WO2001083542A1 - A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide - Google Patents
A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide Download PDFInfo
- Publication number
- WO2001083542A1 WO2001083542A1 PCT/CN2001/000673 CN0100673W WO0183542A1 WO 2001083542 A1 WO2001083542 A1 WO 2001083542A1 CN 0100673 W CN0100673 W CN 0100673W WO 0183542 A1 WO0183542 A1 WO 0183542A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- polynucleotide
- human
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide- ⁇ ⁇
- the invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background
- tumor suppressor genes act as a negative regulator in the body to regulate the normal growth of cells and inhibit tumorigenesis of related tissues. Their deletion or inactivation will cause uncontrolled cell proliferation and canceration.
- tumor suppressor genes have been cloned, such as P53 DCC NF1 NF2 WT-1 MTS1 and so on.
- P53 protein plays an important role in the regulation of the cell growth cycle. It regulates cell proliferation and growth by regulating the transcription and expression of a variety of downstream proteins.
- CDK inhibitors that inhibit the cyclin kinase activity in the body. These CDK inhibitors also regulate cell proliferation and differentiation during the cell cycle of living organisms. Many people have cloned CDK inhibitors from different sources, such as P21 P27 P16 P15 in mammals, and studied the function of these proteins. These proteins all act as negative regulators of cell growth, and they not only play an important regulatory role in cell proliferation and differentiation, but their deletions or mutations are also closely related to processes such as cell canceration. Studies have found that mutations or abnormal expression of these genes are closely related to the occurrence of lung cancer, ovarian cancer, kidney cancer and other malignant tumors and cancers in vivo. These proteins work in concert with cell cycle-dependent protein kinases, oncogenes, etc., and maintain the normal functioning of the cell cycle and the normal progression of cell proliferation.
- the P18 protein is similar to mammalian P21, P27, P16 and other proteins.
- As a negative cell growth regulator in vivo it regulates cell proliferation and differentiation in vivo.
- the mutation or abnormal expression of this protein is usually closely related to the occurrence of various blood system malignant diseases such as leukemia, breast cancer and related immune disorders in the body.
- the protein can also be used for the diagnosis and treatment of various related diseases mentioned above. .
- the human P18 protein 21 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more people involved in these processes P18 protein 21 protein, especially the amino acid sequence of this protein. Isolation of the newcomer P18 protein 21 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding 'DM. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human P18 protein 21.
- Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding human P18 protein 21.
- Another object of the present invention is to provide a method for producing human P18 protein 21.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human P18 protein 21.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human P18 protein 21.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human P18 protein 21. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: '
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 531-3117 in SEQ ID NO: 1; and (b) a sequence having 1-1326 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human P18 protein 21 protein, which comprises using the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human P18 protein 21 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a mutation in a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of blood diseases, various tumors, developmental disorders, inflammation, immune diseases, HIV infection or other diseases caused by abnormal expression of human P18 protein 21. Use of drugs.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human P18 protein 21 and human P18 protein of the present invention.
- the upper graph is a graph of the expression profile of human P18 protein 21, and the lower graph is the graph of the expression profile of human P18 protein.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means sacral gland
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 means prostate
- 21 means fetal heart
- 22 means heart
- 23 means muscle
- 24 means testis
- 25 means fetal thymus
- 26 means thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human P18 protein 21 isolated.
- 21KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- Deletion refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- Antagonist refers to a protein that, when bound to human P18 protein 21, causes a change in the protein and Molecules that regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human P18 protein 21.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human P18 protein 21 when combined with human P18 protein 21.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human P18 protein 21.
- Regular refers to a change in the function of human protein 21, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human P18 protein 21.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human P18 protein 21 using standard protein purification techniques. Essentially pure human P18 protein 21 produces a single main band on a non-reducing polyacrylamide gel. The purity of human P18 protein 21 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences (Higg ins, D. G. and
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymo logy 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to 21 human P18 protein antigen determinant.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity. .
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human P18 protein 21 means that human P18 protein 21 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human P18 protein 21 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the human P18 protein 21 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide ⁇ ⁇ 18 protein 21, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. Choose a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human P18 protein 21.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human P18 protein 21 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues' are conservatively or non-conservatively substituted.
- Amino acid residues are substituted, And the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ) A type in which the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide Sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
- another compound such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol
- IV a type in which the additional amino acid sequence is fused into the mature polypeptide Sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1326 bases, and its open reading frame 533-1117 encodes 194 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human P18 protein, and it can be deduced that the human P18 protein 21 has similar functions to human P18 protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDM, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- the "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SBQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the ability of the polypeptide it encodes. .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, or (2) addition during hybridization Denaturing agent, such as 50% (v / v) formamide, 0, 1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only the identity between the two sequences is at least Above 95%, more preferably above 97 »/», crosses occur.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SBQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human P18 protein 21.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human P18 protein 21 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of the D sequence is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries such as different cDNAs from Clontech library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (D DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human P18 protein 21 transcripts; (4) immunity Technology or measuring biological activity to detect protein products expressed by genes. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 'nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the human P18 protein 21 gene can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method for amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / MA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 546 3- 5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human P18 protein 21 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding the human P18 protein 21 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding human P18 protein 21 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Coll Spring Harbor Labora tory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human P18 protein 21 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM may be in exponential growth phase were harvested after treatment with ⁇ 1 2 method used in the step are well known in the art. Alternatively, MgCl 2 is used.
- transformation can also be performed by electroporation Method.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human P18 protein 21 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- CDK inhibitors are all negative regulators of cell growth. They not only play an important regulatory role in cell proliferation and differentiation, but their deletions or mutations are also closely related to cell canceration and other processes.
- P18 protein is a newly discovered CDK inhibitor. It is highly expressed in white blood cell lines. P18 protein regulates the transcription and expression of related genes by inhibiting the activity of cell cycle-dependent protein kinases such as CDK4 and CDK6 in the body. Studies have found that the protein is a new member of the proto-oncogene family of the human genome, Its mutation or abnormal expression will lead to abnormal proliferation of related tissues and cells, which is usually closely related to the occurrence of blood system malignancies such as leukemia and cancer, and also related to the occurrence of immune disorders.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human P18 protein, and both have similar biological functions. It is mainly used in vivo to inhibit the activity of cell cycle-dependent protein kinases such as CDK4 and CDK6 to regulate the transcription and expression of related genes, especially related to regulating the development and maturation and function of blood system cells. Its abnormal expression can cause the development and maturation of blood cells and dysfunction, abnormal proliferation of related tissue cells such as breast tissue, ovarian tissue, lung and kidney cells, embryonic developmental disorders, growth and development disorders, and abnormal immune regulation, and produce related diseases.
- cell cycle-dependent protein kinases such as CDK4 and CDK6
- the abnormal expression of the human P18 protein 21 of the present invention will produce various diseases, especially blood diseases, various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include but are not Limited to:
- Tumors of various tissues all types of leukemia, lymphoma, breast cancer, ovarian cancer, uterine fibroids, lung cancer, esophageal cancer, gastric cancer, liver cancer, kidney cancer, thyroid tumor, neuroblastoma, astrocytoma, ependyma Tumor, Glioblastoma, Neurofibromatosis, Colon Cancer, Bladder Cancer, Uterine Cancer, Endometrial Cancer, Thymic Tumor
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Abnormal expression of the human P18 protein 21 of the present invention may also cause certain genetic diseases and the like.
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat various diseases, especially blood diseases, various tumors, embryonic development disorders, growth disorders, inflammation , Immune diseases, certain genetic diseases, etc.
- the invention also provides screening compounds to identify raising (agonist) or suppressing (antagonist) human P18 eggs.
- Method of white 21 medicament Agonists enhance biological functions such as human P18 protein 21 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human P18 protein 21 can be cultured with labeled human P18 protein 21 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antibodies to human P18 protein 21 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human P18 protein 21 can bind to human P18 protein 21 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide cannot perform biological functions. '
- human P18 protein 21 When screening compounds as antagonists, human P18 protein 21 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human P18 protein 21 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human P18 protein 21 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human P18 protein 21 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the human P18 protein 21 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human P18 protein 21 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human P18 protein 21 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human P18 protein 21.
- Antibodies against human P18 protein 21 can be used in immunohistochemistry to detect human P18 protein 21 in biopsy specimens.
- -Monoclonal antibodies that bind to human P18 protein 21 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Such as human P18 protein 21 High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human P18 protein 21-positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human P18 protein 21.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of human P18 protein 21.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human P18 protein 21 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human P18 protein 21 detected in the test can be used to explain human P18 protein 2.1. The importance in various diseases and for the diagnosis of diseases in which human P18 protein 21 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human P18 protein 21 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human P18 protein 21.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human P18 protein 21 to inhibit endogenous human P18 protein 21 activity.
- a mutated human P18 protein 21 may be a shortened human P18 protein 21 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human P18 protein 21.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human P18 protein 21 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human P18 protein 21 can be found in the literature (Sarabrook, et al.).
- a recombinant polynucleotide encoding human P18 protein 21 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that suppress human P18 protein 21 fflRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RNA, DM and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can The sequences are obtained by in vitro or in vivo transcription. This DNA sequence is integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human P18 protein 21 can be used for the diagnosis of diseases related to human P18 protein 21.
- the polynucleotide encoding human P18 protein 21 can be used to detect the expression of human P18 protein 21 or the abnormal expression of human P18 protein 21 in a disease state.
- the DM sequence encoding human P18 protein 21 can be used to hybridize biopsy specimens to determine the expression of human P18 protein 21.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
- Human P18 protein 21-specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human P18 protein 21 transcripts.
- Detection of mutations in the human P18 protein 21 gene can also be used to diagnose human P1 S protein 21-related diseases.
- Human P18 protein 21 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human P18 protein 21 DNA sequence. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human P18 protein 21 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human P18 protein 21 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the pBSK (+) vector (Clontech) 's multiple cloning site, and transformed into DH5a. The bacteria formed a cDNA library.
- the Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elraer
- the determined cDM sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0335 a 09 was a new DM.
- a series of primers were synthesized to perform bidirectional determination of the inserted cDM fragments contained in this clone.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following 3i products were used for PCR amplification:
- Primer 1 5'- GGCTGCAGTGCCTCGGGCTTTCCT -3 '(SEQ ID NO: 3)
- Primer2 5'- TCATAGGTAGCTTATTTTATTGGA -3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
- the amplified product was purified using a QIAGEN kit and connected to a pCR vector using a TA cloning kit (Invitrogen product).
- the results of DM sequence analysis showed that The DM sequence of the PCR product is exactly the same as 1-1326bp shown in SEQ ID NO: 1.
- Example 3 Northern Plot analysis of human P18 protein 21 gene expression
- RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA With 20 g of RNA, 1.2 ° / 1.2 M in 20raM 3_ (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 ⁇ m EDTA-2. 2M formaldehyde. Electrophoresis was performed on an agarose gel. It was then transferred to a nitrocellulose membrane. A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers. The DM probe used was the PCR amplified human P18 protein 21 coding region sequence (533bp to 1117bp) shown in FIG. 1.
- the 32P- labeled probes (about 2 xl 0 6 cpm / ml) and transferred to a nitrocellulose membrane MA 42 in a solution. C hybridization overnight, the solution contains 50% formamide-25 mM KH 2 PO 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0. 1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human P18 protein 21
- Prirtier3 5'- CCCCATATGATGGCCCTTTCTCCAGACCCTTGC -3, (Seq ID No: 5)
- Priraer4 5'- CCCGAATTCTTACGGATACAGTGAACTCAAATG -3 '(Seq ID No: 6)
- These two primers contain Ndel and EcoRI digestion sites, respectively.
- the coding sequences for the 5 ,, and 3 'ends of the gene of interest are followed, and the Ndel and EcoRI restriction sites correspond to the expression vector plasmid pET- 2 8b (+) (Novagen, Ca. No. 69865. 3) Selective endonuclease site.
- the PCR reaction was performed using pBS-0335a09 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0335a09 plasmid, primers Primer-3 and Primer-4 were 1 Opraol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. A positive clone (pET-0335a09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunoch ⁇ nistry, 1969; 6:43. Rabbits were immunized with 1 ⁇ 2g of the i-cyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention for use as a hybridization probe, and to use a membrane hybridization method to identify whether some tissues contain the multicore of the present invention.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Low-intensity washing film 1) Take out the hybridized sample membrane.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases, such as genetic diseases .
- the specific method steps have been reported in the literature. For example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP was separately reverse-transcribed.
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizaion Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1> ⁇ SSC, 0.2%) was used at room temperature.
- SDS was washed and scanned with a ScanArray 3000 scanner (purchased from Genera Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU68914/01A AU6891401A (en) | 2000-04-29 | 2001-04-28 | A novel polypeptide, a human protein p18 21 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115547.4 | 2000-04-29 | ||
CN00115547A CN1321675A (zh) | 2000-04-29 | 2000-04-29 | 一种新的多肽——人p18蛋白21和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001083542A1 true WO2001083542A1 (en) | 2001-11-08 |
Family
ID=4584993
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000673 WO2001083542A1 (en) | 2000-04-29 | 2001-04-28 | A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1321675A (zh) |
AU (1) | AU6891401A (zh) |
WO (1) | WO2001083542A1 (zh) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998039007A1 (en) * | 1997-03-03 | 1998-09-11 | Board Of Regents, The University Of Texas System | Supression of cyclin kinase 2 activity for prevention and treatment of dna viral infections |
-
2000
- 2000-04-29 CN CN00115547A patent/CN1321675A/zh active Pending
-
2001
- 2001-04-28 WO PCT/CN2001/000673 patent/WO2001083542A1/zh active Application Filing
- 2001-04-28 AU AU68914/01A patent/AU6891401A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998039007A1 (en) * | 1997-03-03 | 1998-09-11 | Board Of Regents, The University Of Texas System | Supression of cyclin kinase 2 activity for prevention and treatment of dna viral infections |
Also Published As
Publication number | Publication date |
---|---|
AU6891401A (en) | 2001-11-12 |
CN1321675A (zh) | 2001-11-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001083688A2 (fr) | Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide | |
WO2001092514A1 (fr) | Nouveau polypeptide, interleukine humaine 13 (il-13), et polynucleotide codant ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001083542A1 (en) | A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide | |
WO2001083540A1 (fr) | Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001087949A1 (fr) | Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2002006471A1 (fr) | Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001075027A2 (fr) | Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001088154A1 (fr) | Nouveau polypeptide, facteur humain de regulation 17 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2002006473A1 (fr) | Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001073041A1 (fr) | Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2002012486A1 (fr) | Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide | |
WO2001070791A1 (fr) | Nouveau polypeptide, facteur humain lie a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001088151A1 (fr) | Facteur 30 de regulation de transcription de microglobuline, polypeptide humain, et polynucleotide le codant | |
WO2001083682A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide | |
WO2001087916A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s5-13, et polynucleotide codant pour ce polypeptide | |
WO2001083676A2 (en) | A novel polypeptide human strip-riched phosphatase 10 and the polynucleotide encoding said polypeptide | |
WO2001083685A2 (fr) | Nouveau polypeptide, proteine cap 10, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |