WO2001085778A1 - A new polypeptide -human tubulin folding cofactor c13 and the polynucleotide encoding it - Google Patents

Abstract

The present invention discloses a new polypeptide- human tubulin folding cofactor C13, the polynucleotide encoding it and a method producing the polypeptide by DNA recombinant technology. The present invention further discloses a method treating various disorders, e.g., malignant neoplasm, developmental disorder, cilia/villi motor behaviour disorder, inflammation, immunological disease, hemopathy, HIV infection etc. The present invention also discloses an antagonist of the polypeptide and its therapeutic action. The present invention further discloses the use of the polynucleotide encoding the new human tubulin folding cofactor C13.

Description

A new polypeptide, human tubulin folding co-factor C13, and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human tubulin folding co-factor C13, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique

 The evolution of eukaryotes is often accompanied by large changes in cell structure, and many of these processes may depend on the evolution of microtubules. Microtubules are a kind of extremely versatile protein aggregates found in the cells of all eukaryotic cells during their life cycle or development history at a certain period of time. They are unique and ubiquitous structures of eukaryotes. Microtubules have the same morphology in different cells. They are part of the cilia, flagella and other motor organs, and are also an important part of the centrosome. Its mutation or abnormal expression will lead to abnormal composition and function of various organs mentioned above, and then cause various related diseases. Therefore, the protein plays an extremely important role in the composition of individual organisms.

Microtubules are usually formed by the polymerization of alpha-tubulin, beta-tubulin, and a small amount of tubulin-binding proteins. Tubulin is the main protein that constitutes microtubules. It has two configurations of o and β. Two molecules are linked together to form a dimer. The helix is coiled and assembled into the wall of the microtubule. In many cells, microtubules are not smooth and have important physiological functions. However, tubulin must be folded to form an active spatial configuration in order to have the above-mentioned various functions. People have conducted detailed research on the tubulin folding process and found that the spatial folding process of the protein needs to be controlled by the interaction of ATP-dependent intracellular chaperone proteins and synergistic factors. Among them, there are four main synergistic factors: Synergy factor A, synergy factor D, synergy factor E, and synergy factor C. Among them, co-factor A and! ) Is mainly responsible for binding with P-tubulin to stabilize the configuration of β-tubulin; co-factor E and the co-factor D-β-tubulin complex, and promote the binding of this complex with co-factor C to ultimately catalyze Formation of a tubulin fold structure with an active conformation [Guol ing Tian, Yi Huang et al., 1996, Cel l, 86: 287-296] _{0 It} can be seen that the cofactor C plays a role in the formation of the active configuration of the protein It plays an important regulatory role, and its mutation or abnormal expression will lead to abnormal function of the protein, which is an important regulatory protein.

People have cloned a variety of tubulin folding co-factors C from a variety of eukaryotic cells, and found that these proteins have a high degree of homology in the structure, and they are involved in many different cells. This is an important physiological process. Tubulin is an important component of cell movement, cytoskeleton formation, and centriole formation, and tubulin folding co-factor c is formed in the active configuration of tubulin It plays an important regulatory role in the process. It is through regulating the configuration of various tubulins to regulate the progress of various related biological processes. The mutation or abnormal expression of this protein usually results in abnormal microtubule configuration and action, and then affects the occurrence of various intracellular physiological processes related to it. The protein is usually closely related to the development of some related disorders of developmental disorders, disorders of material metabolism, and tumors and cancers of related tissues. The protein can also be used for the diagnosis and treatment of various related diseases mentioned above.

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Bcv304 cell line, starved L02 cell line, arsenic stimulated L02 In cell lines and prostate tissues, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human tubulin folding factor C, so the functions of the two may also be similar. The present invention is named as human tubulin folding co-factor C13.

 As mentioned above, the human tubulin folding co-factor C13 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in this field. These processes of the human tubulin folding co-factor C13 protein, in particular, identify the amino acid sequence of this protein. Isolation of the novel tubulin folding co-factor C13 protein encoding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for diseases, so it is important to isolate its coding for MA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human tubulin folding co-factor C13 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human tubulin folding co-factor C13.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human tubulin folding co-factor C13.

 Another object of the present invention is to provide a method for producing human tubulin folding co-factor C13.

 Another object of the present invention is to provide an antibody against the polypeptide-human tubulin folding synergy factor C13 of the present invention.

Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the human tubulin folding cofactor C13 for the polypeptide of the present invention. Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human tubulin folding cofactor C13.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 346-702 in SEQ ID NO: 1; and (b) a sequence having 1-1581 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human tubulin folding synergist C13 protein activity, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human tubulin folding co-factor C13 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of various tumors, developmental disorders, cilia, villous dyskinesia, inflammation, immune diseases, blood diseases, HIV infection or other causes Use of Drugs for Diseases Caused by Abnormal Expression of Human Tubulin Folding Cofactor C13 .

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also be Refers to genomic or synthetic DNA or RM, which can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human tubulin folding co-factor C13, can cause changes in the protein and thereby regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human tubulin folding co-factor C13.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human tubulin folding cofactor C13 when combined with human tubulin folding cofactor C13. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human tubulin folding co-factor C13.

 "Regulation" refers to a change in the function of human tubulin folding cofactor C13, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human tubulin folding cofactor C13 Change of nature.

"Substantially pure ' ¹ means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human tubulin folding co-factor C13 using standard protein purification techniques. Basically pure human tubulin folding cofactor C13 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human tubulin folding cofactor C13 polypeptide can be analyzed by amino acid sequence. "Complementary" or "complementary" refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Cluster method divides each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or by methods known in the art such as: Totun Hein (Hein J., (1990) Methods in emzumology 183: 625-645 ).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand". "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to the epitope of human tubulin folding cofactor C13.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human tubulin folding co-factor C13" means that human tubulin folding co-factor C13 is substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify human tubulin folding co-factors using standard protein purification techniques

C13. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human microtubule protein folding cofactor C13 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human tubulin folding co-factor C13, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives, and analogs of human tubulin folding cofactor C13. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human tubulin folding co-factor C13 of the present invention. Polypeptides of the invention The fragment, derivative or analog may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may be It may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (II Ι) such a type Where the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as the leader Sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1581 bases, and its open reading frame 346-702 encodes 118 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human tubulin folding factor C, and it can be deduced that the human tubulin folding cofactor C13 has human tubulin folding factor C, the polynucleoside of the present invention The acid can be in DM form or form. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. The MA can be a coded or non-coded chain. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not Change the function of the polypeptide it encodes.

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) A denaturant was added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ico ll, 42. C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human tubulin folding cofactor C13.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human tubulin folding co-factor C13 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The MA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded MA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cMA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989). Commercially available cDM libraries are also available, such as different cDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

These genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-MA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of the transcript of human tubulin folding co-factor C13; (4) Through immunological techniques or determination of biological To detect gene expression of protein products. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of human tubulin folding co-factor C13 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA).

 A method (Sa ik i, et al. Sc ience 1985; 230: 1350-1354) using DNA technology to amplify DNA / RM is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length CDM from a library, the RACE method (RACE-cDM terminal rapid amplification method) may be preferably used, and the primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / MA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various MA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cMA sequence of multiple clones in order to splice into a full-length cMA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human tubulin folding cofactor C13 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

In the present invention, a polynucleotide sequence encoding a human tubulin folding co-factor C13 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; MSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. Express An important feature of vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods well known to those skilled in the art can be used to construct a folding factor containing human tubulin

C13 DNA sequence and expression vector with appropriate transcriptional / translational regulatory elements. These methods include in vitro recombination DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Harbor Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for MA expression, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human tubulin folding co-factor C13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

 Through the conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human tubulin folding co-factor C13 (Sc ience, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human tubulin folding cofactor C13 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time. .

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human tubulin folding co-factor C13 and human tubulin folding factor C of the present invention. The upper graph is a graph of the expression profile of human tubulin folding co-factor C13, and the lower graph is the graph of the expression profile of human tubulin folding factor C.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human tubulin folding cofactor C13. 13KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The following examples are used to indicate the specific conditions of the experimental methods, usually according to conventional conditions such as Sarabrook et al. Molecular Cloning: Laboratory Manual (New York: Co ld Spr ing Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

 Example 1: Cloning of human tubulin folding cofactor C13

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) m legs were isolated from total RNA using Quik niRNA Isolation Kit (product of Qiegene). 2ug poly (A) mRNA forms CDM by reverse transcription. A Smart cDNA cloning kit (purchased from Clontech) was used to orient the cDNA fragment into the multi-cloning site of the _P BSK (+) vector (Ciontech) to transform M5 α, and the bacteria formed a cDNA library. The sequences of the 5 'and 3' ends of all clones were determined using a Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ΑΒΑΙΙ 377 automatic sequencer (Perkin-Elmer). The determined cMA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0992d04 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that 0992d (the full-length cDNA contained in the H clone is 1581b _P (as shown in Seq ID NO: 1), from 346b _P to 702bp there is a 357b _P open reading frame (0RF), which encodes a new protein (As shown in Seq ID NO: 2). We named this clone pBS-0992d04, and named the encoded protein as human tubulin folding co-factor C13. Example 2: Cloning of human tubulin fold encoding using RT-PCR method Cofactor C13 gene

 CMA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Pr imerl: 5'- GGTTAAGTAATTTGCTTGAGGGGA -3 '(SEQ ID NO: 3)

 Pr imer2: 5'- GCAGTCCTGTCGATTTTATTTTAT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Pi-imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Conditions for the amplification reaction: 50 mmol / L KC1, 10 mmol / L Tri s-CI, (pH 8.5.5), 1.5 mmol / L MgCl ₂ , 200 μιηοΙ / L dNTP, lOpmol in a reaction volume of 50 μ1 Primer, 1U of Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1581bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human tubulin folding co-factor C13 gene expression: Total RM extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a MA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human tubulin folding co-factor C13 coding region sequence (346bp to 702bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which MA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 x SSC-5 Denhardt's solution and 200 μg / ml salmon sperm MA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human tubulin folding co-factor C13

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer 3: 5'- CCCCATATGATGCCGAGGGTGAGGAGAGGGCAG -3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTCAGGCCTTATGATCCTCCTCAGG -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the selection on the expression vector plasmid _P ET-28b (+) (Novagen, Cat. No. 69865.3) Sex endonuclease site. The PCR reaction was performed using pBS-0992d04 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0992d04 plasmid, | ¾ Primer-3 Primer-4; ^^! ^ 10: pinol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles in total. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5cc using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0992d04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 30μ _§ / ηι1) in LB liquid medium, host strain BL21 _(P ET-0992d04) at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 ol / L, and continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (Novagen) was used to bind 6 histidines (6His-Tag). The company's product) was chromatographed to obtain the purified human tubulin folding co-factor C13. After SDS-PAGE electrophoresis, a single band was obtained at 13 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of Anti-Human Tubulin Folding Cofactor C13 Antibody

 The following human tubulin folding synergy factor C13 specific

NH2-Met-Pro-Arg-Val-Arg-Arg-Gly-Gln-Glu-Thr-Thr-Asp-Ser-Val-Leu-C00H (SEQ ID NO: 7). The polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avraiiieas, et al. Immunocheinistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Se _P ha _rose 4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human tubulin folding co-factor C13. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 The suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the polymer formed. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to enable hybridization. The scene is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGCCGAGGGTGAGGAGAGGGCAGGAGACCACTGACAGCGTG -3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'- TGCCGAGGGTGAGGAGAGGGCAGGAGACCACTGACAGCGTG -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as the "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

1.Extract DM from fresh or frozen tissue

 Steps: 1) Put fresh or freshly thawed normal liver tissue into ice and hold phosphate buffer solution

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1000 g for 10 minutes. 3) Use cold homogenization buffer (0. 25mo l / L sucrose; 25 draw 1 / L Tris-HCl, pH 7.5; 25 legs ol / LnaCl; 25 mmol / L MgCl ₂ ) suspended pellet (approximately 10 ml / g). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, phenol extraction method for DNA

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells (1 × ^{10 8} cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight.

6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. MA was then purified and ethanol precipitated.

3.Purification and ethanol precipitation of DM

 Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. At -20. C Leave for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol.

4) Wash the pellet with 500ul of 70 ° / »cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper, and gradually increase TE, mix until DM is fully dissolved, and add approximately 1 ul for each 1- 5x10 ^hand cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / mU at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1710 volumes of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well- ² ° C for 1 hour. I ³ ) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid, the process is the same as steps 3-6. 14) A _26Q and A _{28ΰ were measured} to check the purity and yield of DNA. 15) Store at -20 after packing. C. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Filter paper for 5 minutes (twice) and dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi _Y - ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (moni tor can be used for monitoring).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After the collection solution of the first peak is combined, the probe is prepared (the second peak is free γ- ^32P -dATP).

 Pre-hybridization

 Place the sample membrane in a plastic bag, add 3-10 mg of pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM).), Seal the bag, and seal at 68 ° C. Shake for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the sample membrane of hybridization.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70. C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Hel le, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a sloped glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μ ηι. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spotting processing steps of this embodiment are:

1. Hydration in a humid environment for 4 hours; 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

 7. dd 0 flush twice;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen). ] Fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRM of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino -propargyl- 2'- deoxyur idine 5'-triphate cou led to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, and purified probes were prepared. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Pro Nat l. Acad. Sci. USA. Vol. 93: 10614-

10619. Schena, M., Shalon, Dar i., Davis, R. f. (1995) Science. 270. (20): 467-480.

(Three) cross

 Combine the probes from the two tissues with the chips at UniHyb ™ Hybr idizat ion

Hybridization was performed in a Solut ion (purchased from TeleCheni) hybridization solution for 16 hours. After washing at room temperature with a washing solution (1> SSC, 0.2¾SDS), scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). Imagene software (Biodiscovery, USA) was used for data analysis and processing to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, a bar graph is drawn. (figure 1 ) . It can be seen from the figure that the expression profile of human tubulin folding co-factor C13 and human tubulin protein folding factor C according to the present invention are very similar. Industrial applicability

The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, For example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 As a cytoskeleton in eukaryotic cells, microtubules are an important part of the centrosome and regulate the normal progress of mitosis and amitosis in cells. Microtubules are also essential for endoplasmic reticulum and Golgi apparatus for protein transport channels; microtubules Essential for cilia and villi movement.

 Microtubule synergy factor C and other synergistic factors help microtubules fold to form an active spatial configuration and have microtubule functions. Cofactor C plays an important regulatory role in the formation of tubulin's active configuration, and its mutation or abnormal expression will cause tubulin to malfunction.

 Tubulin is an important component of cell movement, cytoskeleton formation, and centriole formation, and tubulin folding co-factor C plays an important regulatory role in the formation of the tubulin active configuration. It is through regulating the configuration of various tubulins to regulate the progress of various biological processes associated with it. The mutation or abnormal expression of this protein usually results in abnormal microtubule configuration and action, which in turn affects the occurrence of various intracellular physiological processes associated with it. This protein is usually closely related to the development of some related disorders of developmental disorders, disorders of material metabolism, and tumors and cancers of related tissues. The protein can also be used for the diagnosis and treatment of various related diseases mentioned above.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human tubulin folding co-factor c, and the two have similar biological functions. It helps the microtubules to fold to form an active spatial configuration in the cell, and then exerts various biological functions of tubulin. Its abnormal expression is usually closely related to abnormalities in embryonic development, cell differentiation, cilia, villous motor tumors, and other related diseases.

 It can be seen that the abnormal expression of the human tubulin folding cofactor C13 of the present invention will produce various diseases, especially various tumors, developmental disorders, cilia, villous dyskinesia, inflammation, and immune diseases. These diseases include But not limited to:

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, myofioma, neuroblastoma, astrocytoma, ependymoma, glial cells Tumor, Neurofibromatosis, Colon Cancer, Melanoma, Bladder Cancer, Uterine Cancer, Endometrial Cancer, Colon Cancer, Nasopharyngeal Cancer, Laryngeal Cancer, Tracheal Tumor

 Developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, mental retardation, brain development disorder, Skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing syndrome, sexual retardation

Ciliary and villous dyskinesias: chronic bronchitis, pneumonia, intestinal dyspepsia inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebral spinal cord Multiple sclerosis, Glomerulonephritis, Myocarditis, Cardiomyopathy, Atherosclerosis, Gastric ulcer, Cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 The abnormal expression of the human tubulin folding co-factor C13 of the present invention will also produce certain hereditary, hematological diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, developmental disorders, cilia, villous dyskinesia, inflammation, Immune diseases, certain hereditary, blood diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human microtubule protein folding co-factor C13. Agonists enhance human tubulin folding co-factor C13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing human tubulin folding cofactor C13 can be cultured together with a labeled human tubulin folding cofactor C13 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human tubulin folding co-factor C13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human tubulin folding cofactor C13 can bind to human tubulin folding cofactor C13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

 When screening compounds as antagonists, human tubulin folding co-factor C13 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human tubulin folding co-factor C13 and its receptor Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human tubulin folding co-factor C13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human tubulin folding co-factor C13 molecule should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human tubulin folding cofactor C13 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and Fab expression Library-generated snippets.

Polyclonal antibodies can be produced by injecting human tubulin folding cofactor C13 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to human tubulin folding cofactor C13 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human tubulin folding co-factor C13.

 Antibodies against human tubulin folding cofactor C13 can be used in immunohistochemical techniques to detect human tubulin folding cofactor C13 in biopsy specimens.

Monoclonal antibodies that bind to human tubulin folding co-factor C13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. Such radiolabeled antibody may be used as a non-invasive diagnostic methods for locating tumor cells and the determination whether there is transfer ₃ off.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human tubulin folding co-factor C13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human tubulin folding synergy factor C13 Cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to human tubulin folding co-factor C13. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human tubulin folding cofactor C13.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human tubulin folding co-factor C13. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human tubulin folding cofactor C13 detected in the test can be used to explain the importance of human tubulin folding cofactor C13 in various diseases and to diagnose the role of human tubulin folding cofactor C13. disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding human tubulin folding cofactor C13 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat non-expression or abnormality / inactivity due to human tubulin folding cofactor C13 Sexual expression caused by abnormal cell proliferation, development, or metabolism. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human tubulin folding cofactor C13 to inhibit endogenous human tubulin folding cofactor C13 activity. For example, a variant human tubulin folding co-factor C13 may be a shortened human tubulin folding co-factor C13, which lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human tubulin folding cofactor C13. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human tubulin folding co-factor C13 into a cell. The method of constructing a polynucleotide encoding a recombinant viral vector carrying the human tubulin folding cofactor C13 can be found in existing literature _{(Sambrook, e ta l.)} . In addition, a recombinant polynucleotide encoding human tubulin folding cofactor C13 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human tubulin folding cofactor C13 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DM sequence has been integrated downstream of the vector's MA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human tubulin folding cofactor C13 can be used for the diagnosis of diseases related to human tubulin folding cofactor C13. The polynucleotide encoding human tubulin folding cofactor C13 can be used to detect the expression of human tubulin folding cofactor C13 or the abnormal expression of human tubulin folding cofactor C13 in a disease state. For example, the DM sequence encoding human tubulin folding cofactor C13 can be used to hybridize biopsy specimens to determine the expression status of human tubulin folding cofactor C13. Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Employing microtubules Protein folding co-factor C13 specific primers can also be used to detect the transcription products of human tubulin folding co-factor C13 by RM-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of mutations in the human tubulin folding cofactor C13 gene can also be used to diagnose human tubulin folding cofactor C13-related diseases. Human tubulin folding co-factor C13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human tubulin folding co-factor C13 MA sequence. Mutations can be detected using well-known techniques such as Southern blotting, MA sequence analysis, PC, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern imprinting method and Western blotting method can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c library.

 Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human tubulin folding co-factor C1 3 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human tubulin folding co-factor C13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Profit

1. An isolated polypeptide-human tubulin folding co-factor C13, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID Ν (2, or an active fragment, analog, or derivative of a polypeptide thereof .

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 346-702 in SEQ ID NO: 1 or the sequence of positions 1-1581 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human tubulin folding co-factor C13 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human tubulin folding co-factor C13;

 (b) Isolating a polypeptide having human tubulin folding cofactor C13 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human tubulin folding co-factor C13.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human tubulin folding co-factor C13.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1. '

13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human tubulin folding co-factor C13 in vitro and in vivo.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human tubulin folding cofactor C13; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormal human tubulin folding cofactor C13.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.