WO2001079482A1 - Gene mapping method - Google Patents

Abstract

A method for gene mapping. It is found out that gene mapping can be efficiently carried out by using microsatellite genetic polymorphism markers substantially designed at a ratio of 1 per about 100 kb. By using this method, genes causative of diseases and genes participating in various phenotypes with hereditary factors can be specified.

Description

 Gene Mapping Method Technical Field

 The present invention relates to a method for mapping a gene using a microsatellite marker. Background art

 When mapping a disease-causing gene, it is generally divided into two groups, patients and healthy individuals, to determine whether there is a difference in the frequency of a particular allele. If there is no difference in the frequency of a particular allele, the causative gene is considered not to be close to that allele; if there is a difference in the frequency of a particular allele, the causative gene is not present in that allele. It is thought that it exists near the gene.

As genetic polymorphisms at the time of genome mapping, single nucleotide polymorphisms (SNPs; single nucleotide polymorphisms) and microsatellite genetic polymorphism markers are known. SNPs are single nucleotide substitutions in the genome and generally have only two alleles. It is said that SNPs show a correlation only with some SNPs existing within 5 to 10 kb from the disease-causing gene. Therefore, when genome mapping is performed using SNPs as markers, an enormous number of SNPs must be set as markers, and a great deal of labor must be spent. The microsatellite genetic polymorphism is characterized by a large number of alleles and a correlation even at a certain distance from the disease-causing gene. However, when setting a microsatellite as a marker, if the number of markers is too large, a great deal of labor must be spent, and if the number is too small, no correlation is detected and the causative gene may be overlooked. Thus, an efficient gene mapping method using micro satellites Has not been established. Disclosure of the invention

 The present invention provides a method for efficiently mapping genes using microsatellite markers.

In order to establish an efficient gene mapping method using the genetic polymorphism marker of microsatellite, the present inventor used microsatellite markers in the region of the human leukocyte antigen (HLA) locus in psoriasis vulgaris as an example. _c psoriasis vulgaris was carried out to search for disease-causing genes used (psoriasis vulgaris; MIM 177900) is a high skin diseases frequently characterized by a hyperproliferation of inflammatory cell infiltration and epidermal cells. Nearly 2% of the Caucasian population suffers from the disease, but it has long been known that the disease has a familial nature. However, the incidence in Japanese is lower (0.1%), and most cases of psoriasis vulgaris are sporadic. These facts clearly show that psoriasis vulgaris is a multifactorial disease, triggered by the addition of some environmental factor to individuals with a particular genetic background. In fact, genome-wide linkage studies have identified several susceptible loci on chromosome 6p21.3 [human leukocyte antigen (HLA)], 17q25, and 4q, and many other sites (Tomfohrde, J et al. (1994) Science, 20, 1141-1145; Matthews, D. et al. (1996) Nature Genet, 14, 231-233; Nair, RP et al. (1997) Hum. Mol. Genet., 6, 1349-1356; Trembath, RC et al. (1997) Hum. Mol. Genet., 6, 813-820).

In particular, the HLA locus is considered to be one of the major genetic factors predisposing to this disease. It is well known that psoriasis vulgaris correlates with several serologically defined HLA class I antigens such as HLA-B13, -B17, -B39, -B57, -Cw6, and -Cw7. This has been confirmed in many populations around the world, including Caucasians and Japanese (Brenner, W. et al. (1978) Arch. Dermatol. Res., 28, 337-339; Tiilikainen, A. (1980) Br. J. Dermatol., 102, 179-184; Ozawa, A. et al. (1981) J. Am. Acad. Dermatol., 4, 205-230; Cao, K. et al. (1993) Chin. Med. J 106, 132-135; Schmitt-Egenolf, M. et al. (1996) J. Invest Dermatol., 106, 711-714). Of these alleles, HLA-Cw6 has the most consistently significant correlation. However, the correlation is stronger as the correlation between HLA-B27 and ankylosing spondylitis (MIM 106300), which is likely to be the true cause in this case because all patients have this allele equal to 100% No (Moller, E. and Olhagen, B. (1975) Tissue Antigens, 6, 237-246). In fact, only 10% (Japanese) to 45% (Caucasian) of the psoriasis vulgaris with the HLA-Cw6 allele (Tiilikainen, A. et al. (1980) Br. J. Dermatol., 102, 179-184; Asahina, A. et al. (1991) J. Invest. Dermatol., 97, 254-258). Because of this, the HLA-Cw6 gene is not the major locus responsible for psoriasis vulgaris, but rather a true pathogenic variant / allele in another gene (s) located nearby. It is clearly possible to show strong linkage disequilibrium. In this regard, it is clearly necessary to use a high-resolution genetic marker located around the HLA-C gene to perform a detailed mapping of this putative susceptibility locus.

The present inventors have recently completed the sequence analysis of the entire 1.8 Mb HLA class I region from MICB (major histocompatibility complex class I chain-related gene B) to HLA-F, and over 40 new genes (1997) Genomics, 42, 55-66; Shiina, T. et al. (1998) Genomics, 47, 372-382; Shiina, T. et al. (1999) Immunol. Rev., 167, 193-199). In order to perform high-resolution mapping in Japanese patients with psoriasis vulgaris, a gene putatively linked to the major histocompatibility complex (MHC), the present inventor has determined that this fragment Then, a total of 11 novel polymorphic microsatellite markers that were present at regular intervals throughout the 1060 kb region around the HLA-C locus were selected, and their correlation analysis was performed. This is presumed to be the one with a density of 96.7 kb. Using these microsatellite markers, A statistical analysis was performed on the distribution of allele frequencies and deviations from Hardy-Weinberg equilibrium. As a result, they have identified that the virulence gene for psoriasis vulgaris is located within a narrow section of lllkb that extends from 89 to 200 kb on the telomere side of the HLA-C gene. According to RT-PCR analysis using keratinocyte mRNA, within this important region defined for psoriasis vulgaris, P0U5F1 (0TF3;

(Takeda, J. et al. (1991) Nucleic Acids Res., 20, 4613-4620; Krishnan, B.R. et al. (1995) Genomics, 30, 53-58), TCF19 (SCI; cell growth regulatory gene)

(Krishnan, BR et al. (1995) Genomics, 30, 53-58; Ku, DH et al. (1991) Cell Growth Differ., 2, 179-186) and S (corneodesmosin gene) (Zhou, Y Acad. Sci. USA, 90, 9470-9474; Ishihara, M. et al. (1996) Tissue Antigens, 48, 182-186; Tazi Ahnini, R. et al. and Chaplin, DD (1993) Proc. Natl. (1999) Hum. Mol. Genet., 8, 1135-1140; Allen, MH et al. (1999) Lancet, 353, 1599-1590), as well as the entire HLA class I region. Four new phenotyped genes identified through genome sequencing: HCR

(helix coiled-coil rod homologue), including SPR1 ^ skin specinc proline rich gene 1), SEEK1 (specific expressed gene in epidermal keratinocytes 1), and STG (skin specific telomeric gene) (AB029331, AB031480, AB031479, and AB031481) . This identifies seven genes that contribute to susceptibility to psoriasis vulgaris.

Above all, the S gene is clearly a candidate for psoriasis vulgaris because it encodes corneodesmosin, a 52-56 kDa protein expressed in differentiating epidermal keratinocytes. In addition, one of the four new genes located in the important region of lllkb for psoriasis vulgaris is expressed in most tissues examined, including keratinocytes, and has a plectin with a helicoid coiled-coil import domain. Encodes a protein. It has been hypothesized that plectin provides mechanical strength to cells and tissues by acting as a cross-linking component of the cytoskeleton (Liu, CG et al. Natl. Acad. Sci. USA, 30, 4278-4283) ₀ Furthermore, it is of particular interest that the plectin gene is responsible for the development of simple congenital epidermolysis bullosa.

(Pulkkinen, L. et al. (1996) Hum. Mol. Genet., 5, 1539-1546). It is noteworthy that the other three new genes were not homologous to any of the known genes in the DNA database, but all were specifically expressed in keratinocytes and skin tissues. Thus, in addition to the S gene, these four novel genes are also particularly potent candidate genes for psoriasis vulgaris in terms of expression patterns and / or expected functions. Thus, the present inventors have demonstrated that gene mapping can be performed efficiently by setting the genetic polymorphism marker of microsatellites substantially at a ratio of one per 100 kb. I came to. The method of the present invention can be applied not only to mapping of disease-causing genes but also to phenotypes having all genetic factors.

 The present invention relates to a gene mapping method characterized by using a microsatellite genetic polymorphism marker substantially set at a ratio of about 1 per 100 kb, more specifically,

 (1) an average of 50 kb or more; a gene mapping method characterized by using a microsatellite genetic polymorphism marker substantially set at one L50 kb,

 (2) a gene mapping method, characterized by using a microsatellite genetic polymorphism marker substantially set at a ratio of one per 80 kb to 120 kb on average,

 (3) a gene mapping method characterized by using a genetic polymorphism of a microsatellite substantially set at a ratio of one per 90 to 110 kb on average,

 (4) the mapping method according to any one of (1) to (3), wherein the gene is a disease-causing gene;

(5) The microsatellite genetic polymorphism marker is characterized in that the average number of alleles is 5 or more and the average heterozygosity is 60% or more. (1) (4) The method according to any one of (4), (6) the mapping method according to any one of (1) to (5), wherein the mapping area is an HLA area;

 (7) The method according to any one of (1) to (6), wherein the frequency of polymorphism markers is compared between a control healthy person and a randomly selected disease patient.

 (8) The mapping method according to any of (1) to (7), wherein the analysis of the genetic polymorphism marker of the microsatellite is performed using a DNA chip and mass spectrometry.

 (9) A method for identifying a target gene by analyzing SNPs in a region narrowed down by the mapping method according to any one of (1) to (8),

 (10) a gene identified by the method according to any one of (1) to (9),

(11) a protein encoded by the gene according to (10),

 (12) an antibody against the protein according to (11),

 (13) A polynucleotide comprising at least 15 nucleotides complementary to one strand of the gene according to (10) or a complementary strand thereof.

The gene isolated by the method of the present invention, a protein encoded by the gene, an antibody against the protein, and / or a polynucleotide comprising at least 15 nucleotides complementary to one strand of the gene or a complementary strand thereof are the following: It can be used for testing and gene therapy. In addition, a disease-causing gene isolated by the method of the present invention, a protein encoded by the gene, an antibody against the protein, and / or a polynucleotide containing at least 15 nucleotides complementary to one strand of the gene or its complementary strand. Pide can be used for testing, preventing, and / or treating the disease. The method for mapping a gene according to the present invention is characterized by using a genetic polymorphism marker of a microsatellite substantially set at a ratio of about one per 100 kb. There is no particular limitation on the target gene to be mapped. For example, a gene associated with a genetic factor-related disease or a disease suspected of involving a genetic factor is a target gene to be mapped by the present invention. For diseases involving genetic factors Includes monogenic diseases caused by a single genetic abnormality, and polygenic diseases caused by the additive effects of multiple genetic factors and / or environmental factors. Polygenic diseases are represented by the so-called “co thighs on diseases”, such as diabetes, hypertension, rheumatoid arthritis, gout, hyperlipidemia, arteriosclerosis, schizophrenia, cancer, and heart disease. , Cerebral infarction, azoospermia, etc., including most lifestyle-related diseases, and autism, manic depression, epilepsy, etc., are also subject to the disease-causing gene mapping of the present invention. The disease-causing gene includes not only the gene alone causing the disease, but also a plurality of genes and genes involved in the onset and progression of the disease along with environmental factors. In the present invention, the disease-causing gene also includes a gene that regulates drug sensitivity in the treatment of a certain disease.The present invention provides identification of a causative gene (group) of a disease and analysis of its molecular mechanism. Other available, diagnostics of the diseases, drug discovery, and its application to the prevention expected.

 Further, the gene mapping method of the present invention is not limited to mapping of a disease-causing gene, but may be applied to human phenotypes having all genetic factors (eg, height, weight, beautiful skin, skin color, hair color, intelligence, memory, personality, etc.). The present invention can also be applied to mapping of a causative gene involved, and therefore, a gene showing a detectable phenotype is a target gene in the present invention. Further, the gene mapping method of the present invention is not limited to humans, and can be applied to all animals including mammals, birds, and the like.

In the mapping of the present invention, a microsatellite genetic polymorphism marker is used. Here, the genetic polymorphism means that there are two or more types of alleles at a specific locus and the frequency is 1% or more. The locus may be any region on the genome, and is not limited to a gene region to be expressed. In addition, the mouth mouth satellite refers to a sequence in which 2 to 6 bases are repeated. It is known that microsatellite exists in the genome at a frequency of one per 2-3 kb. The number of repetitions of each microsatellite may vary between individuals. This variation in the number of repeats forms a polymorphism called STE (Short Tandem Repeat). Microsatellite polymorphism is generally determined by the number of repetitions. A typical example of such a microsatellite is the CA repeat (Dib, C. et al., 1996, Nature 380: 152-154).

 For example, according to the analysis of the microsatellite of the human HLA region by the present inventors, one microsatellite with a two-base repeat is about every 8.9 kb, and a microsatellite with a three base repeat is one at about 12.9 kb, and four base repeats Microsatellite was found at about 6.6 kb, microsatellite with 5 base repeats was found at about 12.6 kb, and these microsatellites were combined at about 2.4 kb (Shi ina, T). et al., 1999, Proc. Natl. Acad. Sci. USA 96: 13282-13287). In the present invention, these can be appropriately selected from these microsatellites and used as genetic polymorphism markers. From these microsatellites, microsatellite markers are substantially set at a ratio of about 100 kb in the genomic region to be searched. By setting microsatellite markers at a ratio of about 100 kb, microsatellites located within 100 kb to 200 kb from the target gene show linkage disequilibrium among these markers. The correlation with the type is detected, and the region of the target gene can be specified. In other words, 100k from the causative gene! ) ~ 200 kb microsatellite polymorphisms show linkage disequilibrium, so it is possible to detect the correlation without overlooking the causative gene and to determine the most effective causal gene mapping that minimizes the effort required. This can be done by using a microsatellite polymorphic marker set at a ratio of about 1 per 100kb. In the present invention, the ratio of "one in about 100 kb" generally means, on average, 50 kb or more: one in 50 kb, preferably one in 80 kb to 120 kb, more preferably 90 kb to 110 kb on average. It is the ratio of one piece.

In the present invention, "substantially set at a ratio of about lOOkb at one" refers to not only the case where the marker is set at a ratio of about lOOkb at the entire region where the marker is set, but also This includes the case where the ratio is set to about 100kb for one part. For example, even if one marker is set at a rate of about 100kb in one area and a marker is set at a different frequency in another area, it may not fit the rate of `` one in about 100kb '' as a whole. As long as the marker is set at a ratio of about 100 kb in the region, it corresponds to "substantially set at a ratio of about 1 kb" in the present invention. The number of markers for calculating the ratio can be calculated as long as three or more markers are set, but it is preferably five or more, more preferably seven or more, and still more preferably ten or more. . For example, if a marker is set at every 200 kb first and then analyzed, and then a different marker is set at every 200 kb in the same region and analyzed, the marker frequency in each analysis is One in 200 kb, but it is substantially the same as the case where one is set in lOOkb, and falls under “substantially set in one in about 100 kb” of the present invention. . As described above, the “substantially set at a ratio of about 100 kb” in the present invention means that in each step, even if the marker is not set at a ratio of about 100 kb at each stage, it is intermediate or This includes the case where one is finally set to about 100kb.

 It is preferable that the genetic polymorphism marker of microsatellite used for the mapping has a high information amount in the analysis. For example, the more alleles (alleles) and the higher the heterozygosity, the greater the amount of information in the analysis.

 The “number of alleles” is the number of alleles of a gene (genome sequences with different nucleotide sequences at a certain locus are said to be in an “allele” relationship to each other, corresponding to a genotype). “Average number of alleles” is the average number of alleles for all microsatellite used in the mapping method of the present invention. The number of alleles of the lth to nth microsatellites, respectively! ! ^ ~ !! ^, 1 ~! ! The average number of alleles for the n microsatellites up to the number is given by:

Average number of alleles: (11 ^ + 1112 + 1113 + · · · + m _n ) / n The term “heterozygosity” refers to the state in a diploid organism such as a human in which two chromosomes have different gene alleles, and the “heterozygosity” refers to the degree of heterozygosity. Represent. A X-th micro Satera wells allele number m _x, when the frequency and the respective FMI Fnix of each allele, the micro Satera wells "heterozygosity (h _x)" is:

_{h x = 1 - (Fm 1} 2 + Fm 2 2 + Fm 3 2 + · · - + Fm x 2)

 Thus, the “average of heterozygosity” for n microsatellites is given by:

Average heterozygosity: (! ^ +! ^ +! ^ 10 · · · + h _n ) / n

Use a genetic polymorphism marker having an average number of alleles of 5 or more, preferably 8 or more, and an average of heterozygosity of 60% or more, preferably 65% or more, and more preferably 70% or more. This enables more efficient mapping. The mapping of the gene of the present invention is usually performed by comparing the frequency of polymorphic markers in microsatellites between a control healthy subject and a randomly selected disease patient. That is, the frequency of each microsatellite allele of a healthy control person and the frequency of each microsatellite allele of a randomly selected disease patient are compared by correlation analysis. Here, “randomly selected” does not mean that the patients must be related to each other (siblings or parents). Preferably, the patient population has no kinship (siblings or parents) between the patients. If the microsatellite is within 100-200 kb from the disease-causing gene, the frequency of each allele of the microsatellite is statistically different between healthy and diseased patients. The correlation analysis can be performed according to a known method (Yasuharu Nishimura: Statistical Use of Polymorphism, Latest Medicine 46: 909-923, 1991; Oka, A. et al., Hum. Mol. Genetics 8). : 2165-2170 (1999); Ota, M. et al., Am. J. Hum. Genet. 64: 1406-1410 (1999); Ozawa, A. et al., Tissue Antigens 53: 263-268 (1999) )). In addition, for phenotypes with arbitrary genetic factors, not only diseases, for example, individuals with the desired phenotype and control individuals are randomly selected, and By comparing the frequency of a polymorphic marker of rosatellite, it is possible to map a causal gene involved in the phenotype.

 For detection of microsatellite polymorphism, for example, the microsatellite portion is amplified by PCR using a primer pair designed to sandwich the microsatellite, followed by electrophoresis on a high-resolution gel such as a DNA sequencer, and the amplified fragment This can be done by measuring the length. More simply, it can be performed using a DNA chip and mass spectrometry. That is, for example, 1000 or more microsatellite is spotted on the chip, ionized by irradiating a single laser beam, and the molecular weight is measured using the distance traveled in a vacuum tube as an index, whereby the number of microsatellite repetitions, That is, polymorphisms can be easily and quickly measured (Braun, A. et al., Genomics 46: 18-23 (1997)). Specifically, for example, DNA MassArray ™ (MS chip) (Sequenom Co. LTD, Sandiego, CA, USA; PE Biosystems Co. LTD, Foster City, CA, USA) can be used.

 When the position of the target gene is narrowed down by mapping using the genetic polymorphism marker of the microsatellite of the present invention, the target gene can be further narrowed down or specified by another mapping. For this purpose, for example, analysis using SNP is effective. SNPs exist in the genome at a rate of one in 300 to 500 base pairs, and have a high appearance frequency approaching several hundred times the appearance frequency of microsatellites. Applying angular analysis is expected to exert a powerful force in identifying target genes. Specifically, after analyzing with a microsatellite marker, the SNP polymorphism frequency in the region where the target gene is supposed to exist is compared between the patient group and the healthy subject group by correlation analysis, for example, and the haplotype SNP markers in linkage disequilibrium detected by the analysis are detected through linkage disequilibrium analysis.

The human genome diversity project based on SNP analysis, which is about to proceed worldwide, is called SNP (single nucleotide polymorphism). This is an attempt to collect about 300,000 genome-wide polymorphisms based on differences due to single nucleotide substitutions, deletions, and insertions, and use these as genetic polymorphism markers to map disease-causing genes. This is because multifactorial diseases, including so-called lifestyle-related diseases, were thought to be caused by SNP polymorphisms. However, SNPs typically have only two alleles and therefore have low mapping power.

(Kruglyak, L., Nature Genetics 17: 21-24, 1999). In fact, according to our analysis, microsatellite with 5 or more alleles showed significant correlation for all microsatellites located within about 200 kb from the target gene, while for SNP, Only very close SNPs within about 5 kb of the target gene, and only some of them, were found to show significant correlation. The reason is that, as mentioned above, the number of alleles (alleles) of SNPs is generally only 2 and the heterozygosity is 50% or less (usually 17%), and the power of SNP mapping is low. It is thought to be possible. Therefore, according to the method of the present invention, the most effective strategy for genome mapping is to first perform mapping with about 30,000 genome-wide polymorphic microsatellites (density of about 100 k per 100 k) to obtain a target gene candidate region. It is thought that the target gene is identified by performing SNP analysis after narrowing down to 100 kb. To identify the target gene from the determined sequence, for example, (ffiAIL

(Uberbacher, EC and Mural, RJ, Pro Natl. Acad. Sci. USA 88: 11261-5 (1991)) or GENSCAN (Burge, C. and Karl in, S., J. Mol. Biol. 268: 78-). 94 (1997)), and perform a homology search on the EST (expressed sequence tag) database using the EST (expressed sequence tag) database. Can be predicted. Based on these results, PCR primers and probes are prepared, and fragments expressed in cells are identified by RT-PCR or Northern hybridization. If an expression fragment can be obtained, the full-length cDNA can be obtained by 5 ′ RACE, 3 ′ RACE, and the like. Alternatively, a cDNA library screen using gene fragments as probes CDNA can also be isolated by leaning, screening of CapSite library, and the like.

 We have previously identified microsatellite that can be used for mapping, along with a large number of genes, through extensive sequence analysis of the human leukocyte antigen (HLA) locus (Mizuki, N. et al. (1997) Genomics, 42, 55-66; Shiina, T. et al. (1998) Genomics, 47, 372-382; Shiina, T. et al. (1999) Immunol. Rev., 167, 193 -199). The gene mapping method of the present invention can be suitably applied to this HLA region. In the present invention, the “HLA region” is a 3.6 Mb region from the centromeric HSET gene to the telomeric HLA-F gene. In addition to the previously mentioned psoriasis, the HLA region is expected to contain causative genes related to various diseases. By applying the gene mapping method of the present invention to the HLA region, it is possible to map the causative genes of these diseases. Specific diseases for which the causative gene is expected to be present in the HLA region include, in addition to psoriasis, for example, rheumatism, Behcet's disease, juvenile diabetes, Graves' disease, cardiomyopathy, diffuse panbronchiolitis, Bajaja Disease, Takayasu disease, narcolepsy, sarcoidosis, Harada disease, myasthenia gravis, multiple sclerosis and the like.

 Of course, the method of the present invention can be applied to areas other than the HLA region. In May 2000, the nucleotide sequence of the human genome was almost determined. If this nucleotide sequence information is used, the method of the present invention can be applied to all human genomic regions, that is, all diseases having genetic factors. It can also be applied to the mapping of causative genes involved in human phenotypes with all genetic factors (eg height, weight, beautiful skin, skin color, hair color, intelligence, memory, personality, etc.) as well as diseases. it can. For example, if the method of the present invention is applied to a population of a tall person and a population of a short person, a gene relating to height can be mapped.

If the causative gene of a disease is identified using the method of the present invention, the gene can be used for disease inspection, disease prevention and treatment. In addition, Genes involved in phenotypes other than disease can also be used for tests such as genetic diagnosis and gene therapy. Cloning of the gene can be performed by a method known to those skilled in the art. For example, it can be prepared by preparing a cDNA library from cells expressing the gene and performing hybridization using the gene fragment identified by mapping as a probe. The cDNA library may be prepared, for example, by the method described in the literature (Sambrook, J. et al, Molecular Clonings Cold Spring Harbor Laboratory Press (1989)), or a commercially available DNA library may be used. In addition, RNA is prepared from cells in which the gene is expressed, cDNA is synthesized by a reverse transcriptase, oligo DNA is synthesized based on the gene sequence (or fragment), and this is used as a primer. It can also be prepared by amplifying cDNA by performing a PCR reaction.

 By determining the base sequence of the full length of the target gene, the translation region encoded by the gene can be determined, and the amino acid sequence of the protein encoded by the gene can be obtained. Genomic DNA can be isolated by screening the genomic DNA library using the obtained cDNA as a probe.

 In the present invention, the gene includes cDNA and genomic MA. Genomic DNA includes the genes exon, intron, promoter and enhansa. Also includes alleles and variants.

Specifically, the cloning of the target gene may be performed, for example, as follows. First, mRNA is isolated from cells, tissues, and organs in which the gene is expressed. Isolation of ιηϋΝΑ can be performed by a known method, for example, guanidine ultracentrifugation (Chirgwin, JM et al., Biochemistry (1979) 18, 5294-5299) ヽ AGPC method (Chomczynski, P. and Sacchi, N., Anal. Prepare total RNA using Biochem. (1987) 162, 156-159) and purify mRNA from total RNA using mRNA Purification Kit (Pharmacia). Alternatively, mRNA can be directly prepared using the QuickPrep mRNA Purification Kit (Pharmacia). CDNA is synthesized from the obtained mRNA using reverse transcriptase. Synthesis of cDNA can also be performed using AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Shi-Dai-gaku Kogyo) or the like. Using the partial sequence of the target gene as a primer, 5, -Ampli FINDER RACE Kit (Clontech) and the polymerase chain reaction (PCR) 5, -RACE method (Frohman, Natl. Acad. Sci. USA (1988) 85, 8998-9002; cDNA synthesis according to Belyavsky, A. et al., Nucleic Acids Res. (1989) 17, 2919-2932). And amplification can be performed. A desired MA fragment is prepared from the obtained PCR product, and ligated to the vector DNA. The nucleotide sequence of the target DNA can be confirmed by a known method, for example, the didequinone nucleoside chain polymerization method.

The isolated gene is inserted into a vector as appropriate. The vector one, for example, in the case of Escherichia coli as a host, the vector one E. coli (e.g., JM109, DH5 shed, HB101 _S XLl-Blue) for mass prepared by mass amplified, etc., it is amplified in E. coli And a transformed gene selected from Escherichia coli (for example, a drug resistance gene that can be distinguished by any drug (ampicillin, tetracycline, kanamycin, chloramphenicol)). There are no particular restrictions. Examples of vectors include M13 vectors, pUC vectors, pBR322, pBluescript and pCR-Script. In addition, for the purpose of subcloning and excision of cDNA, pGEM-T ヽ DIRECT, pT7, etc. may be mentioned in addition to the above vectors. When a vector is used for the purpose of producing a protein encoded by a gene, an expression vector is particularly useful. For example, when the expression vector is intended for expression in Escherichia coli, in addition to having the above characteristics such that the vector can be amplified in Escherichia coli, the host can be used for JM109, DH5, HB101, XLl-Blue. in case of the E. coli, such as a promoter that allows efficient expression in E. coli, for example, lacZ flop Romo - evening _{- (Ward, Ε · s et} al (1989) Nature 341, 544-546;.. Ward, ES (1992) FASEB J. 6, 2422-2427), araB Promo Ichiichi (Better, M. et al. (1988) Science 240, 1041-1043), or T7 Promo. Such vectors include pGEX-5X-1 (Pharmacia),

"QIAexpress systemj (Qiagen), pEGFP, or pET (in this case, the host is preferably BL21 expressing T7 MA polymerase).

 The vector may also include a signal sequence for polypeptide secretion. As a signal sequence for protein secretion, the pelB signal sequence (Lei, SP et al J. Bacterid. (1987) 169, 4379) may be used when produced in E. coli periplasm. The introduction of the vector into the host cell can be performed using, for example, a calcium chloride method or an electroporation method.

 In addition to E. coli, for example, vectors for producing proteins include mammalian expression vectors (for example, pcDNA3 (manufactured by Invitrogen)) and pEF-BOS (Nucleic Acids. Res. 1990, 18 (17) , p5322), pEF, pCDM8), insect cell-derived expression vectors (eg, “BAC-T0-BAC Baculovirus Expression Systems j (manufactured by Gibco BRL), pBacPAK8), and plant-derived expression vectors (eg, ρΜΗ1, p H2), expression vector derived from animal virus

(Eg, pHSV, pMV, pAdexLcw), retrovirus-derived expression vectors (eg, pZIPneo), yeast-derived expression vectors (eg, “Pichia Expression Kit” (manufactured by Invitrogen), pNVll, SP- Q01), and expression vectors derived from Bacillus subtilis (eg, pPL608, PKTH50).

 For expression in animal cells such as CH0 cells, COS cells, and NIH3T3 cells, a promoter necessary for expression in cells, for example, SV40 promoter

(Mulligan, RG et al. (1979) Nature 277, 108-114), MMLV-LTR Promo Overnight, EFla promoter (Mizushima, S. and Nagata, S. (1990) Nucleic Acids Res. 18, 5322) It is essential to have a CMV promoter, etc., and if it has a gene for selection of cell transformation (for example, a drug resistance gene that can be identified by a drug (neomycin, G418, etc.)) preferable. Examples of vectors having such properties include, but are not limited to, p band, pDR2, pBK-RSV, pB-CMV, pOPRSV, p0P13 And the like.

 Furthermore, in a host vector system for the purpose of amplifying the copy number in a cell, in order to obtain a stable production cell line, a vector having a DHFR gene complementary to a CH0 cell lacking a nucleic acid synthesis pathway ( For example, pCHOI) may be introduced and amplified with methotrexate (MTX) .For transient expression of a gene, a gene that expresses the SV40 T antigen is present on the chromosome. There is a method in which COS cells are used to transform with a vector (such as pcD) having an SV40 origin of replication. As a replication starting point, those derived from poliovirus, adenovirus, sipapiroma virus (BPV) and the like can also be used. Furthermore, in order to amplify the gene copy number in the host cell system, the expression vector is used as a selection marker, such as aminoglycoside transferase (APH) gene, thymidine kinase (TK) gene, and Escherichia coli xanthinguanine phosphoribosyltransferase ( Ecogpt) gene and dihydrofolate reductase (dhfr) gene.

On the other hand, as a method for expressing a gene in the living body of an animal, the gene is incorporated into an appropriate vector and, for example, a retrovirus method, a ribosome method, a cationic liposome method, an adenovirus method, etc. There is a method for introduction. This makes it possible to carry out gene therapy or the like for a phenotype such as a disease caused by mutation or polymorphism of the gene. Examples of the vector used include, but are not limited to, an adenovirus vector (for example, pAdexlcw) and a retrovirus vector (for example, pZIPneo). General gene manipulation such as insertion of the MA fragment into the vector can be performed according to a conventional method (Sambrook, J. et al. (1989) Molecular Cloning 2nd ed., 5.61-5.63, Cold Spring Harbor). Lab. Press) ₀ Administration into a living body may be an ex vivo method or an in vivo method.

The host cell into which the vector is introduced is not particularly limited, and for example, Escherichia coli and various animal cells can be used. Host cells, for example, protein production And a production system for expression. Production systems for protein production include in vitro and in vivo production systems. Examples of the in vitro production system include a production system using eukaryotic cells and a production system using prokaryotic cells.

 When eukaryotic cells are used, for example, animal cells, plant cells, and fungal cells can be used as hosts. Animal cells include mammalian cells, such as CH0, COS, 3T3, myeloma, BHK (baby hamster kidney), HeLa, Vero, amphibian cells, such as African Megafrog oocytes (Valle, et al., Nature (1981). ) 291, 358-340) or insect cells such as Sf9, Sf21 and Tn5. Examples of CH0 cells include DHFR-deficient CH0 cells such as dhfr-CHO (Urlaub, G. and Chasin, LA (1980) Proc. Natl. Acad. Sci. USA 77, 4216-4220) and CHO Kl. (Kao, FT and Puck, TT (1968) Proc. Natl. Acad. Sci. USA 60, 1275-1281) can be preferably used. In animal cells, when large-scale expression is intended, CH0 cells are particularly preferred. The vector can be introduced into a host cell by, for example, a calcium phosphate method, a DEAE dextran method, a method using Cationic ribosome D0TAP (manufactured by Boehringer Mannheim), an electoral poration method, or a lipofection method. It is.

As a plant cell, for example, a cell derived from Nicotiana tabacum is known as a protein production system, and it may be callus cultured. Fungal cells include yeast, for example, the genus Saccharomyces, for example, Saccharomyces cerevisiae _N filamentous fungi, for example, the genus Aspergillus, for example, Aspergillus niger. ing.

 When using prokaryotic cells, there is a production system using bacterial cells. Examples of the bacterial cells include Escherichia coli (E. coli) such as JM109, DH5 and HB101, and Bacillus subtilis.

These cells are transformed with the desired DNA, and the transformed cells are The protein can be obtained by culturing in vitro. The culture can be performed according to a known method. For example, DMEM, MEM, RPMI1640, IMDM can be used as a culture solution of animal cells. At that time, a serum replacement solution such as fetal calf serum (FCS) can be used together, or serum-free culture may be performed. The pH during culturing is preferably about 6-8. Culture is usually performed at about 30 to 40 ° C for about 15 to 200 hours, and if necessary, the medium is replaced, aerated, and stirred.

 On the other hand, examples of a system for producing a protein in vivo include a production system using animals and a production system using plants. The target DNA is introduced into these animals or plants, and proteins are produced and recovered in the animals or plants. The “host” in the present invention includes these animals and plants.

 When using animals, there are production systems using mammals or insects. As mammals, goats, bushes, ovines, mice, and mice can be used (Vicki Glaser, SPECTRUM Biotechnology Applications, 1993). When a mammal is used, a transgenic animal can be used.

 For example, the target DNA is prepared as a fusion gene with a gene encoding a protein that is specifically produced in milk, such as goat casein. The MA fragment containing the fusion gene is then injected into a goat embryo and the embryo is transferred to a female goat. The target protein can be obtained from milk produced by the transgenic goat born from the goat that has received the embryo or its progeny. Hormones may be used in transgenic goats as appropriate to increase the amount of milk containing proteins produced by transgenic goats (Ebert, KM et al., Bio / Technology (1994) 12, 699-702). In addition, silkworms can be used as insects, for example. When a silkworm is used, the target protein can be obtained from the body fluid of the silkworm by infecting the silkworm with a baculovirus into which DNA encoding the target protein has been introduced (Susumu, M. et al., Nature (1985) 315, 592-594).

Furthermore, when using a plant, for example, tobacco can be used. Tobacco When used, DNA encoding the desired protein is introduced into a plant expression vector, for example, pMON530, and this vector is introduced into a bacterium such as Agrobacterium tumefaciens. This bacterium is infected to tobacco, for example, Nicotiana tabacum, and the desired polypeptide can be obtained from the tobacco leaves (Ma, JK et al. (1994) Eur. J. Immunol. 24, 131-138).

 The protein thus obtained can be isolated from the inside or outside of the host cell (such as a medium) and purified as a substantially pure and homogeneous protein. The separation and purification of the protein may be carried out by using the separation and purification methods used in ordinary protein purification, and is not limited at all. For example, chromatography column, filter, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectric focusing, dialysis, recrystallization, etc. If selected and combined, proteins can be separated and purified.

Examples of the chromatography include affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reversed-phase chromatography, and adsorption chromatography. (Strategies for Protein) Purification and Characterization: A Laboratory Course Manual.Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996) _D These chromatography methods are liquid phase chromatography, for example, liquid phase chromatography such as HPLC and FPLC. Can be performed. Using these purification methods, highly purified proteins can be obtained.

 The protein can be arbitrarily modified or partially removed by reacting the protein with an appropriate protein modifying enzyme before or after purification. As the protein-modifying enzyme, for example, trypsin, chymotrypsin, lysylendopeptidase, protein kinase, dalcosidase and the like are used.

By using the protein obtained in this way, the protein encoded by the target gene can be used. Antibodies can be prepared. The form of the antibody is not particularly limited, and includes a monoclonal antibody in addition to a polyclonal antibody. Also included are antisera obtained by immunizing immunized animals such as rabbits with the protein, polyclonal antibodies and monoclonal antibodies of all classes, as well as human antibodies and humanized antibodies obtained by genetic recombination.

 The protein used as a sensitizing antigen for obtaining an antibody is not limited to the animal species from which it is derived, but is preferably a protein derived from a mammal, for example, a human, a mouse or a rat, and particularly preferably a protein derived from a human.

 In the present invention, the protein used as the sensitizing antigen may be a complete protein or a partial peptide of the protein. Examples of the partial peptide of the protein include an amino group (N) terminal fragment and a carboxy (C) terminal fragment of the protein. As used herein, “antibody” refers to an antibody that reacts with the full length or fragment of a protein.

 To prepare an antibody, a target gene or a fragment thereof is introduced into a known expression vector system, the vector is used to transform a host cell described in the present specification, and a target protein or a target protein is introduced from inside or outside the host cell. The fragment may be obtained by a known method, and these may be used as a sensitizing antigen. Alternatively, a cell expressing the protein, a lysate thereof, or a chemically synthesized protein may be used as the sensitizing antigen. It is preferable that the short peptide is appropriately bound to a carrier protein such as keyhole limpet hemocyanin, pepsin albumin, and ovalbumin to form an antigen.

 The mammal to be immunized with the sensitizing antigen is not particularly limited, but is preferably selected in consideration of compatibility with the parent cell used for cell fusion. In general, rodents are used. Eyes, egrets, and primates are used.

As rodent animals, for example, mice, rats, hamsters and the like are used.動物 As an heronoid animal, for example, a heron is used. For example, monkeys are used as primates. As monkeys, monkeys with lower nose (old world monkey), For example, cynomolgus monkeys, rhesus monkeys, baboons, chimpanzees, etc. are used. Immunization of an animal with a sensitizing antigen is performed according to a known method. As a general method, a sensitizing antigen is injected intraperitoneally or subcutaneously into a mammal. Specifically, the sensitizing antigen is diluted and suspended in an appropriate amount with PBS (Phosphate-Buffered Saline), physiological saline, or the like, and then mixed with an appropriate amount of a normal adjuvant, for example, Freund's complete adjuvant, if desired. After emulsification, it is administered to mammals. Thereafter, it is preferable to administer the sensitizing antigen mixed with an appropriate amount of incomplete Freund's adjuvant several times every 4 to 21 days. In addition, a suitable carrier can be used at the time of immunization with the sensitizing antigen. Immunize in this way and confirm that the level of the desired antibody in the serum increases by a conventional method.To obtain a polyclonal antibody, confirm that the level of the desired antibody in the serum has increased, and then sensitize the antigen. Remove the mammal's blood. The serum is separated from this blood by a known method. As the polyclonal antibody, a serum containing the polyclonal antibody may be used. If necessary, a fraction containing the polyclonal antibody may be further isolated from this serum and used. For example, using an affinity column in which a protein encoded by the target gene is coupled, a fraction that recognizes only the protein is obtained, and this fraction is further purified using Protein A or Protein G column. Thus, immunoglobulin G or M can be prepared.

 To obtain a monoclonal antibody, after confirming that the desired antibody level is increased in the serum of the mammal sensitized with the antigen, the immune cells may be removed from the mammal and subjected to cell fusion. In this case, preferred immune cells used for cell fusion include splenocytes, in particular. The other parent cell to be fused with the immune cell is preferably a mammalian myeloma cell, and more preferably a myeloma cell that has acquired the properties for selecting fused cells by a drug.

Cell fusion of the immune cells and myeloma cells is basically a known method, for example, The method can be performed according to the method of Milstein et al. (Galfre, G. and Milstein, C., Methods Enzymol. (1981) 73, 3-46).

 The hybridoma obtained by cell fusion is selected by culturing it in a normal selective culture medium, for example, a HAT culture medium (a culture medium containing hypoxanthine, aminopterin and thymidine). Culturing in the HAT culture solution is continued for a time sufficient to kill cells other than the target hybridoma (non-fused cells), usually for several days to several weeks. Next, a conventional limiting dilution method is performed to screen and clone a hybridoma producing the desired antibody.

 In addition to immunizing non-human animals with antigen to obtain the above-mentioned hybridomas, human lymphocytes, for example, human lymphocytes infected with EB virus, are sensitized in vitro with proteins, protein-expressing cells or lysates thereof. Alternatively, sensitized lymphocytes can be fused with human-derived myeloma cells capable of permanent division, for example, U266, to obtain a hybridoma that produces a desired human antibody having protein binding activity (Japanese Patent Application Laid-Open No. -No. 17688).

 Next, the obtained hybridoma was transplanted into the peritoneal cavity of a mouse, ascites was recovered from the mouse, and the obtained monoclonal antibody was subjected to, for example, ammonium sulfate precipitation, protein A, protein G force ram, DEAE ion exchange chromatography, It can be prepared by purifying the protein encoded by the target gene using a coupled affinity column or the like. The prepared antibody is used not only for purification and detection of the protein encoded by the target gene, but also as a candidate for the agonist-ian gonist of the protein. It is also conceivable to apply this antibody to antibody therapy for diseases. When the obtained antibody is used for administration to the human body (antibody therapy), a human antibody or a humanized antibody is preferable in order to reduce immunogenicity.

For example, a transgenic animal having a repertoire of human antibody genes is immunized with a protein serving as an antigen, a protein-expressing cell or a lysate thereof to obtain antibody-producing cells, and a hybridoma obtained by fusing this with myeloma cells is used. Against protein Human antibodies can be obtained (see International Publication Nos. W092--03918, W093-2227, W094-02602, W094-25585, W096-33735 and W096-34096).

 In addition to producing antibodies using hybridomas, cells in which immune cells such as sensitized lymphocytes producing antibodies have been immortalized with oncogenes may be used. The monoclonal antibody thus obtained can also be obtained as a recombinant antibody produced using a gene recombination technique (for example, Borrebaeck, CA and Larrick, JW, THERAPEUTIC MONOCLONAL ANTIBODIES, Published in the United Kingdom by MCMILLAN PUBLISHERS LTD, 1990). Recombinant antibodies are produced by cloning the DNA encoding them from immune cells such as hybridomas or sensitized lymphocytes producing the antibodies, inserting them into an appropriate vector, and introducing them into a host to produce them. . The present invention includes this recombinant antibody.

 Furthermore, in the present invention, the antibody may be an antibody fragment or a modified antibody thereof as long as it binds to the protein encoded by the target gene. For example, as an antibody fragment, Fab, F (ab,) 2, Fv or a single chain Fv (scFv) obtained by linking an Fv of an H chain and an L chain with an appropriate linker (Huston, JS et al.,? Roc. Natl. Acad. Sci. USA (1988) 85, 5879-5883). Specifically, an antibody is treated with an enzyme, for example, papain or pepsin, to generate antibody fragments, or a gene encoding these antibody fragments is constructed and introduced into an expression vector. Expression in a suitable host cell (eg, Co, MS et al., J. Immunol. (1994) 152, 2968-2976; Better, M. and Horwitz, A. H "Methods Enzymol. (1989) 178, 476-496; Pluckthun, A. and Skerra, A., Methods Enzymol. (1989) 178, 497-515; Lamoyi, Ε ·, Methods Enzymol. (1986) 121, 652-663; Rousseaux, J. et al. (1986) 121, 663-669; Bird, RE and Walker, BW, Trends Biotechnol. (1991) 9, 132-137).

As the modified antibody, an antibody bound to various molecules such as polyethylene glycol (PEG) can be used. In the present invention, “antibody” includes these modified antibodies. Included. Such a modified antibody can be obtained by subjecting the obtained antibody to chemical modification. These methods are already established in this field.

 In the present invention, the antibody may be a chimeric antibody composed of a variable region derived from a non-human antibody and a constant region derived from a human antibody, or a CDR (complementarity determining region) derived from a non-human antibody and a human antibody. It can be obtained as a humanized antibody consisting of FR (framework region) and constant region derived from it.

The antibody obtained as described above can be purified to homogeneity. The separation and purification of the antibody used in the present invention may be performed by the separation and purification methods used for ordinary proteins. For example, antibodies can be separated by appropriately selecting and combining chromatographic columns such as affinity chromatography, filters, ultrafiltration, salting out, dialysis, SDS polyacrylamide gel electrophoresis, isoelectric focusing, etc. can this the force ^s purifying (Antibodies:. a Laboratory Manual Ed Harlow and David Lane, Cold Spring Harbor Laboratory, 1988) is not intended to be limited thereto. The concentration of the antibody obtained as described above can be measured by measuring absorbance or enzyme-linked immunosorbent assay (ELISA).

Columns used for affinity chromatography include Protein A column and Protein G column. For example, columns using a protein A column include Hyper D, POROS, Sepharose FF (Pharmacia) and the like. Examples of chromatography other than affinity chromatography include, for example, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization: A Laboratory). (Course Manual. Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996) ₀ These chromatography methods can be carried out using liquid phase chromatography such as HPLC and FPLC. Methods for measuring the antigen-binding activity of antibodies include, for example, measurement of absorbance, enzyme-linked immunosorbent assay (EUSA), EIA (enzyme immunoassay), and RIA (radioimmunoassay). Measurement method) or a fluorescent antibody method. When using ELISA, a target protein is added to a plate on which an antibody is immobilized, and then a sample containing the target antibody, for example, a culture supernatant of antibody-producing cells or a purified antibody is added. Add a secondary antibody that recognizes an enzyme, for example, an antibody labeled with alkaline phosphatase, and incubate the plate.After washing, add an enzyme substrate such as p-nitrophenyl folic acid and measure the absorbance. Thus, the antigen binding activity can be evaluated. As the protein, a protein fragment, for example, a fragment comprising the C-terminus or a fragment comprising the N-terminus may be used. BIAcore (Pharmacia) can be used for antibody activity evaluation.

 By using these techniques, the antibody is brought into contact with a sample expected to contain the protein encoding the target gene contained in the sample, and an immunocomplex of the antibody and the protein is detected or measured. The method for detecting or measuring the protein encoded by the gene can be carried out. Since this measurement method can specifically detect or measure the protein encoded by the gene, it is useful for various experiments, tests, diagnoses, and the like using the protein.

 The present invention also provides a polynucleotide comprising at least 15 nucleotides complementary to one strand of the target gene or its complementary strand.

As used herein, the term “complementary strand” refers to one strand of a two-membered nucleic acid consisting of A: T (U for RNA) and G: C base pairs with respect to the other strand. Further, the term "complementary" is not limited to a completely complementary sequence in at least 15 contiguous nucleotide regions, but is at least 70%, preferably at least 80%, more preferably 90%, and still more preferably 95%. What is necessary is that they have homology on the base sequence of at least%. To determine the homology of proteins, the algorithm described in the literature (Wilbur, WJ and Lipman, DJ Proc. Natl. Acad. Sci. USA (1983) 80, 726-730) may be used. Such nucleic acids include probes and primers used for detection and amplification of a target gene, probes and primers for detecting the expression of the gene, nucleotides or nucleotide derivatives for controlling the expression of the gene (for example, antisense Oligonucleotides, ribozymes, or DNA encoding them). Here, the detection of a gene includes the detection of a mutation in the gene. Such a nucleic acid can also be used for producing a DNA chip. When the above-mentioned polynucleotide is used as a primer, the region on the 3 ′ side may be complementary, and a tag for a restriction enzyme recognition sequence may be added to the 5 ′ side.

 Antisense oligonucleotides include, for example, antisense oligonucleotides that hybridize at any point in the coding region of a protein. The antisense oligonucleotide is preferably an antisense oligonucleotide for at least 15 consecutive nucleotides in the coding region of the protein. More preferably, at least 15 or more consecutive nucleotides are an antisense oligonucleotide containing a translation initiation codon.

 As the antisense oligonucleotide, derivatives and modifications thereof can be used. Examples of the modified product include a modified lower alkyl phosphonate such as a methyl phosphonate type or an ethyl phosphonate type, a phosphorothioate modified product, a phosphoroamidate modified product, and the like.

 Antisense oligonucleotides include not only those whose nucleotides corresponding to the nucleotides constituting the predetermined region of DNA or mRNA are all complementary sequences, but also those whose oligonucleotides specifically target DNA or RNA encoding the target gene. Hybridization Includes one or more nucleotide mismatches wherever possible o

The antisense oligonucleotide derivative of the present invention acts on a cell that produces a protein encoded by a target gene and binds to DNA or mRNA encoding the protein, thereby inhibiting its transcription or translation, or Or promote the decomposition of By suppressing the expression of white matter, it has the effect of suppressing the action of the protein as a result.

 The antisense oligonucleotide derivative of the present invention can be made into an external preparation such as a coating agent or a patch by mixing with an appropriate base material which is inactive against the derivative.

 If necessary, excipients, isotonic agents, solubilizing agents, stabilizers, preservatives, soothing agents, etc. may be added to tablets, splinters, granules, capsules, ribosome capsules, It can be a lyophilized agent such as a propellant, a liquid, a nasal drop and the like. These can be prepared according to a conventional method.

 The antisense oligonucleotide derivative of the present invention is applied directly to the affected area of the patient, or is applied to the patient so as to be able to reach the affected area as a result of intravenous administration or the like. Furthermore, an antisense-encapsulated material that enhances durability and membrane permeability can be used. For example, ribosome, poly-L-lysine, lipid, cholesterol, lipofectin or derivatives thereof can be mentioned.

 The dosage of the antisense oligonucleotide derivative of the present invention can be appropriately adjusted according to the condition of the patient, and a preferred amount can be used. For example, it can be administered in the range of 0.1 to 100 mg / kg, preferably 0.1 to 50 mg / kg.

 The antisense oligonucleotide of the present invention inhibits the expression of the protein encoded by the target gene and is therefore useful in suppressing the biological activity of the protein. Further, the expression inhibitor containing the antisense oligonucleotide of the present invention is useful in that it can suppress the biological activity of the protein.

The mutation or expression of the gene or protein can be tested using an antibody against the protein encoded by the target gene or a polynucleotide containing at least 15 nucleotides complementary to one strand of the gene or its complementary strand. When the target gene is involved in the disease, the antibody or the polynucleotide can be used to test for the disease. In the present invention, the examination of the disease includes not only the examination of a patient who has developed the symptoms of the disease due to the mutation of the disease-causing gene, To assess whether the disease-causing gene is susceptible to the disease due to abnormal expression of the disease-causing gene or mutation in the gene, and also to test for mutations in the gene. included. That is, even if the symptom has not yet been expressed on the surface due to abnormal expression of the disease-causing gene or mutation of one allele of the disease-causing gene, the risk of the disease is extremely high. It is considered that the number has increased. In addition, not only for diseases but also for phenotypes having other genetic factors, for example, it is possible to test whether or not the phenotype has the causative gene, and to test for mutation or expression of the gene.

 Testing of a disease or the like using an antibody includes, for example, a method including a step of detecting a protein encoded by a causative gene in a test sample. If the causative gene is

The test using an antibody against the protein to be loaded includes, specifically, (a) a step of bringing the antibody into contact with a test sample, (b) a step of detecting the binding of the antibody to the test sample, including. The protein can be detected by immunoprecipitation using an antibody, Western blot, immunohistochemistry, ELISA, or the like.

 In addition, in the test of the present invention, the nucleotide sequence of the transcript of the gene or its cDNA, the nucleotide sequence of the genomic DNA sequence (including the endogenous transcription control sequence), or a polynucleotide complementary to its complementary strand ( Probes and primers). The mutation test also includes a test to identify “carriers” with a mutation in one allele of the allele.

 When used as a primer, the polynucleotide is usually between 15 bp and: LOObp, preferably between 17 bp and 30 bp. The primer may be any primer that can amplify at least a part of the target gene or a region that regulates its expression. Examples of such a region include an exon region, an intron region, a promoter region, and an enhancer region of a gene.

On the other hand, a polynucleotide as a probe generally has a chain length of at least 15 bp or more if it is a synthetic polynucleotide. Combine into vectors such as plasmid DNA It is also possible to use a double-stranded MA obtained from the cloned clone as a probe. The probe may be any probe as long as it is complementary to the base sequence of at least a part of the gene or a region that regulates its expression or a complementary strand thereof. Examples of the region to which the probe hybridizes include an exon region, an intron region, a promoter region, and an enhancer region of a gene. When used as a probe, the polynucleotide or double-stranded DNA is used after being appropriately labeled. Labeling methods include, for example, labeling by phosphorylating the 5 'end of the polynucleotide with ³² P using T4 polynucleotide kinase, or random hexamer oligonucleotide using a DNA polymerase such as Klenow II enzyme. Using a primer as a primer, a method of incorporating a substrate base labeled with an isotope such as ³² P, a fluorescent dye, or biotin (such as a random prime method) can be used. One of the testing methods using an antibody against the protein encoded by the target gene or a polynucleotide containing at least 15 nucleotides complementary to one strand of the gene or its complementary strand is a transcript of the target gene in a test sample. This is a method that includes the step of detecting Such a test method includes a method comprising: (a) contacting the above-mentioned polynucleotide with a test sample; and (b) detecting the binding of the polynucleotide to mRNA in the test sample. included. Such a test can be performed, for example, by Northern hybridization—RT-PCR. Inspection using RT-PCR includes the following steps: (a) a step of synthesizing cDNA from mRNA in a test sample; (b) a step of synthesizing the synthesized cDNA and a primer of the polynucleotide of the present invention. Performing a polymerase chain reaction; and (c) detecting DNA amplified by the polymerase chain reaction. Northern hybridization—RT-PCR can be performed by known genetic engineering techniques. Detection by DNA chip or DNA microarray is also possible.

In addition, testing for a disease or the like may be performed by detecting a mutation or polymorphism in a target gene. That is, the coding region or transcriptional regulation of the target gene The test can be performed by detecting a mutation or polymorphism in the control region. One embodiment of such a test method is a method for directly determining the nucleotide sequence of a target gene of a subject. For example, a part or all of the target gene (for example, exon, intron, or the like) of the subject can be determined by PCR (Polymerase Chain Reaction) method or the like using the above nucleotide as a primer and DNA isolated from the subject as type III. The region containing the promoter and enhancer is amplified and its base sequence is determined. A test can be performed by comparing this with the sequence of the gene of a control person (for example, a healthy person or the like).

 As a test method, various methods are used other than the method of directly determining the nucleotide sequence of the DNA derived from the subject. One embodiment is (a) a step of preparing an MA sample from a subject, (b) a step of amplifying DNA from the subject using the polynucleotide of the present invention as a primer, and (c) amplified DNA. (D) separating the dissociated single-stranded DNA on a nondenaturing gel, and (e) controlling the mobility of the separated single-stranded DNA on the gel. Comparing with the case of.

As such a method, PCR-SSCP (Single-strand conformation polymorphism, Single-strand conformation polymorphism) method (Cloning and polymerase chain reactioh-smgle-strand conformation polymorphism analysis of anonymous Alu repeats on chromosome 11.Genomics. 1992) Jan 1; 12 (1): 139-146., Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products.Oncogene.1991 Aug 1; 6 (8): 1313-1318. , Multiple fluorescence-based PCR-SSCP analysis with post labeling., PCR Methods Appl. 1995 Apr 1; 4 (5): 275-282.). This method has advantages such as relatively simple operation and small sample size, and is particularly suitable for screening a large number of DNA samples. The principle is as follows. When a double-stranded DNA fragment is dissociated into single strands, each strand forms a unique higher-order structure depending on its base sequence. This dissociated MA chain is denatured without polyacrylic When electrophoresed in an amide gel, single-stranded DNAs of the same complementary length move to different positions according to the differences in their higher-order structures. The single-stranded substitution also changes the higher-order structure of this single-stranded DNA, indicating different mobilities in polyacrylamide gel electrophoresis. Therefore, by detecting the change in mobility, it is possible to detect the presence of a mutation due to a point mutation, deletion, or insertion in the MA fragment. Specifically, first, part or all of the target gene is amplified by PCR or the like. As the range to be amplified, usually, a length of about 200 to 400 bp is preferable. In addition, the region to be amplified includes not only all the exons and all the introns of the gene, but also the gene promoter and the enhancer. When amplifying gene fragments by PCR, use an isotope such as ³² P or a primer labeled with a fluorescent dye or biotin, or use an isotope such as ³² P or a fluorescent dye or biotin in the PCR reaction solution. The DNA fragment synthesized by adding the labeled substrate base and performing PCR is labeled. Alternatively, labeling can also be performed by adding an isotope such as ³² P or a substrate base labeled with a fluorescent dye or biotin to the synthesized DNA fragment using Klenow enzyme after the PCR reaction. The thus obtained labeled DNA fragment is denatured by applying heat or the like, and electrophoresis is performed on a polyacrylamide gel containing no denaturing agent such as urea. At this time, the conditions for separation of MA fragments can be improved by adding a suitable amount of glycerol (about 5 to 10%) to polyacrylamide gel. The electrophoresis conditions vary depending on the properties of each DNA fragment. However, it is usually performed at room temperature (20 to 25 ° C), and when favorable separation is not obtained, the temperature which gives the optimum mobility at a temperature of 4 to 30 ° C is examined. The mobility is detected and analyzed by autoradiography using X-ray film or a scanner that detects fluorescence, etc. If a band with a difference in mobility is detected, this band is directly analyzed from the gel. Excision, re-amplification by PCR, and direct sequencing can confirm the presence of the mutation. Le The band can be detected by staining the DNA with ethidium mouth silver silver staining method or the like.

 Other aspects of the test method of the present invention include: (a) a step of preparing a DNA sample from a subject; (b) a step of amplifying DNA from the subject using the polynucleotide of the present invention as a primer; (C) a step of cleaving the amplified DNA, (d) a step of separating the DNA fragment according to its size, and (e) a detectable labeled polynucleotide of the present invention is added to the separated DNA fragment. And (f) comparing the size of the detected DNA fragment with that of a control.

 Examples of such a method include a method using restriction fragment length polymorphism (RFLP) and a PCR-RFLP method. Restriction enzymes are usually used as enzymes that cut DNA. Specifically, when a mutation or polymorphism is present at the recognition site of the restriction enzyme, or when there is a base insertion or deletion in the DNA fragment generated by the restriction enzyme treatment, the size of the fragment generated after the restriction enzyme treatment Varies compared to controls (eg, in healthy individuals). By amplifying the portion containing this mutation or polymorphism by PCR and treating with each restriction enzyme, these mutations or polymorphism can be detected as a difference in the mobility of the band after electrophoresis. . Alternatively, the presence or absence of a mutation or polymorphism can be detected by treating the chromosomal MA with these restriction enzymes, electrophoresing, and performing Southern plotting using the polynucleotide as a probe. The restriction enzyme to be used can be appropriately selected according to each test site. In this method, in addition to genomic DNA, RNA prepared from a subject can be converted into cDNA with a reverse transcriptase, which can be directly cut with a restriction enzyme and then subjected to Southern blotting. Alternatively, using this cDNA as type II, a part or all of the target gene can be amplified by PCR and cut with restriction enzymes, and then the difference in mobility can be examined.

Also, detection can be performed in the same manner by using RNA instead of DNA prepared from the subject. Such a method includes the steps of (a) preparing an RNA sample from a subject; (C) a step of hybridizing the isolated RNA with the detectable-labeled oligonucleotide of the present invention as a probe, and (d) the detected RNA. Comparing the size of the control with the control. As an example of a specific method, RNA prepared from a subject is subjected to electrophoresis, and Northern blotting is performed using the above-described polynucleotide as a probe to detect a difference in mobility.

 Other aspects of the test method include: (a) a step of preparing a DNA sample from a subject;) amplifying MA from the subject using the polynucleotide of the present invention as a primer; and (c) amplifying the amplified DNA. Separating on a gel in which the concentration of the DNA denaturing agent is gradually increased, and (d) comparing the mobility of the separated DNA on the gel with that of a control.

 Examples of such a method include denaturant gradient gel electrophoresis (DGGE). A part or all of the target gene is amplified by PCR using the above primers, etc., and this is amplified in a polyacrylamide gel where the concentration gradually increases as the concentration of denaturant such as urea moves. Run the sample and compare it with a control (eg, a healthy subject). In the case of a DNA fragment containing a mutation, the MA fragment becomes single-stranded at a lower denaturant concentration and the migration speed becomes extremely slow.The presence or absence of a mutation or polymorphism can be detected by detecting this difference in mobility. Can be detected.

In addition to these methods, the Allele Specific Oligonucleotide (ASO) hybridization method can be used for the purpose of detecting only a mutation at a specific position. When an oligonucleotide containing a nucleotide sequence that is considered to have a mutation is prepared and hybridized with this and a sample DNA, the efficiency of hybridization decreases when the mutation is present. This can be detected by the Southern plot method or a method utilizing the property of quenching by a special fluorescent reagent being applied to the hybrid gap in a single step. Also, Ribonuclea It can also be detected by the A-Masemachi cutting method. Specifically, a part or all of the target gene is amplified by PCR or the like, and the target gene is hybridized with a labeled RNA prepared from a target gene fragment or the like incorporated in a plasmid vector or the like. Since the hybrid has a single-stranded structure in the portion where the mutation exists, it is possible to detect the presence of the mutation by cleaving this portion with ribonuclease A and detecting this by autoradiography. it can. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows the P values obtained by the correlation test and the Hardy-Weinberg ratio exact test, together with the positions of the microsatellite markers used for the gene mapping of psoriasis vulgaris. ^a Gene map showing the location of each gene in the HLA class I region from IkBL to HLA-L. White and black boxes represent HLA class I genes and non-HLA genes, respectively. Arrows indicate the direction of the gene. ^b Statistical analysis by case-control correlation test and exact test of Hardy-Weinberg ratio. The curves were drawn after smooth fitting based on the two-point moving average in each test. The white circles connected by a solid line indicate the Pc values obtained by the Fisher's exact probability test in the case-control analysis, and the white squares connected by the broken line indicate the deviation from the Hardy-Weinberg ratio. The P value obtained by the exact probability test (probability test), the solid square connecting the solid squares to the P value obtained by the exact probability test for heterozygous reduction on the null hypothesis of Hardy-Weinberg equilibrium in patients. Indicates a value. The distance (kb) from the HLA-C locus to each microsatellite is shown in parentheses along with the position of the ^e microsatellite car. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described specifically with reference to Examples, but the present invention is not limited to these Examples. [Example 1] HSA class I microsatellite matrix

 Through extensive genome sequencing by the present inventors, the centromeric MICB gene was converted to the telomere HLA-F gene (Mizuki, N. et al. (1997) Genomics, 42, 55-66; Shiina, T et al. (1998) Genomics, 47, 372-382; Shiina, T. et al. (1999) Immunol. Rev., 167, 193-199; Tamiya, G. et al. (1998) Tissue Antigens, 51 , 337-346), 758 microsatellite loci ranging from 2- to 5-nucleotide repeats were identified in the 1.8 Mb HLA class I region containing the HLA-B and HLA-C genes. . For 70 of these microsatellites, we analyzed polymorphism information in the Japanese population. Of these, 38 were highly informative, with an average heterozygosity of 66% and an average of 8.9 alleles (Tamiya, G. et al. (1998) Tissue Antigens, 51 , 337-346; Tamiya, G. et al. (1999) Tissue Antigens 54: 221-228). These 38 microsatellite repeat sites were selected for high resolution mapping. Seven known polymorphic genes and microsatellite [MICB ヽ MICA ヽ HLA-B ヽ HLA-C, HLA-A ヽ MIB (Grimaldi, MC et al. (1996) Hum. Immunol., 51, 89-94) And D6S265 (Weissenbach, J. et al. (1992) Nature, 29, 794-801)], resulting in a total of 45 informative genetic markers, one at 41.1 kb. Specified within the area. These high-density polymorphic markers enable haplotype and mapping analysis of HLA class I-related diseases such as psoriasis vulgaris, Behcet's disease (MIM 109650), acute pancreatitis and ulcerative colitis (MIM 191390). Useful and accurate information about

 [Example 2] Identification of susceptibility locus for psoriasis vulgaris

In this example, correlation analysis was performed using 11 out of the 38 repeat sites described above to determine the clear position of the causative gene for psoriasis vulgaris within the HLA class I region. The selected microsatellites are densely distributed around the HLA-C locus at a resolution of approximately 1 microsatellite per lOOkb (C and 2_A, 232kb centromere side; Cl_4_l, 91kb centromere side; C15, 191 ^ Centromeric side 1_4-3, 29kb telomere side; G13 1, C1-2-1.6, 89kb T-mail side; C3-2, 143kb Telo-mail side; C2-4-1-4, 200kb T-mail side; C4-212, 457kb T-mail Side; C4 1-2-25, 618 kb telomere side; and C3-2 ”1 ヽ 831 kb telomere side) (Fig. 1).

The correlation analysis included a total of 76 unrelated Japanese patients with psoriasis vulgaris and 132 healthy controls. All patients were admitted to the Department of Dermatology, Tokai University (Kanagawa, Japan) for diagnosis and treatment. The patient group consisted of 51 men and 25 women with an average age of onset of 33.9 years (SD = 15.3). Prior to collection of peripheral blood, informed consent was obtained from all healthy individuals and patients by explaining the details of the study. Label the ends with fluorescent reagents 6-FAM, HEX or TET (PE Biosystems, Foster City, CA) to determine the number of repeat units (microsatellite allele genotypes) at the microsatellite loci exhibiting polymorphism it allows unilateral primers were microsatellite (C in _c 11 species synthesized 2_A, Cl_4- 1, Cl-2_5 , Cl_4- 3, Cl_3_l, C and 2- 6, Cl_3_2, C2_4- 4, C4_2_12, C4_2_25 , C3_2_ll) are shown in Table 1. The PCR reaction mixture consisted of 50 ng of genomic DNA, dNTPs (2.5 mM each) 2j 10 x buffer (100 mM Tris-HCl, pH 8.3, 500 mM KC1, 15 niM MgCl ₂ ) 21 and 20 pmol of forward and reverse primers, and Evening Recombinant Taq Polymerase (Takara Shuzo, Kyoto, Japan) 0.5U is included in total 201. After initial denaturation at 96 ° C for 5 minutes, 30 cycles of 96 ° C for 1 minute, 55 ° C for 30 seconds, and 72 ° C for 45 seconds were performed using an automatic thermal cycler (Takara Shuzo). This was followed by a final extension at 72 ° C for 4 minutes. The amplification product was denatured at 100 ° C for 5 minutes, mixed with a stop buffer containing formamide, applied to each lane with the size standard marker of GS500 Tamra (PE Biosystems), and placed in an automated DNA sequencer. Separation was performed on a 4% polyacrylamide denaturing sequencing gel containing 8M urea. Fragment size was automatically determined using GeneScan software (PE Biosystems). Table 1 Microsatellite markers used for correlation analysis Microsatellite Position Repeat unit PCR primer

 C1_2_A Tel. (0 Vh) IMlCB (CA) 23 CA: AATAGCCATGAGAAGCTATGTGGGGGAG

 Cen. (89 W) / M1CA TG: CTACCTCCTTGCCAAACTTGCTGTTTGTG

Cl_4_l Tel. (40 iMICA (CAAA) ₆ CAAA: CGAGAACAACTGGCAGGACTG

 Cen. (6 kb) / HLA-B TTTG: GACAGTCCTCATTAGCGCTGAGG

CI— 2— 5 Tel. (62 kb) / HLA-B (CA) ₄ AA (CA) ₂₀ CA: CAGTAGTAAGCCAGAAGCTATTAC

 Cen. (19 kb) / LA-C TG: AAGTCAAGCATATCTGCCATTTGG

CI—4-1 3 Tel. (26 klia LA-C (GGAA) ₁₈ GGAA: TAGAAAACGCAATCTCGGCC

 Cen. (71 kb) / OTF3 TTCC: CTGGATTAACCTGGAGACTC

C1J_1 Tel. (27 kb) IHLA-C (TTG) ₈ TTG: CAGTGACAAGCACCTGGCAC

 Cen. (69 kb) / OTF3 CAA: GCCAGATGTGGTGGCATGC

C1 J5 Tel. (85 kb) / HLA-C (TA) ₁₇ TA: TGTTCAGACCTCTTCCTGCC

 Cen. (11 kb) / OrFJ AT: GACTAGCTCTTGACTACTTG

Cl_3_2 Tel. (3 kb) / OTF3 (TAA) ₁₆ TAA: TAGGGATGGTCCCAAACGTG

 Cen. (7 kb) / S TTA: CCCGTGCAGGACTGATCTCC

C2-4-4 Tel (80 kb) / 5 (GAAA) ₆ AAAA (GAAA) _: GAAA: GGCTTGACTTGAAACTCAGAGACC

 TTTC: T ATCTACTTATAGTCTATCACGG

C4 J2 Tel. (75 kb) / DDR (CA) ₁₃ CA: GAGCCACGGAGAGTCTCCCTTTATC

 Cen. (89 kb) / TUBB TG: TCCAGGAACTGTGAGTAGTAAGAAC

C4-2-25 Tel. (69 kb) / TUBB (TG) ₁₆ TG: TCTTCTGTGCAAGCAATGCACTGTAC

 Cen. (47 kb) / HSGT260 CA: ATGTTACTTTTAGAAGATAACACTC

C3 2 11 Tel. (50 kb) / «LA- £ (GA) ₂₂ TA (GA) ₈ GA: AGATGGCATTTGGAGAGTGCAG

 Cen. (21 kb) / M / CC TC: TCCTTACAGCAGAGATATGTGG Markers are in the order of centromere to telomere, C12-21 A, Cl_4_l, C1_2_5 CI—4—3, CI—3_1, CI—2_6, Cl— 3-2, C2_4_4, C4-2_12, C4-2_25 and C3-2-11 (Fig. 1). The repeat units were determined from the sequence data determined by the inventors (Shi ina, T. et al. (1999) Immunol. Rev., 167, 193-199). All markers were established by Tamiya et al. (Tamiya, G. et al. (1998) Tissue Antigens, 51, 337-346; Tamiya, G. et al. (1999) Tissue Antigens 54: 221-228). Tel stands for telomere, Cen for centromere. The sequences of the PGR primers were set as SEQ ID NOs: 1 to 22 in order from the top.

Allele frequency was assessed by direct counting. The significance of the allele distribution between patients and controls was tested by ^two methods with continuity correction and Fisher's exact test (P-value test). P values were corrected by multiplying the number of microsatellite alleles observed at each locus (Pc). Levels with Pc <0.05 were considered statistically significant. The odds ratio for the risk of psoriasis vulgaris was calculated from a 2x2 contingency table. Exact P-value test for Hardy-Weinberg ratio for multiple alleles Were simulated by the Markov chain method in the Genepop software package (Taiya, G. et al. (1998) Tissue Antigens, 51, 337-346; Tamiya, G. et al. (1999) Tissue Antigens 54 : 221-228; Guo, SW and Thompson, EA (1992) Biometrics, 48, 361-372). The Markov chain method has the advantage that a complete calculation for testing the Hardy-Weinberg ratio can be made for small numbers of alleles and samples. When the number of alleles was <5, the exact probability (exact P-value) was calculated by the complete calculation method. The level of P <0.1 was considered statistically significant for the Hardy-Weinberg equilibrium.

The phenotypic frequency of HLA-Cw6 in the patient group (8 of 76, 10.5%) was significantly higher, with a Pc value of 0.02 (oz ratio = 15.88). As shown in Table 2, alleles with a statistical significance of <0.05 relative to Pc values in the patient group were found in the following four microsatellite loci: C and 2J allele 303 ( ² = 12.62). , Pc = 0.0015), CI—alleles of 3_2 357 ( ² = 7.91, Pc = 0.0034), alleles of C2_4_4 255, 259 ( ² = 9.53, Pc = 0.0012 and ² = 11.58, Pc = 0.0022, respectively), C4 — 2—12 alleles 223 (^ ² = 7.59, Pc = 0.036). Allele naming in each microsatellite matrix was based on the size length of the amplified fragment. The most significant correlation was observed for the C1-126 allele 303. All four microsatellites in the area from C1 2-6 to C4-2_12 showed statistically significant differences in allele frequency between patients and controls (Table 2 and Figure 1). .

Table 2.Statistically significant alleles correlated with psoriasis vulgaris

a (c) Centromere side of HLA-C gene, (t) Telomere side of HLA-C gene.

b Judgment by Fisher's exact test.

. Corrected by multiplying the number of microsatellite alleles at each locus did. Pc values less than 0.05, which were considered statistically significant, are underlined.

Deviation from Hardy-Weinberg ratio (probability test) and heterozygous reduction for the null hypothesis of Hardy-Weinberg equilibrium (Raymond, M. and Rous set, F. (1995) J. Hered., 86, 248 -249; Rousset, F. and Raymond, M. (1995) Genetics, 140, 1413-1419) using the Markov chain method (Guo, SW and Thompson, EA (1992) Biometrics, 48, 361-372). Exact tests of Hardy-Weinberg ratios for 11 microsatellite markers were also performed. As expected, all 11 markers examined followed the Hardy-Weinberg equilibrium in healthy controls (P> 0.25). In contrast, in the patient group, as shown in Table 3, significant deviations from the Hardy-Weinberg equilibrium were observed at the five loci (P <0.1; C1_2_5, C1_3_1, C1 2J, C 3-2 and C2_4-4). In addition, a significant decrease in heterozygotes was observed at the five loci (P <0.1; Cl_4_3, C_31, Cl_3_2, C2_4_4 and C4_2_12). In contrast, no increase in heterozygotes was observed in any of the markers. At three microsatellite loci (C3-11, Cl_3_2 and C2-4_4) located in the area from C1-1-3 to C2-4-4, significant P-values were obtained for both the probability test and the heterozygous reduction test. The findings are noteworthy (Table 3 and Figure 1). In particular, Cl_3_2 and C2_4_4 reached extremely significant P values in both tests.

Table 3 Exact test of Hardy-Weinberg ratio for microsatellite

 b

Sedentary position HW ³ SE to cue SE to te α expected value C heterotranslation

CJ-2-A 0.3939 0.0043 0.2881 0.0042 U.oUl, / ο

C1JJ 0.2443 0.0016 0.7024 0.0019 0.633 0.613

C1 2 0, W «0.0006 0.1599 0.0042 0.883 0.842

C1 3 0.1968 0.0065 0,0362 0.0028 0.89 0.829

C1JJ 0-0203 0.561 0.461

C1J 0.0889 0.0023 0.1776 0.0027 0.676 0.579

C1J 0,0172 0.0005 0,0051 0.0003 0.848 0.75

C2JJ 0.Q097 0.0004 0,0093 0.0003 0.655 0.553

C4 J2 0.3006 0.0052 0,0303 0.0013 0.679 0.635

C4 25 0.666 0.0041 0.6684 0.007 0.466 0.481

C3 2 Π 0.1837 0.0057 0.4787 0.0078 0.9 0.895 In the table, the exact probability (exact P-value) was estimated by a simulation based on the Markov chain method using the following parameters: dememorization number = 1000,, = = 400, notch 0β | 5 per time (= 8000. When the number of alleles is <5, the exact probability was calculated by the complete calculation method. ΡValues are underlined SE, standard error.

a Deviation from Hardy-Weinberg ratio (probability test).

b Heterozygous reduction to the null hypothesis of Hardy-Weinberg equilibrium. ^c Expected heterozygous frequency in patient population.

d Observed heterozygous frequency in the patient population.

As described above, four of the analyzed microsatellites (C and 2_6, Cl_3_2, C2_4_4 and C4 and 2_12) located in the area from C and 2J to C4__2_12 have statistically significant differences between patients and controls. A significant difference was observed (Table 2 and FIG. 1). In addition, a Hardy-Weinberg equilibrium analysis of the patient group showed a probability test and heterozygotes for three microsatellite loci (Cl_3_l, Cl_3_2 and C2-4_4) in the area from Cl_3_l to C2-14-4. Both reduction tests showed significant deviations from Hardy-Weinberg equilibrium (Table 3 and FIG. 1). In particular, Cl_32 and C24 were extremely significant in both tests. P value reached. Although the mode of inheritance of psoriasis is unknown, the frequency of heterozygotes at these five microsatellite loci was lower than expected in patients (Table 2), indicating that this disease has a high genetic penetrance. Although it does not exist, it seems to indicate that it is a recessive HLA trait. To summarize the above, the lllkb area from C1_2_6 (89kb telomere of HLA-C) to C2_4_4 (200kb telomere of HLA-C) is statistically related to the allele distribution and deviation from Hardy-Weinberg equilibrium. The assessments by both determined that it was an important common area for psoriasis vulgaris with a confidence level of> 95% (Figure 1). Emphasis that nearly identical key areas for psoriasis vulgaris were identified by both independent statistical methods, the former dealing with patient and control cases overnight and the latter dealing only with patient data. There is a need to. The results indicate that the transmission / disequilibrium test (TDT) and parametrization in patients with HLA class I (HLA-A, -B and -C) and class II (HLA-DRB1 and -DQB1) alleles Based on Rick linkage analysis, this is consistent with previous mapping data indicating that a susceptibility gene for psoriasis vulgaris is located on the telomere side of the HLA-C gene (Jenisch, S. et al. (1998) Am. J. Hum. Genet., 63, 191-199). Industrial applicability

 According to the present invention, there has been provided a gene mapping method characterized by using a microsatellite genetic polymorphism marker substantially set at a ratio of about 1 per 100 kb. This enables efficient mapping of the disease-causing gene. Further, the method of the present invention is also useful for mapping genes involved in any phenotype having a genetic factor, other than the causative gene of a disease.

Claims

The scope of the claims

1. A gene mapping method characterized by using a microsatellite genetic polymorphism marker substantially set at a ratio of one per 50 to 150 kb on average.

 2. A gene mapping method characterized by using microsatellite genetic polymorphism markers substantially set at a ratio of one per 80 to 120 kb on average.

 3. A gene mapping method characterized by using a microsatellite genetic polymorphism marker substantially set at a ratio of one per 90 to 110 kb on average.

 4. The mapping method according to any one of claims 1 to 3, wherein the gene is a disease-causing gene.

 5. The microsatellite genetic polymorphism marker according to claim 1, wherein the average number of alleles is 5 or more, and the average heterozygosity is 60% or more. The method according to any of the above.

 6. The mapping method according to any one of claims 1 to 5, wherein the mapping area is an HLA area.

 7. The mapping method according to any one of claims 1 to 6, wherein the frequency of the polymorphism marker is compared between a control healthy subject and a randomly selected disease patient.

 8. The method according to claim 1, wherein analysis of the genetic polymorphism marker of the microsatellite is performed using a DNA chip and mass spectrometry.

 9. A method for identifying a target gene by analyzing SNP in a region narrowed down by the mapping method according to any one of claims 1 to 8.

 10. A gene specified by the method according to any one of claims 1 to 9.

 11. A protein encoded by the gene according to claim 10.

 12. An antibody against the protein of claim 11.

13. The complement of the gene of claim 10 or one of its complements. A polynucleotide comprising 15 nucleotides.