WO2001078796A1 - Type ii gonadotropin-releasing hormone receptor and polynucleotides encoding therefor - Google Patents

Abstract

There is provided polynucleotides encoding the full sequence for the marmoset and human Type II gonadotropin-releasing hormone receptors (Type II GnRH-R). The corresponding amino acid sequences are also provided.

Description

  



  "Type   II      Gonadotropin-releasing Hormone    Receptor and   Polynucleotides    Encoding Therefor"
The present invention relates to a novel Type II gonadotropin-releasing hormone receptor (Type II
GnRH-R), to genetically engineered host cells able to express the Type   II      GnRH-R,    and the ligands and antibodies therefor.



  Type I gonadotropin-releasing hormone (GnRH) is a decapeptide released from the hypothalamus, and acts through receptors to regulate the secretion of gonadotropins required for reproductive function (see Fink et al.,"Gonadotrophin secretion and its control", The Physiology of Reproduction, E Knobil and I Neill, New York, Raven Press, pages 13491377,1988).



  Receptors for Type I GnRH (ie Type I   GnRH-R)    are members of the large G-protein-coupled receptor family and are preferentially coupled to phosphoinositidase C via the   Gq/Gll    family of G proteins. Typically Type I GnRH-Rs are located in the gonadotroph cells of the anterior pituitary gland (where binding of Type I GnRH leads to release of the gonadotropins luteinising hormone and follicle-stimulating hormone), as well as on the central and peripheral nervous systems, gonads, placenta and on certain tumours, such as breast and prostate. Type   I    GnRH receptors may display both up and down regulation and Type I GnRH agonists have been used in management of prostate and breast cancer, as well as to stimulate gonadotropin secretion in the treatment of infertility.



  Expression of mouse and rat Type I   GnRH-R    was first achieved by injecting poly (A) + mRNA from a suitable source (eg from the pituitary gland) into Xenopus oocytes (see, for example, Eidne et al., J. Mol.



  Endocr. Vol 1, pages   R9-R12,    1988; Yoshida et al.,
Molecular Endocrinology, Vol 3, pages 1953-1960, 1989; and Sealfon et   al.,    Molecular Endocrinology,
Vol 4, pages 119-124,1990). This system allowed some characterisation of the pharmacology of the
Type I   GnRH-R.   



  The protein-encoding nucleotide sequence of the murine Type   I      GnRH-R    was first published by
Tsutsumi et al., (Molecular Endocrinology, Vol 6, pages 1163-1169, 1992) together with the deduced amino acid sequence for murine Type I   GnRH-R.    



  Eleven different forms of GnRH in vertebrates have been identified to date (see King and Millar,"Coordinated evolution of GnRHs and their receptors", in GnRH Neurons: Gene to Behavior, Eds. I. S. Parhar and Y. Sakuma, Brain Shuppan, Tokyo, pages 51-77, 1997; see Sealfon et al., Endocr. Rev. 18: 180-205, 1997; Millar et   al.,"Plasticity    in the structural and functional evolution of GnRH : A peptide for all seasons", in Proceedings of the XIIIth
International Conference of Comparative
Endocrinology, Eds. S. Kawashima and S. Kikuyama,
Moduzzi Editore, Italy, pages 15-27,1997; and see
Sherwood et al., General and Comparative
Endocrinology, 112,1998). Many of these different
GnRH forms are in fact variants of GnRH Type I.



  However, distinct Type II and Type III GnRHs have been identified.



  Type II GnRH was originally isolated from chicken brain (see Millar and King, News Physiological
Science, 3: 49-53,1988) and was initially termed "chicken GnRH II"or"cGnRH II". Subsequent investigations have revealed that this isoform is present in most vertebrate species, and of all the
GnRH isoforms GnRH II is the most ubiquitous. The wide distribution of GnRH II suggests on important function and it is postulated to have a neuromodulatory, and possibly a neuroendocrine, role in the central and peripheral nervous systems (see Millar and King, 1988, supra). GnRH II has been shown to regulate M currents   (K+ channels)    in the sympathetic ganglion (Bosma et al., in G proteins and Signal Transduction, The RockeFeller
University Press, pages 43-59,1990) and stimulates reproductive behaviour (see King et al., in GnRH
Neurones : Gene to Behavior, eds.

   Parhar (Brain
Shuppan), Tokyo, pages 51-77,1997. It has also been postulated that GnRH II acts as a specific
FSH-releasing agent (Millar et al. Ref No. 33).



  Type II GnRH is highly expressed in kidney, bone marrow and prostate tissues as well as the extrahypothalamic brain (White et al. Ref No. 15).



  To date only partial sequence information has been available for a Type II   GnRH-R.    Specifically,
Millar et al. (in Journal of Endocrinology, 162: 117-126,1999) reported a continuous nucleotide sequence of 1642 nucleotides of the human gene, obtained by screening the human genome EST (expressed sequence tag) database. The EST sequences were confirmed in the cloned human gene and in PCR products of   cDNA    from several tissues.



  All the EST transcripts detected were in the antisense orientation with respect to the novel
GnRH receptor sequences herein described and were highly expressed in a wide range of human brain and peripheral tissues.



  PCR analysis of the cDNA partial sequence obtained by Millar et al., revealed that an intronic sequence equivalent to intron 2 of human Type I   GnRH-R    was retained. The intron itself was not spliced out in the transcript, but this was expected for anti-sense transcripts, as candidate donor and acceptor sites were only present in the gene when transcribed in the orientation encoding the GnRH receptor homolog. Despite extensive   5'   
RACE studies Millar et al. did not obtain any transcript   5'to    the sequence corresponding to intron 2 of human Type I   GnRH-R,    and the antisense transcripts terminated in poly A due to the presence of a polyadenylation signal sequence in the putative intron 2 when transcribed in the antisense orientation (see Fig. 1).



  None of the sequence revealed any contiguous openreading frame which would translate a functional protein. Millar et al. concluded that the putative receptor was probably a pseudogene representing a receptor which had become redundant and further investigations have revealed that the full-length antisense transcript encodes a novel ribonucleoprotein (RNP) which localised to chromosome 14 (Ref 26). Subsequently it was found that the gene was a pseudogene for both RNP and
Type II   GnRH-R.   



  The presence of the RNP explains the widespread tissue expression observed and it is significant that only the 3'untranslated sequences of the RNP   cDNA    overlap the putative GnRH Type II receptor sequences encoding the equivalent of exon 1 and exon 2.



  Despite the findings of Millar et al. which suggest that an operative version of   GnRH-R    Type II does not exist in mammals, we have now obtained the full nucleotide sequence encoding the Type II   GnRH-R    from marmoset and also the complete nucleotide sequence (including exon I) encoding the human Type
II   GnRH-R.    The human Type II   GnRH-R    herein reported has been localised to chromosome 1 (lql221).



  The present invention thus provides a polynucleotide encoding a functional Type II   gonadotropin-releasing    hormone receptor (Type II   GnRH-R)    peptide.



  The term"peptide"is used herein to refer to any peptidal compound without connotation of size, and includes therefore larger molecules which elsewhere may alternatively be termed"polypeptides"or   "proteins"also    fall within this definition.



  In one embodiment the peptide encoded comprises at least a portion of exon I. By"exon I"we refer to that portion of Type II   GnRH-R    which corresponds to and exhibits substantial homology with exon I of
Type I   GnRH-R.    In particular we refer to a peptide which includes over   90%    of the amino acid sequence 1 to 170 in the marmoset Type II   GnRH-R    sequence of 
SEQ ID No 2 or to a peptide which includes the equivalent amino acids of the human Type II   GnRH-R    sequence. Thus, for example, exon I refers to amino acid nos.   1    to 168 of splicing alternative 1 as set out in SEQ ID No 5 (see Fig. 3).

   The above terminology has been adopted for clarity; the short splice referred to below is herein designated intron   1'to    distinguish it from intron 1.



  Consequently the short exon (exon   1')    comprising amino acids nos. 1 to 9 of the human Type II   GnRH-R    peptide is incorporated into exon I as herein defined.



  Preferred embodiments of the present invention include polynucleotides having a nucleotide sequence as set out in SEQ ID No 1 (marmoset) or
SEQ ID No 3 (human) or polynucleotides which encode a polypeptide having an amino acid sequence as set out in SEQ ID No 2 (marmoset) or SEQ ID Nos 4,6,8 or 10 (human).



  As shown in Fig. 3 the marmoset amino acid sequence of Type II   GnRH-R    has over 90% homology with the corresponding human sequence. Accordingly, the present invention incorporates any polypeptide having at least   90%    homology with the amino acid sequence of SEQ ID Nos. 1 or 3.



  When the human nucleotide sequence is compared to that of the marmoset, there is an apparent singlebase deletion at position 30 of the coding sequence. The earlier EST sequence (Genbank
BG036291) matches the 5'end of the sequence, but the match ends at nucleotide 29 of the coding sequence and continues from nucleotide 290 of the coding sequence, indicating that this is a splice site. In the chicken receptor an intron was also located in a similar position. Excision of a very short intron (intron   l')    at this position would account for the frame shift ; very short introns have been noted in other genes, for example the mouse alpha-7 integrin gene has an intron of only 16 bases (Genbank L23422).

   There are three alternative splicing possibilities, involving 5-, 8-or 38-base deletions, each of which would restore the open reading frame of the human Type II   GnRH-R.   



  The start of the human Type II   GnRH-R    amino acid sequence following each of the three splicing alternatives is set out below:
Splicing alternative 1: (5 bases deleted from position 29 on)
Met Ser Ala Gly Asn Gly Thr Pro Trp 9 1 ATG TCT GCA GGC AAC GGC ACC CCT TGG
Ala Ala Gly Glu Glu Val Trp Ala 17 28 GCA GCG GGG GAG GAG GTC TGG GCT 
Splicing alternative 2: (8 bases deleted from position 29 on)
Met Ser Ala Gly Asn Gly Thr Pro Trp 9 1 ATG TCT GCA GGC AAC GGC ACC CCT TGG
Ala Gly Glu Glu Val Trp Ala Gly 17   28    GCG GGG GAG GAG GTC TGG GCT GGA
Splicing alternative 3:

   (38 bases deleted from position 29 on)
Met Ser Ala Gly Asn Gly Thr Pro Trp 9 1 ATG TCT GCA GGC AAC GGC ACC CCT TGG
Val Glu Val Glu Gly Ser Glu Leu 17 28 GTG GAG GTG GAG GGC TCA GAG CTG
The full sequences for human Type II   GnRH-R    according to the first splicing alternative are set out in SEQ ID Nos 5 and 6, according to the second splicing alternative in SEQ ID Nos 7 and 8, and according to the third splicing alternative in SEQ
ID Nos 9 and 10.



  As shown in SEQ ID No. 3, the human nucleotide sequence includes an apparent stop codon in the first part of exon 2. In the marmoset the equivalent codon (shown at nucleotides 449-452 of 
SEQ ID No 1) represents an arginine. A modified version of SEQ ID No 3 whereby the stop codon is engineered to represent an amino acid (for example arginine) is hereby incorporated. However, we believe that the codon TGA does not function as stop codon, but is instead translated as selenocysteine. In eukaryotes decoding of TGA as selenocysteine requires the selenocysteine insertion element (SECIS) in the 3'UTR of the   mRNA    (see Copeland et al., EMBO J, 19 (2): 306-14,2000; and Fagegaltier et   al.,    Nucleic Acids Research, 29 (14): 2679-80,1995).

   The putative UTR of the sequence (see SEQ ID No. 3) was found to contain the SECIS pattern   RTGAN {13, 15} AARN {23, 26} GA.    Thus, selenocysteine insertion at that position of the protein (amino acid no 177 in SEQ ID No 6; amino acid no 176 in
SEQ ID No 8; amino acid no 166 in SEQ ID No 10) is possible. In SEQ ID Nos. 3,5,7 and 9 the TGA in shown as Xaa (and defined as TGA in the preamble to the sequence) simply to maintain the coding sequence as a whole in the PATENTIN program.



  Desirably the polynucleotide according to the present invention encodes a peptide which is able to bind specifically to Type II GnRH and, preferably, is able to function as a receptor therefor.



  Those skilled in the art will appreciate that the nucleotide sequences of SEQ ID No 1 and Nos 3,5,7 and 9 correspond to one allele of the marmoset and human gene respectively, and that allelic variation is likely. Allelic variants can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures.



  Allelic variants of the DNA sequences shown in the sequence listing, including those containing silent mutations and those in which mutations result in amino acid sequence changes, are within the scope of the present invention, as are proteins which are allelic variants of SEQ ID No 2 and Nos 4,6,8 and 10.



  The present invention also comprises polynucleotides encoding homologous Type II GnRH-Rs from other species, preferably other mammalian species. Murine, porcine, ovine, bovine, canine, feline, equine and primate Type II GnRH-Rs are of particular interest. The sequence information provided in SEQ ID Nos 1,3,5,7 and 9 together with the techniques described herein and the standard conventional cloning techniques known in the art are sufficient to obtain such homologous polynucleotides. For example, there is a substantial body of knowledge concerning the techniques required for the art of genetic engineering and reference is made to Maniatis et al, Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory, Cold Spring Harbor, New
York 1982 and"Principles of Genetic Engineering",
Old and Primrose, fifth addition, 1994. 



  The present invention also includes modified sequences retaining Type   II      GnRH-R    function (i. e. the ability to bind GnRH Type II) and having at least 70% homology (preferably 80% homology, especially preferably 85-90% homology and most preferably over 90% homology) with the nucleotide sequence in question. Functional equivalents of such polynucleotides are also part of this invention. In particular, we include nucleotide substitutions which do not affect the amino acid expressed. The term"functional equivalent"used herein refers to any derivative in which nucleotide (s) and/or amino acid (s) have been added, deleted or replaced without a significantly adverse effect on expression of the gene product or on biological function thereof.

   Thus, for example, amino acid Glu may be encoded by the codon gag or by the codon gaa and each construct may be varied in this way without affecting the sequence of the expressed peptide. Additionally, most vertebrates have three types of GnRH and it is postulated that three cognate receptors exist. Together with collaborators (Troskie, Kwon and Wangli) we have identified Types I, II and III GnRH receptors in
Xenopus and bullfrog. The Type III   GnRH-R    is more similar to Type II   GnRH-R    than Type I. We therefore propose the existence of a Type III human   GnRH-R    with homology to Type II.

   Thus, the Type
III   GnRH-R    is expected to have substantial homology with the Type II   GnRH-R    described herein and hence will be covered by the modified versions of the sequences disclosed.



  The polynucleotides may be in any form (for example
DNA or RNA, double or single stranded) but generally double stranded DNA is the most convenient. Likewise the polynucleotides according to the present invention may be part of a recombinant genetic construct, which itself may include a vector (for example an expression vector) and eukaryotic vectors (as well as prokaryotic vectors) are of interest. Alternatively, the construct may be incorporated into the genome of a transgenic animal. Any vectors or transgenic animals comprising a polynucleotide as described above form a further aspect of the present invention.



  Viewed in a yet further aspect the present invention provides a recombinant expression system able to express the Type II   GnRH-R    described above.



  DNA constructs (i. e. a standard vector recombinantly combined with a polynucleotide sequence coding for the Type II   GnRH-R    of interest) and cells transformed with such constructs are also encompassed by the present invention.



  The term"expression system"is used herein to refer to a genetic sequence which includes a protein-encoding region and is operably linked to all of the genetic signals necessary to achieve expression of that region. Optionally, the expression system may also include a regulatory element, such as a promoter or enhancer, to increase transcription and/or translation of the protein encoding region or to provide a control over expression. The regulatory element may be located upstream or downstream of the protein encoding region or within the protein encoding region itself.



  In addition to the Type II   GnRH-R    construct described above, the present invention also provides host cells transformed with such constructs and which may express the biologically active modified gene product.



  In a further aspect, the present invention provides a stable cell-line capable of expressing Type Il   GnRH-R,    preferably human Type II   GnRH-R,    as described above. By"stable"we mean that the cell-line retains its ability to express useful quantities of Type II   GnRH-R    after several (e. g.



  10) generations, with any decrease in the level of
Type II   GnRH-R    expression being sufficiently low not to materially affect the utility of the cellline.



  Desirably the host cell transformed with the construct encoding the human Type II   GnRH-R    is of mammalian origin, but other cell types may also be useful. Examples include prokaryotic cells (such as E. coli), non-mammalian derived eukaryotic cells (such as insect, yeast or plant cells). Suitable host cells include, for example, COS-1 cells, COS-7 cells, COSM6 cells, CHO cells, BHK cells, GH3 cells, HEK293 cells and 293EBNA cells.



  The present invention also provides isolated peptides comprising a functional Type II gonadotropin-releasing hormone receptor (Type II   GnRH-R)    peptide. Preferably said peptide comprises at least a portion of exon I.



  Preferred embodiments of the peptides according to the present invention include peptides having an amino acid sequence corresponding to the sequence of amino acid nos 1 to 170 of SEQ ID No 2 (preferably comprising substantially the full sequence as set out in SEQ ID No 2) or corresponding to the sequence of amino acid nos 1 to 168 of SEQ ID No 6, amino acid nos 1 to 165 of
SEQ ID No 8 or amino acid nos 1 to 155 of SEQ ID No 10 (preferably also comprising substantially the full sequence of SEQ ID Nos 4,6,8 or 10).



  Desirably, the peptide is able to bind to Type II
GnRH and, preferably, is a functional receptor therefor.



  The present invention also provides antibodies specific to Type II   GnRH-R    peptides, preferably antibodies which are specific to the extracellular domains of Type II   GnRH-R,    for example EC3 in exon 3 thereof. The   term"antibodies"as    used herein includes not only monoclonal and polyclonal antibodies, but also antigen binding fragments thereof, trimeric or tetrameric constructs and recombinant or proteolytic antibody fragments.



  Antibodies directed to EC1, EC2 and EC3 (especially
EC2) are of particular interest and may be of therapeutic value for cancer treatment.



  The Type II   GnRH-R    can be expressed and used to screen agents of potential therapeutic interest.



  Thus, the present invention further provides a method of screening an agent for pharmacological activity (i. e. to ascertain its utility in binding to Type   II    GnRH-R), said method comprising: a) providing a Type II   GnRH-R    peptide as described above and exposing said Type II    GnRH-R    peptide to the agent to be tested; and b) ascertaining whether said agent interacts with  (for example binds specifically to) said Type
II   GnRH-R    peptide.



  Labelled (eg. radio-labelled or fluorescentlabelled) antibodies may be used to determine whether the agent and Type II   GnRH-R    interact together. Optionally a washing step may be included to remove labels not bound to the agent or   GnRH-R.    



  An expression system able to produce the Type II   GnRH-R    described above may be used in this method; preferably the expression system will be a transformed cell-line, the host cell usually being of mammalian origin. Alternatively the expression system may be a transgenic animal.



  Optionally, the receptor expressed may be mutated to produce constitutively active receptors which can be used to screen for antagonists and agonists.



  An expression system able to produce the Type II   GnRH-R    described above may be used to screen agents of potential therapeutic use (such as Type II GnRH agonists or antagonists). Desirably, therefore the expression system will imitate at least some aspects of Type II GnRH-induced signal transduction. Optionally, the expression system may be a stable cell line, the host cell usually being of mammalian origin. Alternatively the expression system may be a transgenic animal.



  In another embodiment of the invention, the Type II   GnRH-R    itself or extracellular domain thereof (e. g. the EC2 or EC3 loop) could be administered in vivo.



  The free   GnRH-R    or extracellular domains (which could be synthetic peptides) could competitively bind to GnRH and inhibit its reaction with the native receptor in vivo. 



  Alternatively, the Type   II      GnRH-R    or an extracellular domain thereof may be used as a means of contraception. For example, a patient may be immunised by injection with the Type II   GnRH-R.   



  This will induce antibody production to the Type II   GnRH-R    and the antibodies so produced will also interact with native Type II   GnRH-R    affecting reproductive ability. Alternatively, the exogenous
Type II GnRhH-R may bind competitively for endogenous GnRH.



  The present invention will now be further described with reference to the following, non-limiting, examples and Figures in which:
Fig.   1    is a schematic representation of the human gene structure of Type I   GnRH-R    and of Type II   GnRH-R.    The positions of the extracellular (EC) and intracellular   (IC)    loop domains, transmembrane (dark blocks) and carboxy terminal tail (C) are indicated. The approximate positions of the"short splice" (SS) for intron 1 and selenocysteine (SeCys) in the human receptor is shown.



  Fig.   2    shows the immunolocalisation of Type II GnRH receptor and Luteinizing Hormone (LH) to sheep pituitary: a) immunolocalisation of Type II   GnRH-R    using antibody against EC3; b) immunolocalisation of LH to pituitary gonadotropes; c) co-localisation using antibodies a) and b) and enzymatic detection   ;    d) co-localisation of Type II   GnRH-R    (black) and
LH (grey) by confocal microscopy   ;,    some cells contain LH only but most expressing Type II    GnRH-R    are LH positive.



  Fig. 3 is a comparison of the amino acid sequences of human Type II   GnRH-R    according to splicing alternative 1, and marmoset Type II   GnRH-R.   



  The numbering used is that of the human sequence.



  Asterisks (*) indicate identity, and vertical slashes   zu    conserved substitution. Regions predicted to be helical from homology modelling with the rhodopsin crystal structure are indicated.



  Exon boundaries, the position of the short splice (intron   1')    and the apparent stop codon in the human sequence are also shown.



  Fig. 4 shows the heterologous competitor binding of   t25I-   [His5, D-Tyr5] GnRH mediated by the Marmoset
Type II   GnRH-R    expressed in COS-7 cells in the presence of increasing doses of the peptides (IC50 values indicated in   nM)    : mGnRH (mammalian GnRH,   N,    51.7   1.      9nM    ; GnRH II (GnRH Type II,   A,    1.30.2nM); and sGnRH (salmon GnRH,, 9.81. 4nM). Error bars represent s. e. m. (n=2).



  Fig. 5 shows the total inositol phosphate production mediated by the Marmoset Type II   GnRH-R    expressed in COS-7 cells in response to concentration of various peptides   (EC50    values indicated in nM) mGnRH (mammalian GnRH,   ,    33.2 6.3nM); GnRH II (GnRH Type II,   A,    0.460.12nM); sGnRH (salmon   GnRH,,    8.70.5nM); [D-Arg6] GnRH II   ([D-Arg6]    GnRH Type II,   1. 10.    23nM); and Ant 13518 (Antagonist   135-18, , 223¯7nM).    Error bars represent s. e. m. (n=2).



  Fig. 6 shows receptor binding (a) and inositol phosphate production (b) of mammalian GnRH   I      (0)    and   GnRH II (-)    in COS-7 cells transfected with marmoset Type II receptor (left panel) and human
Type   I    receptor (right panel). Stimulation of inositol phosphate by Type I receptor Antagonist 135-18   (0)    at the Type II receptor is also shown.



  Error bars represent s. e. m. of 3-6 separate experiments.



  Fig. 7 shows the Luteinizing hormone (LH) and
Follicle Stimulating Hormone (FSH) response to GnRH
I and II in sheep.



  Fig. 8 shows activation of ERK2 and p38a MAP kinases by Type I (open bars) and Type II (closed bars) GnRH receptors in COS-7 cells. Stimulation of 
Type I (a) and Il (b) GnRH receptors with mammalian
GnRH I, GnRH II and Antagonist 135-18 of immunoprecipitated myc-ERK2. Inset panels depict anti-phospho-ERK2 immunoblotting of anti-myc COS-7 cell immunoprecipitates. c, Left panel, selective and time-dependent activation of   p38 (X    by GnRH   II    stimulation (100 nM) of Type II GnRH receptor.



  Stimulation of Type I GnRH receptor (100 nM) failed to activate   p38 (X    MAP kinase. The right panel demonstrates that both Type I and Type II GnRH receptor stimulation induces a time-dependent activation of ERK but that the GnRH II stimulation of the Type II receptor is more prolonged. Data represent mean       s. e. m., n   2    3.



  Fig. 9 shows expression of Type II GnRH receptor in marmoset and human tissues. (a) RT-PCR was carried out with specific primers on cDNA prepared from marmoset RNA isolated from various tissues. PCR products were fractionated by size on agarose gels.



  Type II GnRH receptor levels were normalised to actin RNA and represented as the log of the RNA expression relative to pituitary. Hatched bars indicate marmoset brain tissues, solid bars indicate marmoset reproductive tissues while open bars indicate other marmoset tissues. (b, c)
Expression of the Type II GnRH receptor in human tissues was examined in Northern blots of   mRNA    (Clontech) by hybridisation with 32P labelled human exon 1; (b)   mRNA    from human cerebellum (1), cerebral cortex (2), medulla (3), spinal cord (4), occipital pole (5), frontal lobe (6), temporal lobe (7) and putamen (8); (c) mRNA from heart (1), whole brain (2), placenta (3), lung (4), liver (5), skeletal muscle (6), kidney (7) and pancreas (8).



  Another blot showed moderate expression in the amygdala and low expression in caudate nucleus, corpus callosum, hippocampus, substantia nigra, subthalamic nucleus and thalamus (data not shown).



  Examples
Following numerous failed attempts to locate exon   I    from the sequence reported by Millar et al.



  (Journal of Endocrinology (1999), Vol 162, pages 117-126) subsequent work demonstrated that the antisense sequence of Millar et al. was the   3'    untranslated end of an RNP which localised to chromosome 14.



  It was recognised that as long as exon 2 or exon 3 sequence information was used in PCR we would always detect the 3'untranslated end of the RNP since this is highly expressed in all tissues. In addition, the putative intron 2 of Type II receptor would always be retained. Since this transcript ends with a polyadenylation in the region of the equivalent of intron 1 of the putative Type II receptor (read in the opposite direction to RNP), we would never obtain information on exon 1 of the
Type II receptor. 



  We concluded that three new elements were necessary to find the putative Type II GnRH receptor. a) Search the data bases for a nucleotide sequence encoding part of exon 1.   b)    Generate an antibody against a highly specific domain which is responsible for ligand selectivity (see Sealfon et al., Endocr.



   Review 18 : 180-205 and Troskie et al., General and Comparative Endocrinology 112 : 296-302  (1998)) in extracellular loop 3 of the human
Type II   vis-a-vis    Type I receptor to determine in which tissue this rare receptor is expressed. c) Undertake chromosomal localisation to determine if the coding sequence exists in a pseudogene locale (with RNP) and in another    "real"gene    location elsewhere.



  Materials and Methods
Cloning of the marmoset Type II GnRH receptor. RNA was isolated from marmoset pituitary and brain stem using RNAsol B (Biogenesis). 2 Rg of RNA was incubated with 1 mM dNTPs, 2   WM    random hexapolynucleotides (Promega), gene specific primers or anchored oligo-dT primers at   80 C    for 10 min. lx
RT buffer (Sigma),   1      U/Rl    RNAsin (Promega) and 0.5   U/gl    AMV reverse transcriptase (Sigma) were added in a total volume of 20   Rl    and incubated at   55 C    for 2 h, then   65 C    for 10 min. Primers designed to the Type II marmoset GnRH receptor exon sequences.



  Primers were chosen to span putative introns, to enable detection of processed RNA in the presence of possible genomic DNA contamination and the RNP antisense transcript. 50 ng of purified (Qiagen) cDNA produced with random hexa-polynucleotides were subjected to PCR using human sequences previously described (17) and human genomic sequence encoding exon 1 (Zymogenetics AL 160282, BG 636291, AA 954764). Round 1 PCR: 5 cycles at   65 C,    23 cycles at   63 C    using primers S1 and Al (S1,
GATGCCACCTGGAATATCACTG (SEQ ID No 17); Al,
AGGCAGCAGAAGG (SEQ ID No 18). Round 2 PCR: 5 cycles at   63 C,    25 cycles at   61 C    using   1    Rl of products from Round 1 as template and primers S2 and A2 (S2, CAGCCTGGGGACTTAGTTTCCTG (SEQ ID No 19);
A2, GGTTATAGGTGGTCTCTTGC (SEQ ID No 20).

   Products were size-purified (Qiagen), cloned into   pGEM-T    (Promega) and sequenced. Sense and antisense oligonucleotides were designed from the novel marmoset sequences and used in   3'and    5'RACE. For the remaining PCRs a three-step protocol was used where the annealing temperature of the first 5 cycles was   2 C    higher than the lower Tm of the two primers. In the second step the annealing temperature of 5 cycles was the same as the lower
Tm of the two primers. The third step was 20 cycles with annealing temperatures   2 C    below the lower Tm of the two primers. For the 5'RACE a poly-A sequence was added to 50 ng marmoset pituitary cDNA produced with gene specific primers.



  Products were purified (Qiagen) and subjected to
PCR. 2   Rl    of products of a first round PCR, using primers S3 and A3, were used in a second round of
PCR using primers S4 and A4 (S3,
GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV (SEQ ID No 21) (anchored RACE primer from Boehringer
Mannheim); A3, GAAGGGACTGGACCAGCTCG (SEQ ID No 22);
S4, GACCACGCGTATCGATGTCGAC (SEQ ID No 23); A4,   CAAGGCAAGCAGGAAACTAAG    (SEQ ID No 24)). For the   3'   
RACE 50 ng marmoset pituitary cDNA was produced with anchored oligo-dT primers was subjected to PCR using primers S5 and S3 (S5, ACCTCTTCACCTTCTGCTGCCT (SEQ ID No 25)). 2 pl of products from this PCR and primers S6 and S4 were used in a secondary PCR (S6, CCTCCTCAATGCTCCTTTGGATC (SEQ ID No 26).



  Products were size purified (Qiagen), cloned into pGEM-T (Promega) and   sequenced. Full    length marmoset Type   II    GnRH receptor was produced by PCR using oligos of the 5'UTR (S7,   GAATTCGCTTCATACTCACACTTCATC (SEQ    ID No 27);   S8,      CGGAATTCTCACACTTCATCCTCCTATCTC (SEQ    ID No 28)) and the 3'sequence including the stop codon (A5, GCTCTAGAGATCAGATTGATGTTATAGGAATG (SEQ ID No 29)). 50 ng of marmoset brain stem cDNA produced with random hexa-polynucleotides was subjected to
PCR using primers S7 and A5.2   gl    of products and primers S8 and A5 were used in a secondary round of
PCR. Products of this PCR were purified (Qiagen), cloned into pcDNA3.1+ (Invitrogen) and sequenced. 



  The resultant plasmid was used in expression studies.



     Immunocytochemistry.    Tissues from human, mouse, sheep, rhesus and cynomologus monkeys were obtained. An antiserum to the human Type II GnRH receptor was produced by immunisation of rabbits with a synthetic peptide corresponding to EC3 (YSPTMLTEVPPC (SEQ ID No 30)) conjugated to keyhole limpet haemocyanin via the Cys residue. This peptide, a synthetic peptide to EC3 of the human
Type I receptor (DPEMLNRLSDPC (SEQ ID No 31)) and haemocyanin were used for immunoneutralisation specificity studies. For detection of mammalian
GnRH I specific antiserum GF6 was used (18).



  Tissue sections (15   pm)    were subjected to the peroxidase/diaminobenzidine visualisation technique as previously described (18,19). Fluorescent labelling was accomplished using the same procedure up to the step prior to ABC reaction, when the fluorescein label (Rhodamine 600, avidin D or FITC) was applied to the slides and incubated at room temperature in the dark for 2-4 hours. For double labelling, slides were incubated sequentially with avidin D and biotin blocking solutions for 15 min each, then re-incubated with the next primary antibody, followed by the other fluorescent labelling (Rhodamine or FITC). Controls, including omission of primary antibodies and order of exposure, were consistently negative. 



  Immunofluorescence was viewed at two wave lengths by confocal microscopy.



  Cell culture and   transfection.    COS-7 cells were cultured as previously described (20,21).



  Transient transfections of COS-7 cells with human
Type I GnRH receptor or marmoset Type II GnRH receptor, along with myc-tagged ERK2, JNK and   p38a    constructs were performed using Superfect (Qiagen) according to the manufacturer's protocol. All assays described were performed 48 h post transfection.



  Receptor binding and inositol phosphate production.



  Receptor binding utilising   125, ¯ [Hi S5-D-Tyr6] GNRH    I and inositol phosphate production by GnRH ligands were studied as previously described (20-22).



  Phospho-MAP kinase assay. Serum starved (12-16 h)
COS-7 cells, transfected with human Type I or marmoset Type II GnRH receptors were treated with either mammalian GnRH I, GnRH II or antagonist 13518 for the time and dose specified for Fig. 9 at   37 C.    After ligand stimulation, COS-7 cells were prepared for immunoprecipitation (23). Cotransfected myc-tagged MAP kinase constructs were immunoprecipitated from cell lysates by overnight incubation with myc-agarose slurry (Santa Cruz), washed, an equal volume of 2x Laemmli sample buffer added, resolved by SDS-PAGE and electrotransferred to PVDF membrane (NEN Life Sciences).

   Activated MAP kinase was detected using anti-phospho  ERK/JNK/p38a-kinase    specific antisera (New England
Biolabs), visualised by enzyme-linked chemifluorescence (Amersham-Pharmacia) and quantified using a phosphorimager. The degree of phosphorylated MAP kinase was normalised to the amount of unphosphorylated MAP kinase detected with specific antisera.



  Expression of Type II receptor   mRNA    in marmoset and human tissues. Total RNA was extracted from various marmoset tissues using TRI reagent (Sigma), and cDNA was produced using oligo dT primers (Ambion). PCR was performed on the cDNA using marmoset Type II GnRH receptor   cDNA    specific primers spanning exons 1-3 (sense:   CTTCGGCTGGAGGGAACCTG,    antisense:
GGTGCCCTCTTCGGCAGC), and actin specific primers.



  PCR products were run on an agarose gel and blotted onto   HybondNs nylon    membrane (Amersham). The
Southern blot was probed with random primed marmoset Type   II    GnRH receptor cDNA or actin   cDNA.   



  Southern blots were quantified using a phosphorimager and marmoset Type II GnRH receptor expression was normalised to the expression of actin.



  Expression in human tissues was examined by
Northern blots of   mRNA    with random primed 32P labelled human Type II GnRH receptor exon 1. The human Type II GnRH receptor genomic   sequence (P1    clone) was obtained by Genome Systems (St Louis,
MD) using PCR screen of   P1    clones with oligonucleotides to human sequences   (17).   



  Oligonucleotides (antisense: CTGTCCTGCCCGGTCCTGAG; sense: TGCCCACCTTCTCGGCAGCA) to this sequence were used with the P1 clone to produce a 460 bp amplicon. Labelling was done with   32P dCTP    (6000   Ci/mMole)    using supplier's specified conditions (Stratagene). Hybridisation was performed using 2   x      107 cpm    at   652C    in 5 x SSC/0.005% SDS/5x   Denhardt's/2    mg/ml salmon sperm DNA, washing with 0.1 x SSC/0.5% SDS at   55 C    and the blots exposed to
X-ray film for 6 days.



  Stimulation of LH and FSH in sheep. The relative potency of mammalian GnRH I and GnRH II at inducing
FSH and LH secretion in vivo was tested using our
Soay ram sheep model (24). This was repeated during both the sexually active (short days, SD) and inactive phases (long days, LD) of the photoperiod-induced reproductive cycle (24). The same animals (n = 8) were used on the two occasions. The GnRHs were administered at doses of 250 ng/ram and 10 Rg/ram in a cross-over design with a week between treatments to permit full recovery. The peptides were dissolved in 1 ml of 0.9% saline and given as an intravenous bolus.



  Blood samples were collected every 10 min, from 20 min before, until 2 h after the treatments and assayed by specific radioimmunoassays (24). The
FSH and LH responses to the GnRH agonists were calculated as delta responses (2 h mean hormone concentration post treatment minus 20 min mean pretreatment hormone concentration). These values were used to calculate the FSH : LH response ratio for GnRH II and GnRH I, and thus the overall ratio for the GnRH II stimulation compared with the mammalian GnRH I stimulation. This was assessed for each animal and then for the group (mean       SEM, n = 8), under both LD and SD.



  Results and Discussion
Cloning and primary structure of the Marmoset Type   II    GnRH receptor.



  Amplification of EC3 from genomic DNA from a range of vertebrate species revealed two distinct sequences of receptors representing the known Type   I    receptors and novel Type II receptors in an amphibian and reptile (25). Searches of human EST databases revealed homologous sequences to the reptile EC3 (17). From EST contigs we constructed a partial receptor sequence encoding the putative exons 2 and 3 corresponding to these exons of the
Type I receptor (17). All ESTs were in the antisense orientation and it transpired that these were in the 3'untranslated region (UTR) of a novel human ribonucleoprotein (RBM8) which was highly expressed in all tissues examined (26). The equivalent of exon 1 was absent from the RMB8 3'
UTR.

   It was therefore evident that the identification of sequences homologous to exon 1 was essential to discover the Type   II    receptors.



  Searches of human databases, using as a query exon 1 of the human Type I receptor, revealed several
ESTs and genomic sequences BG 036291, AA 954764; AL   160282.   



  Since the receptor was likely to be a rare transcript expressed in discrete tissues, we generated antisera to the EC3 domain of the human
Type II receptor and found by immunocytochemistry strong reactivity in pituitary and brain of the human, rhesus monkey, sheep and mouse (Fig. 2). We then used oligonucleotides to the human exon 1 and
RBM8   3'UTR    sequences to amplify cDNA from marmoset pituitary and brain by PCR and 5'RACE procedures.



  The full length   cDNA    encodes a 380 amino acid protein with characteristic   G    protein-coupled receptor (GPCR) structure SEQ   ID No.    1. Although it is more homologous with GnRH receptors than other   GPCRs,    it has only 41% sequence identity with the human Type I receptor suggesting an early evolutionary gene duplication. It also possesses a carboxy terminal tail which is important for rapid desensitization and is uniquely absent from mammalian Type I receptors (27-30). The receptor also does not have the unusual Asn/Asp microdomain of transmembrane helices 2 and 7 of the mammalian
Type I receptors which plays a role in receptor activation (21). Instead it has the Asp/Asp motif as in non-mammalian Type I GnRH receptors recently cloned (7,9).

   The   Drosophila GnRH    receptor homologue has the usual Asp/Asn motif characteristic of most GPCRs (31) indicating that there was an initial mutation to Asp/Asp in the ancient vertebrate GnRH receptor followed by mutation to Asn/Asp in the mammalian Type I receptors. The activation role of this microdomain (21) may therefore be further elucidated by experimentation with the Type II receptor. The
LSD/EP sequence of EC3 which is important for ligand selectivity of mammalian Type I receptors (9,20) is replaced by VPPS which is also present in reptile (VPPS) and amphibian (VPPV) Type II GnRH receptors (25). This difference in sequence is likely, therefore, to be a determinant of Type II receptor selectivity for GnRH II as all other binding sites (9) are conserved.



  Pharmacological characterization of the marmoset
Type II GnRH receptor.



  Fig. 4 shows the heterologous competition binding of   l25I-[His5, D-Tyr6] GnRH    mediated by the Marmoset
Type II GnRH receptor expressed in the transfected
COS-7 cells and shows that the Type II GnRH receptor demonstrates high selectivity for GnRH
Type II.



  The affinity and specificity of the Type II GnRH receptor for the natural GnRHs and two GnRH analogues is shown in Fig. 5. Further characterisation of GnRH agonists and antagonists can be determined with the routine binding assays.



  The identification of the signalling pathway of the receptor was examined by testing the ability of the ligand-induced receptor to activate second messenger generating systems.



  Using the above described expression system, we have determined that the Type II   GnRH-R    activates the production of Inositol phosphate (see Fig. 5) but does not stimulate cyclic AMP production.



  Thus, expression of the Type II receptor in COS-7 cells revealed that it is highly selective for GnRH   II    in receptor binding assays (Fig. 4) and in the stimulation of inositol phosphate intracellular messenger production (40-fold and 90-fold greater activity relative to mammalian GnRH I) (Fig. 5) (Table   1).    This contrasts with the Type I receptor in which GnRH II has only 10% and 9% activities of mammalian GnRH I in these assays (Fig. 6). Overall
GnRH II has an affinity 24-fold greater for the
Type II receptor than for the Type I receptor. The
Type II receptor was also more selective for salmon
GnRH and   [D-Arg6] GnRH    II (Table 1). 



  Table   1 :    Comparative ligand binding and inositol phosphate production properties of marmoset type II  &  human Type 1 GnRH receptors.



  Peptides Ligand binding InsP production    (ICso)    (ECso)
Marmoset Human Marmoset Human
Type II Type I Type II Type   I   
GnRH II 1.070.04 26.14 0.450.05 7.411.55
GnRH I 42.   63.    19 2.810.17 40.54.43 0.630.08 sGnRH 9.482.17   24423.    6 5.990.91 9.623.5   [D-Arg6]    3.340.06 11.90.35 2.390.64 3.80.71
GnRH II
Antagonist   1650478    10.61.4   27645.    5 Full 135-18 antagonist
Data are expressed in nanomolar and represent the s.   e.    m. (n=3-6).

   Mammalian GnRH I   (GnRH I)    salmon GnRH (sGnRH:   [Trp7, Leu8] GnRH    I), GnRH   II ( [Hiss, Trp', Tyr8] GnRH   
I)
1 Moreover, a Type I receptor GnRH antagonist behaved
2 as an agonist at the Type II receptor (Fig. 5). It
3 has recently been demonstrated that control of
4 gonadotropin biosynthesis and regulation of
5 gonadotrope function regulated by GnRH can be
6 mediated by the activation of mitogen-activated protein kinases (MAP kinases). Therefore we assessed the capacity of both the Type I human GnRH receptor and the marmoset Type II GnRH receptor to activate the three major MAP kinase prototypes,
ERK, JNK (a particular type of MAP kinases available through Eisuke Nishida, Kyoto University) and   p38a    in COS-7 cells.

   At the Type I receptor, mammalian GnRH I was considerably more potent than
GnRH II in activating ERK2 (Fig. 8a). In contrast, at the Type II receptor the ligand specificity was the inverse and antagonist 135-18 had significant agonist activity compared with low activity at the
Type I receptor (Fig. 8 panels a and b). Agonistinduced activation of JNK was not detected with stimulation of either the Type I or Type II receptor (data not shown). However, activation of   p38a    was detected upon stimulation of the Type II receptor but not with stimulation of the Type   I    receptor (Fig. 8c). The time course of   p38a    activation was also considerably more protracted than that for Type   I/II    receptor activation of
ERK2.

   In addition we noted that ERK2 stimulation via the Type I GnRH receptor is more transient than that mediated by Type II GnRH receptor stimulation (Fig. 8c). There are therefore distinct differences in signalling by the two receptors.



  Tissue distribution and expression of the marmoset
Type II GnRH receptor. To gain insight into the potential functions of the Type II receptor, its expression in human and marmoset tissues was examined. PCR amplification of cDNA from marmoset brain tissues revealed that it is expressed in the pituitary, spinal cord, pons, cerebellum, putamen, medulla, hypothalamus, preoptic area, midbrain, occipital pole, frontal lobe and corpus callosum (Fig. 9a). Expression was high in reproductive tissues such as testis, prostate, mammary glands, seminal vesicles and epididymis. Substantial expression was detected in adrenal, thyroid, heart and skeletal muscle but little or no expression was found in other tissues such as liver, ovary and bladder (Fig. 9a). Northern blots yielded a similar expression pattern (data not shown).



  Northern blots on human tissues probed with exon   1    showed highest expression in the cerebral cortex and occipital pole, moderate expression in the frontal lobe, temporal lobe and putamen, and low expression in the cerebellum, medulla and spinal cord (Fig. 9b). There was substantial expression in the amygdala and low expression in the caudate nucleus, corpus callosum, hippocampus, substantia nigra, subthalamic nucleus and thalamus (data not shown). There was also significant expression in the heart and pancreas but little or no expression in placenta, lung, liver, skeletal muscle and kidney (Fig. 9c).



  Type II GnRH receptor function in the pituitary.



  A specific antiserum to EC3 of the human Type II receptor was used to conduct immunocytochemistry and demonstrated specific expression of the receptor in human anterior pituitary (Fig. 2). In view of the possibility that the novel Type II receptor may regulate pituitary function, we determined if it was expressed in the pituitary of other mammals. Staining was also found in about 10% of cells, (the relative occurrence of gonadotropes), in the anterior pituitary of the mouse and sheep (Fig. 2). In the sheep anterior pituitary double staining with Type II receptor and
LH antisera revealed that the Type II receptor immunoreactivity is co-localised in 69% of LH positive cells (Fig. 2). Only   12%    of Type   II    receptor positive cells were negative for LH.



  Since mammalian GnRH I binding sites also colocalise with LH in up to 90% of gonadotropes in the rat pituitary at proestrus (32), it is likely that the majority of gonadotropes express both Type
II and Type I receptors and suggests that these receptors may co-ordinately regulate LH and FSH biosynthesis and secretion. The presence of Type
II receptors in the majority of gonadotropes is, at first consideration, unexpected as there is a substantial literature suggesting that a single
GnRH (mammalian GnRH   I)    is sufficient to regulate the secretion of gonadotropins, and that the differential secretion of LH and FSH during the mammalian ovarian cycle may be adequately accounted for by modulatory effects of gonadal steroids (androgen, estrogen and progesterone) and peptides (activin, inhibin and follistatin) (14).

   However, a substantial number of physiological studies invoke the existence of an FSH-releasing peptide to account for the differential secretion of gonadotropins (13-16).



  In the early studies on the GnRH II (previously called chicken GnRH II), it was found to have preferential FSH-releasing activity when compared with chicken GnRH I (chicken Type I GnRH) (33).



  Moreover, GnRH II has been localised to the hypothalamic area in species of non-mammalian vertebrates (see Refs. (7,8) for review) and the supraoptic, paraventricular, arcuate and pituitary stalk regions of monkeys where it is thought to play a role in gonadotropin secretion (19,34), . We therefore conducted studies using a wellestablished sheep model to determine the relative effects of mammalian GnRH I and GnRH II on LH and
FSH secretion. The responses to a 250 ng bolus of
GnRHs was too low for comparison of relative LH and
FSH secretion. At the 10   pg    dose all the rams showed a robust response and every individual exhibited a higher ratio of FSH to LH secretion when treated with GnRH II compared with mammalian
GnRH I (Fig. 7).

   The mean ratio of FSH to LH induced by GnRH II was 2.140.29 and 2.020.34 (mean       SD) times higher than that induced by mammalian GnRH I for sexually active and sexually quiescent rams respectively. The FSH/LH ratios generated in both sexually active and quiescent rams upon GnRH II treatment were both significantly greater (p=0.03, p=0.002 respectively, paired two tailed t-test) than with mammalian GnRH I treatment.



  When it is considered that GnRH II has an affinity and potency of  <  20% of mammalian GnRH I at the
Type I receptor (7,9,20), and the in vivo secretion of the two peptides is likely to be finely tuned in both concentration and phasing of pulsatile release, our exogenous bolus administration of the peptides is a relatively crude approach. Thus, the relative differential stimulation of FSH by endogenously secreted GnRH II may be much greater in vivo.



  The findings of GnRH II in the hypothalamus, the presence of the Type II receptor immunoreactivity in gonadotropes and differential release of gonadotropins suggest that, contrary to existing dogma, gonadotropins are regulated by two different forms of GnRH acting through two separate cognate gonadotrope receptors. In order to elicit differences in relative LH and FSH secretion mammalian GnRH I and GnRH II would have to have different patterns of duration of release, concentration and pulse frequency of secretion and/or differential intracellular signalling pathways. The differential, temporal or qualitative, downstream signalling between the Type
II and Type I receptors shown here may provide the means for preferential FSH secretion. 



  GnRH II activation of the Type II receptor in bullfrog sympathetic ganglia potently inhibits Mtype K+ channels (11). A similar action in gonadotropes would partially depolarise them thus facilitating external excitatory inputs to the cell or entry of extracellular   Ca2+    through L type channels, which occurs on stimulation of Type I receptors by mammalian GnRH   I    (1-3). These two
GnRHs and GnRH receptor systems, along with differences in signalling pathways, provide the means for differential FSH and LH secretion and open the possibility of developing new GnRH II analogues for the treatment of diseases of the reproductive system as well as contraceptives which selectively inhibit FSH and gametogenesis without affecting sex steroid hormone production.



  Type II GnRH receptor may have roles in neural development and sexual arousal. In view of its wide distribution in the central and peripheral nervous systems, GnRH II has been proposed to have a neuromodulatory role (7,8) as evidenced by   K+    channel inhibition in bullfrog sympathetic ganglia (11). Our demonstration of a GnRH II-selective receptor expression in many brain regions (Figs. 2, 9) supports this.

   Type II GnRH receptor antisera immunoreactive cells'were widely seen in the extrahypothalamic regions, such as medial septum, bed nucleus of the stria terminalis, medial preoptic area, substantia innominata, basal nuclues of Meynert, claustrum, amygdala and putamen, and in the hypothalamic regions, such as supraoptic nucleus, periventricular area, ventromedial nucleus and dorsomedial nucleus in rhesus monkeys at embryonic days E58, E70 and E78 as well as in the adult cynomologus monkey. In some of these areas (e. g. midbrain and supraoptic nucleus) the GnRH II ligand is also expressed (19,34). The distribution pattern of Type II GnRH receptor positive cells in extrahypothalamic regions overlapped with that of the early developing mammalian GnRH I cells we have described   (18).   



  Later in embryonic development the GnRH I cells were not consistently immunopositive with Type II
GnRH receptor antiserum. This suggests a potential role for the receptor in the development of mammalian GnRH I neurones. An intriguing observation was that neurones which express the mammalian GnRH I gene in the preoptic area and periventricular region of the hypothalamus (Ref.



  34) were stained with the Type II GnRH receptor antiserum in the rhesus monkey, suggesting that
GnRH II may regulate mammalian GnRH I neurones.



  Mammalian GnRH I is known to have ultrashort feedback on its own secretion (8,35) but the colocalisation of Type II receptor on mammalian GnRH
I neurones in the hypothalamic regions suggests that some effects on mammalian GnRH I secretion may be mediated via GnRH II.



  GnRH has been shown to have direct effects on reproductive behaviour and sexual arousal in rodents independent of its stimulation of sex hormone production (8,36). Rapid changes in GnRH content of brain areas, cell number and cell size in response to visual, olfactory and other stimulants of sexual behaviour have been observed in species of fish, amphibians, reptiles and mammals (see Refs. (7,8,10,36,37) for review).



  Moreover, GnRH II is much more effective than mammalian GnRH I in stimulating courtship and song in ring doves (7) and song sparrows (12), and GnRH   II    distribution shifts from midbrain cell bodies to terminal regions following the initiation of courtship in newts (37). There is remarkable concurrence of the distribution of the Type II GnRH receptor in the temporal lobe, putamen, amygdala, medial preoptic area, ventromedial nucleus, dorsomedial nucleus and periventricular nucleus of the human or monkey brain with effects of lesions and/or electrical stimulation of these areas on reproductive behaviours such as sexual interest, erection, intromission, thrusting and ejaculation in rats, dogs,   cats ;    monkeys and humans (36-38).



  GnRH II has also been localised to these regions in the rhesus monkey (19,34).



  The mechanism of action of GnRH II in the nervous system of mammals is unknown but the peptide has been identified in sympathetic ganglia of amphibians where it binds to selective high affinity receptors (22) and potently inhibits Mtype   K+    channels (11). Inhibition of these   K+    channels by GnRH II facilitates fast excitatory transmission by conventional neurotransmitters, by increasing input resistance of postsynaptic neurones and by partial depolarization (11). This may, therefore, provide a general neuromodulatory mechanism for GnRH II effects in the nervous system, and specifically in reproductive behaviour, by facilitating signalling by neurotransmitters.



  Type II GnRH receptor in reproductive tissues. The marmoset Type II GnRH receptor expression and GnRH
II ligand expression (7,8,11) in non-neural reproduction-related tissues such as the mammary gland, prostate, gonads and adrenal cells may resolve the long-standing enigma of the nonconcurrence of the binding pharmacology of receptors in these tissues and in various tumours (e. g. prostate, ovarian and mammary gland (1-3)) with that of the known pituitary Type I receptor which is believed to be the receptor in these tissues. For example, the paradox of similar effects of both GnRH agonists and antagonists (1, 2) on proliferation of these tumour cell lines can be rationalised if the Type II receptor is mediating these effects, as we have shown that certain mammalian GnRH I antagonists (e. g. 135-18) behave as agonists with the Type II receptor (Fig.



  8b). Moreover, the antiproliferative effects of
GnRH analogues on cell lines of these tumours is consistent with the activation of p38a by the Type   II    receptor since this MAP kinase is known to be antiproliferative (39). 



   References   1.    Millar, R. P., King, J. A., Davidson, J. S.



   Milton, R. C. (1987) S Afr Med J 72, 748-55.



  2. Conn, P. M.  &  Crowley, W. F., Jr. (1991) N    Engl J Med    324,93-103.



  3. Conn, P. M.  &  Crowley, W. F., Jr. (1994) Annu
Rev Med 45,391-405.



  4. Nieschlag,   E.,    Behre, H. M.  &  Weinbauer, G. F.



   (1992) in   Spermatogenesis-Fertilization-   
Contraception. Molecular, cellular and endocrine events in male reproduction, eds.



   Nieschlag, E.  &  Habenicht, U.-F. (Springer
Verlag, Berlin), pp. 447-501.



  5. Fraser, H. M. (1993) Br Med Bull 49,62-72.



  6. King, J. A.  &  Millar, R. P. (1979) Science
206, 67-9.



  7. King, J. A.  &  Millar, R. P. (1997) in GnRH
Neurones: Gene to Behavior, eds. Parhar, I.  & 
Y., S. (Brain Shuppan), Tokyo, pp. 51-77.



  8. Sherwood, N. M., Lovejoy, D. A.  &  Coe, I. R.



   (1993) Endocr Rev 14,241-54. 



  9. Sealfon, S. C., Weinstein, H.  &  Millar, R. P.



   (1997) Endocr Rev 18,180-205.



  10. White, R. B., Eisen, J. A., Kasten, T.   L.  &    
Fernald, R. D. (1998) Proc   Natl    Acad Sci U S A
95,305-9.



  11. Bosma, M. M., Bernheim, L., Leibowitz, M. D.,
Pfaffinger, P. J.  &  Hille, B. (1990) in G
Proteins and Signal Transduction (The
Rockefeller University Press), pp. 43-59.



  12. Maney, D. L., Richardson, R. D.  &  Wingfield,
J. C. (1997) Horm Behav 32,11-8.



  13. Lumpkin, M. D., Moltz, J. H., Yu, W. H.,
Samson, W. K.  &  McCann, S. M. (1987) Brain Res
Bull 18,175-8.



  14. Padmanabhan,   V.     &  McNeilly, A. S. (2001)
Reproduction 121,21-30.



  15. Yu, W. H., Karanth, S., Walczewska, A., Sower,
S. A.  &  McCann, S. M. (1997) Proc Natl Acad
Sci   U S    A 94,9499-503.



  16. Yu, W. H., Karanth, S., Sower, S. A., Parlow,
A. F.  &  McCann, S. M. (2000) Proc Soc Exp Biol
Med 224,87-92. 



  17. Millar, R., Conklin, D., Lofton-Day, C.,
Hutchinson, E., Troskie, B., Illing, N.,
Sealfon, S. C.  &  Hapgood, J. (1999) J
Endocrinol 162,117-26.



  18.   Quanbeck,    C., Sherwood, N. M., Millar, R. P.  & 
Terasawa, E. (1997) J Comp Neurol 380,293
309.



  19. Lescheid, D. W., Terasawa, E., Abler, L. A.,
Urbanski, H. F., Warby, C. M., Millar, R. P.  & 
Sherwood, N. M. (1997) Endocrinology 138,
5618-29.



  20. Flanagan, C. A., Becker, II, Davidson, J. S.,
Wakefield, I. K., Zhou, W., Sealfon, S. C.  & 
Millar, R. P. (1994) J Biol Chem 269,22636
41.



  21. Flanagan, C. A., Zhou, W., Chi, L., Yuen, T.,
Rodic, V., Robertson,   D.,    Johnson, M.,
Holland, P., Millar, R. P., Weinstein, H.,
Mitchell, R.  &  Sealfon, S. C. (1999)   J Biol       Chem    274,28880-6.



  22. Troskie, B., King, J. A., Millar, R. P., Peng,
Y. Y., Kim, J., Figueras, H.  &  Illing, N.



   (1997) Neuroendocrinology 65,396-402.



  23. Maudsley, S., Pierce, K. L., Zamah, A. M.,
Miller, W. E., Ahn, S., Daaka, Y., Lefkowitz, 
R. J.  &  Luttrell, L. M. (2000) J Biol Chem
275,9572-80.



  24. Lincoln, G. A.  &  Clarke, I. J. (1998) J    Neuroendocrinol    10,461-71.



  25. Troskie, B., Illing, N., Rumbak, E., Sun, Y.



   M., Hapgood, J., Sealfon, S., Conklin, D.  & 
Millar, R. (1998) Gen Comp   Endocrinol    112,
296-302.



  26. Conklin, D. C., Rixon, M. W., Kuestner, R. E.,
Maurer, M. F.,   Whitmore,    T. E.  &  Millar, R. P.



   (2000) Biochim Biophys Acta 1492,465-9.



  27. Tensen, C., Okuzawa, K., Blomenrohr, M.,
Rebers, F., Leurs, R.,   Bogerd,    J.,   Schulz,    R.



    &  Goos, H. (1997) Eur J Biochem 243,134-40.



  28. Illing, N., Troskie, B. E., Nahorniak, C. S.,
Hapgood, J. P., Peter, R. E.  &  Millar, R. P.



   (1999) Proc Natl Acad Sci   U S A    96,2526-31.



  29. Troskie, B. E., Hapgood, J. P., Millar, R. P.



    &  Illing, N. (2000) Endocrinology 141,1764
71.



  30. Sun, Y. M., Flanagan, C. A., Illing, N., Ott,
T. R., Sellar, R., Fromme, B. J., Hapgood, J.,
Sharp, P., Sealfon, S. C.  &  Millar, R. P.



   (2000) J Bid   Chem.    



  31. Hauser, F., Sondergaard, L.  & 
Grimmelikhuijzen, C. J. (1998)   Biochem    Biophys
Res Commun 249,822-8.



  32. Childs, G. V., Unabia, G.  &  Miller, B. T.



   (1994) Endocrinology 134,1943-51.



  33. Millar, R. P., Milton, R. C., Follett, B. K.  & 
King, J. A. (1986) Endocrinology 119,224-31.



  34. Urbanski, H. F., White, R. B., Fernald, R. D.,
Kohama, S. G., Garyfallou, V. T.  &  Densmore,
V. S. (1999) Endocrinology 140,1945-8.



  35. Leranth, C., Segura, L. M., Palkovits, M.,
MacLusky, N. J., Shanabrough, M.  &  Naftolin,
F. (1985) Brain Res 345,332-6.



  36. Moss, R. L. (1979) Annu Rev Physiol 41,617
31.



  37. Muske, L. E., King, J. A., O'Connell, B. G.,
Moore, F. L.  &  Millar, R. P. (1995) Soc.



   Neurosci. Abstr. 21,100.



  38. Slimp, J. C., Hart, B. L.  &  Goy, R. W.   (1978)   
Brain Res 142,105-22.



  39. Smalley, K.  &  Eisen, T. (2000) FEBS Lett 476,
198-202.

Claims

CLAIMS 1. A polynucleotide encoding a functional Type II gonadotropin-releasing hormone receptor (Type II GnRH-R) peptide.

2. A polynucleotide as claimed in Claim 1 encoding at least a portion of exon I of Type II GnRH-R.

3. A polynucleotide as claimed in either one of Claims 1 and 2 which encodes mammalian Type II GnRH-R.

4. A polynucleotide as claimed in Claim 3 which encodes a primate Type II GnRH-R.

5. A polynucleotide as claimed in Claim 4 which encodes marmoset Type II GnRH-R.

6. A polynucleotide as claimed in Claim 5 having the nucleotide sequence as set out in SEQ ID No.

1 or which has over 90% homology thereto.

7. A polynucleotide as claimed in Claim 4 which encodes human Type II GnRH-R.

8. A polynucleotide as claimed in Claim 7 which comprises a nucleotide sequence as set out in any one of SEQ ID Nos. 3,5,7 or 9 or which has over 90% homology thereto.

9. A polynucleotide is claimed in Claim 8 which encodes an amino acid sequence as set out in any one of SEQ ID Nos. 4,6,8 or 10 or which has over 90% homology thereto.

10. A polynucleotide as claimed in any one of Claims 1 to 9 which encodes a peptide able to bind specifically to Type II GnRH.

11. A polynucleotide as claimed in Claim 10 which encodes a peptide able to act as a receptor for Type II GnRH-R.

12. A recombinant genetic construct comprising a polynucleotide as claimed in any one of Claims 1 to 11.

13. An expression vector comprising a polynucleotide as claimed in any one of Claims 1 to 11 and able to express functional Type II GnRH-R peptide.

14. A host cell transformed with a vector as claimed in Claim 13.

15. A host cell as claimed in Claim 14 able to express functional Type II GnRH-R.

16. A transgenic animal having a construct as claimed in Claim 12 stably integrated into its genome.

17. A peptide comprising at least a portion of exon I of Type II gonadotropin-releasing hormone receptor (Type II GnRH-R).

18. An isolated functional Type II gonadotropin releasing hormone receptor (Type II GnRH-R).

19. A peptide as claimed in either one of Claims 17 and 18 which comprises a portion of exon I of mammalian Type II GnRH-R.

20. A peptide as claimed in Claim 19 which comprises a portion of exon I of primate Type II GnRH-R.

21. A peptide as claimed in any one of Claims 17 to 20 having an amino acid sequence as set out in SEQ ID No. 2 which has over 90% homology thereto.

22. A peptide as claimed in any one of Claims 17 to 20 having an amino acid sequence as set out in any one of SEQ ID Nos. 4,6,8 or 10, or which has over 90% homology thereto.

23. A peptide as claimed in any one of Claims 17 to 22 which is able to bind Type II GnRH specifically.

24. A peptide as claimed in Claim 23 which is a functional receptor for Type II GnRH.

25. An antibody able to bind specifically to Type II GnRH-R.

26. An antibody as claimed in Claim 25 which is specific to an extracellular domain EC1, EC2 or EC3 of Type II GnRH-R.

27. A method of screening an agent for pharmacological activity, said method comprising: a) providing functional Type II GnRH-R peptide and exposing said peptide to the agent; and b) ascertaining whether said agent interacts with said Type II GnRH-R peptide.

28. The method as claimed in Claim 27 wherein said Type II GnRH-R is expressed by a host cell as claimed in Claim 15.

29. The method as claimed in Claim 27 wherein said Type II GnRH-R is expressed by a host cell transformed with a polynucleotide as claimed in Claim 11 wherein said host cell imitates Type II GnRH-R signal transduction at least partially and wherein exposure of said host cell to said agent results in Type II GnRH-R signal transduction when said agent binds successfully to said Type II GnRH-R peptide.

30. A method of inhibiting binding of GnRH to its native receptor in vivo, said method comprising administering Type II GnRH-R or an extracellular domain thereof.

31. The method of Claim 30 wherein the EC2 loop of Type II GnRH-R is administered.

32. A method of contraception, said method comprising administering exogenous Type II GnRH-R or an extracellular domain thereof to a patient in quantities sufficient to substantially diminish binding of endogenous Type II GnRH to endogenous Type II GnRH-R.

33. Use of Type II GnRH-R or an extracellular domain thereof to inhibit endogenous Type II GnRH binding to its native receptor in vivo.

34. Use of Type II GnRH-R as a contraceptive.

35. The use as claimed in either one of Claims 33 and 34 wherein said Type II GnRH-R is expressed from a recombinant genetic construct.