequence of the viral antigen, which is a necessary step for obtaining the antigen closest to the rabies virus strains circulating in the Russian Federation

In a number of studies, it was shown that the use of viral antigens with a consensus sequence for immunization can expand the specificity of recognition of various strains. To draw up a consensus sequence, a search was made in the Protein database (http://www.ncbi.nlm.nih.gov/protein/) of the amino acid sequences of the selected rabies virus antigen. This database is the most complete because it combines a collection of sequences from various sources, including open reading frames from annotated coding sections in the GenBank, RefSeq and TPA databases, as well as records from SwissProt, PIR, PRF and PDB databases.

As a result of the search, the following sequences were selected:

- containing full-sized antigen;

- obtained from samples registered in the Russian Federation.

126 amino acid sequences of the glycoprotein of rabies virus isolates detected in the Russian Federation were identified. The obtained sequences were exported from the database and analyzed in the BioEdit program. The sequences are aligned and the consensus amino acid sequence of SEQ ID NO 1 is constructed.

This consensus sequence was compared with the sequence of the glycoprotein of the vaccine strain Vnukovo-32, registered in GenBank: CAA50713.1. This strain is used to prepare the vaccine KOKAV. 21 amino acid substitutions were detected:

L71S, M75V, N89T, L106F, S139H, R166K, V181I, A182T, K206M, E224K, R297K, L358I, N389H, V415M, N444K, T468I, S486P, P488S, T506S, W507G,

2. Compilation of optimized codons for the representation of the nucleotide sequence of a gene encoding the consensus amino acid sequence of rabies virus antigen

Optimization of the nucleotide sequence of the gene improves the efficiency of the synthesis of glycoprotein, which leads to an increase in its accumulation in the cell and thereby allows to increase the strength of the immune response.

Gene Designer 2.0 programs and online resources / tools (Integrated DNA Technologies - http://eu.idtdna.com/CodonOpt, OPTIMIZER http: //genomes.urv.) Were used to compile a nucleotide sequence optimized for the representation of codons. es / OPTIMIZER /, EnCor Biotechnology Inc. - http://www.encorbio.com/protocols/Codon.htm, Entelechon - http://www.entelechon.com/2008/10/backtranslation-tool/). Based on the consensus amino acid sequence of the glycoprotein of rabies virus isolates circulating in the Russian Federation, using the proposed programs, a nucleotide sequence was developed that was optimized for the representation of codons - the sequence of SEQ ID NO 2.

3. Obtaining a recombinant modified glycoprotein gene (G-cons) and cloning it into the pVAX1 vector

Based on this nucleotide sequence, a recombinant gene was obtained by genetic engineering that encodes a rabies virus antigen with a consensus amino acid sequence. First, DNA fragments of 726 and 849 bp were obtained from synthetic oligonucleotides, which were then combined into a full-sized gpG-cons gene with a length of 1575 bp The gpG-cons gene was cloned into the pVAX1 vector at the BamHI EcoRI sites. The structure of the nucleotide sequence of the insertion region was confirmed by sequencing. The vector containing the proposed DNA construct was designated pVAX-G-cons, and the vector used for comparison with the gene encoding the rabies virus glycoprotein of the Vnukovo 32 strain (Rabies virus mRNA for glyoprotein G GenBank: X71879.1) is designated pVAX- G-vn32.

Standard molecular cloning methods were used, including stages such as PCR with specific primers, cloning of the obtained fragment at selected restriction sites, transformation of E. coli cells, isolation of the plasmid by alkaline lysis, and sequencing of the resulting constructs.

4. Preparative Isolation and Purification of the Plasmid

Isolation of plasmid DNA under low endotoxin conditions was performed using a number of commercially available EndoFree Plasmid Kit kits (Qiagen, USA).

5. Verification of the obtained DNA construct: expression of the obtained DNA construct in eukaryotic cells

A) HeLa cells were transfected with Lipofectamine LTX liposome preparation in combination with Plus reagent (Invitrogen, USA) in accordance with the manufacturer's recommendations.

The day before transfection, the cells were scattered on Petri dishes or plates at the rate of 3 × 10 ⁵ cells per ml of medium. So, when using a Petri dish with a diameter of 3.5 cm in 250 μl of OPTI-MEM medium (Invitrogen, USA), 3 μl of liposome reagent was dissolved. Then, a complex consisting of 1 μg of plasmid DNA and 1 μl of Plus reagent diluted in 250 μl of OPTI-MEM was added thereto. The resulting mixture was incubated for 30 min at room temperature. 500 μl of DMEM was added and applied to the cell layer, which was previously washed twice with PBS buffer. Cells were incubated in a CO ₂ incubator for 4 hours, after which the transfection mixture was replaced with complete DMEM growth medium containing 10% fetal calf serum and cell incubation was continued under standard conditions.

B) The expression of glycoprotein genes was evaluated by the level of m-RNA accumulation. HeLa cells were transfected with plasmids and after 2 days RNA was isolated from the cells using a kit (GeneJet RNA PurificationKit, ThermoSci, USA). Then cDNA was synthesized using Mint reverse transcriptase (Eurogen, Russia) and oligo-T primer (Thermo, USA). The obtained samples were analyzed by highly specific real-time PCR with the intercalating dye SYBR Green I using qPCRmixHS-SYBR reagents (Eurogen, Russia). For the G-vn32 glycoprotein gene, primers were used (top-vn32 - 5'CGATCAGAACCTACGCAACAC, bot-vn32 - 5'TTCTCACAGTCTGGTCTCACC), for the G-cons glycoprotein gene (top-cons-5'GCACCCAACACACGTTCTTGCTTC. The actin gene was used as the reference gene [Ivanov A.V., Smirnova O.A., Ivanova O.N., Masalova O.V., Kochetkov S.N. and Isaguliants M.G. 2011. Hepatitis C virus proteins activate NRF2 / ARE pathway by distinct ROS-dependent and independent mechanisms in HUH7 cells. PLoS One, 6, e24957]. The results were processed by direct comparison of data 2-ΔΔCt [Schmittgen T.D. and Livak K.J. 2008. Analyzing real-time PCR data by the comparative C (T) method. Nat Protoc, 3, 1101-1108]. The data presented in figure 1 demonstrate that the level of m-RNA expressed from the codon-optimized gene is 2 times higher than the amount of m-RNA obtained using the glycoprotein gene of the Vnukovo-32 virus vaccine strain.

C) Assessment of the level of accumulation of proteins encoded by the obtained DNA constructs.

HeLa cells were also transfected with plasmids, after 2 days, the cells were lysed and glycoproteins were determined by immunoblotting using specific antibodies. The results presented in Figure 2 show that a protein with a molecular weight of 67 kDa was detected in the lysates of transfected cells, which corresponds to the expected mass of glycosylated glycoprotein [Kaur M., Rai A. and Bhatnagar R. 2009. Rabies DNA vaccine: no impact of MHC class I and class II targeting sequences on immune response and protection against lethal challenge. Vaccine, 27, 2128-2137]. At the same time, the level of accumulation of the modified glycoprotein is 20 times higher than the glycoprotein of the vaccine strain Vnukovo-32. It should be noted that the m-RNA level of the modified glycoprotein is only 2 times higher than that of the glycoprotein of the Vnukovo-32 strain. Therefore, we can assume that such a significant increase in protein synthesis is associated with more efficient translation of m-RNA of modified glycoprotein, the gene of which was optimized for the representation of codons. Thus, we obtained a modified rabies antigen - glycoprotein, which is expressed more efficiently than the glycoprotein of the vaccine strain Vnukovo-32. Such a modified glycoprotein is a promising protein for use as a DNA vaccine antigen in the Russian Federation. It can significantly increase the effectiveness of the rabies DNA vaccine and serve as a platform for further modifications that allow changing the processing pathways of antigens.

Claims (1)

A genetic (recombinant) DNA construct represented by the nucleotide sequence of SEQ ID NO 2 containing a codon-optimized gene that encodes a rabies virus glycoprotein (protein G) with the consensus amino acid sequence of SEQ ID NO 1, based on the amino acid sequences of protein G isolated from strains of rabies virus circulating in the Russian Federation, designed to obtain rabies vaccines and used in the diagnosis of rabies.

Images