WO2001083679A2 - A novel polypeptide- central cannabinoid recptor 9 and the polynucleotide encoding said polypeptide - Google Patents
A novel polypeptide- central cannabinoid recptor 9 and the polynucleotide encoding said polypeptide Download PDFInfo
- Publication number
- WO2001083679A2 WO2001083679A2 PCT/CN2001/000630 CN0100630W WO0183679A2 WO 2001083679 A2 WO2001083679 A2 WO 2001083679A2 CN 0100630 W CN0100630 W CN 0100630W WO 0183679 A2 WO0183679 A2 WO 0183679A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- central
- cannabis
- receptor
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, the central cannabis receptor 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Cannabis major pharmacologically active ingredient is a stimulant one endogenous ⁇ 9 tetrahydrocannabinol a, cannabinoid receptor present in the cell membrane of some of the tissue can bind specifically cannabis-related components, the cells respond To generate excitement.
- Partial cDNA sequences encoding cannabis receptors have been obtained from mouse and human brain tissues (Mat suda, LA, Lola it, et al., 1990).
- the human cannabis receptor protein contains 472 amino acid residues, of which 7 highly hydrophobic regions are combined, which belongs to the more typical G protein coupled receptor superfamily.
- CB1 The main component of the cannabis receptor is CB1, which mediates the inhibition of pertussis toxin-sensitive GTP-binding regulatory protein-dependent adenylase and the inhibition of N-type Ca ion channels (Mackie, K., and Hi l le, B., 1992).
- CB1 and its mRNA are mostly found in the brain, and also detected in peripheral tissues by PCR.
- the full-length mature coding region can be translated into a shortened, terminal amino-modified form of CB1 and named it CB1A.
- An antagonist drug SR 141716A can specifically bind to the central cannabis receptor with a high degree of affinity.
- the main difference in the structure of the central cannabis receptor lies in its long end region located outside the cell, which can be selectively cleaved to produce differently structured receptors.
- CB1 mRNA in the amino-terminal coding region.
- a huge intron was found upstream of the start codon of the gene in humans, with a length of at least 1.8 Kb.
- small non-peptide molecules have small amino-terminal regions and ligand-binding sites, and are composed of pocket structures formed by seven-helical transmembrane regions (Fr iel le, T., Daniel, K.., Et a l ., 1988). All known cannabinols, including endogenous ligands, are small peptide-free molecules.
- cannabinols including endogenous ligands, are small peptide-free molecules.
- the modified CB1A and CB1 have some ligand-binding properties. different. There are three protein glycosylation sites in CB1, but CB1A is missing due to different junctions Got two of them. Studies have found that protein glycosylation plays a very important role in guiding signal transduction and subcellular distribution.
- the central cannabis receptor 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these processes Central cannabis receptor 9 protein, especially the amino acid sequence of this protein is identified.
- the isolation of the new central cannabis receptor 9 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a central cannabis receptor 9.
- Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding a central cannabis receptor 9.
- Another object of the present invention is to provide a method for producing a central cannabis receptor 9.
- Another object of the present invention is to provide an antibody directed against the central cannabis receptor 9 of the polypeptide of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, the central cannabis receptor 9.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 111-353 in SEQ ID NO: 1; and (b) a sequence having 1-1344 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the central cannabis receptor 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of a central cannabis receptor 9 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample.
- the amount or biological activity of a polypeptide of the invention comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of neuropsychiatric disorders, developmental disorders, tumors or occupying lesions of the nervous system, immune diseases, inflammation, HIV infection, etc., especially
- the utility model is used for treating mental disorders caused by psychoactive drugs or other diseases caused by abnormal expression of central cannabis receptor 9.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the central cannabis receptor 9 and the central cannabis receptor of the present invention.
- the upper graph is a graph of the central cannabis receptor 9 expression profile
- the lower graph is the central hemp receptor's expression profile.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates test
- Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated central hemp receptor 9.
- 9KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to natural, recombinant or synthetic proteins and fragments thereof in suitable The ability to induce a specific immune response in an animal or cell and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when bound to the central cannabis receptor 9, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the central cannabis receptor 9.
- Antagonist refers to a molecule that can block or modulate the biological or immunological activity of central cannabis receptor 9 when bound to central cannabis receptor 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the central cannabis receptor 9.
- Regular refers to a change in the function of central cannabis receptor 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of central cannabis receptor 9.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify the central cannabis receptor 9 using standard protein purification techniques. Basically pure The central cannabis receptor 9 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the central cannabis receptor 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues that match between sequences
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of central hemp receptor 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated central cannabis receptor 9 means that central cannabis receptor 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify the central cannabis receptor 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the central cannabis receptor 9 polypeptide can be analyzed by amino acid sequence. The present invention provides a new polypeptide, the central cannabis receptor 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the central cannabis receptor 9.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the central cannabis receptor 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1344 bases in length and its open reading frames 111-353 encode 80 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile as the central cannabis receptor, and it can be inferred that the central cannabis receptor 9 has a similar function as the central cannabis receptor.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° / »Fi co ll, 42 ° C, etc .; or (3) only in two sequences Crosses occur only when the identity between them is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding central cannabis receptors 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the central cannabis receptor 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate raRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Q i agene There are many mature techniques for extracting mRM, and kits are also commercially available (Q i agene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the transcript of the central cannabis receptor 9; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the central cannabis receptor 9 gene.
- ELISA enzyme-linked immunosorbent assay
- a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequences of multiple clones in order to splice into full-length cDM sequences.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using the central cannabis receptor 9 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding the central cannabis receptor 9 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7-based, expressed in bacteria Promoter expression vector (Rosenberg, et al.
- pMSXND expression vector expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and in insect cells Expression of a baculovirus-derived vector.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a central cannabis receptor 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a central cannabis receptor 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- Competent cells that absorb DNA can be harvested after the exponential growth phase and treated with the 01 2 method.
- the steps used are well known in the art.
- MgCl 2 is used.
- transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant central cannabis receptor 9 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Cannabis has a wide range of effects on the central nervous system.
- the cannabis component receptor and its endogenous ligands constitute a system that regulates certain specific brain functions, such as brain injury, motion control, memory and neuroendocrine control, etc. Recently, it has been found that this system is still in the brain Plays a role in development.
- the central cannabis component receptor CB1 mediates the inhibitory effect of adenylate cyclase and the N-type calcium ion channel, and also mediates the activation of extracellular signal-regulated kinases. CB1 activation inhibits the release of synaptic transmitters in the rat hippocampus. CB1 is mainly found in the brain, but is also found in peripheral tissues such as testes, spleen, and white blood cells. Most motor dysfunction and motor dysfunction are caused by dysfunction of the basal ganglia-thalamus-cortex pathway. Because the endocannabinoid component plays a role in controlling exercise, the central cannabis component receptor system may play a role in the occurrence of these diseases. Now There is evidence that cannabis is effective in the treatment of Touret te syndrome, Parkinson's disease, Alzheimer's disease, obsessive-compulsive behavior disorder, tremor and dystonia.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human central hemp component receptor CB1, both of which have similar biological functions. It mainly mediates the pharmacological activity of cannabis in the body, especially in the central nervous tissue, which is important for the regulation of neurotransmitters. In addition, it is also important for the regulation of the body's immune system and for the regulation of growth and development. Its abnormal expression is closely related to the occurrence of pathological processes of the above-mentioned tissue systems, and causes related diseases.
- the abnormal expression of the central cannabis receptor 9 of the present invention will produce various diseases, especially neuropsychiatric diseases, immune diseases, developmental disorders, inflammation, and various tumors. These diseases include, but are not limited to:
- Neuropsychiatric disorders Tourette's disease, Alzheimer's disease, Parkinson's disease, obsessive-compulsive disorder, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, multiple sclerosis, Schizophrenia, depression, neurasthenia, neuromuscular disease, neurocutaneous syndrome, trigeminal neuralgia, facial paralysis
- Developmental disorders neural tube insufficiency, brain developmental abnormalities, neuronal migration disorders, congenital abortion, cleft palate, limb absentness, limb differentiation disorders, atrial septal defect, neural tube defects, congenital hydrocephalus, mental retardation, Brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, sexual retardation
- Tumors or occupying lesions of the nervous system Tumors or occupying lesions of the nervous system: neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibromatosis, intracranial granuloma
- Immune diseases Guillain-Barre syndrome, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, myasthenia gravis, common variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, acquired immunity Defect Syndrome
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal spinal multiple sclerosis, glomerulonephritis, 'myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis Certain infectious inflammation
- Abnormal expression of the central cannabis receptor 9 of the present invention may also cause certain genetic diseases and the like.
- the polypeptide of the present invention can be directly used in the treatment of diseases, for example, it can treat various diseases, especially neuropsychiatric disorders, tumors or occupying lesions of the nervous system, and development disorders. Disease, immune disease, inflammation, certain hereditary diseases, etc.
- the polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides can be directly used for the treatment of mental disorders caused by psychoactive drugs.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) central cannabis receptors 9.
- Agonists enhance biological functions such as central cannabis receptor 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane formulations expressing central cannabis receptor 9 can be cultured with labeled central cannabis receptor 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of central cannabis receptor 9 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of central cannabis receptor 9 can bind to central cannabis receptor 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- central cannabis receptor 9 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between central cannabis receptor 9 and its receptor.
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to the central cannabis receptor 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the central cannabis receptor 9 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a central cannabis receptor 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting central cannabis receptor 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to central cannabis receptor 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against the central cannabis receptor 9.
- Antibodies to central cannabis receptor 9 can be used in immunohistochemistry to detect central cannabis receptor 9 in biopsy specimens.
- Monoclonal antibodies that bind to central cannabis receptor 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis. ' Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, a high-affinity monoclonal antibody to the central cannabis receptor 9 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill central cannabis receptor 9 positive cells. .
- the antibodies in the present invention can be used to treat or prevent diseases related to the central cannabis receptor 9.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of central cannabis receptors 9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of central cannabis receptor 9 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. Central cannabis receptor 9 levels detected in the test can be used to explain the importance of central cannabis receptor 9 in various diseases and to diagnose diseases in which central cannabis receptor 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding the central cannabis receptor 9 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of central cannabis receptor 9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated central cannabis receptor 9 to inhibit endogenous central cannabis receptor 9 activity.
- a variant central cannabis receptor 9 may be a shortened central cannabis receptor 9 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of central cannabis receptor 9.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding the central cannabis receptor 9 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a central cannabis receptor 9 can be found in the existing literature (Sambrook, et al.).
- the polynucleotide encoding the central cannabis receptor 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit the central cannabis receptor 9 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target R to perform endonucleation.
- Antisense RM and DM and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramide chemistry The technology of synthesizing oligonucleotides has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the R polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- Polynucleotides encoding central cannabis receptor 9 can be used to diagnose diseases related to central cannabis receptor 9. Polynucleotides encoding central cannabis receptor 9 can be used to detect the expression of central cannabis receptor 9 or abnormal expression of central cannabis receptor 9 in disease states. For example, the DNA sequence encoding central cannabis receptor 9 can be used to hybridize biopsy specimens to determine the expression of central cannabis receptor 9. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Central cannabis receptor 9 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the transcription of central cannabis receptor 9.
- Central cannabis receptor 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type central cannabis receptor 9 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing human genes corresponding to the primers will produce increased fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cMA libraries.
- Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Central cannabis receptor 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of central cannabis receptors 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total RM of human fetal brain was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech) was used to insert the cMA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Pr imer 1 5,-GATTTTATGCTTTATAATGCATGA -3 '(SEQ ID NO: 3)
- Primer 2 5'- AAATTAAATATATACTTGTATTCA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions 50ramol / L KCl, 10mmol / L Tri s-HCl pH8.5, 1.5 leg ol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, . 1U Taq DNA polymerase (Clontech Co.) on the PE9600 DNA thermal cycler (Perkin-Elmer Co.) by the reaction of 25 cycles of the following conditions: 94 ° C 30sec; 55.C 30sec ; 72 ° C 2min 0 in During RT-PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
- the amplified product was purified using a QIAGEN kit, and the TA cloning kit was used to connect to a pCR vector (Invitrogen).
- DNA Sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1344 bp shown in SEQ ID NO: 1.
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159].
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water. , (H7.
- Primer 3 5'- CATGCTAGCATGTTTATGTTCTTTAAGATGTAT -3, (Seq ID No: 5)
- Pr iraer4 5'- CATGGATCCTCAAGTGATGGAGTTGCTGTTAGT -3, (Seq ID No: 6)
- Nhel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR was performed using the PBS-0428a07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0428a07 plasmid, Primer-3 and Primer-4 were included in a total volume of 50 ⁇ 1; lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
- coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0428a07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- NH2-Met-Phe-Met-Phe-Phe-Phe-Lys-Met-Tyr-I le-Arg-Thr-Tyr-Leu-Ser-Cys-C00H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunocheraistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the i-cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
- the peptide was bound to a cyanogen bromide-activated Sepha rOS e 4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
- the immunoprecipitation method showed that the purified antibody could specifically bind to the central cannabis receptor 9.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps. This embodiment makes use of higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to enable hybridization
- the background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- cold homogenization buffer (0.25 mol / L sucrose; 25 capsules 1 / L Tris-HCl, pH 7.5; 25 mraol / L NaCl; 25 mmol / L MgCl 2 ).
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT MA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT MA (calf thymus DNA)
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
- the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, refer to the literature DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DMs, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified by Ol igotex mRNA Midi Ki t (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5> -triphate coupled to Cy3 fluorescent dye, purchased: from Araersham Phamacia Biotech) was used to label mRM of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
- Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5> -triphate coupled to Cy3 fluorescent dye, purchased: from Araersham P
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Bcv304 cell line, PMA-Ecv304 cell line, and non-starved L02 cell line , L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart.
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU77438/01A AU7743801A (en) | 2000-04-29 | 2001-04-28 | A novel polypeptide, a hman central receptor of cannabinoide 9 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115571 CN1321648A (en) | 2000-04-29 | 2000-04-29 | Novel polypeptide-central cannabis receptor 9 and polynucleotide for coding this polypeptide |
CN00115571.7 | 2000-04-29 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001083679A2 true WO2001083679A2 (en) | 2001-11-08 |
WO2001083679A3 WO2001083679A3 (en) | 2002-04-04 |
Family
ID=4585017
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000630 WO2001083679A2 (en) | 2000-04-29 | 2001-04-28 | A novel polypeptide- central cannabinoid recptor 9 and the polynucleotide encoding said polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1321648A (en) |
AU (1) | AU7743801A (en) |
WO (1) | WO2001083679A2 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2090658A3 (en) * | 2006-06-13 | 2009-11-11 | Agrinomics, LLC | Generation of plants with improved pathogen resistance |
-
2000
- 2000-04-29 CN CN 00115571 patent/CN1321648A/en active Pending
-
2001
- 2001-04-28 WO PCT/CN2001/000630 patent/WO2001083679A2/en active Application Filing
- 2001-04-28 AU AU77438/01A patent/AU7743801A/en not_active Abandoned
Non-Patent Citations (2)
Title |
---|
DATABASE PROTEIN [Online] 03 April 1998 PAGE G.S. AND HALL B.D. Retrieved from NCBI, accession no. GI:456155 Database accession no. (AAC09508.1) * |
DATABASE PROTEIN [Online] 08 February 1999 TANAKA T. ET AL. Retrieved from NCBI, accession no. GI:3258324 Database accession no. (BAA31007.1) * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2090658A3 (en) * | 2006-06-13 | 2009-11-11 | Agrinomics, LLC | Generation of plants with improved pathogen resistance |
US8222485B2 (en) | 2006-06-13 | 2012-07-17 | Agrinomics Llc | Generation of plants with improved pathogen resistance |
Also Published As
Publication number | Publication date |
---|---|
AU7743801A (en) | 2001-11-12 |
CN1321648A (en) | 2001-11-14 |
WO2001083679A3 (en) | 2002-04-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001083679A2 (en) | A novel polypeptide- central cannabinoid recptor 9 and the polynucleotide encoding said polypeptide | |
WO2001092514A1 (en) | A novel polypeptide-human interleukin-13 (il-13) receptor 11 and the polynucleotide encoding said polypeptide | |
WO2001074888A1 (en) | A novel polypeptide-human beta-preprotachykinin 9 and a polynucleotide encoding the same | |
WO2001070964A1 (en) | A novel polypeptide, a human glucose transport like protein 18 and the polynucleotide encoding the polypeptide | |
WO2001068873A1 (en) | Novel polypeptide---a human linker adhesion molecule 12 and polynucleotide encoding it | |
WO2001064719A1 (en) | A novel polypeptide-homo negative regulator 21 of programmed cell death and polynucleotide encoding said polypeptide | |
WO2001087954A1 (en) | A novel polypeptide, a human clathrin light chain 9 and the polynucleotide encoding the polypeptide | |
WO2001092286A1 (en) | A novel peptide---human octamer binding protein 48 and the polynucleotide coding this novel peptide | |
WO2001049727A1 (en) | A novel polypeptide-bacteria chemotactic signal transducer 9 and the polynucleotide encoding said polypeptide | |
WO2001083688A2 (en) | A novel polypeptide, a human subunit 13 phosphatidylinositol-4-phosphate-5-kinase ii beta and the polynucleotide encoding the polypeptide | |
WO2001088158A1 (en) | A novel polypeptide- human triose-phosphate isomerase 10 and the polynucleotide encoding said polypeptide | |
WO2002000712A1 (en) | A novel polyptide, a human central cannabinoid receptor 22 and the polynucleotide encoding the polypeptide | |
WO2001068693A1 (en) | A novel polypeptide, human cannabinoid receptor protein 7 and the polynucleotide encoding thereof | |
WO2001066726A1 (en) | A novel polypeptide, a human excitatory amino acids transporter 17 and the polynucleotide encoding the polypeptide | |
WO2001096386A1 (en) | A novel polypeptide - human neuropeptide y protein 9 and a polynucleotide encoding the same | |
WO2001070802A1 (en) | A novel polypeptide, zinc finger protein 11 and the polynucleotide encoding thereof | |
WO2001068838A1 (en) | A novel polypeptide, a human excitatory amino acids transporter 16 and the polynucleotide encoding the polypeptide | |
WO2001087950A1 (en) | A novel polypeptide -human cannabinoid receptor 11 and the polynucleotide encoding said polypeptide | |
WO2001079491A1 (en) | A novel polypeptide-human chloride channel protein 12 and the polynucleotide encoding said polypeptide | |
WO2001074997A2 (en) | Novel polypeptide - a human cannabis alcohol receptor protein 11 and polynucleotide encoding it | |
WO2001079439A2 (en) | A novel polypeptide, a human cannabinoid receptor protein 19 and the polynucleotide encoding the polypeptide | |
WO2001074887A1 (en) | A novel polypeptide - human humsian protein 9 and a polynucleotide encoding the same | |
WO2002006473A1 (en) | A novel polypeptide, a human estrogen receptor relative protein 10.01 and the polynucleotide encoding the polypeptide | |
WO2001088154A1 (en) | Microglobulin transcription human regulation factor 17 | |
WO2001073012A1 (en) | A novel polypeptide, a human zinc finger protein 36 and the polynucleotide encoding the polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |