JP2006061108A - Cancer diagnosis targeting gasdermin b and establishment of medicine - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for examining cancers using expression and variation of GSD(gasdermin)MB(agene) and a GSDMB splicing variant as indexes and to obtain an examination medicine used in the examination method, the GSDMB variant and the GSDMB splicing variant as subjects of examination. <P>SOLUTION: It is found that, in spite of no expression of GSDMB in normal tissue in many cancers, when a person has a cancer, GSDMB is overexpressed regardless of amplification of human 17 chromosome 17q12 amplicon region. An anti-GSDMB polyclonal antibody is prepared, and confirmation of antigenic specificity of tissue section level is elucidated. In GSDMB, existence of amino acid change at two parts is found in an undifferentiated stomach cancer patient and a signet ring cell cancer patient. Specific amino acid variation is found in the signet ring cell cancer (sig) patients and nonsolid poorly differentiated cancer (port2) patients in an exceedingly high ratio and the amino acid variation suggests deep association with cancer occurrence, infiltration, metastasis, or the like. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a cancer testing method using GSDMB and GSDMB splicing variant expression and mutation as indices. The present invention also relates to a test agent used in the test method, a GSDMB variant and a GSDMB splicing variant to be tested. The present invention also relates to a cancer therapeutic agent comprising an antibody that specifically binds to the protein as an active ingredient. It also relates to a GSDMB promoter that is selectively used when cancerous.

  The canceration process involves changes at multiple gene levels, such as accumulation of mutations in many genes, increased expression, and decreased expression. One of these causes is genomic instability.

  Genomic instability is well studied in human carcinogenesis. For example, partial cuts and translocations of chromosomes, deletions, duplications, homogeneously stained regions (HSR) and double minute (DM) chromosomes are phenomena that are remarkably observed in cancer cells. Cancer cells are sometimes reported to have one or both of HSR and DM. These genome rearrangements are caused by DNA double strand break down, and as a result, are thought to lead to amplification of oncogenes and deletion of tumor suppressor genes (Non-patent Document 1).

  Amplification of human chromosome 17 long arm, 17q12 amplicon, is often observed in breast cancer, stomach cancer, ovarian cancer, bladder cancer, and uterine cancer. ERBB2, which belongs to the epidermal growth factor receptor family, which is a proto-oncogene, is located in this region, and as a result of canceration, the number of copies per genome is amplified and overexpressed in about 20% of breast cancer and gastric cancer. (Non-Patent Documents 2 and 3). In the process of structural analysis of 17q12 amplicon, the present inventors have confirmed that the region where CAB1 / MLN64, CAB2, ERBB2, and GRB7 are located in this region is generally or mainly amplified in canceration. I found it. In addition, it was reported that gasdermin (renamed as mouse gasdermin A-1) was present in a region homologous to human 17q12 amplicon in mice (Non-Patent Document 4).

Prior art document information related to the invention of the present application is shown below.
Coquelle, A., Pipiras, E., Toledo, F., Buttin, G., and Debatisse, M. (1997). Expression of fragile sites triggers intrachromosomal mammalian gene amplification and sets boundaries to early amplicons.Cell 89, 215- 225. van de Vijver, M., van de Bersselaar, R., Devilee, P., Cornelisse, C., Peterse, J, and Nusse, R. (1987). Amplification of the neu (c-erbB-2) oncogene in human mammary tumors is relatively frequent and is often accompanied by amplification of the linked c-erbA oncogene. Mol. Cell. Biol. 7, 2019-2023. Yokota, J., Yamamoto, T., Miyajima, N., Toyoshima, K., Nomura, N., Sakamoto, H., Yoshida, T., Terada, M., and Sugimura, T. (1988). Genetic alterations of the c-erbB-2 oncogene occur frequently in tubular adenocarcinoma of the stomach and are often accompanied by amplification of the v-erbA homologue.Oncogene 2, 283-287. Saeki, N., Kuwahara, Y., Sasaki, H., Satoh H., and Shiroishi, T. Gasdermin (Gsdm) localizing to mouse chromosome 11 is predominantly expressed in upper gastrointestinal tract but significantly suppressed in human gastric cancer cells. Genome., 11 (9): 718-724, 2000.

  The inventors of the present invention have found that the causative gene of Recombinant-induced mutation 3 (Rim3) found in the National Institute of Genetics / Mammalian Genetic Laboratory is a GasderminA cluster (hereinafter referred to as GsdmA) that exists as a cluster on mouse chromosome 11. It was clarified that it is GasderminA-3 (hereinafter referred to as GsdmA3), which is one gene in the cluster (PCT / JP03 / 02345). The human homologous gene of the mouse GsdmA cluster is a human GasderminA (hereinafter referred to as GSDMA) gene present on human chromosome 17. The mouse GsdmA cluster is formed from three genes, GsdmA1 (GasderminA-1), GsdmA2 (GasderminA-2), and GsdmA3, whereas in humans, only the GSDMA gene is present on chromosome 17.

  Moreover, by analyzing the base sequence of the BAC clone including the vicinity of human GSDMA, it was found that there are genes similar to GsdmA2 and GsdmA3 but clearly different from GsdmA2 and GsdmA3 in mice. The cDNA was isolated using the PCR method. This gene was named GasderminB (hereinafter referred to as GSDMB) (referred to as GasderminB-1 in PCT / JP03 / 02345).

  GSDMB is a gene belonging to the Gsddermin Family member, but it does not exist in mice but exists only in humans. In addition, it has a feature that the Cx-terminal Rex mutation region conserved in all Gsddermin families is missing. GSDMB is present on human chromosome 17 17q12 amplicon. In this region, amplification of the genomic region is observed in gastric cancer, esophageal cancer, breast cancer, skin cancer, and ovarian cancer, and it is considered that there are genes that are deeply involved in these canceration. So far, we have shown that GSDMA, a member of the same Gsddermin Family as GSDMB and present in the same human chromosome 17 17q12 amplicon, functions as a tumor suppressor gene in gastric cancer and esophageal cancer ( PCT / JP03 / 02345). However, the function of GSDMB was unclear.

  The present invention has been made in view of such circumstances, and an object of the present invention is to provide a cancer testing method using GSDMB and GSDMB splicing variant expression and mutation as indices. Also provided are a test agent used in the test method, a GSDMB variant and a GSDMB splicing variant to be tested. The present invention also provides a cancer therapeutic agent comprising an antibody that specifically binds to the protein as an active ingredient. Furthermore, it provides a promoter for GSDMB that is selectively used when cancerous.

  In order to solve the above problems, the present inventors first conducted intensive research on the expression of GSDMB, and although GSDMB is not expressed in normal tissues in many cancers, It was found that human chromosome 17 was overexpressed regardless of the amplification of the 17q12 amplicon region. The present inventors GSDMB is expressed in breast cancer tissue, stomach cancer tissue, esophageal cancer tissue, colon cancer tissue, skin cancer tissue, lung cancer tissue, skin cancer, breast cancer, esophageal cancer, cervical cancer, stomach cancer, colon cancer, pancreas It was revealed that it is expressed in cancer and liver cancer-derived cell lines. GSDMB was expressed not only in cancer tissues but also in precancerous conditions such as polyps in the large intestine and intestinal epithelialization in the stomach, and in some normal tissues. Furthermore, it was confirmed that the expression level of GSDMB in each normal, precancer, and cancer tissue increased in proportion to the progression of canceration.

  In addition, the inventors of the present application made an anti-GSDMB polyclonal antibody and clarified that antigen specificity at the tissue section level can be confirmed.

  In addition, the inventors of the present application have two promoters in GSDMB in the pre-cancerous stage (including the stage where GSDMB expression has already started, although it is classified as normal tissue in appearance) It was found that the cancer was completely suppressed and only the other was selectively used. Moreover, it was clarified that more and more alternative splicing variants were transcribed from selectively used promoters, and that specific band patterns existed in breast cancer tissues. Furthermore, the expression of variants was confirmed in all cancer tissues and cancer cell lines examined.

  Furthermore, the present inventors have found that there are two amino acid changes in patients with undifferentiated gastric cancer (signature ring cell carcinoma, non-solid poorly differentiated cancer) in GSDMB. The position was an amino acid conserved in the entire Gasdermin family, and was in the vicinity of alanine that was conserved among all the families in which the mutation was present in the abnormal epithelial mutant mouse Rim3. The amino acid mutations found by the present inventors were found in a very high proportion in patients with signet ring cell carcinoma (sig) and non-solid poorly differentiated cancer (por2).

  GSDMB SNP (Single nucleotide polymorphism) was analyzed using the SNP database (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=snp). As a result, the glycine at the 304th amino acid was found to be arginine. It was found that the causative base that changes the amino acid 311 proline to serine (base C → T) was originally a SNP present in the human genome. As a result of the SNP database survey, the appearance frequency of the base A corresponding to the 304th amino acid change was 26.4%, and the base T corresponding to the 311th amino acid change was 26.7%. Furthermore, the frequency of appearance in patients with signet ring cell carcinoma and poorly differentiated poorly differentiated cancer was much higher than the frequency of appearance of this SNP data. These results seem to suggest that this amino acid mutation is deeply involved in the development, invasion, metastasis, etc. of these cancers.

  That is, the present inventors have succeeded in developing a cancer testing method using GSDMB and GSDMB splicing variant expression and mutation as an index, thereby completing the present invention.

More specifically, the present invention provides the following (1) to (22).
(1) A method for examining cancer, comprising a step of measuring the expression level of the protein according to any one of the following (a) to (d).
(A) a protein encoded by DNA consisting of the base sequence described in any one of the odd-numbered sequences of SEQ ID NOs: 1 to 68 (b) described in any of the even-numbered sequences of SEQ ID NOs: 1 to 68 Protein (c) consisting of an amino acid sequence consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence described in any of the even-numbered sequences of SEQ ID NOs: 1 to 68 A protein derived from nature and having a functional equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 (d) The odd-numbered proteins of SEQ ID NOs: 1 to 68 A protein encoded by a naturally-occurring DNA that hybridizes under stringent conditions with DNA comprising the base sequence described in any of the sequences, No .: Protein functionally equivalent to the protein consisting of the amino acid sequence described in any of the even-numbered sequences of 1 to 68 (2) Protein consisting of the amino acid sequence of the even-numbered sequences of SEQ ID NOS: 1-34 A method for testing cancer, comprising a step of detecting a mutation in.
(3) The cancer testing method according to (2), wherein the mutation in the protein is a mutation involving amino acid substitution.
(4) A method for examining cancer, comprising a step of detecting a mutation in the DNA sequence described in the odd-numbered sequence of SEQ ID NOs: 1 to 34.
(5) The method for examining cancer according to (4), wherein the mutation in the DNA sequence is a mutation accompanied by base substitution.
(6) The cancer test according to (1) to (5), wherein the cancer is skin cancer, breast cancer, stomach cancer, lung cancer, colon cancer, esophageal cancer, cervical cancer, pancreatic cancer or liver cancer. Method.
(7) An antibody that binds to the protein or fragment thereof described in any of (a) to (d) below.
(A) a protein encoded by a DNA comprising the base sequence described in any of the odd-numbered sequences of SEQ ID NOs: 1 to 68 (b) described in any of the even-numbered sequences of SEQ ID NOs: 1 to 68 Protein (c) containing an amino acid sequence (c) consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of any of the even-numbered sequences of SEQ ID NOs: 1 to 68 A protein derived from nature and having a functional equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 (d) The odd-numbered proteins of SEQ ID NOs: 1 to 68 A protein encoded by naturally occurring DNA that hybridizes under stringent conditions with DNA comprising the base sequence described in any of the sequences, Comprising the antibody according to the protein comprising the amino acid sequence of any one of the even-numbered sequence of 1 to 68 functionally equivalent protein (8) (7), diagnostic agent for cancer.
(9) A therapeutic drug for cancer comprising the antibody according to (7) as an active ingredient.
(10) A test agent for cancer comprising an oligonucleotide that hybridizes to the DNA according to any one of the following (a) to (d) and has a chain length of at least 15 nucleotides.
(A) DNA comprising the base sequence described in any of the odd-numbered sequences of SEQ ID NOs: 1 to 68
(B) DNA encoding a protein comprising the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68
(C) a naturally occurring protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 A DNA that encodes a protein that is functionally equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68
(D) a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence of any one of the odd-numbered sequences of SEQ ID NOs: 1 to 68, DNA encoding a protein functionally equivalent to the protein consisting of the amino acid sequence described in any of the even-numbered sequences
(11) The test agent according to (8) or (10), wherein the cancer is skin cancer, breast cancer, stomach cancer, lung cancer, colon cancer, esophageal cancer, cervical cancer, pancreatic cancer or liver cancer (12) ) DNA according to any one of (a) to (c) below.
(A) DNA comprising the base sequence set forth in SEQ ID NO: 69
(B) a DNA comprising a base sequence in which one or more bases are substituted, deleted, added and / or inserted in the base sequence set forth in SEQ ID NO: 69, wherein the base sequence set forth in SEQ ID NO: 69 DNA with promoter activity equivalent to DNA containing
(C) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 69, and has a promoter activity equivalent to that of the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 69 DNA
(13) DNA obtained by functionally binding the DNA according to (12) and a DNA encoding a protein that acts in a suppressive manner in cancer.
(14) The DNA according to (13), wherein the protein that acts suppressively in cancer is a tumor suppressor protein or a cytotoxic protein.
(15) A vector into which the DNA according to any one of (12) to (14) is inserted.
(16) The vector according to (15), which is for gene therapy.
(17) A transformed cell carrying the vector according to (15) or (16).
(18) The DNA according to any one of (a) to (d) below.
(A) DNA comprising the base sequence described in any one of the odd-numbered sequences of SEQ ID NOs: 3 to 68
(B) DNA encoding a protein comprising the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 3 to 68
(C) a naturally occurring protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 3 to 68 A DNA that encodes a protein that is functionally equivalent to a protein consisting of the amino acid sequence set forth in any of the even-numbered sequences of SEQ ID NOs: 3 to 68
(D) a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence of any one of the odd-numbered sequences of SEQ ID NOs: 3 to 68, DNA encoding a protein functionally equivalent to the protein consisting of the amino acid sequence described in any of the even-numbered sequences
(19) A protein inserted from the DNA according to (18) (20) A vector into which the DNA according to (18) is inserted.
(21) A transformed cell carrying the DNA according to (18) or the vector according to (19).
(22) An oligonucleotide that hybridizes to the DNA of (18) and has a chain length of at least 15 nucleotides.

According to the present invention, GSDMB is deeply involved in the canceration process, and there are specimens that are already in the direction of canceration even if they are classified as normal tissues by pathological identification, especially at the tissue level. It was shown that. In other words, by examining specimens obtained by biopsy using the expression level of GSDMB as an index, cancer diagnosis at an early cancer stage that has been impossible to discriminate until now (the stage that has been judged normal until now) can be performed. It becomes possible.
Moreover, it is expected that the antibody of the present invention can be used as a new tumor marker. Many of the tumor markers currently used are commonly expressed in many cancer tissues, and it is difficult to identify the primary site by itself. For example, CA-19-9 is used as a tumor marker for pancreatic cancer and the like, and this marker shows an increase in antigen in general gastrointestinal cancer. The present inventors have clarified that a band pattern specific to at least breast cancer exists among alternative splicing products of GSDMB. By producing an antibody against this breast cancer-specific product and using it as a tumor marker, it becomes possible to identify the primary cancer site only with a simple tumor marker test. In addition, the primary site of cancer can be identified by designing a primer or probe for this specific product and detecting its expression. This means very much even in the early detection and early treatment principles that are the principles of cancer treatment. Furthermore, the anti-GSDMB antibody is considered to be usable as a highly safe pharmaceutical (anti-GSDMB antibody anticancer drug) that acts specifically on cancer and has few side effects. Anti-GSDMB antibodies are expected to function as anticancer drugs by attacking cancer cells using the patient's own immune response. Anti-GSDMB antibody is an antibody that binds to GSDMB protein expressed specifically in cancer cells, and when the antibody binds to GSDMB protein, signal transduction by antigen-antibody reaction occurs and activates immune cells in the patient's body, and immune cells It is thought that the increase of cancer can be suppressed by inducing the attack on cancer cells.

  Since anti-GSDMB antibodies target GSDMB proteins that are specifically expressed in cancer, they are specifically treated for cancer. That is, since it does not act on normal cells, side effects are expected to be extremely small. Furthermore, GSDMB is commonly expressed in all cancers, and thus can be applied to a wide range of cancers. Moreover, anti-GSDMB antibody (anticancer drug) can estimate the effectiveness of an antibody drug by examining the expression level of GSDMB in a patient's cancer cells before treatment. Therefore, it is possible to perform treatment according to the pathology of each individual patient.

  By clarifying the mechanism of selection of the promoter of the present invention and alternative splicing in the future, it is expected that a great clue for elucidating the canceration process at the transcription level can be obtained. The GSDMB promoter is considered to be very useful for gene therapy. It does not function in completely normal tissues, functions from the initial canceration state, and its activity increases with the progression of canceration, and the target gene, such as a tumor suppressor gene, is linked to the GSDMB promoter. It becomes possible to express a gene. Due to this extremely high cancer specificity, even a product encoding a highly toxic product as a target gene is considered to have no effect on normal tissues.

  The amino acid mutations found in the present invention were found in a very high proportion in patients with signet-ring cell carcinoma (sig) and poorly differentiated poorly differentiated cancer (por2), and GSDMB was a very early precancer. Considering that expression begins at the stage, it is very important to diagnose specimens collected by biopsy etc. at the time of endoscopy or cancer diagnosis using GSDMB expression level, base change, and amino acid change as indicators. It is considered possible to find undifferentiated cancers such as non-solid poorly differentiated cancers and signet ring cell cancers at an early stage.

  Furthermore, by the method of the present invention, it is considered that the risk of non-solid poorly differentiated cancer and signet-ring cell cancer can be determined by analyzing the genomic nucleotide sequence of the mutated region in normal cancer. For example, whether it has the SNP of base A, which causes GSDMB amino acid 304 glycine to change to arginine, or the base T, which causes amino acid 311 th proline to change to serine, or only one side It is thought that it is possible to predict the risk depending on whether you have both, hetero or homo.

  The present invention relates to a method for examining cancer, comprising the step of measuring the expression level of GSDMB, a GSDMB splicing variant, a GSDMB variant, and a GSDMB splicing variant variant.

  In the present invention, the cancer to be examined may be any cancer that develops in mammals including humans. For example, cancers such as lymphoma and melanoma are also included as cancer in the present invention. More preferably, skin cancer, breast cancer, stomach cancer, lung cancer, esophageal cancer, cervical cancer, colon cancer, pancreatic cancer or liver cancer can be mentioned.

  The nucleotide sequence of GSDMB cDNA is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the DNA is shown in SEQ ID NO: 2.

  A variant of GSDMB in the present invention is a naturally occurring protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 2. A protein functionally equivalent to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 2 can be exemplified. A protein encoded by a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, wherein the protein comprises the amino acid sequence set forth in SEQ ID NO: 2 Functionally equivalent proteins can also be mentioned as GSDMB variants. The nucleotide sequence of the cDNA of a more preferred variant of GSDMB is shown in SEQ ID NO: 35, and the amino acid sequence of the protein encoded by the DNA is shown in SEQ ID NO: 36.

  In the present invention, the number of amino acids to be mutated is not particularly limited, but is usually within 30 amino acids, preferably within 15 amino acids, and more preferably within 5 amino acids (for example, within 3 amino acids). The amino acid residue to be mutated is preferably mutated to another amino acid in which the properties of the amino acid side chain are conserved. For example, amino acid side chain properties include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl group-containing side chains (S, T, Y), sulfur atom-containing side chains Amino acids having amino acids (C, M), amino acids having carboxylic acid and amide-containing side chains (D, N, E, Q), amino acids having base-containing side chains (R, K, H), aromatic-containing side chains The amino acids (H, F, Y, W) that can be used can be listed (the parentheses indicate the single letter of the amino acid). It is already known that a polypeptide having an amino acid sequence modified by deletion, addition and / or substitution by one or more amino acid residues to a certain amino acid sequence maintains its biological activity. (Mark, DF et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, MJ & Smith, M. Nucleic Acids Research (1982) 10, 6487-6500, Wang, A et al., Science 224, 1431-1433, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).

  In the present invention, “functionally equivalent” means that the target protein has a biological function and biochemical function equivalent to the protein. In the present invention, the biological function and biochemical function of the protein include the property of being highly expressed specifically in cancer cells. Examples of methods for measuring such properties include the methods described in Examples, but are not limited to these methods. Biological properties include the specificity of the site to be expressed and the expression level.

  In order to prepare DNA encoding a “functionally equivalent protein” of a protein of interest, methods well known to those skilled in the art include hybridization techniques (Southern, EM (1975) Journal of Molecular Biology, 98, 503) and polymerase chain reaction (PCR) technology (Saiki, RK et al. (1985) Science, 230, 1350-1354, Saiki, RK et al. (1988) Science, 239, 487-491). Can be mentioned. That is, for those skilled in the art, GSDMB base sequence (SEQ ID NO: 1) or a part thereof is used as a probe, and an oligonucleotide that specifically hybridizes to GSDMB (SEQ ID NO: 1) is used as a primer and highly homologous to GSDMB. It is usually possible to isolate DNA having sex. Thus, DNA encoding a protein having a function equivalent to GSDMB that can be isolated by hybridization technology or PCR technology is also included in the DNA of the present invention.

  In order to isolate such DNA, the hybridization reaction is preferably carried out under stringent conditions. In the present invention, stringent hybridization conditions refer to hybridization conditions of 6M urea, 0.4% SDS, 0.5xSSC or equivalent stringency. Isolation of DNA with higher homology can be expected by using conditions with higher stringency, for example, conditions of 6M urea, 0.4% SDS, 0.1 × SSC. The isolated DNA is considered to have high homology with the amino acid sequence of the target protein at the amino acid level. High homology means a sequence of at least 50% or more, more preferably 70% or more, more preferably 90% or more (for example, 95%, 96%, 97%, 98%, 99% or more) in the entire amino acid sequence. Refers to the identity of The identity of amino acid sequences and nucleotide sequences is determined using the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc Natl Acad Sci USA 90: 5873, 1993) by Carlin and Arthur. it can. Programs called BLASTN and BLASTX based on the BLAST algorithm have been developed (Altschul SF, et al: J Mol Biol 215: 403, 1990). When analyzing a base sequence using BLASTN, parameters are set to, for example, score = 100 and wordlength = 12. In addition, when an amino acid sequence is analyzed using BLASTX, the parameters are, for example, score = 50 and wordlength = 3. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific methods of these analysis methods are known.

  As the “GSDMB splicing variant” of the present invention, various cancer tissues and cancer cell line cDNAs are used as templates, PCR is performed with a primer set of GSDMB710F (SEQ ID NO: 72) and GSDMB1185R (SEQ ID NO: 73), and a 3% agarose gel is used. Examples of the DNA that can be used to amplify fragments of about 540 bp, about 500 bp, about 470 bp, about 420 bp, about 400 bp, about 380 bp, and about 350 bp by the electrophoresis used (100 volts 2 hours 50 minutes). As a more preferable base sequence of genomic DNA of GSDMB splicing variant, the odd-numbered base sequence of SEQ ID NO: 3-34, and as the amino acid sequence of the protein encoded by the DNA, the even-numbered sequence of SEQ ID NO: 3-34 Can be mentioned. The odd base sequences of SEQ ID NOs: 3 to 34 are those of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33. The even-numbered amino acid sequences of SEQ ID NOs: 3 to 34 are SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, It is the arrangement of 32 and 34.

  The “GSDMB splicing variant variant” of the present invention includes substitution, deletion, insertion and / or substitution of one or more amino acids in the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 3 to 34. A protein that is a naturally derived protein consisting of an added amino acid sequence and functionally equivalent to a protein consisting of an amino acid sequence described in any of the even-numbered sequences of SEQ ID NOs: 3 to 34 can be mentioned. A protein encoded by a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the base sequence described in any one of the odd-numbered sequences of SEQ ID NOs: 3 to 34, wherein SEQ ID NO: A protein functionally equivalent to a protein consisting of the amino acid sequence described in any of the even-numbered sequences of 3 to 34 can also be mentioned as a variant of the GSDMB splicing variant.

  More preferable GSDMB splicing variant variant DNA base sequence is the odd number base sequence of SEQ ID NOs: 37 to 68, and the amino acid sequence of the protein encoded by the DNA is the even number sequence number: 37 to 68. Amino acid sequences can be mentioned. The odd base sequences of SEQ ID NOs: 37 to 68 are those of SEQ ID NOs: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67. The even-numbered amino acid sequences of SEQ ID NOs: 37 to 68 are 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68 Is an array of

  In the cancer testing method of the present invention, first, the expression level of the protein is measured. The expression level of the protein can be measured by methods known to those skilled in the art. In a preferred embodiment of the above inspection method, first, a test sample is prepared from a subject. For example, protein mRNA is extracted from a subject's blood, skin, oral mucosa, hair, tissue or cells collected or excised by surgery or biopsy, etc. according to a standard method, and Northern hybridization method using this mRNA as a template, or RT- By carrying out the PCR method, the transcription level of the gene can be measured. Furthermore, the expression level of the protein can be measured using DNA array technology.

  Alternatively, the translation level of the gene can be measured by collecting a fraction containing the protein according to a standard method and detecting the expression of the protein by electrophoresis such as SDS-PAGE. Moreover, it is also possible to measure the translation level of a gene by performing Western blotting using an antibody against the protein and detecting the expression of the protein.

  In the method for detecting cancer, after measuring the expression level of the protein, it is determined whether or not it is cancerous based on the expression level. Since the expression of GSDMB increases with the progression of cancer, it can be determined whether the test cell is normal, pre-cancerous or cancerous using the expression level as an index. Although GSDMB is not expressed in many normal tissues, but is partially expressed in normal tissues, some pathologically determined specimens are already becoming cancerous at the level of gene expression It can also be determined that the sample exists.

  The present invention relates to a method for examining cancer, comprising a step of detecting a mutation in GSDMB and a GSDMB splicing variant.

  In the present invention, GSDMB and GSDMB splicing variant mutations include GSDMB and GSDMB splicing variant gene regions, and gene regions mean GSDMB and GSDMB splicing variant genes and regions that affect the expression of the genes. . The region that affects the expression of the gene is not particularly limited, and examples thereof include a promoter region.

  Moreover, if the mutation in this invention is a mutation involved in canceration, there will be no restriction | limiting in the kind, the number, etc. There are many mutations that change the expression level of the gene, change properties such as the stability of mRNA, or change the activity of the protein encoded by the gene, but are not particularly limited. Examples of the type of mutation include deletion, substitution, or insertion mutation. The above mutation includes a mutation in which amino acid substitution occurs in the amino acid sequence of the protein, and a mutation in which amino acid substitution does not occur but base substitution in the base sequence occurs.

  Examples of base substitution and amino acid substitution involved in the canceration of the present invention are shown below, but the mutation in the present invention is not limited to these.

  As the substitution of the base involved in the canceration of the present invention, the base at the (b) position and / or the (c) position in the base sequence described in (a) of Table 1 below is preferably replaced with another base. The thing to substitute can be mentioned. More preferably, guanine at position (b) in the base sequence described in (a) of Table 1 below is mutated to adenine and / or (c) cytosine at position c is mutated to thymine. be able to.

  In addition, as the substitution of amino acids involved in the canceration of the present invention, the amino acid at the (b) position and / or (c) position in the amino acid sequence described in (a) of Table 2 below is preferably The thing substituted by an amino acid can be mentioned. More preferably, a mutation from glycine at position (b) to arginine and / or a mutation from proline to serine at position (c) in the amino acid sequence shown in (a) of Table 2 below can be mentioned. .

  In the inspection method of the present invention, two amino acid or base mutations may be detected simultaneously, or only one of them may be detected.

  Hereinafter, although the preferable aspect of the test method including the process of detecting the variation | mutation which arose in GSDMB and the GSDMB splicing variant is described, the method of this invention is not limited to those methods.

  In a preferred embodiment of the above inspection method, first, a DNA sample is prepared from a subject. The DNA sample was extracted from, for example, a subject's blood, skin, oral mucosa, hair, tissue or cells collected or excised by surgery or biopsy. It can be prepared based on chromosomal DNA or RNA.

  In this method, DNA containing the gene regions of GSDMB and GSDMB splicing variants is then isolated. The DNA can be isolated, for example, by PCR or the like using a primer that hybridizes to DNA containing the gene region of GSDMB and GSDMB splicing variants, using chromosomal DNA or RNA-derived cDNA as a template.

  In this method, the base sequence of the isolated DNA is then determined.

  In this method, the determined DNA base sequence is then compared with a control. In the present invention, the control refers to DNA containing the gene regions of normal (more frequent or wild-type) GSDMB and GSDMB splicing variants. In general, the sequence of DNA containing the gene region of GSDMB and GSDMB splicing variants of healthy people is considered to be normal, so the above "compared to controls" usually refers to the genes of GSDMB and GSDMB splicing variants of healthy people. Comparing with the sequence of DNA containing the region.

  Detection of the mutation in the present invention can also be performed by the following method. First, a DNA sample is prepared from a subject. Next, the prepared DNA sample is cleaved with a restriction enzyme. The DNA fragments are then separated according to their size. The size of the detected DNA fragment is then compared to a control. In another embodiment, a DNA sample is first prepared from a subject. Next, DNA containing the gene regions of GSDMB and GSDMB splicing variants is amplified. Furthermore, the amplified DNA is cleaved with a restriction enzyme. The DNA fragments are then separated according to their size. The size of the detected DNA fragment is then compared to a control.

  Examples of such methods include a method using restriction fragment length polymorphism (RFLP) and a PCR-RFLP method. Specifically, if there is a mutation at the restriction enzyme recognition site, or if there is a base insertion or deletion in the DNA fragment produced by the restriction enzyme treatment, the size of the fragment produced after the restriction enzyme treatment is compared with the control. Change. By amplifying the portion containing this mutation by PCR and treating with each restriction enzyme, these mutations can be detected as a difference in mobility of bands after electrophoresis. Alternatively, the presence or absence of mutation can be detected by treating chromosomal DNA with these restriction enzymes, performing electrophoresis, and performing Southern blotting using the probe DNA of the present invention. The restriction enzyme used can be appropriately selected according to each mutation. In this method, in addition to genomic DNA, RNA prepared from a subject can be converted to cDNA using reverse transcriptase, cut with a restriction enzyme as it is, and then subjected to Southern blotting. It is also possible to amplify DNA containing the gene region of GSDMB and GSDMB splicing variant by PCR using this cDNA as a template, cleave it with a restriction enzyme, and then examine the difference in mobility.

  In yet another method, a DNA sample is first prepared from a subject. Next, DNA containing GSDMB and the GSDMB splicing variant gene region is amplified. Furthermore, the amplified DNA is dissociated into single-stranded DNA. The dissociated single-stranded DNA is then separated on a non-denaturing gel. The mobility of the separated single-stranded DNA on the gel is compared with the control.

  Examples of the method include PCR-SSCP (single-strand conformation polymorphism) method (Cloning and polymerase chain reaction-single-strand conformation polymorphism analysis of anonymous Alu repeats on chromosome 11. Genomics. 1992 Jan 1; 12 (1): 139-146., Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products.Oncogene. 1991 Aug 1; 6 (8): 1313-1318. Multiple fluorescence-based PCR-SSCP analysis with postlabeling. PCR Methods Appl. 1995 Apr 1; 4 (5): 275-282.). This method is suitable for screening a large number of DNA samples in particular because it is relatively easy to operate and has advantages such as a small amount of test sample. The principle is as follows. When a double-stranded DNA fragment is dissociated into single strands, each strand forms a unique higher-order structure depending on its base sequence. When this dissociated DNA strand is electrophoresed in a polyacrylamide gel containing no denaturing agent, single-stranded DNA having the same complementary strand length moves to a different position according to the difference in each higher-order structure. The higher-order structure of this single-stranded DNA also changes by substitution of a single base, and shows different mobility in polyacrylamide gel electrophoresis. Therefore, by detecting this change in mobility, it is possible to detect the presence of mutation due to point mutation, deletion, insertion or the like in the DNA fragment.

Specifically, first, DNA containing the gene regions of GSDMB and GSDMB splicing variants is amplified by PCR or the like. As a range to be amplified, a length of about 200 to 400 bp is usually preferable. Those skilled in the art can perform PCR by appropriately selecting reaction conditions and the like. During PCR, the amplified DNA product can be labeled by using a primer labeled with an isotope such as ³² P, a fluorescent dye, or biotin. Alternatively, the amplified DNA product can be labeled by adding a substrate base labeled with an isotope such as ³² P, a fluorescent dye, or biotin to the PCR reaction solution and performing PCR. Furthermore, labeling can also be performed by adding a substrate base labeled with an isotope such as ³² P, a fluorescent dye, or biotin to the amplified DNA fragment using Klenow enzyme or the like after the PCR reaction. The labeled DNA fragment thus obtained is denatured by applying heat or the like and electrophoresed on a polyacrylamide gel containing no denaturing agent such as urea. At this time, conditions for separating DNA fragments can be improved by adding an appropriate amount (about 5 to 10%) of glycerol to the polyacrylamide gel. Electrophoretic conditions vary depending on the nature of each DNA fragment, but are usually performed at room temperature (20 to 25 ° C). If favorable separation cannot be obtained, the temperature at which the optimal mobility is obtained at temperatures from 4 to 30 ° C. Review. After electrophoresis, the mobility of the DNA fragments is detected and analyzed by autoradiography using an X-ray film, a scanner that detects fluorescence, or the like. When a band with a difference in mobility is detected, this band can be directly excised from the gel, amplified again by PCR, and directly sequenced to confirm the presence of the mutation. Even when the labeled DNA is not used, the band can be detected by staining the gel after electrophoresis with ethidium bromide or silver staining.

  In yet another method, a DNA sample is first prepared from a subject. Next, DNA containing the gene regions of GSDMB and GSDMB splicing variants is amplified. Furthermore, the amplified DNA is separated on a gel where the concentration of the DNA denaturant is gradually increased. The mobility of the separated DNA on the gel is then compared to the control.

  Examples of such a method include denaturant gradient gel electrophoresis (DGGE method). The DGGE method is a method in which a mixture of DNA fragments is run in a polyacrylamide gel having a concentration gradient of a denaturing agent, and the DNA fragments are separated depending on the instability of each. When a mismatched unstable DNA fragment migrates to a certain denaturant concentration in the gel, the DNA sequence around the mismatch is partially dissociated into single strands due to its instability. The mobility of this partially dissociated DNA fragment becomes very slow and can be separated from the mobility of a complete double-stranded DNA without a dissociated portion. Specifically, DNA containing the gene region of GSDMB and GSDMB splicing variants is amplified by a PCR method using the primer of the present invention, and this is gradually increased as the concentration of denaturing agents such as urea moves. Electrophorese in a polyacrylamide gel and compare to a control. In the case of a DNA fragment with mutation, the DNA fragment becomes single-stranded at a lower denaturant concentration position, and the movement speed becomes extremely slow. Therefore, the presence of mutation is detected by detecting this difference in mobility. be able to.

  In yet another method, first, a DNA containing a gene region of GSDMB and a GSDMB splicing variant prepared from a subject and a substrate on which a nucleotide probe that hybridizes to the DNA is immobilized are provided.

  In the present invention, the “substrate” means a plate-like material on which a nucleotide probe can be fixed. In the present invention, the nucleotide includes oligonucleotides and polynucleotides. The substrate of the present invention is not particularly limited as long as the nucleotide probe can be immobilized, but a substrate generally used in DNA array technology can be preferably used. In general, a DNA array is composed of thousands of nucleotides printed on a substrate at high density. Usually, these DNAs are printed on the surface of a non-porous substrate. The surface layer of the substrate is generally glass, but a porous membrane such as a nitrocellulose membrane can be used.

  In the present invention, examples of the nucleotide immobilization (array) method include an oligonucleotide-based array developed by Affymetrix. In an array of oligonucleotides, the oligonucleotides are usually synthesized in situ. For example, in-situ synthesis methods of oligonucleotides using photolithographic technology (Affymetrix) and inkjet (Rosetta Inpharmatics) technology for immobilizing chemical substances are already known. Can be used.

  The nucleotide probe immobilized on the substrate is not particularly limited as long as it can detect a mutation in the gene region of GSDMB and GSDMB splicing variants. That is, the probe is, for example, a probe that hybridizes to DNA containing the gene region of GSDMB and GSDMB splicing variants. If specific hybridization is possible, the nucleotide probe need not be completely complementary to the DNA containing the gene region of GSDMB and GSDMB splicing variants. In the present invention, the length of the nucleotide probe to be bound to the substrate is usually 10 to 100 bases, preferably 10 to 50 bases, more preferably 15 to 25 bases when oligonucleotides are immobilized.

  In this method, the DNA is then brought into contact with the substrate. Through this process, DNA is hybridized to the nucleotide probe. The hybridization reaction solution and reaction conditions may vary depending on various factors such as the length of the nucleotide probe immobilized on the substrate, but can generally be performed by methods well known to those skilled in the art.

  In this method, the intensity of hybridization between the DNA and the nucleotide probe immobilized on the substrate is then detected. This detection can be performed, for example, by reading the fluorescence signal with a scanner or the like. In a DNA array, DNA fixed on a slide glass is generally called a probe, while labeled DNA in a solution is called a target. Therefore, the nucleotide immobilized on the substrate is referred to as a nucleotide probe in this specification. In this method, the detected hybridization intensity is further compared with a control.

  Examples of such a method include a DNA array method.

  In addition to the above method, an allele specific oligonucleotide (ASO) hybridization method can be used for the purpose of detecting only a mutation at a specific position. When an oligonucleotide containing a nucleotide sequence that is considered to have a mutation is prepared and hybridized with DNA, the efficiency of hybridization is reduced when the mutation exists. It can be detected by Southern blotting or a method that uses the property of quenching by intercalating a special fluorescent reagent into the hybrid gap.

  In the present invention, TaqMan PCR method, Acyclo Prime method, MALDI-TOF / MS method and the like can also be used. Invader method and RCA method can also be used as a method for determining base species independent of PCR. These methods are briefly described below. Any of the methods described herein can be applied to the determination of the base type of the mutation site in the present invention.

[TaqMan PCR method]
The principle of TaqMan PCR method is as follows. The TaqMan PCR method is an analysis method using a primer set that can amplify a region containing an allele and a TaqMan probe. The TaqMan probe is designed to hybridize to the region containing the allele amplified by this primer set.

  If the target base sequence is hybridized under conditions close to the Tm of the TaqMan probe, the hybridization efficiency of the TaqMan probe is significantly reduced due to the difference of one base. When PCR is performed in the presence of the TaqMan probe, the extension reaction from the primer eventually reaches the hybridized TaqMan probe. At this time, the TaqMan probe is degraded from its 5 ′ end by the 5′-3 ′ exonuclease activity of DNA polymerase. If the TaqMan probe is labeled with a reporter dye and a quencher, the degradation of the TaqMan probe can be followed as a change in fluorescence signal. In other words, when the TaqMan probe is decomposed, the reporter dye is released and the distance from the quencher is increased to generate a fluorescent signal. If the hybridization of the TaqMan probe decreases due to a difference in one base, the TaqMan probe does not decompose and a fluorescent signal is not generated.

  If a TaqMan probe corresponding to the mutation is designed and a different signal is generated by the decomposition of each probe, the base species can be determined at the same time. For example, as a reporter dye, 6-carboxy-fluorescein (FAM) is used for the TaqMan probe of allele A of an allele, and VIC is used for the probe of allele B. In a state where the probe is not decomposed, generation of a fluorescent signal of the reporter dye is suppressed by the quencher. If each probe hybridizes to the corresponding allele, a fluorescence signal corresponding to the hybridization is observed. That is, when either FAM or VIC signal is stronger than the other, it is found that allele A or allele B is homozygous. On the other hand, when the allele is hetero, both signals are detected at substantially the same level. By using the TaqMan PCR method, PCR and base type determination can be performed simultaneously on a genome as an analysis target without a time-consuming step such as separation on a gel. Therefore, the TaqMan PCR method is useful as a method that can determine the base species for many subjects.

[Acyclo Prime method]
The Acyclo Prime method has also been put to practical use as a method for determining the base species using the PCR method. In the Acyclo Prime method, one set of primers for genome amplification and one set of primers for SNPs detection are used. First, the region including the mutation site in the genome is amplified by PCR. This process is the same as normal genomic PCR. Next, the obtained PCR product is annealed with a primer for detecting SNPs, and an extension reaction is performed. SNPs detection primers are designed to anneal to the region adjacent to the mutation site to be detected.

  At this time, a nucleotide derivative (terminator) labeled with a fluorescent polarizing dye and blocked with 3′-OH is used as a nucleotide substrate for the extension reaction. As a result, only one base complementary to the base at the position corresponding to the mutation site is incorporated, and the extension reaction stops. Incorporation of a nucleotide derivative into a primer can be detected by an increase in fluorescence polarization (FP) due to an increase in molecular weight. If two types of labels having different wavelengths are used for the fluorescent polarizing dye, it is possible to specify which of the two types of bases the specific SNPs are. Since the level of fluorescence polarization can be quantified, it is also possible to determine whether an allele is homo or hetero in one analysis.

[MALDI-TOF / MS method]
The base species can also be determined by analyzing the PCR product with MALDI-TOF / MS. MALDI-TOF / MS can be used in various fields as an analytical method that can clearly identify slight differences in amino acid sequences of proteins and DNA base sequences because it can know the molecular weight with great accuracy. Yes. In order to determine the base species by MALDI-TOF / MS, first, the region containing the allele to be analyzed is amplified by PCR. The amplification product is then isolated and its molecular weight is measured by MALDI-TOF / MS. Since the base sequence of the allele is known in advance, the base sequence of the amplification product is uniquely determined based on the molecular weight.

In order to determine the base species using MALDI-TOF / MS, a PCR product separation step is required. However, accurate base species determination can be expected without using labeled primers or labeled probes. It can also be applied to simultaneous detection of mutations at multiple locations.
[SNPs-specific labeling method using type IIs restriction enzyme]

  A method that can determine the base species at higher speed using the PCR method has also been reported. For example, the base type of the mutation site is determined using a type IIs restriction enzyme. In this method, a primer having a recognition sequence for type IIs restriction enzyme is used for PCR. A general restriction enzyme (type II) used for gene recombination recognizes a specific base sequence and cleaves a specific site in the base sequence. In contrast, type IIs restriction enzymes recognize specific base sequences and cleave sites away from the recognized base sequences. The number of bases between the recognition sequence and the cleavage site is determined by the enzyme. Therefore, if the primer containing the recognition sequence of the type IIs restriction enzyme is annealed at a position separated by the number of bases, the amplification product can be cleaved at the mutation site by the type IIs restriction enzyme.

  At the end of the amplification product cleaved with the type IIs restriction enzyme, a cohesive end containing the base of SNPs is formed. Here, an adapter having a base sequence corresponding to the sticky end of the amplification product is ligated. The adapter is composed of different base sequences including bases corresponding to mutations and can be labeled with different fluorescent dyes. Finally, the amplification product is labeled with a fluorescent dye corresponding to the base at the mutation site.

  When PCR is performed by combining a primer containing the IIs type restriction enzyme recognition sequence with a capture primer, the amplification product is fluorescently labeled and can be immobilized using the capture primer. For example, if a biotin-labeled primer is used as a capture primer, the amplification product can be captured on avidin-bound beads. By tracking the fluorescent dye of the amplification product thus captured, the base species can be determined.

[Determination of base species at mutation sites using magnetic fluorescent beads]
A technique capable of analyzing a plurality of alleles in parallel in a single reaction system is also known. Analyzing a plurality of alleles in parallel is called multiplexing. In general, a typing method using a fluorescent signal requires fluorescent components having different fluorescent wavelengths for multiplexing. However, there are not so many fluorescent components that can be used for actual analysis. On the other hand, when a plurality of types of fluorescent components are mixed in a resin or the like, a variety of fluorescent signals that can be distinguished from each other can be obtained even with limited types of fluorescent components. Furthermore, if a component that is magnetically adsorbed in the resin is added, it is possible to obtain beads that emit fluorescence and can be separated magnetically. Multiplexed mutation typing using such magnetic fluorescent beads has been devised (Bioscience and Bioindustry, Vol. 60 No. 12, 821-824).

  In multiplexed mutation typing using magnetic fluorescent beads, a probe having a base complementary to the mutation site of each allele at its end is immobilized on the magnetic fluorescent beads. Both are combined so that each allele corresponds to a magnetic fluorescent bead having a unique fluorescent signal. On the other hand, when a probe fixed to a magnetic fluorescent bead is hybridized to a complementary sequence, a fluorescently labeled oligo DNA having a base sequence complementary to an adjacent region on the allele is prepared.

  The region containing the allele is amplified by asymmetric PCR, the above-mentioned magnetic fluorescent bead-immobilized probe and the fluorescently labeled oligo DNA are hybridized, and both are further ligated. When the end of the magnetic fluorescent bead-immobilized probe has a base sequence complementary to the base at the mutation site, ligation is efficiently performed. On the other hand, if the terminal bases are different due to mutation, the ligation efficiency of the two decreases. As a result, the fluorescent labeled oligo DNA is bound to each magnetic fluorescent bead only when the sample is a base species complementary to the magnetic fluorescent bead.

  The base species is determined by collecting the magnetic fluorescent beads by magnetism and further detecting the presence of fluorescently labeled oligo DNA on each magnetic fluorescent bead. Since magnetic fluorescent beads can analyze the fluorescence signal for each bead using a flow cytometer, the signal can be easily separated even if various types of magnetic fluorescent beads are mixed. That is, “multiplexing” in which multiple types of mutation sites are analyzed in parallel in a single reaction vessel is achieved.

[Invader method]
A method for genotyping independent of the PCR method has also been put into practical use. For example, in the Invader method, the base type is determined by only three types of oligonucleotides, an allele probe, an invader probe, and a FRET probe, and a special nuclease called cleavase. Of these probes, only the FRET probe requires labeling.

  Allele probes are designed to hybridize to regions adjacent to the allele to be detected. On the 5 ′ side of the allele probe, a flap composed of a base sequence unrelated to hybridization is linked. The allele probe has a structure that hybridizes to the 3 ′ side of the mutation site and is linked to a flap on the mutation site.

  On the other hand, the invader probe has a base sequence that hybridizes to the 5 ′ side of the mutation site. The base sequence of the invader probe is designed so that the 3 ′ end corresponds to the mutation site by hybridization. The base at the position corresponding to the mutation site in the invader probe may be arbitrary. That is, both base sequences are designed so that the invader probe and the allele probe hybridize adjacent to each other across the mutation site.

  If the mutation site is a base complementary to the base sequence of the allele probe, when both the invader probe and the allele probe hybridize to the allele, the invader probe enters the base corresponding to the mutation site of the allele probe (invasion probe). ) Is formed. The cleavase cleaves the invading strand of the oligonucleotide that has formed the invading structure thus formed. Since the cutting occurs on the intrusion structure, the result is that the allele probe flap is cut off. On the other hand, if the base at the mutation site is not complementary to the base of the allele probe, there is no competition between the invader probe and the allele probe at the mutation site, and no invasion structure is formed. Therefore, the flap is not cut by cleavase.

  The FRET probe is a probe for detecting the flap thus separated. The FRET probe constitutes a hairpin loop having a self-complementary sequence on the 5 ′ end side and a single-stranded portion arranged on the 3 ′ end side. The single-stranded portion arranged on the 3 ′ end side of the FRET probe has a base sequence complementary to the flap, and the flap can hybridize there. Both base sequences are designed so that when the flap hybridizes to the FRET probe, a structure is formed in which the 3 ′ end of the flap enters the 5 ′ end of the self-complementary sequence of the FRET probe. A cleavase recognizes and cleaves an invasion structure. If the FRET probe is cleaved by a cleavase and labeled with a reporter dye and quencher similar to TaqMan PCR, the FRET probe cleavage can be detected as a change in fluorescence signal.

  Theoretically, the flap should hybridize to the FRET probe even in the uncut state. However, in reality, there is a large difference in the binding efficiency to FRET between the cut flap and the flap present in the state of the allele probe. Therefore, it is possible to specifically detect the cleaved flap using the FRET probe.

  In order to determine the base type based on the Invader method, two types of allele probes including base sequences complementary to allele A and allele B may be prepared. At this time, the base sequences of the flaps are different base sequences. If two types of FRET probes for detecting flaps are prepared and each reporter dye can be identified, the base species can be determined based on the same concept as the TacMan PCR method.

  The advantage of the Invader method is that the FRET probe is the only oligonucleotide that needs to be labeled. The FRET probe can use the same oligonucleotide regardless of the base sequence to be detected. Therefore, mass production is possible. On the other hand, since the allele probe and the invader probe do not need to be labeled, a genotyping reagent can be manufactured at low cost.

[RCA method]
The RCA method can be mentioned as a method for determining the base species independent of the PCR method. A method for amplifying DNA based on a reaction in which a DNA polymerase having a strand displacement action synthesizes a long complementary strand using a circular single-stranded DNA as a template is the Rolling Circle Amplification (RCA) method (Lizardri PM et al., Nature Genetics 19, 225, 1998). In the RCA method, an amplification reaction is configured using a primer that anneals to a circular DNA and initiates complementary strand synthesis and a second primer that anneals to a long complementary strand generated by this primer.

  In the RCA method, a DNA polymerase having a strand displacement action is used. Therefore, the portion that has become double-stranded by complementary strand synthesis is replaced by a complementary strand synthesis reaction started from another primer annealed to the 5 ′ side. For example, the complementary strand synthesis reaction using circular DNA as a template does not end in one round. The complementary strand synthesis continues while replacing the previously synthesized complementary strand, and a long single-stranded DNA is produced. On the other hand, the second primer anneals to the long single-stranded DNA generated using the circular DNA as a template, and complementary strand synthesis starts. Since single-stranded DNA generated by the RCA method uses circular DNA as a template, its base sequence is a repetition of the same base sequence. Thus, continuous production of long single strands results in continuous annealing of the second primer. As a result, single-stranded portions that can be annealed by the primer are continuously generated without going through a denaturing step. Thus, DNA amplification is achieved.

  If the circular single-stranded DNA necessary for the RCA method is generated according to the base type of the mutation site, the base type can be determined using the RCA method. For this purpose, a linear single-stranded padlock probe is used. The padlock probe has complementary base sequences on both sides of the mutation site to be detected at the 5 ′ end and 3 ′ end. These base sequences are linked at a portion consisting of a special base sequence called a backbone. If the mutation site is a base sequence complementary to the end of the padlock probe, the end of the padlock probe hybridized to the allele can be ligated by DNA ligase. As a result, the linear padlock probe is circularized and the reaction of the RCA method is triggered. The reaction of DNA ligase is significantly reduced in efficiency when the terminal portion to be ligated is not completely complementary. Therefore, by confirming the presence or absence of ligation by the RCA method, the base type of the mutation site can be determined.

  The RCA method can amplify DNA but does not generate a signal as it is. If only the presence or absence of amplification is used as an index, the base species cannot usually be determined unless a reaction is performed for each allele. Methods are known in which these points are improved for the determination of base species. For example, using a molecular beacon, the postponement type can be determined in one tube based on the RCA method. A molecular beacon is a signal generation probe using a fluorescent dye and a quencher, as in the TaqMan method. The molecular beacons are composed of complementary base sequences at the 5 ′ end and 3 ′ end, and form a hairpin structure alone. If both ends are labeled with a fluorescent dye and a quencher, a fluorescent signal cannot be detected in a state where a hairpin structure is formed. If a part of the molecular beacon is set as a base sequence complementary to the amplification product of the RCA method, the molecular beacon hybridizes to the amplification product of the RCA method. Since the hairpin structure is eliminated by hybridization, a fluorescent signal is generated.

  The advantage of the molecular beacon is that the base sequence of the molecular beacon can be made common regardless of the detection target by using the base sequence of the backbone portion of the padlock probe. By changing the backbone base sequence for each allele and combining two types of molecular beacons with different fluorescence wavelengths, the base type can be determined in one tube. Since the cost of synthesis of fluorescently labeled probes is high, the ability to use a common probe regardless of the measurement target is an economic advantage.

  All of these methods have been developed for genotyping a large amount of samples at high speed. With the exception of MALDI-TOF / MS, it is usually necessary to prepare a labeled probe or the like in any way for either method. On the other hand, a method for determining a base type that does not rely on a labeled probe has been performed for a long time. As one of such methods, for example, a method using restriction fragment length polymorphism (RFLP), a PCR-RFLP method and the like can be mentioned.

Furthermore, the present invention relates to an antibody that binds to the protein or fragment thereof described in any of (a) to (d) below.
(A) a protein encoded by a DNA comprising the base sequence described in any of the odd-numbered sequences of SEQ ID NOs: 1 to 68 (b) described in any of the even-numbered sequences of SEQ ID NOs: 1 to 68 Protein (c) containing an amino acid sequence (c) consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of any of the even-numbered sequences of SEQ ID NOs: 1 to 68 A protein derived from nature and having a functional equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 (d) The odd-numbered proteins of SEQ ID NOs: 1 to 68 A protein encoded by naturally occurring DNA that hybridizes under stringent conditions with DNA comprising the base sequence described in any of the sequences, A protein comprising the amino acid sequence of any one of the even-numbered sequence of 1 to 68 functionally equivalent protein

  The antibody of the present invention is not particularly limited as long as it recognizes the protein described in any of (a) to (d) above, but specifically recognizes the protein described in any of (a) to (d). It is preferably an antibody.

  The antibody used for detecting the protein is not particularly limited as long as it is a detectable antibody. For example, both a monoclonal antibody and a polyclonal antibody can be used. As the antibody recognizing the protein of the present invention, a known antibody can be used. Alternatively, an antibody can be prepared by a method known to those skilled in the art using the protein as an antigen.

Specifically, for example, it can be produced as follows.
A serum is obtained by immunizing a small animal such as a rabbit with the recombinant protein expressed in a microorganism such as Escherichia coli or a partial peptide thereof as a fusion protein with the protein or GST. This is prepared by, for example, purification by ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, affinity column coupled with the protein or synthetic peptide, or the like. In the case of a monoclonal antibody, for example, the protein or a partial peptide thereof is immunized to a small animal such as a mouse, the spleen is removed from the mouse, and this is ground to separate cells, and the cells and mouse myeloma cells are isolated. Are fused using a reagent such as polyethylene glycol, and a clone that produces an antibody that binds to the protein is selected from fused cells (hybridomas) produced by the method. Next, the obtained hybridoma is transplanted into the abdominal cavity of the mouse, and ascites is collected from the mouse, and the obtained monoclonal antibody is obtained by, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, the protein Or by purification using an affinity column coupled with a synthetic peptide.

  Moreover, if it is a polyclonal antibody, it can acquire as follows, for example. Using the protein or fragment thereof as a sensitizing antigen, immunizing it according to a normal immunization method, fusing the resulting immune cells with known parental cells by a normal cell fusion method, by a normal screening method, A monoclonal antibody-producing cell (hybridoma) is screened. The antigen can be prepared according to a known method, for example, a method using a baculovirus (WO98 / 46777 etc.). The hybridoma can be produced, for example, according to the method of Milstein et al. (Kohler. G. and Milstein, C., Methods Enzymol. (1981) 73: 3-46). When the immunogenicity of the antigen is low, immunization may be performed by binding to an immunogenic macromolecule such as albumin. Thereafter, the cDNA of the variable region (V region) of the antibody is synthesized from the hybridoma mRNA using reverse transcriptase, and the sequence of the obtained cDNA may be decoded by a known method.

  The antibody that recognizes the protein is not particularly limited as long as it binds to the protein, and a mouse antibody, a rat antibody, a rabbit antibody, a sheep antibody, a human antibody, and the like can be appropriately used. In addition, recombinant antibodies that have been artificially modified for the purpose of reducing the heterologous antigenicity to humans, such as chimeric antibodies and humanized antibodies, can also be used. These modified antibodies can be produced using known methods. The chimeric antibody is a mammal other than a human, for example, an antibody comprising a heavy chain of a mouse antibody, a variable region of a light chain and a heavy chain of a human antibody, a constant region of a light chain, and the like, and encodes a variable region of a mouse antibody. It can be obtained by ligating DNA with DNA encoding the constant region of a human antibody, incorporating it into an expression vector, introducing it into a host and producing it.

  A humanized antibody is also called a reshaped human antibody, and is a non-human mammal, for example, a complementarity determining region (CDR) of a mouse antibody transplanted to the complementarity determining region of a human antibody. There are also known general genetic recombination techniques. Specifically, several oligos prepared from DNA sequences designed to link the CDR of a mouse antibody and the framework region (FR) of a human antibody so as to have a portion overlapping the terminal portion. It is synthesized from nucleotides by PCR. The obtained DNA is obtained by ligation with DNA encoding a human antibody constant region, and then incorporated into an expression vector, which is introduced into a host and produced (European Patent Application Publication Number EP 239400, International Patent Application Publication Number). WO 96/02576). As the FR of the human antibody to be ligated via CDR, one in which the complementarity determining region forms a favorable antigen binding site is selected. If necessary, amino acid in the framework region of the variable region of the antibody may be substituted so that the complementarity determining region of the reshaped human antibody forms an appropriate antigen binding site (Sato, K. et al., Cancer Res. (1993) 53, 851-856).

  A method for obtaining a human antibody is also known. For example, human lymphocytes are sensitized with a desired antigen or a cell that expresses the desired antigen in vitro, and the sensitized lymphocyte is fused with a human myeloma cell such as U266 to have a desired human antibody having an antigen-binding activity. (See Japanese Patent Publication No. 1-59878). Further, a desired human antibody can be obtained by immunizing a transgenic animal having all repertoires of human antibody genes with a desired antigen (International Patent Application Publication Nos. WO 93/12227, WO 92/03918, WO 94/02602, WO 94/25585, WO 96/34096, WO 96/33735). Furthermore, a technique for obtaining a human antibody by panning using a human antibody library is also known. For example, the variable region of a human antibody is expressed as a single chain antibody (scFv) on the surface of the phage by the phage display method, and a phage that binds to the antigen can be selected. By analyzing the gene of the selected phage, the DNA sequence encoding the variable region of the human antibody that binds to the antigen can be determined. If the DNA sequence of scFv that binds to the antigen is clarified, an appropriate expression vector having the sequence can be prepared and a human antibody can be obtained. These methods are already well known and can be referred to WO 92/01047, WO 92/20791, WO 93/06213, WO 93/11236, WO 93/19172, WO 95/01438, WO 95/15388. .

  In the present invention, a specific example of an antibody that recognizes the protein was prepared by synthesizing a peptide corresponding to the 67th to 18th amino acids of the GSDMB protein: DKWLDELDSGLQGQKAEF (SEQ ID NO: 77) and immunizing chickens. An antibody is mentioned.

  The antibody used in the present invention may be a conjugated antibody bound to various molecules such as polyethylene glycol (PEG), radioactive substances, and toxins. Such a conjugated antibody can be obtained by chemically modifying the obtained antibody. Antibody modification methods have already been established in this field. The “antibody” in the present invention includes these conjugated antibodies.

  Preferred antibodies in the present invention include low molecular weight antibodies. The low molecular weight antibody is not particularly limited as long as it includes an antibody fragment lacking a part of a full-length antibody (whole antibody such as whole IgG) and has an ability to bind to an antigen. The antibody fragment of the present invention is not particularly limited as long as it is a part of a full-length antibody, but preferably contains a heavy chain variable region (VH) or a light chain variable region (VL), particularly preferably VH and VL. A fragment containing both. Specific examples of antibody fragments include, for example, Fab, Fab ′, F (ab ′) 2, Fv, scFv (single chain Fv), and the like. Preferably, scFv (Huston, JS et al., Proc. Natl. Acad. Sci. USA (1988) 85, 5879-5883, Plickthun "The Pharmacology of Monoclonal Antibodies" Vol.113, Resenburg and Moore, Springer Verlag, New York, pp.269-315, (1994) ). In order to obtain such an antibody fragment, the antibody is treated with an enzyme such as papain or pepsin to generate antibody fragments, or genes encoding these antibody fragments are constructed and introduced into expression vectors. Thereafter, it may be expressed in an appropriate host cell (for example, Co, MS et al., J. Immunol. (1994) 152, 2968-2976; Better, M. and Horwitz, AH, Methods Enzymol. (1989) 178, 476-496; Pluckthun, A. and Skerra, A., Methods Enzymol. (1989) 178, 497-515; Lamoyi, E., Methods Enzymol. (1986) 121, 652-663; Rousseaux, J. et al., Methods Enzymol. (1986) 121, 663-669; Bird, RE and Walker, BW, Trends Biotechnol. (1991) 9, 132-137).

  The antibody of the present invention can be used as a diagnostic agent for cancer. In the above test agents, in addition to the active ingredient antibody, for example, sterile water, physiological saline, vegetable oil, surfactant, lipid, solubilizer, buffer, protein stabilizer (BSA, gelatin, etc.), storage Agents etc. may be mixed as necessary

  The antibody of the present invention can be used not only as a cancer test agent but also as a cancer therapeutic agent. The antibody can function as an anticancer drug by attacking cancer cells using the patient's own immune response. The antibody is an antibody that binds to a GSDMB protein that is expressed specifically in cancer cells. When the antibody binds to the GSDMB protein, signal transduction by an antigen-antibody reaction occurs and activates immune cells in the patient's body. It can induce an attack on cancer cells and suppress the increase of cancer.

  The antibody of the present invention may be a conjugated antibody bound to various molecules such as polyethylene glycol (PEG), radioactive substances, and toxins. Such a conjugated antibody can be obtained by chemically modifying the obtained antibody. Antibody modification methods have already been established in this field. The “antibody” in the present invention includes these conjugated antibodies.

  Since the antibody targets a GSDMB protein that is specifically expressed in cancer, it can be treated specifically for cancer, and does not act on normal cells, so it can have very few side effects. Furthermore, GSDMB is commonly expressed in all cancers, and thus can be applied to a wide range of cancers. Further, the effectiveness of the antibody (anticancer drug) can be estimated by examining the expression level of GSDMB in the patient's cancer cells before treatment. Therefore, it is possible to perform treatment according to the pathology of each individual patient.

  A pharmaceutically acceptable additive may be added to the therapeutic agent comprising the antibody of the present invention as an active ingredient. Here, the pharmaceutically acceptable additive means a pharmaceutically acceptable material that is itself a substance different from an antibody and can be administered together with the antibody in antibody administration. For example, vaccine additives such as preservatives and stabilizers can be exemplified, but are not limited thereto.

  As a stabilizer, about 0.2% gelatin or dextran, 0.1-1.0% sodium glutamate, or about 5% lactose or about 2% sorbitol can be used, but it is not limited thereto. . As a preservative, about 0.01% thimerosal, about 0.1% betapropionolactone, about 0.5% phenoxyethanol, and the like can be used, but are not limited thereto.

  When preparing injections, add pH adjusters, buffers, stabilizers, preservatives, etc., if necessary, and make subcutaneous, intramuscular, and intravenous injections by conventional methods. The injection may be a solid preparation or a preparation prepared at the time of use by lyophilization after the solution is stored in a container. One dose may be stored in a container, and the dose may be stored in the same container.

  Various known methods can be used as the method for inoculating the antibody of the present invention. As the inoculation method, subcutaneous injection, intramuscular injection, nasal inoculation, oral inoculation, transdermal inoculation and the like are preferable, and intramuscular injection is more preferable, but it is not limited thereto.

  Which inoculation method is appropriate is determined in consideration of the type of antibody, the dosage form, the age of the person to be inoculated, and the like. In addition to human beings, livestock, outdoor animals, and birds can be included as subjects for inoculation. Inoculation methods are finalized through expert clinical trials and these methods are well known to those skilled in the art. A single inoculation product or multiple inoculation products may be used. The dose varies depending on the weight and age of the patient, the administration method, etc., but those skilled in the art can appropriately select an appropriate dose.

Furthermore, the present invention relates to an oligonucleotide that hybridizes to the DNA described in any of the following (a) to (d) and has a chain length of at least 15 nucleotides.
(A) DNA comprising the base sequence described in any of the odd-numbered sequences of SEQ ID NOs: 1 to 68
(B) DNA encoding a protein comprising the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68
(C) a naturally occurring protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 A DNA that encodes a protein that is functionally equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68
(D) a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence of any one of the odd-numbered sequences of SEQ ID NOs: 1 to 68, DNA encoding a protein functionally equivalent to the protein consisting of the amino acid sequence described in any of the even-numbered sequences

  Here, the oligonucleotide includes a polynucleotide. The oligonucleotide of the present invention comprises a probe or primer used for detection or amplification of the DNA encoding the protein of the present invention, a probe or primer for detecting the expression of the DNA, or a nucleotide for controlling the expression of the protein of the present invention. Alternatively, it can be used as a nucleotide derivative (for example, an antisense oligonucleotide, a ribozyme, or a DNA encoding them). Moreover, the oligonucleotide of the present invention can be used in the form of a substrate of a DNA array.

  When the oligonucleotide is used as a primer, the length is usually 15 bp to 100 bp, preferably 17 bp to 30 bp. The primer is not particularly limited as long as it can amplify at least part of the DNA of the present invention or its complementary strand. When used as a primer, the 3 ′ region can be complementary, and a restriction enzyme recognition sequence, a tag, or the like can be added to the 5 ′ side.

  In addition, when the oligonucleotide is used as a probe, the probe is not particularly limited as long as it specifically hybridizes to at least a part of the DNA of the present invention or its complementary strand. The probe may be a synthetic oligonucleotide and usually has a chain length of at least 15 bp.

When the oligonucleotide of the present invention is used as a probe, it is preferably used after appropriately labeling. As a labeling method, a method of labeling by phosphorylating the 5 ′ end of the oligonucleotide with ³² P using T4 polynucleotide kinase, and a random hexamer oligonucleotide or the like using a DNA polymerase such as Klenow enzyme are used. Examples of the primer include a method of incorporating a substrate base labeled with an isotope such as ³² P, a fluorescent dye, or biotin (random prime method or the like).

  The oligonucleotide of the present invention can be prepared, for example, by a commercially available oligonucleotide synthesizer. The probe can also be prepared as a double-stranded DNA fragment obtained by restriction enzyme treatment or the like.

  The oligonucleotide of the present invention can also be used as a cancer test agent. In the test agent, in addition to the active ingredient oligonucleotide, for example, sterile water, physiological saline, vegetable oil, surfactant, lipid, solubilizer, buffer, protein stabilizer (such as BSA and gelatin), storage An agent or the like may be mixed as necessary.

  The present invention provides GSDMB promoter DNA (Promoter B described in Example 4). Examples of the promoter DNA include DNA containing the nucleotide sequence set forth in SEQ ID NO: 69. Examples of the DNA containing the base sequence described in SEQ ID NO: 69 include DNA comprising the base sequence described in SEQ ID NO: 69, DNA containing the upstream region and downstream region of the DNA comprising the base sequence described in SEQ ID NO: 69, etc. However, it is not limited to these.

  Further, the promoter DNA in the present invention is structurally similar to the DNA containing the base sequence set forth in SEQ ID NO: 69, and is equivalent to or improved from the DNA containing the base sequence set forth in SEQ ID NO: 69. DNA having a promoter activity ability is also mentioned. Examples of such DNA include DNA containing a base sequence in which one or more bases are substituted, deleted, added, and / or inserted in the base sequence set forth in SEQ ID NO: 69. The DNA can be prepared by a method such as a hybridization technique, a polymerase chain reaction (PCR) technique, or a site-directed mutagenesis method. Hybridization conditions are the same as described above.

  Whether or not the prepared DNA has promoter activity can be examined by those skilled in the art by a reporter assay using a reporter gene. The reporter gene is not particularly limited as long as its expression can be detected. For example, a CAT gene, a lacZ gene, a luciferase gene, a β-glucuronidase gene (GUS), and a GFP that are commonly used by those skilled in the art. A gene etc. can be mentioned. The expression level of the reporter gene can be measured by methods known to those skilled in the art depending on the type of the reporter gene. For example, when the reporter gene is a CAT gene, the expression level of the reporter gene can be measured by detecting acetylation of chloramphenicol by the gene product. When the reporter gene is a lacZ gene, by detecting the color development of the dye compound catalyzed by the gene expression product, and when the reporter gene is a luciferase gene, the fluorescent compound catalyzed by the gene expression product By detecting fluorescence, and in the case of a β-clonidase gene (GUS), the luminescence of Glucuron (ICN) by the catalytic action of the gene expression product or 5-bromo-4-chloro-3-indolyl- By detecting the color development of β-glucuronide (X-Gluc), and in the case of a GFP gene, the expression level of the reporter gene can be measured by detecting fluorescence due to the GFP protein.

  The DNA containing the base sequence in which one or more bases are substituted, deleted, added, and / or inserted in the base sequence shown in SEQ ID NO: 69 is more suitable than DNA consisting of the base sequence shown in SEQ ID NO: 69 Short DNA that includes a region essential for promoter activity is also included. Such DNA can be identified and isolated by methods well known to those skilled in the art.

  The present invention also provides a DNA in which the promoter DNA of the present invention and a DNA encoding a protein that acts in a suppressive manner are functionally linked. Such a DNA is a useful DNA that can be used in the treatment of cancer as an anticancer agent.

  In the present invention, “functionally bound” means that the transcription factor binds to the promoter DNA of the present invention so that expression of DNA encoding a protein that acts suppressively in cancer is induced. It means that the promoter DNA of the invention is linked to DNA encoding a protein that acts suppressively in cancer. Therefore, even when a DNA encoding a protein that acts suppressively in cancer is bound to another gene and forms a fusion protein with another gene product, a transcription factor is present in the promoter DNA of the present invention. If the expression of the fusion protein is induced by binding, it is included in the meaning of “functionally linked”.

  Examples of proteins that act in a suppressive manner in cancer in the present invention include, but are not limited to, tumor suppressor proteins and cytotoxic proteins. Proteins that directly or indirectly damage cells and have a lethal effect are included in the cytotoxic proteins of the present invention. Examples of such proteins include diphtheria toxin and HSV-derived thymidine kinase. Moreover, it does not specifically limit as a tumor suppressor protein, p53 (Tp53), RB-1 (Retinoblastoma-1), etc. can be illustrated.

  The promoter DNA of the present invention can be obtained by amplification by PCR, for example. The promoter DNA of the present invention acts in a suppressive manner in cancer by ligating the 3 ′ side of the obtained promoter DNA with a DNA encoding a protein that acts in a suppressive manner in cancer by a method well known to those skilled in the art. It is possible to construct DNA in which DNAs encoding proteins are functionally bound. In addition, the constructed DNA can be incorporated into an appropriate vector and amplified in a host cell such as E. coli.

  As a method of expressing DNA in which the promoter DNA of the present invention and DNA encoding a protein that suppressively acts in cancer are expressed in vivo in animals including humans, the DNA is incorporated into an appropriate vector, Examples thereof include a method for introduction into a living body by a retrovirus method, a liposome method, a cationic liposome method, an adenovirus method, and the like. Thereby, it is possible to perform cancer gene therapy. Examples of the vector to be used include, but are not limited to, an adenovirus vector (for example, pAdexlcw) and a retrovirus vector (for example, pZIPneo). General genetic manipulations such as insertion of the DNA of the present invention into a vector can be performed according to conventional methods (Molecular Cloning, 5.61-5.63). Administration to a living body may be an ex vivo method or an in vivo method.

  The present invention relates to GSDMB splicing variants, GSDMB variants, and GSDMB splicing variant variants DNA.

  As DNA of the GSDMB splicing variant, GSDMB variant, and DNA of the GSDMB splicing variant, a DNA containing the base sequence described in any of the odd-numbered sequences of SEQ ID NOs: 3 to 68, and the DNAs of SEQ ID NOs: 3 to 68 Examples thereof include DNA encoding a protein containing the amino acid sequence described in any of the even-numbered sequences.

  The present invention includes DNA encoding a protein functionally equivalent to a protein containing the amino acid sequence described in any of the even-numbered sequences of SEQ ID NOs: 3 to 68. Such DNA includes, for example, DNAs encoding mutants, alleles, variants, homologs and the like of the protein. The explanation regarding the description “functionally equivalent” is equivalent to the above description.

  As a method well known to those skilled in the art for preparing a protein functionally equivalent to a certain protein, a method of introducing a mutation into the protein is known. For example, those skilled in the art will recognize site-directed mutagenesis (Gotoh, T. et al. (1995) Gene 152, 271-275, Zoller, MJ, and Smith, M. (1983) Methods Enzymol. 100, 468 -500, Kramer, W. et al. (1984) Nucleic Acids Res. 12, 9441-9456, Kramer W, and Fritz HJ (1987) Methods. Enzymol. 154, 350-367, Kunkel, TA (1985) Proc Natl Acad Sci USA. 82, 488-492, Kunkel (1988) Methods Enzymol. 85, 2763-2766), etc. Can be prepared.

  Amino acid mutations can also occur in nature. Thus, a protein that is composed of an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence of the protein and is functionally equivalent to the protein is also included in the present invention. In such mutants, the number of amino acids to be mutated is usually within 30 amino acids, preferably within 15 amino acids, more preferably within 5 amino acids (for example, within 3 amino acids).

  The amino acid residue to be mutated is preferably mutated to another amino acid in which the properties of the amino acid side chain are conserved. For example, amino acid side chain properties include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl group-containing side chains (S, T, Y), sulfur atom-containing side chains Amino acids with amino acids (C, M), amino acids with carboxylic acid and amide-containing side chains (D, N, E, Q), amino groups with base-containing side chains (R, K, H), aromatic-containing side chains (H, F, Y, W) can be mentioned (all parentheses represent single letter symbols of amino acids).

  It is already known that proteins having amino acid sequences modified by deletion, addition and / or substitution with other amino acids of one or more amino acid residues to a certain amino acid sequence maintain their biological activity. (Mark, DF et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, MJ & Smith, M. Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al., Science 224, 1431-1433, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).

  Proteins having a plurality of amino acid residues added to the amino acid sequence of the protein include fusion proteins containing these proteins. The fusion protein is a fusion of these proteins and other proteins and is included in the present invention. In order to prepare a fusion protein, for example, a DNA encoding the protein and a DNA encoding another protein are linked so that the frames coincide with each other, introduced into an expression vector, and expressed in a host. Other proteins to be subjected to fusion with the protein of the present invention are not particularly limited.

  There is no restriction | limiting in particular as another peptide attached | subjected to fusion with the protein of this invention, For example, well-known peptides, such as 6 * His which consists of six His (histidine) residues, can be used. In addition, examples of other proteins that are subjected to fusion with the protein of the present invention include GST (glutathione-S-transferase), but are not limited thereto. A fusion protein can be prepared by fusing a commercially available DNA encoding such a protein with a DNA encoding the protein of the present invention and expressing the prepared fusion DNA.

  Other methods well known to those skilled in the art for preparing DNA encoding a protein functionally equivalent to a certain protein include hybridization techniques (Sambrook, J et al., Molecular Cloning 2nd ed., 9.47- 9.58, Cold Spring Harbor Lab. Press, 1989). That is, a person skilled in the art uses a DNA sequence encoding the protein (odd number sequence of SEQ ID NOs: 3 to 68) or a part thereof to isolate DNA having high homology with this, Isolating a protein functionally equivalent to the protein from the DNA is a well-known technique.

  The present invention includes DNA that hybridizes with a DNA encoding the protein under stringent conditions and encodes a protein functionally equivalent to the protein. Examples of such DNA include, but are not limited to, mammal-derived DNA, and more preferably homologs derived from humans, monkeys, pigs, and cattle.

  Hybridization conditions for isolating DNA encoding a protein functionally equivalent to the protein can be appropriately selected by those skilled in the art. Examples of hybridization conditions include low stringency conditions. Low stringent conditions are, for example, conditions of 42 ° C., 5 × SSC, 0.1% SDS, and preferably 50 ° C., 5 × SSC, 0.1% SDS in washing after hybridization. More preferable hybridization conditions include highly stringent conditions. High stringent conditions are, for example, conditions of 65 ° C., 0.1 × SSC, and 0.1% SDS. Under these conditions, it can be expected that DNA having high homology can be efficiently obtained as the temperature is increased. However, a plurality of factors such as temperature and salt concentration can be considered as factors affecting the stringency of hybridization, and those skilled in the art can realize the same stringency by appropriately selecting these factors. .

  In addition, a gene amplification method using a primer synthesized based on sequence information of a DNA sequence (SEQ ID NO: 3 to 68) encoding the protein, for example, polymerase chain reaction (PCR) method is used. It is also possible to isolate DNA encoding a protein functionally equivalent to the protein.

  A protein functionally equivalent to the protein encoded by DNA isolated by these hybridization techniques and gene amplification techniques usually has high homology in amino acid sequence with the protein. The protein of the present invention includes a protein that is functionally equivalent to the protein and has high homology with the amino acid sequence of the protein. High homology generally refers to at least 50% identity, preferably 75% identity, more preferably 85% identity, more preferably 95% identity at the amino acid level. .

  The identity of amino acid sequences and base sequences can be determined by the algorithm BLAST (Proc. Natl. Acad. Sci. USA 90: 5873-5877, 1993) by Karlin and Altschul. Based on this algorithm, programs called BLASTN and BLASTX have been developed (Altschul et al. J. Mol. Biol. 215: 403-410, 1990). When a base sequence is analyzed by BLASTN based on BLAST, parameters are set to score = 100 and wordlength = 12, for example. Further, when the amino acid sequence is analyzed by BLASTX based on BLAST, the parameters are set to score = 50 and wordlength = 3, for example. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific methods of these analysis methods are known (http: //www.ncbi.nlm.nih.gov.).

  The DNA of the present invention may be in any form as long as it can encode the protein of the present invention. That is, it does not matter whether it is cDNA synthesized from mRNA, genomic DNA, or chemically synthesized DNA. Moreover, as long as it can code the protein of this invention, DNA which has the arbitrary base sequences based on the degeneracy of a genetic code is contained.

  The DNA of the present invention can be prepared by methods known to those skilled in the art. For example, a cDNA library is prepared from cells expressing the protein of the present invention, and hybridization is carried out using a part of the DNA sequence of the present invention (odd number sequence of SEQ ID NOs: 3 to 68) as a probe. Can be prepared. The cDNA library may be prepared, for example, by the method described in the literature (Sambrook, J. et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989)), or a commercially available cDNA library may be used. Good. In addition, RNA is prepared from cells expressing the protein of the present invention, cDNA is synthesized by reverse transcriptase, and then based on the sequence of the DNA of the present invention (odd-numbered sequences of SEQ ID NOs: 3 to 68). It can also be prepared by synthesizing an oligo DNA, performing a PCR reaction using this as a primer, and amplifying the cDNA encoding the protein of the present invention.

  Moreover, by determining the base sequence of the obtained cDNA, the translation region encoded by the cDNA can be determined, and the amino acid sequence of the protein of the present invention can be obtained. In addition, genomic DNA can be isolated by screening a genomic DNA library using the obtained cDNA as a probe.

  The present invention provides a protein encoded by the DNA of the present invention. The protein of the present invention may differ in amino acid sequence, molecular weight, isoelectric point, presence / absence of sugar chain, form, etc., depending on the cell, host or purification method that produces it. However, as long as the obtained protein has a function equivalent to the protein, it is included in the present invention. For example, when the protein of the present invention is expressed in prokaryotic cells such as E. coli, a methionine residue is added to the N-terminus of the original amino acid sequence of the protein. The protein of the present invention includes such a protein.

  The protein of the present invention can be prepared as a recombinant protein or a natural protein by methods known to those skilled in the art. If it is a recombinant protein, the DNA encoding the protein of the present invention is incorporated into an appropriate expression vector, and this is introduced into an appropriate host cell. It can be purified and prepared by chromatography such as exchange, reverse phase, gel filtration, or affinity chromatography in which an antibody against the protein of the present invention is immobilized on the column, or by further combining these columns. Is possible.

  In addition, when the protein of the present invention is expressed in a host cell (for example, animal cell or E. coli) as a fusion protein with glutathione S-transferase protein or as a recombinant protein to which a plurality of histidines are added, it is expressed. The recombinant protein can be purified using a glutathione column or a nickel column. After purification of the fusion protein, the region other than the target protein in the fusion protein can be cleaved and removed with thrombin or factor Xa as necessary.

  If it is a natural protein, a method well known to those skilled in the art, for example, an affinity column in which an antibody that binds to the protein of the present invention described later is bound to an extract of a tissue or a cell expressing the protein of the present invention is used. It can be isolated by purifying by acting. The antibody may be a polyclonal antibody or a monoclonal antibody.

  The present invention also provides a vector into which the DNA of the present invention has been inserted. The vector of the present invention is useful for retaining the DNA of the present invention or expressing the protein of the present invention in a host cell.

  As the vector, for example, when E. coli is used as a host, the vector is amplified in E. coli (for example, JM109, DH5α, HB101, XL1Blue), etc. In addition, there is no particular limitation as long as it has a selected gene of transformed E. coli (for example, a drug resistance gene that can be discriminated by any drug (ampicillin, tetracycline, kanamycin, chloramphenicol)). Examples of vectors include M13 vectors, pUC vectors, pBR322, pBluescript, pCR-Script, and the like. In addition, for the purpose of subcloning and excision of cDNA, in addition to the above vector, for example, pGEM-T, pDIRECT, pT7 and the like can be mentioned.

  An expression vector is particularly useful when a vector is used for the purpose of producing the protein of the present invention. As an expression vector, for example, for the purpose of expression in E. coli, in addition to the above characteristics that the vector is amplified in E. coli, the host is E. coli such as JM109, DH5α, HB101, XL1-Blue, etc. In some cases, promoters that can be efficiently expressed in E. coli, such as the lacZ promoter (Ward et al., Nature (1989) 341, 544-546; FASEB J. (1992) 6, 2422-2427), araB promoter (Better et al. , Science (1988) 240, 1041-1043), or the T7 promoter or the like. In addition to the above vectors, such vectors include pGEX-5X-1 (Pharmacia), “QIAexpress system” (Qiagen), pEGFP, or pET (in this case, the host expresses T7 RNA polymerase). BL21 is preferred).

  The vector may also contain a signal sequence for protein secretion. As a signal sequence for protein secretion, a pelB signal sequence (Lei, S. P. et al J. Bacteriol. (1987) 169, 4379) may be used when it is produced in the periplasm of E. coli. Introduction of a vector into a host cell can be performed using, for example, a calcium chloride method or an electroporation method.

  In addition to E. coli, examples of vectors for producing the protein of the present invention include mammalian-derived expression vectors (for example, pcDNA3 (manufactured by Invitrogen)) and pEGF-BOS (Nucleic Acids. Res. 1990, 18 (17), p5322), pEF, pCDM8), insect cell-derived expression vectors (eg “Bac-to-BAC baculovairus expression system” (manufactured by Gibco BRL), pBacPAK8), plant-derived expression vectors (eg pMH1, pMH2 ), Animal virus-derived expression vectors (eg, pHSV, pMV, pAdexLcw), retrovirus-derived expression vectors (eg, pZIPneo), yeast-derived expression vectors (eg, “Pichia Expression Kit” (manufactured by Invitrogen)) PNV11, SP-Q01), and an expression vector derived from Bacillus subtilis (for example, pPL608, pKTH50).

  For the purpose of expression in animal cells such as CHO cells, COS cells, NIH3T3 cells, etc., promoters required for expression in cells such as the SV40 promoter (Mulligan et al., Nature (1979) 277, 108) , MMLV-LTR promoter, EF1α promoter (Mizushima et al., Nucleic Acids Res. (1990) 18, 5322), CMV promoter, etc., and genes for selecting transformation into cells (for example, It is more preferable to have a drug resistance gene that can be discriminated by a drug (neomycin, G418, etc.). Examples of such a vector include pMAM, pDR2, pBK-RSV, pBK-CMV, pOPRSV, and pOP13.

  Further, when the gene is stably expressed and the purpose is to amplify the copy number of the gene in the cell, a vector having a DHFR gene complementary to CHO cells lacking the nucleic acid synthesis pathway (for example, , PCHOI, etc.), and amplifying with methotrexate (MTX). In addition, for the purpose of transient expression of genes, COS cells that have a gene that expresses SV40T antigen on the chromosome Can be used to transform with a vector (such as pcD) having an SV40 replication origin. As the replication origin, those derived from polyoma virus, adenovirus, bovine papilloma virus (BPV) and the like can also be used. Furthermore, for gene copy number amplification in host cell systems, the expression vectors are selectable markers: aminoglycoside transferase (APH) gene, thymidine kinase (TK) gene, E. coli xanthine guanine phosphoribosyltransferase (Ecogpt) gene, dihydrofolate reductase ( dhfr) gene and the like.

  On the other hand, as a method for expressing the DNA of the present invention in the living body of an animal, the DNA of the present invention is incorporated into an appropriate vector, for example, in vivo by a retrovirus method, a liposome method, a cationic liposome method, an adenovirus method, or the like. The method introduced into

  The present invention also provides a host cell into which the vector of the present invention has been introduced. The host cell into which the vector of the present invention is introduced is not particularly limited, and for example, E. coli and various animal cells can be used.

  When eukaryotic cells are used, for example, animal cells, plant cells, and fungal cells can be used as the host. Animal cells include mammalian cells such as CHO (J. Exp. Med. (1995) 108, 945), COS, 3T3, myeloma, BHK (baby hamster kidney), HeLa, Vero, amphibian cells such as Xenopus eggs Mother cells (Valle, et al., Nature (1981) 291, 358-340) or insect cells such as Sf9, Sf21, Tn5 are known. Examples of CHO cells include dhfr-CHO (Proc. Natl. Acad. Sci. USA (1980) 77, 4216-4220) and CHO K-1 (Proc. Natl. Acad.), Which are CHO cells deficient in the DHFR gene. Sci. USA (1968) 60, 1275) can be preferably used. In animal cells, CHO cells are particularly preferred for mass expression purposes. Introduction of a vector into a host cell can be performed by, for example, a calcium phosphate method, a DEAE dextran method, a method using a cationic ribosome DOTAP (Boehringer Mannheim), an electroporation method, a lipofection method, or the like.

  As plant cells, for example, cells derived from Nicotiana tabacum are known as protein production systems, and these may be cultured in callus. As fungal cells, yeasts such as the genus Saccharomyces, such as Saccharomyces cerevisiae, filamentous fungi such as the genus Aspergillus, such as Aspergillus niger, are known. .

  When prokaryotic cells are used, there are production systems using bacterial cells. Examples of bacterial cells include E. coli, for example, JM109, DH5α, HB101, and others, and Bacillus subtilis is known.

  These cells are transformed with the target DNA, and the proteins are obtained by culturing the transformed cells in vitro. The culture can be performed according to a known method. For example, DMEM, MEM, RPMI1640, and IMDM can be used as the culture medium for animal cells. At that time, a serum supplement such as fetal calf serum (FCS) can be used in combination, or serum-free culture may be performed. The pH during culture is preferably about 6-8. Culture is usually performed at about 30 to 40 ° C. for about 15 to 200 hours, and medium exchange, aeration, and agitation are added as necessary.

  On the other hand, examples of systems that produce proteins in vivo include production systems that use animals and production systems that use plants. A target DNA is introduced into these animals or plants, and proteins are produced and collected in the animals or plants. The “host” in the present invention includes these animals and plants.

  When animals are used, there are production systems using mammals and insects. As mammals, goats, pigs, sheep, mice and cows can be used (Vicki Glaser, SPECTRUM Biotechnology Applications, 1993). Moreover, when using a mammal, a transgenic animal can be used.

  For example, the target DNA is prepared as a fusion gene with a gene encoding a protein inherently produced in milk such as goat β casein. Next, a DNA fragment containing the fusion gene is injected into a goat embryo, and the embryo is transferred to a female goat. The protein of interest can be obtained from the milk produced by the transgenic goat born from the goat that received the embryo or its offspring. Hormones may be used in transgenic goats as appropriate to increase the amount of milk containing proteins produced from transgenic goats (Ebert, KM et al., Bio / Technology (1994) 12, 699-702) .

  Moreover, as an insect, a silkworm can be used, for example. When a silkworm is used, the target protein can be obtained from the body fluid of this silkworm by infecting the silkworm with a baculovirus into which a DNA encoding the target protein is inserted (Susumu, M. et al., Nature (1985) 315, 592-594).

  Furthermore, when using plants, for example, tobacco can be used. When tobacco is used, a DNA encoding a target protein is inserted into a plant expression vector, for example, pMON 530, and this vector is introduced into a bacterium such as Agrobacterium tumefaciens. This bacterium can be infected with tobacco, for example Nicotiana tabacum, to obtain the desired protein from the leaves of this tobacco (Julian K.-C. Ma et al., Eur. J. Immunol. ( 1994) 24, 131-138).

  The protein of the present invention thus obtained can be isolated from the inside of the host cell or outside the cell (such as a medium) and purified as a substantially pure and homogeneous protein. The separation and purification of the protein may be performed using the separation and purification methods used in normal protein purification, and is not limited at all. For example, chromatography column, filter, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectric focusing, dialysis, recrystallization, etc. are appropriately selected, When combined, proteins can be separated and purified.

  Examples of chromatography include affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed Daniel). R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996). These chromatography can be performed using liquid phase chromatography, for example, liquid phase chromatography such as HPLC and FPLC. The present invention also encompasses highly purified proteins using these purification methods.

  In addition, the protein can be arbitrarily modified or the peptide can be partially removed by allowing an appropriate protein modifying enzyme to act before or after purification of the protein. Examples of protein modifying enzymes include trypsin, chymotrypsin, lysyl endopeptidase, protein kinase, glucosidase, and the like.

  The present invention also provides an oligonucleotide that hybridizes to the DNA of the present invention and comprises at least 15 nucleotides. The description of the oligonucleotide is the same as described above.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples. Each Example described below was implemented in the following cells and experimental methods.

<Cancer tissue / normal tissue>
As a human cancer tissue, a specimen excised by surgery of a patient who received sufficient informed consent at Juntendo University / Izu Nagaoka Hospital was used. As the normal tissue, a tissue judged to be normal as a result of pathological examination around the excised cancer tissue of the same patient was used. The pre-cancerous lesion tissue is a tissue that has been determined to be a pre-cancerous stage by pathological examination, in the periphery of the cancer tissue resected by surgery of a patient who received sufficient informed consent at Juntendo University / Izu Nagaoka Hospital Was used. This study was conducted with the approval of the National Institute of Genetics and the Human Genome Research Ethics Committee of Juntendo University Izu Nagaoka Hospital.

<Cancer cell culture method>
5 types of gastric cancer cell lines: MKN-1 (adenosquamous carcinoma), MKN-7 (tubular adenocarcinoma, well differentiated), MKN-45 (tubular adenocarcinoma, poorly differentiated), MKN-74 (tubular adenocarcinoma)・ Medium differentiation type), and KATOIII (signature ring cell carcinoma), pancreatic cancer cell lines: MIAPaCa-2, KP-2, skin cancer cell lines: HSC-1, HSC-4, HSC-5, A-431, Purchased from the Human Science Foundation and Human Science Research Resources Bank. Colon cancer cell lines: CACO-2, COLO-320, CW-2, TT1TKB, and liver cancer cell lines: HepG2 were purchased from RIKEN RIKEN CELL BANK. Breast cancer cell line: SK-BR-3 was purchased from Dainippon Pharmaceutical Co., Ltd. Each cancer cell line was used for experiments after culturing cells according to the cell culture solution and cell culture conditions described in the cell culture data sheet attached from the purchaser.

<Method for analyzing GSDMB expression by RT-PCR>
Preparation of human normal tissue total RNA, human cancer tissue total RNA, human precancerous lesion tissue total RNA, and total RNA from gastric cancer cultured cells using ISOGEN (Nippon Gene) according to the procedures recommended by the supplier. It was. Total RNA obtained from each cultured skin cancer cell was treated with a DNA-degrading enzyme at 37 ° C. for 30 minutes to remove genomic DNA in the sample. The procedure for synthesizing cDNA from total RNA is as follows. Human normal, precancerous, cancer tissue-derived total RNA, 7.5 μg, and cancer cultured cell total RNA 3 μl of 10 mM dNTP (10 mM dATP, 10 mM dCTP, 10 mM dGTP, 10 mM dTTP), 1500 ng of Oligo (dT) _12-18 primer In addition, a final volume of 39 μl was prepared with distilled water subjected to RNase removal treatment. This solution was treated at 65 ° C. for 5 minutes and then rapidly cooled in ice. In a solution that has been sufficiently cooled to ice temperature, 12 μl of 5x First strand buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl ₂ ), 3 μl of 100 mM DTT, 3 μl of RNA Inhibitor, reverse transcriptase (SuperScript III Reverse Transcriptase: 3 μl of Invitrogen) was added and reacted at 55 ° C. for 50 minutes. After completion of the reaction, further incubate at 70 ° C. for 15 minutes, remove the enzyme activity of reverse transcriptase, and use this final reaction product for human normal tissue, human cancer tissue, human precancerous tissue, and gastric cancer cultured cells A cDNA sample of the strain was used.

  Confirmation of GSDMB expression in each human normal, precancerous, all cancer tissue-derived, and cancer cultured cell line samples was performed by PCR. The primers used were GSDMB420: GGGGACAAGTGGTTAGATGAA (SEQ ID NO: 70) and GSDMB1388: TAGGAAGAGACAGAGGTAGGC (SEQ ID NO: 71), GSDMB710F: GGAGCGGTAAAGGAGGAAAC (SEQ ID NO: 72) and GSDMB1185R: TACCAAGACCCCAGCATG (GT B: GT, GA: TG SEQ ID NO: 74) and GSDMB-R: TTAGGAAGAGACAGAGGTAGG (SEQ ID NO: 75), GSDMB PB: GATCTTCAGTTGCTTCAGGCC (SEQ ID NO: 76) and GSDMB-R. The reaction conditions are: DNA denaturation reaction at 94 ° C for 30 seconds, annealing reaction at 57 ° C for 30 seconds, extension reaction at 72 ° C for 1 minute 30 seconds, reaction cycle of 35 cycles, and the machine used was DNA amplification from Biometra Device. After completion of the reaction, the PCR sample was electrophoresed on a 1% agarose gel, and GSDMB expression in each sample was evaluated. For detection of alternative splice products specific to promoter A and promoter B, first, 50 μl using promoter A specific primer set GSDMB PA and GSDMB-R and promoter B specific primer set GSDMB PA and GSDMB-R. RT-PCR was performed in the system, and a portion of the obtained PCR sample was used as a template, and Nested PCR was performed using GSDMB710F and GSDMB1185R, which are alternative splice product detection primer sets. The PCR product obtained by this operation was analyzed by electromigration on a 2.5% or 3% agarose gel. The PCR conditions for Nested PCR are as follows: DNA denaturation reaction at 94 ° C. for 30 seconds, annealing reaction at 57 ° C. for 30 seconds, extension reaction at 72 ° C. for 30 seconds, reaction cycle of 25 cycles, and the machine used is Biometra It is a DNA amplification device.

<Base sequence analysis method>
Human normal tissue, human cancer tissue, human precancerous lesion tissue, and gastric cancer cell line GSDMB derived by RT-PCR were subcloned using the pGEM-Teasy TA cloning vector. The subcloned GSDMB base sequence was subjected to a sequencing reaction using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and analyzed by ABI PRISM 3700 Analyzer (Applied Biosystems). The obtained base sequence information was analyzed using gene analysis software DNASIS Ver. 3.7 (Hitachi Software).

<Method for producing anti-GSDMB antibody and in situ hybridization method>
The anti-GSDMB antibody was prepared by synthesizing a peptide in a region corresponding to the 67th to 18th amino acids of the GSDMB protein: DKWLDELDSGLQGQKAEF (SEQ ID NO: 77) and immunizing chickens. The antibody titer was measured by ELISA.

  Human cancer tissue samples were excised by surgery and then fixed with 4% formaldehyde solution for 12 to 16 hours. The fixed cancer tissue sample was embedded using an O.C.T. compound and sliced to a thickness of 10 μm using a microtome for frozen sections (Leica CM3050). Localization of GSDMB in cancer and precancerous tissues was performed using anti-GSDMB (50-fold dilution) as the primary antibody and FITC-labeled donkey anti-chicken IgY polyclonal antibody (500-fold dilution, Jacson ImmunoReseach) as the secondary antibody. Visualization was performed using a vertical fluorescence microscope (OLYMPUS BX51).

  Human cancer tissue samples were excised by surgery and then fixed with 4% formaldehyde solution for 12 to 16 hours. The tissue pieces after fixation were embedded in O.C.T compound and sliced 25 μm using a cryotome microtome (Leica CM3050) to prepare an in situ preparation.

The in situ preparation was dried at 42 ° C. for 1 hour and then fixed with 4% paraformaldehyde / PBS. Then, it was washed twice with PBS for 5 minutes, then treated with Proteinase-K (Roche Applied Science) at a concentration of 50 μg / ml, washed once with PBS for 5 minutes, and fixed again with 4% paraformaldehyde / PBS. It was. After fixation, it was treated in distilled water for 5 minutes and placed in a 0.1 M triethanolamine (pH 8.0) solution stirred with a stirrer. Acetic anhydride was added to 0.25%, and when all the acetic anhydride was dissolved, the stirrer was stopped and left for 10 minutes. Thereafter, the cells were treated with PBS for 5 minutes and 0.85% NaCl for 5 minutes.
Prehybridization was performed using a hybridization solution (50% Formamide, 5X SSC, 1 mg / ml Yeast tRNA, 100 μg / ml Heparin, 1X Denhardt's solution (50X Denhardt's solution = 1% Ficoll 400, 1% polyvinylpyrrolidone, 1% BSA), It was carried out at 60 ° C. for 3 hours or more in 0.1% Tween 20, 0.1% CHAPS (3-[(3-Cholamidopropyl) dimethylammonio] -1-propanesulfonate), 5 mM EDTA).

As an in situ probe, cRNA was synthesized using human GSDMB cDNA as a template. At this time, the probe was labeled by incorporating digoxigenine-labeled-UTP (Roche Applied Science). The probe is a in order to improve the penetration into the tissue _{40 mM NaOCO 3/60 mM Na} 2 CO 3 (pH 10.2) solution, the time length of the probe is 250 bases, incubated at 60 ° C. Then, fragmentation was performed. Note that the time (T) when the probe length is 250 bases is obtained by dividing {(first cRNA length, kb)-0.25} by {0.11 x (first cRNA length, kb) x 0.25}. It was derived by
The pre-hybridized in situ preparation was hybridized at 60 ° C. for 12 to 16 hours in a solution in which the probe was added to the hybridization solution to a concentration of 1 μg / ml to 2 μg / ml.

Preparations after hybridization were washed at 1X SSC, 0.3% CHAPS, 60 ° C for 10 minutes, 1.5X SSC, 0.3% CHAPS, 60 ° C for 10 minutes, and then washed at 37 ° C in 1.5X SSC, 0.3% CHAPS solution. The temperature was lowered to. After reaching 37 ° C, wash twice with 2 X SSC, 0.3% CHAPS at 37 ° C, then add RNase (Rnase A) to 2 X SSC, 0.3% CHAPS to a concentration of 20μg / ml. The cRNA probe that did not hybridize was digested at 37 ° C. for 30 minutes. Then, 2X SSC, 0.3% CHAPS at room temperature for 10 minutes, 0.2X SSC, 0.3% CHAPS at 60 ° C for 30 minutes twice, 0.1% Tween 20, 0.3% CHAPS / PBS at 60 ° C for 2 minutes. Washing was performed 10 times with 0.1% Tween 20 / PBS at room temperature and 10 minutes with PBT (2 mg / ml BSA, 0.1% Triton-X 100 / PBS) at room temperature.
After preparing the probe, the preparation was blocked with a PBT solution containing 20% sheep serum at room temperature for 1 hour, and then anti-digoxigenine antibody (anti-digoxigenine antibody coupled to alkaline phosphatase, Roche Applied Science) was added to 20% sheep serum. Antibody treatment was performed at 4 ° C. for 12 to 16 hours using an antibody solution diluted 1000 times with the PBT solution contained.

Then, wash the antibody with PBT at room temperature 4 times for 30 minutes, then with Alkaline phosphatase buffer (100 mM Tris-HCl pH 9.5, 100 mM NaCl, 0.1% Tween 20, 50 mM MgCl ₂ ) for 5 minutes each. Processed twice.

  The preparation after antibody washing and Alkaline phosphatase buffer treatment was performed using Alkaline phosphatase detection solution (337.5 μg / ml Nitro blue tetrazolium, 175 μg / ml 5-bromo-4-chrolo-3-indoyl phosphate / Alkaline phosphatase buffer). Visualization of Alkaline phosphatase was performed.

  After completion of all the operations, the preparation was fixed with a 4% formaldehyde solution, and then covered with a rubber glass and observed with an upright optical microscope (OLYMPUS BX51).

[Example 1] Expression analysis of GSDMB in human gastric cancer tissue using RT-PCR
We have shown that GSDMA is expressed in normal stomach tissue and its expression disappears in gastric cancer. Therefore, GSDMB expression in human normal stomach tissue and stomach cancer tissue was examined by RT-PCR using PCR primers GSDMB420 (SEQ ID NO: 70) and GSDMB1388 (SEQ ID NO: 71). The result is shown in FIG. Although GSDMB is not expressed in many normal stomach tissues, expression was observed in the precancerous stage and cancer tissues. It is of great interest that the expression of both genes that are members of the same gene family and present in the same chromosomal region are complementary.

  Furthermore, since GSDMB expression is observed in some normal stomach tissues and all precancerous stages and cancer tissues, it is considered that GSDMB expression is closely related to canceration. Therefore, the expression of GSDMB in normal stomach tissue, precancerous tissue, and cancer tissue derived from the same patient was examined by semi-quantitative RT-PCR using PCR primers GSDMB420 (SEQ ID NO: 70) and GSDMB1388 (SEQ ID NO: 71). . The result is shown in FIG. GSDMB was not expressed in normal stomach tissue of patient A, but was strongly expressed in cancer tissue. In patient B, weak expression was also observed in normal stomach tissue. In patient C, as in patient A, it was not expressed in normal stomach tissue, but strong expression was observed in precancerous tissue and cancer tissue. Most notable is Patient D. In patient D, GSDMB expression in 2 samples of normal stomach tissue, 1 sample of precancerous state, and 1 sample of cancer tissue is not expressed in 1 sample of 2 samples of normal stomach tissue, but weak expression is observed in the other sample. It was. Furthermore, the expression became strong when pre-cancerous, and the strongest expression was observed in cancer tissues. This means that the expression of GSDMB increases with the progression of cancer, that is, the expression level of GSDMB and canceration are closely related. In addition, GSDMB is not expressed in many normal tissues, but the expression is partially observed in normal tissues. Some specimens judged to be pathologically normal are already suitable for canceration at the level of gene expression. Is considered to exist.

[Example 2] Analysis of localization of GSDMB mRNA in gastric cancer tissue by in situ hybridization Next, expression of GSDMB in human gastric cancer tissue was examined by in situ hybridization. FIG. 3A shows the expression of GSDMB in gastric cancer tissue, and FIG. 3B shows an enlarged image of FIG. 3A. GSDMB was expressed in cancer tissues and was not expressed in normal tissue areas around the cancer. This result suggests that cancer acts on surrounding normal tissues, and that GSDMB expression is not induced in normal tissues, but GSDMB is expressed in cancer cells themselves. Further, when an anti-GSDMB polyclonal antibody was prepared and the expression of the GSDMB protein was examined, it was shown that the GSDMB protein was localized in the cancer tissue as in the case of gene expression (FIG. 4).

[Example 3] Expression analysis of GSDMB in human cancer tissue using RT-PCR The above results indicate that the expression level of GSDMB and canceration may be closely related in gastric cancer. Furthermore, when other cancers were examined by RT-PCR for the expression of GSDMB using PCR primers GSDMB420 (SEQ ID NO: 70) and GSDMB1388 (SEQ ID NO: 71), interesting results were obtained. FIG. 5 shows the expression of GSDMB in breast cancer and FIG. 6 in colorectal cancer.

  GSDMB in breast cancer and colon cancer was expressed in some normal tissues, precancerous tissues, and cancerous tissues. In these cancers, the expression level of GSDMB and canceration are considered to be closely related to those of gastric cancer. A notable point in breast cancer is the size of its PCR product. The same PCR primer was used for analysis, but the breast cancer showed a clearly different band pattern from that of stomach cancer and colon cancer. This suggests the possibility of tissue-specific splicing products.

  In the case of colorectal cancer, the same expression and splicing pattern as gastric cancer is shown. However, amplification of the 17q12 amplicon region where GSDMB is present is known in breast cancer, but amplification of the 17q12 amplicon region has not been reported in colorectal cancer (no amplification is observed). Thus, colorectal cancer results indicate that GSDMB is not overexpressed due to amplification of the 17q12amplicon region due to canceration. Furthermore, GSDMB expression by many other cancers can be expressed in various types of cancer cell lines (even if these cell lines are derived from the same tissue, such as undifferentiated cancer, poorly differentiated cancer, moderately differentiated cancer, and well differentiated cancer. ). Expression was confirmed by RT-PCR using PCR primers GSDMB420 (SEQ ID NO: 70) and GSDMB1388 (SEQ ID NO: 71). As a result, expression of GSDMB was confirmed in all examined skin cancer, breast cancer, stomach cancer, colon cancer, pancreatic cancer and liver cancer cell lines. From the above results, GSDMB was expressed in all cancers, and it was considered that the increase in GSDMB promoter activity accompanying canceration was responsible for the increase in GSDMB expression.

[Example 4] Promoter analysis of GSDMB
As a result of examining the structure of the GSDMB promoter, we found that there are two types of promoter regions and two types of first exons (FIG. 8).

  A 5 ′ primer (GSDMB PA (SEQ ID NO: 74) and GSDMB PB (SEQ ID NO: 76)) is set in exon 1a and exon 1b, and a common primer GSDMB-R (SEQ ID NO: 75) is used on the 3 ′ side. When GSDMB in gastric cancer was examined by RT-PCR, it was thought that an alternative splice product was transcribed from promoter B (Fig. 8). As a result of examination by nested PCR method using several kinds of primer sets using cancer tissues and cancer tissues, it is clear that most GSDMB alternative splice products have differences in the central region with poor preservation in all gasdermin families. (Figure 9) The primer sets used at this time were GSDMB710F (SEQ ID NO: 72) and GSDMB1185R (SEQ ID NO: 73). The agarose gel was 3%, and the electrophoretic conditions were 100 volts, 2 hours and 50 minutes.At the same time, not only promoter B but also at least three types of promoter A (GSDMB710F (SEQ ID NO: 72)). About 540 bases, about 500 bases, about 470 bases using GSDMB1185R (SEQ ID NO: 73), and at least 7 alternative splice products (GSDMB710F (SEQ ID NO: 72) and GSDMB1185R (SEQ ID NO: 73) from promoter B About 540 bases, about 500 bases, about 470 bases, about 420 bases, about 400 bases, about 380 bases, about 350 bases).

  Since human cancer tissue is excised by surgery, there are various tissues such as cancer tissue, pre-cancerous tissue, tissue that is normal in pathology but already expresses GSDMB and is progressing to cancer. The organization is included. Therefore, in order to investigate the selectivity of GSDMB promoter in a single cancer cell, an experiment was conducted using a cancer cell line. As a result, it was revealed that promoter A was not used and promoter B was selectively used in all the cell lines examined (FIG. 10). The primers used at this time were GSDMB P-A (SEQ ID NO: 74) and GSDMB-R (SEQ ID NO: 75), and GSDMB P-B (SEQ ID NO: 76) and GSDMB-R (SEQ ID NO: 75).

  Furthermore, as a result of examining increase / decrease in promoter B-derived alternative splice products in normal stomach tissue, precancerous tissue, cancer tissue, gastric cancer cell line, the alternative splice product increased in the order of normal gastric tissue, precancerous tissue, cancer tissue, gastric cancer cell line. At the same time, it was revealed that the longest transcript with the highest transcription amount in normal stomach tissue decreased (FIG. 11). The primer sets used at this time were GSDMB710F (SEQ ID NO: 72) and GSDMB1185R (SEQ ID NO: 73), and the analyzed gel was 2.5%.

[Example 5] Detection of cancer-specific GSDMB mutations These results indicate that alternative splice products specific for cancer cells are deeply involved in canceration. However, another possibility is cancer-specific GSDMB mutation. Therefore, we examined the presence or absence of GSDMB mutations expressed in human gastric cancer. As described above, since the patient cancer specimen contains various tissues, an experiment was conducted using a cancer cell line as the first stage. As a result, in poorly differentiated, moderately differentiated, and well differentiated gastric cancers (MKN-1, MKN-7, MKN-45, MKN-74)
TCTGAGGTCCTGATTTCC G GGGAGCTACACATGGAGGAC C CAGACAAGCCTCTCCTAAGC (SEQ ID NO: 78)
This sequence is specific for undifferentiated gastric cancer (KATOIII).
TCTGAGGTCCTGATTTCC A GGGAGCTACACATGGAGGAC T CAGACAAGCCTCTCCTAAGC (SEQ ID NO: 79)
Mutations were found. That is, although it is a cancer cell line, 100% (4/4) in poorly differentiated, moderately differentiated, and well differentiated gastric cancer
TCTGAGGTCCTGATTTCC G GGGAGCTACACATGGAGGAC C CAGACAAGCCTCTCCTAAGC (SEQ ID NO: 78)
The change in base was observed only in undifferentiated gastric cancer (KATOIII). However, this result is only for cancer cell lines, and only one line of undifferentiated gastric cancer cell lines was examined. Therefore, whether or not this base change is actually related to undifferentiated gastric cancer (non-solid poorly differentiated cancer, signet ring cell carcinoma) was examined using cancer tissue derived from undifferentiated gastric cancer patients. Examination of 6 undifferentiated gastric cancer patient-derived cancer tissues (2 signet-ring cell carcinomas, 4 undifferentiated poorly differentiated cancers) revealed that two similar bases were found in 80% or more (5/6) specimens. A substitution was found (Figure 12).

  This base substitution causes an amino acid substitution. Substitution of the front base, G to A, causes an amino acid substitution from amino acid 282 to glycine to arginine, and substitution of the rear base, C to T, causes an amino acid substitution from amino acid 289 to proline to serine . Furthermore, these amino acids are amino acids that are conserved throughout the Gasdermin Family (FIG. 13).

More interestingly, in the process of verifying the base change of 6 undifferentiated gastric cancer patient-derived cancer tissues (2 signet ring cell carcinomas, 4 non-solid poorly differentiated cancers), 3 A transcript of a combination of types of base changes was found. One was found in normal type, differentiated gastric cancer
TCTGAGGTCCTGATTTCC G GGGAGCTACACATGGAGGAC C CAGACAAGCCTCTCCTAAGC (SEQ ID NO: 78)
Type of,
The second was found in undifferentiated gastric cancer
TCTGAGGTCCTGATTTCC A GGGAGCTACACATGGAGGAC T CAGACAAGCCTCTCCTAAGC (SEQ ID NO: 79)
Type of,
The third is between differentiated and undifferentiated gastric cancer
TCTGAGGTCCTGATTTCC A GGGAGCTACACATGGAGGAC C CAGACAAGCCTCTCCTAAGC (SEQ ID NO: 80).
Of the type. Furthermore, SNP (Single nucleotide polymorphism) of GSDMB was analyzed using SNP database (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=snp). It was revealed that the significant base change was single nucleotide polymorphism (SNP). These results suggest that these SNPs are closely related to the development of undifferentiated gastric cancer, and it is expected that it will probably be important to have the SNP combination and homo or hetero.

It is a photograph which shows the result of the expression analysis of GSDMB in the human stomach cancer tissue using RT-PCR. 1 lane is a set of DNA markers, 2 and 3, 4 and 5, 6 and 7, 8 and 9, 10 and 11, 12 and 13, 14 and 15, 16 and 17 from the same patient, Even numbers indicate expression results in cancer tissue, odd numbers indicate precancerous state or normal tissue (precancerous state is 3, 5, 7 lanes, normal tissue is 9, 11, 13, 15, 17 lanes) It is a photograph which shows the result of the expression analysis of GSDMB in a human gastric cancer tissue using semiquantitative RT-PCR. Lanes 1, 4 and 14 show DNA markers. 2 to 3 lanes are tissue from the same patient A (2 lanes: normal stomach tissue, 3 lanes: cancer tissue), 5 to 6 lanes are tissue from the same patient B (5 lanes: normal stomach tissue, 6 lanes: cancer tissue) ), 7 to 9 lanes from the same patient C (7 lanes: normal stomach tissue, 8 lanes: precancerous tissue, 9 lanes: cancer tissue), 10 to 13 lanes from the same patient D (10 lanes: Expression in normal stomach tissue, 11 lanes: normal stomach tissue, 12 lanes: precancerous tissue, 13 lanes: cancer tissue) is shown. It is a photograph which shows the analysis result of the localization of GSDMB mRNA in the gastric cancer tissue by in situ hybridization method. A shows the localization of GSDMB mRNA (weak gastric cancer tissue image), and B shows an enlarged view of the region surrounded by the square shown in FIG. It is a photograph which shows the detection result of GSDMB protein in gastric cancer using an anti-GSDMB antibody. A shows the expression of GSDMB protein in stomach cancer tissue, and B shows normal stomach tissue. It was revealed that GSDMB protein is expressed specifically in cancer tissues. It is a photograph which shows the result of the expression analysis of GSDMB in the human breast cancer tissue using RT-PCR. One lane shows a DNA marker. 2 to 3 lanes are tissues from the same patient (2 lanes: cancer tissue, 3 lanes: normal breast tissue), 4 to 5 lanes are tissues from the same patient (4 lanes: cancer tissue, 5 lanes: normal breast tissue) 6 to 7 lanes are tissues from the same patient (6 lanes: cancer tissue, 7 lanes: normal breast tissue), 8 to 9 lanes are tissues from the same patient (8 lanes: cancer tissue, 9 lanes: normal breast tissue), Lane 10 shows the expression in a patient-derived cancer tissue, lanes 11 to 12 show the expression in the same patient-derived tissue (11 lanes: cancer tissue, 12 lanes: normal breast tissue), and 13 lanes show the expression in the patient-derived cancer tissue. It is a photograph which shows the result of the expression analysis of GSDMB in the human colon cancer tissue using RT-PCR. One lane shows a DNA marker. 2 to 3 lanes are tissues from the same patient (2 lanes: cancer tissue, 3 lanes: normal colon tissue), 4 to 5 lanes are tissues from the same patient (4 lanes: cancer tissue, 5 lanes: normal colon tissue), 6 to 7 lanes are tissues from the same patient (6 lanes: cancer tissue, 7 lanes: normal colon tissue), 8 to 9 lanes are tissues from the same patient (8 lanes: cancer tissue, 9 lanes: normal colon tissue), 10 to 11 lanes are tissues from the same patient (10 lanes: cancer tissue, 11 lanes: normal colon tissue), 12 to 13 lanes are tissues from the same patient (12 lanes: cancer tissue, 13 lanes: normal colon tissue), 14 to 15 lanes are tissue from the same patient (14 lanes: cancer tissue, 15 lanes: normal colon tissue), and 16 to 17 lanes are tissues from the same patient (16 lanes: cancer tissue, 17 lanes: normal colon group) Shows expression in). It is a photograph which shows the result of the expression analysis of GSDMB in the cancer tissue of various parts of origin using RT-PCR. Lanes 1 and 17 represent DNA markers. Lanes 2, 12, and 14 represent controls. 3 lanes are colon cancer (CW-2), 4 lanes are liver cancer (HepG2), 5 lanes are colon cancer (TT1TKB), 6 lanes are colon cancer (CaCo2), 7 lanes are colon cancer (Colo320), 8 lanes Is gastric cancer (MKN-1), 9 lanes are gastric cancer (MKN-74), 10 lanes are pancreatic cancer (KP2), 11 lanes are pancreatic cancer (MIAPaCa2), 13 lanes are gastrointestinal cancer (MKN-1), 15 lanes are Gastric cancer (MKN-45), lane 16 shows expression in pancreatic cancer (MIAPaCa2 substrain). FIG. 3 is a photograph showing the expression of an alternative splice product of GSDMB, and a diagram showing the structure of the GSDMB promoter. In the gel photograph, lanes 1 to 4 are transcripts derived from the same stomach cancer patient (1 lane: transcript derived from cancer tissue promoter B, 2 lanes: transcript derived from cancer tissue promoter A, 3 lanes: transcript derived from precancerous tissue promoter B) 4 lanes: precancerous tissue promoter A-derived transcription product). 5 to 8 lanes are transcripts derived from the same stomach cancer patient (5 lanes: transcripts derived from cancer tissue promoter B, 6 lanes: transcripts derived from cancer tissue promoter A, 7 lanes: transcripts derived from precancerous tissue promoter B, 8 lanes: (Pre-cancerous tissue promoter A-derived transcript). It is a photograph which shows expression of the alternative splice product in cancer tissue and precancerous tissue. Lane 1 is a DNA marker, Lane 2 is an alternative splice product derived from promoter A-derived precancerous tissue, Lane 3 is an alternative splice product derived from promoter B-derived precancerous tissue, Lane 4 is an alternative splice product derived from cancer tissue promoter A, and Lane 5 is The alternative splice product derived from cancer tissue promoter B is shown. It is a photograph which shows the selectivity of the GSDMB promoter in a cancer cell line. One lane is a breast cancer cell line, 2 lanes are gastric cancer cell lines, 3 lanes are colon cancer cell lines, 4 lanes are skin cancer cell lines, and 5 lanes are GSDMB promoter selectivities in pancreatic cancer cell lines. It is a figure which shows expression of the alternative splice product derived from promoter B. One lane shows a DNA marker. 2 lanes are normal small intestine, 3 lanes are precancerous colon tissue (3, 4 from the same patient), 4 lanes are colon cancer tissue, 5 lanes are colon cancer cell line (CW-2), 6 lanes are precancerous stomach Tissues (6, 7 from the same patient), 7 lanes show gastric cancer tissue, 8 lanes show expression of alternative splice products in gastric cancer cell line (MKN-1). It is a figure which shows the variation | mutation of cancer specific GSDMB. It is a figure which shows the homology of the GSDMB mutation location in Gasdermin Family.

Claims (22)

A test method for cancer, comprising a step of measuring the expression level of the protein according to any one of the following (a) to (d).
(A) a protein encoded by DNA consisting of the base sequence described in any one of the odd-numbered sequences of SEQ ID NOs: 1 to 68 (b) described in any of the even-numbered sequences of SEQ ID NOs: 1 to 68 Protein (c) consisting of an amino acid sequence consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence described in any of the even-numbered sequences of SEQ ID NOs: 1 to 68 A protein derived from nature and having a functional equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 (d) The odd-numbered proteins of SEQ ID NOs: 1 to 68 A protein encoded by a naturally-occurring DNA that hybridizes under stringent conditions with DNA comprising the base sequence described in any of the sequences, No.: a protein comprising the amino acid sequence of any one of the even-numbered sequence of 1 to 68 functionally equivalent protein   A test method for cancer, comprising a step of detecting a mutation in a protein consisting of the amino acid sequence described in the even-numbered sequences of SEQ ID NOs: 1 to 34.   The method for examining cancer according to claim 2, wherein the mutation in the protein is a mutation accompanied by amino acid substitution.   A test method for cancer, comprising a step of detecting a mutation in the DNA sequence described in the odd-numbered sequence of SEQ ID NOs: 1 to 34.   The method for examining cancer according to claim 4, wherein the mutation in the DNA sequence is a mutation accompanied by base substitution.   The cancer testing method according to claim 1, wherein the cancer is skin cancer, breast cancer, stomach cancer, lung cancer, colon cancer, esophageal cancer, cervical cancer, pancreatic cancer or liver cancer. The antibody couple | bonded with the protein in any one of the following (a)-(d), or its fragment | piece.
(A) a protein encoded by a DNA comprising the base sequence described in any of the odd-numbered sequences of SEQ ID NOs: 1 to 68 (b) described in any of the even-numbered sequences of SEQ ID NOs: 1 to 68 Protein (c) containing an amino acid sequence (c) consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of any of the even-numbered sequences of SEQ ID NOs: 1 to 68 A protein derived from nature and having a functional equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 (d) The odd-numbered proteins of SEQ ID NOs: 1 to 68 A protein encoded by naturally occurring DNA that hybridizes under stringent conditions with DNA comprising the base sequence described in any of the sequences, A protein comprising the amino acid sequence of any one of the even-numbered sequence of 1 to 68 functionally equivalent protein A diagnostic agent for cancer comprising the antibody according to claim 7. A therapeutic agent for cancer comprising the antibody according to claim 7 as an active ingredient. A diagnostic agent for cancer, comprising an oligonucleotide that hybridizes to the DNA according to any one of the following (a) to (d) and has a chain length of at least 15 nucleotides.
(A) DNA comprising the base sequence described in any of the odd-numbered sequences of SEQ ID NOs: 1 to 68
(B) DNA encoding a protein comprising the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68
(C) a naturally occurring protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68 A DNA that encodes a protein that is functionally equivalent to a protein consisting of the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 1 to 68
(D) a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence of any one of the odd-numbered sequences of SEQ ID NOs: 1 to 68, DNA encoding a protein functionally equivalent to the protein consisting of the amino acid sequence described in any of the even-numbered sequences The test agent according to claim 8 or 10, wherein the cancer is skin cancer, breast cancer, stomach cancer, lung cancer, colon cancer, esophageal cancer, cervical cancer, pancreatic cancer or liver cancer. The DNA according to any one of the following (a) to (c).
(A) DNA comprising the base sequence set forth in SEQ ID NO: 69
(B) a DNA comprising a base sequence in which one or more bases are substituted, deleted, added and / or inserted in the base sequence set forth in SEQ ID NO: 69, wherein the base sequence set forth in SEQ ID NO: 69 DNA with promoter activity equivalent to DNA containing
(C) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 69, and has a promoter activity equivalent to that of the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 69 DNA A DNA in which the DNA of claim 12 and a DNA encoding a protein that acts in a suppressive manner are functionally bound. The DNA according to claim 13, wherein the protein that acts in a suppressive manner in cancer is a tumor suppressor protein or a cytotoxic protein. A vector into which the DNA according to any one of claims 12 to 14 is inserted. The vector according to claim 15, which is used for gene therapy. A transformed cell carrying the vector according to claim 15 or 16. The DNA according to any one of the following (a) to (d).
(A) DNA comprising the base sequence described in any one of the odd-numbered sequences of SEQ ID NOs: 3 to 68
(B) DNA encoding a protein comprising the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 3 to 68
(C) a naturally occurring protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence of any one of the even-numbered sequences of SEQ ID NOs: 3 to 68 A DNA that encodes a protein that is functionally equivalent to a protein consisting of the amino acid sequence set forth in any of the even-numbered sequences of SEQ ID NOs: 3 to 68
(D) a naturally-occurring DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence of any one of the odd-numbered sequences of SEQ ID NOs: 3 to 68, DNA encoding a protein functionally equivalent to the protein consisting of the amino acid sequence described in any of the even-numbered sequences A protein encoded from the DNA of claim 18 A vector into which the DNA according to claim 18 is inserted. A transformed cell carrying the DNA according to claim 18 or the vector according to claim 19. 19. An oligonucleotide that hybridizes to the DNA of claim 18 and has a chain length of at least 15 nucleotides.