WO2001072973A2 - Regulation d'une enzyme humaine de type heparanase - Google Patents
Regulation d'une enzyme humaine de type heparanase Download PDFInfo
- Publication number
- WO2001072973A2 WO2001072973A2 PCT/EP2001/001997 EP0101997W WO0172973A2 WO 2001072973 A2 WO2001072973 A2 WO 2001072973A2 EP 0101997 W EP0101997 W EP 0101997W WO 0172973 A2 WO0172973 A2 WO 0172973A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- heparanase
- hle
- enzyme
- polynucleotide
- polypeptide
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01166—Heparanase (3.2.1.166)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- the invention relates to the area of regulation of extracellular matrix degradation. More particularly, the invention relates to the regulation of human heparanase-like enzyme activity to increase or decrease extracellular matrix degradation.
- Heparan sulfate proteoglycans are ubiquitous macromolecules associated with the cell surface and extracellular matrix of a wide range of cells of vertebrate and invertebrate tissues (1-4).
- the basic HSPG structure includes a protein core to which several linear heparan sulfate chains are covalently attached. These polysaccharide chains are typically composed of repeating hexuronic and D- glucosamine disaccharide units that are substituted to a varying extent with N- and O-linked sulfate moieties and N-linked acetyl groups (1-4).
- Studies on the involvement of extracellular matrix molecules in cell attachment, growth, and differentiation revealed a central role of HSPG in embryonic morphogenesis, angiogenesis, neurite outgrowth, and tissue repair (1-5).
- HSPG are prominent components of blood vessels (3). In large blood vessels they are concentrated mostly in the intima and inner media, whereas in capillaries they are bound mainly in the subendothelial basement membrane where they support proliferating and migrating endothelial cells and stabilize the structure of the capillary wall.
- extracellular matrix macromolecules such as collagen, laminin, and fibronectin and with different attachment sites on plasma membranes suggests a key role for this proteoglycan in the self-assembly and insolubility of extracellular matrix components, as well as in cell adhesion and locomotion.
- HS heparan sulfate
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 4;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 6;
- amino acid sequence shown in SEQ ID NO. 6 amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ED NO. 8;
- Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a heparanase-like enzyme comprising an amino acid sequence selected from the group consisting of:- ' /
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 4;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 6;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 8;
- binding between the test compound and the heparanase-like enzyme is detected.
- a test compound which binds to the heparanase-like enzyme is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- the agent can work by decreasing the activity of the heparanase-like enzyme.
- Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a polynucleotide encoding a heparanase-like enzyme polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 3;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 5;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 7;
- a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
- the agent can work by decreasing the amount of the heparanase-like enzyme through interacting with the heparanase-like enzyme mRNA.
- Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
- a test compound is contacted with a heparanase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2;
- amino acid sequence shown in SEQ ID NO. 4 0 amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 6;
- a heparanase-like enzyme activity of the polypeptide is detected.
- a test compound which increases heparanase-like enzyme activity of the polypeptide relative to heparanase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
- a test compound which decreases heparanase-like enzyme activity of the polypeptide relative to heparanase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- Yet another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
- a test compound is contacted with a heparanase-like enzyme product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 3;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 5;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1; and the nucleotide sequence shown in SEQ ID NO. 7.
- Binding of the test compound to the heparanase-like enzyme product is detected.
- a test compound which binds to the heparanase-like enzyme product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
- a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a heparanase-like enzyme polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1 ;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 3;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 5;
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 7;
- the invention thus provides reagents and methods for regulating extracellular matrix degradation.
- Such reagents and methods can be used inter alia, to suppress metastatic activity of malignant cells, to enhance extracellular matrix degradation during development, and to regulate tumor angiogenesis.
- Fig. 1 shows the DNA-sequence encoding a heparanase-like enzyme polypeptide.
- Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.1.
- Fig. 3 shows the DNA-sequence encoding a heparanase-like enzyme polypeptide.
- Fig. 4 shows the amino acid sequence deduced from the DNA-sequence of Fig. 3.
- Fig. 5 shows the DNA-sequence encoding a heparanase-like enzyme polypeptide.
- Fig. 6 shows the amino acid sequence deduced from the DNA-sequence of Fig. 5.
- Fig. 7 shows a DNA-alignment of 3 ESTs the consensus sequence encoding a heparanase-like enzyme polypeptide.
- Fig. 8 shows the amino acid sequence alignment of 3 ESTs the consensus sequence representing a heparanase-like enzyme polypeptide DETAILED DESCRIPTION OF THE INVENTION
- the mvention relates to an isolated polynucleotide encoding a heparanase-like enzyme polypeptide and being selected from the group consisting of:
- amino acid sequences which are at least about 50% identical to
- amino acid sequences which are at least about 50% identical to
- amino acid sequences which are at least about 50% identical to
- amino acid sequences which are at least about 50% identical to
- HLE heparanase-like enzyme
- HLE has a heparanase catalytic activity, e.g., an endoglycosidase hydrolyzing activity which is specific for heparan or heparan sulfate proteoglycan substrates as opposed to the activity of bacterial enzymes (heparinase I, II, and III), which degrade heparin or heparan sulfate by means of ⁇ - elimination (34).
- HLE can be used to develop treatments for various diseases, to develop diagnostic assays for these diseases, and to provide new tools for basic research especially in the fields of medicine and biology.
- the present invention can be used to develop new drugs to inhibit tumor cell metastasis, inflammation, and autoimmunity, as well as to modulate bioavailability of heparin-binding growth factors, cellular responses to heparin-binding growth factors (e.g., bFGF, VECGF), and cytokines (e.g., IL-8), cell interaction with plasma lipoproteins, cellular susceptibility to viral, protozoan, and some bacterial infections, and disintegration of neurodegenerative plaques.
- heparin-binding growth factors e.g., bFGF, VECGF
- cytokines e.g., IL-8
- HLE and regulators of HLE thus can provide treatments for wound healing, angiogenesis, restenosis, atherosclerosis, inflammation, neurodegenerative diseases (such as, for example, Genstmann-Straussler Syndrome, Creutzfeldt-Jakob disease, Scrapie, and Alzheimer's disease), and certain viral and some bacterial and protozoan infections.
- HLE also can be used to neutralize plasma heparin, as a potential replacement of protamine.
- HLE polypeptides according to the invention comprise an amino acid sequence as shown in SEQ ID NOS: 2, 4, 6 or 8, a portion of one of those amino acid sequences, or a biologically active variant of an amino. acid sequence shown in SEQ ID NOS: 2,
- an HLE polypeptide can be a portion of a heparanase-like enzyme molecule, a full-length HLE molecule, or a fusion protem comprising all or a portion of an HLE molecule. Most preferably, an HLE polypeptide has a heparanase activity. Heparanase activity can be measured, inter alia, as described in the above Examples.
- HLE variants which are biologically active, i.e., retain a heparanase activity, also are HLE polypeptides.
- naturally or non-naturally occurring HLE variants have amino acid sequences which are at least about 50, preferably about 75, 90, 96, or 98% identical to an amino acid sequence shown in SEQ ID NOS: 2, 4, 6 or 8.
- Percent identity between a putative HLE variant and an amino acid sequence of SEQ ID NOS: 2, 4, 6 or 8 is determined using the Blast2 alignment program.
- Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
- Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
- Amino acid insertions or deletions are changes to or within an amino acid sequence.
- Insertions or deletions can be the result of, for example, alternative splicing. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of an HLE polypeptide can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active HLE polypeptide can readily be determined by assaying for HLE activity, as described, for example, in Example 2.
- Fusion proteins can comprise at least 5, 6, 8, 10, 25, or 50 or more contiguous amino acids of an amino acid sequence shown in SEQ ID NO. 2, 4, 6 or 8. Fusion proteins are useful for generating antibodies against HLE amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a HLE polypeptide. Protem affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
- a HLE fusion protein comprises two protein segments fused together by means of a peptide bond.
- the first protein segment comprises at least 5, 6, 8, 10, 25, or 50 or more contiguous amino acids of an HLE polypeptide.
- Contiguous amino acids for use in a fusion protein can be selected from the amino acid sequence shown in SEQ ID NOS: 2, 4, 6 or 8 or from a biologically active variant of those sequences, such as those described above.
- the first protein segment also can comprise full-length HLE.
- the second protein segment can be a full-length protem or a protein fragment or polypeptide.
- Proteins commonly used in fusion protein construction include ⁇ - galactosidase, ⁇ -glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase
- epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV- G tags, and thioredoxin (Trx) tags.
- Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP1 protein fusions.
- a fusion protein also can be engineered to contain a cleavage site located between the HLE polypeptide-encoding sequence and the heterologous protein sequence, so that the HLE polypeptide can be cleaved and purified away from the heterologous moiety.
- a fusion protein can be synthesized chemically, as is known in the art.
- a fusion protem is produced by covalently linking two protein segments or by standard procedures in the art of molecular biology.
- Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from the complements of SEQ ID NO. 1 or 3 in proper reading frame with nucleotides encoding the second protein segment and expressing the DNA construct in a host cell, as is known in the art.
- kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International
- Species homologs of human HLE can be obtained using HLE polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of HLE, and expressing the cDNAs as is known in the art.
- a ⁇ L ⁇ polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a ⁇ L ⁇ polypeptide.
- the complements of partial nucleotide sequences for ⁇ L ⁇ polypeptides are shown in S ⁇ Q ID NOS: 1, 3, 5 and 7.
- nucleotide sequences encoding human ⁇ L ⁇ polypeptides as well as homologous nucleotide sequences which are at least about 50, preferably about 75, 90, 96, or 98% identical to the complements of the nucleotide sequences shown in S ⁇ Q ID NOS: 1, 3,5 or 7 also are ⁇ L ⁇ polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
- Complementary DNA (cDNA) molecules, species homologs, and variants of ⁇ L ⁇ polynucleotides which encode biologically active ⁇ L ⁇ polypeptides also are ⁇ L ⁇ polynucleotides.
- Variants and homologs of the ⁇ L ⁇ polynucleotides described above also are ⁇ L ⁇ polynucleotides.
- homologous ⁇ L ⁇ polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known ⁇ L ⁇ polynucleotides under stringent conditions, as is known in the art.
- homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-
- HLE polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
- Human variants of HLE polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1- 1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973).
- Variants of human HLE polynucleotides or HLE polynucleotides of other species can therefore be identified by hybridizing a putative homologous HLE polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NOS: 1, 3, 5 or 7 or the complements thereof to form a test hybrid.
- the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising HLE polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
- HLE poly- nucleotides Nucleotide sequences which hybridize to HLE polynucleotides or their complements following stringent hybridization and/or wash conditions also are HLE poly- nucleotides.
- Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
- T m of a hybrid between an HLE polynucleotide having a nucleotide sequence shown in SEQ ID NOS: 1, 3, 5 or 7 or the complements thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
- Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
- Highly stringent wash conditions include, for example; 0.2X SSC at 65°C.
- HLE polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
- Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated HLE polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprise HLE nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
- HLE cDNA molecules can be made with standard molecular biology techniques, using HLE mRNA as a template. HLE cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of HLE polynucleotides using either human genomic DNA or cDNA as a template. Alternatively, synthetic chemistry techniques can be used to synthesize HLE polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode an HLE polypeptide having, for example, an amino acid sequence shown in SEQ ID NO. 2, 4, 6 or 8 or a biologically active variant of one of those sequences .
- the partial sequences of SEQ ID NOS: 1, 3, 5 or 7 or their complements can be used to identify the corresponding full length gene(s) from which they were derived.
- the partial sequences can be nick-translated or end-labeled with 32 P using polynucleotide kinase using labeling methods known to those with skill in the art (BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al, eds., Elsevier Press, N.Y., 1986).
- a lambda library prepared from human tissue can be screened directly with the labeled sequences of interest or the library can be converted en masse to pBluescript (Stratagene Cloning Systems, La Jolla, Calif. 92037) to facilitate bacterial colony screening (see Sambrook et al, 1989, pg. 1.20).
- filters with bacterial colonies containing the library in pBluescript or bacterial lawns containing lambda plaques are denatured, and the DNA is fixed to the filters.
- the filters are hybridized with the labeled probe using hybridization conditions described by Davis et al, 1986.
- the partial sequences, cloned into lambda or pBluescript can be used as positive controls to assess background binding and to adjust the hybridization and washing stringencies necessary for accurate clone identification.
- the resulting auto- radiograms are compared to duplicate plates of colonies or plaques; each exposed spot corresponds to a positive colony or plaque.
- the colonies or plaques are selected and expanded, and the DNA is isolated from the colonies for further analysis and sequencing.
- Positive cDNA clones are analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence and the other primer from the vector.
- Clones with a larger vector-insert PCR product than the original partial sequence are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert of the same size or similar as the mRNA size determined from Northern blot Analysis.
- the complete sequence of the clones can be determined, for example after exonuclease III digestion (McCombie et al, Methods 3, 33-40, 1991).
- a series of deletion clones are generated, each of which is sequenced.
- the resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence.
- PCR-based methods can be used to extend the nucleic acid sequences encoding the disclosed portions of human HLE to detect upstream sequences such as promoters and regulatory elements.
- restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
- Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988).
- Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68°-72°C.
- the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
- capture PCR involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991).
- multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
- Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
- capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
- capillary sequencing can employ f ⁇ owable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
- Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
- Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
- HLE polypeptides can be obtained, for example, by purification from human germ B cells, by expression of HLE polynucleotides, or by direct chemical synthesis.
- HLE polypeptides can be purified, for example, from human germ B cells.
- a purified HLE polypeptide is separated from other compounds which normally associate with the HLE polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis. Purification of human platelet heparanase, a similar enzyme, is taught in Freeman & Parish, Biochem. J. 330, 1341-50 (1998).
- a preparation of purified HLE polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. Enzymatic activity of the purified preparations can be assayed, for example, as described in Example 2.
- a HLE polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
- Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding HLE polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN
- a variety of expression vector/host systems can be utilized to contain and express sequences encoding an HLE polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
- microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors
- yeast transformed with yeast expression vectors insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
- control elements or regulatory sequences are those non-translated regions of the vector — enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity.
- any number of suitable transcription and translation elements including constitutive and inducible promoters, can be used.
- inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used.
- the baculovirus polyhedrin promoter can be used in insect cells.
- Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO, and storage protein genes
- plant viruses e.g., viral promoters or leader sequences
- promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding an HLE polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
- a number of expression vectors can be selected depending upon the use intended for an HLE polypeptide. For example, when a large quantity of an HLE polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding an HLE polypeptide can be ligated in frame with sequences for the amino- terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J.
- Biol. Chem. 264, 5503- 5509, 1989 or pGEX vectors also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
- GST glutathione S-transferase
- fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- Proteins made in such systems can be designed to include heparin, thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
- yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters, such as alpha factor, alcohol oxidase, and PGH, can be used.
- constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH
- HLE polypeptides can be driven by any of a number of promoters.
- viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
- plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671- 1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl
- An insect system also can be used to express a HLE polypeptide.
- Autographa califo nica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodopter a frugiperda cells or in Trichoplusia larvae.
- Sequences encoding HLE polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter.
- Successful insertion of HLE polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
- the recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which HLE polypeptides can be expressed (Engelhard et al, Proc. Nat.
- a number of viral-based expression systems can be used to express HLE polypeptides in mammalian host cells.
- sequences encoding HLE polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing an HLE polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655- 3659, 1984).
- transcription enhancers such as the Rous sarcoma virus (RSV) enhancer can be used to increase expression in mammalian host cells.
- RSV Rous sarcoma virus
- HACs Human artificial chromosomes
- 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
- Specific initiation signals also can be used to achieve more efficient translation of sequences encoding HLE polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding an HLE polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the
- ATG initiation codon should be provided.
- the initiation codon should be in the correct reading frame to ensure translation of the entire insert.
- Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see
- a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed HLE polypeptide in the desired fashion.
- modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
- Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding, and or function.
- Different host cells which have specific cellular machinery and characteristic mechanisms for post- translational activities e.g., CHO, HeLa, MDCK, HEK293, and WI38
- ATCC American Type Culture Collection
- Stable expression is preferred for long-term, high-yield production of recombinant proteins.
- cell lines which stably express HLE polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium.
- the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced HLE sequences.
- Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
- any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in ti or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci. 77, 3567-70, 1980) npt confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol 150, 1-
- trpB allows cells to utilize indole in place of tryptophan
- hisD allows cells to utilize histinol in place of histidine
- Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
- marker gene expression suggests that an HLE polynucleotide is also present, its presence and expression may need to be confirmed, " fcof'example, if a sequence encoding an HLE polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode the HLE polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding an HLE polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of an HLE polynucleotide.
- host cells which contain an HLE polynucleotide and which express an HLE polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA- RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the ' presence of a polynucleotide sequence encoding an HLE polypeptide can be detected by DNA-DNA or DNA- RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding the HLE polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding the HLE polypeptide to detect transformants which contain an HLE polynucleotide.
- a variety of protocols for detecting and measuring the expression of an HLE polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- FACS fluorescence activated cell sorting
- a two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on an HLE polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St.
- Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding HLE polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
- sequences encoding an HLE polypeptide can be cloned into a vector for the production of an mRNA probe.
- RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
- Host cells transformed with nucleotide sequences encoding an HLE polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
- the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing poly- nucleotides which encode HLE polypeptides can be designed to contain signal sequences which direct secretion of HLE polypeptides through a prokaryotic or eukaryotic cell membrane.
- purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.).
- cleavable linker sequences such as those specific for Factor XA or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the HLE polypeptide also can be used to facilitate purification.
- One such expression vector provides for expression of a fusion protein containing an HLE polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp.
- enterokinase cleavage site provides a means for purifying the HLE polypeptide from the fusion protein.
- Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
- Sequences encoding an HLE polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res.
- an HLE polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid- phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
- fragments of HLE polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
- the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983).
- the composition of a synthetic HLE polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the HLE polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
- HLE polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons may be advantageous to produce HLE polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons.
- codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protem expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
- nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter HLE polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
- DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
- site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
- Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of an HLE polypeptide.
- Fab fragment antigen binding protein
- F(ab') 2 fragment antigen binding protein
- Fv fragment antigen binding protein
- at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope.
- epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
- An antibody which specifically binds to an epitope of an HLE polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots,
- ELISAs ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
- Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
- an antibody which specifically binds to an HLE polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
- antibodies which specifically bind to HLE polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate an HLE polypeptide from solution.
- HLE polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
- an HLE polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
- a carrier protein such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
- various adjuvants can be used to increase the immunological response.
- adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.
- BCG Bacilli Calmette-Guerin
- Corynebacterium parvum are especially useful.
- Monoclonal antibodies which specifically bind to a HLE polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV- hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-
- Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.
- Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.
- humanized antibodies can be produced using recombinant methods, as described in
- Antibodies which specifically bind to an HLE polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
- single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to HLE polypeptides.
- Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
- Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11).
- Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15,
- a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
- single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J Immunol. Meth. 165, 81- 91).
- Antibodies which specifically bind to HLE polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
- Other types of antibodies can be constructed and used therapeutically in methods of the invention.
- chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO
- Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which an HLE polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
- Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of HLE gene products in the cell.
- Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Bio 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
- Modifications of HLE gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of an HLE gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition, of the ability of the double helix to open sufficiently for the binding of polymefases, x transcription factors, or chaperons.
- An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
- Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to an HLE polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent HLE nucleotides, can provide sufficient targeting specificity for HLE mRNA.
- each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
- Non- complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length.
- One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular HLE polynucleotide sequence.
- Antisense oligonucleotides can be modified without affecting their ability to hybridize to an HLE polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule.
- internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
- Modified bases and/or sugars such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
- modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem.
- Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
- Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
- the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
- the coding sequence of an HLE polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the HLE polynucleotide.
- Methods of designing and constructing ribozymes which can cleave RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al Nature 334, 585-591 , 1988).
- the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
- the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
- Specific ribozyme cleavage sites within an HLE RNA target can be identified by scanning the HLE target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitabili -Of candidate HLE RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
- nucleotide sequences shown in SEQ ID NOS:l and 3 and their complements provide sources of suitable hybridization region sequences. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target.
- the hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
- Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease HLE expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art.
- a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
- ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.
- the invention provides methods for identifying modulators, t ' .e., candidate or test compounds which bind to HLE polypeptides or polynucleotides and/or have a stimulatory or inhibitory effect on, for example, expression or activity of the HLE polypeptide or polynucleotide, so as to regulate degradation of the extracellular matrix.
- Decreased extracellular matrix degradation is useful, for example, for preventing or suppressing malignant cells from metastasizing.
- Increased extra- cellular matrix degradation may be desired, for example, in developmental disorders characterized by inappropriately low levels of extracellular matrix degradation.
- the invention provides assays for screening test compounds which bind to or modulate the activity of an HLE polypeptide or an HLE polynucleotide.
- a test compound preferably binds to an HLE polypeptide or polynucleotide. More preferably, a test compound decreases an HLE activity of an HLE polypeptide or expression of an HLE polynucleotide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
- Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
- the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
- the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See ⁇ am, Anticancer Drug Des. 12, 145, 1997.
- Test compounds can be screened for the ability to bind to HLE polypeptides or polynucleotides or to affect HLE activity or HLE gene expression using high throughput screening.
- high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
- the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
- many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
- free format assays or assays that have no physical barrier between samples, can be used.
- an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl Acad. Sci. U.S.A. 19, 1614-18 (1994).
- the cells are placed under agarose in perri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
- the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
- Chelsky "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadephia, Pa. (Nov. 7-10, 1995).
- Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel.
- beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
- test samples are placed in a porous matrix.
- One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- the test compound is preferably a small molecule which binds to the heparanase-like enzyme polypeptide and preferably occupies the active site of an HLE polypeptide, thereby making the active site inaccessible to substrate such that normal biological activity is prevented.
- small molecules include, but are not limited to, small peptides or peptide-like molecules.
- either the test compound or the HLE polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the HLE polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
- binding of a test compound to an HLE polypeptide can be determined without labeling either of the interactants.
- a microphysiometer can be used to detect binding of a test compound with an HLE polypeptide.
- a microphysiometer e.g., CytosensorTM
- LAPS light-addressable potentiometric sensor
- Determining the ability of a test compound to bind to an HLE polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995).
- BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g, BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
- an HLE polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046- 12054, 1993; Barrel et al, Biotechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent W094/10300) to identify other proteins which bind to or interact with the HLE polypeptide and modulate its activity.
- the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
- the assay utilizes two different DNA constructs. For example, in one construct a poly- nucleotide encoding an HLE polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein (“prey" or "sample”) can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
- a known transcription factor e.g., GAL-4
- the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the HLE polypeptide.
- a reporter gene e.g., LacZ
- HLE polypeptide or polynucleotide
- test compound can be bound to a solid support.
- Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
- HLE polypeptide or polynucleotide
- test compound Any method known in the art can be used to attach the HLE polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide or test compound and the solid support.
- Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to an HLE polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
- an HLE polypeptide is a fusion protein comprising a domain that allows the HLE polypeptide to be bound to a solid support.
- glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non- adsorbed HLE polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
- HLE polypeptide or polynucleotide
- test compound can be immobilized utilizing conjugation of biotin and streptavidin.
- Biotinylated HLE polypeptides, poly- nucleotides, or test compounds can be prepared from biotin-NHS(N-hydroxy- succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
- antibodies which specifically bind to an HLE polypeptide, polynucleotides, or a test compound, but which do not interfere with a desired binding site, such as the active site of the HLE polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
- Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to an HLE polypeptide or test compound, enzyme- linked assays which rely on detecting an HLE activity of the HLE polypeptide, and SDS gel electrophoresis under non-reducing conditions.
- HLE polypeptide or polynucleotide Screening for test compounds which bind to an HLE polypeptide or polynucleotide also can be carried out in an intact cell.
- Any cell which comprises an HLE polynucleotide or polypeptide can be used in a cell-based assay system.
- An HLE polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
- MT MT, MDA-468, SK-BR3, and BT-474, the A549 lung cancer cell line, and the H392 glioblastoma cell line, can be used.
- An intact cell is contacted with a test compound.
- Binding of the test compound to an HLE polypeptide or polynucleotide is determined as described above, after lysing the cell to release the HLE polypeptide-or polynucleo tide-test compound complex.
- Test compounds can be tested for the ability to increase or decrease an HLE activity of an HLE polypeptide.
- HLE activity can be measured, for example, of an HLE activity can be measured after contacting either a purified HLE polypeptide, a cell extract, or an intact cell with a test compound.
- a test compound which decreases HLE activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100%) is identified as a potential agent for decreasing extracellular matrix degradation.
- a test compound which increases HLE activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential agent for increasing extracellular matrix degradation.
- test compounds which increase or decrease HLE gene expression are identified.
- An HLE polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the HLE polynucleotide is determined.
- the level of expression of HLE mRNA or polypeptide in the presence of the test compound is compared to the level of expression of HLE mRNA or polypeptide in the absence of the test compound.
- the test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of HLE mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of HLE mRNA or polypeptide expression. Alternatively, when expression of HLE mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of HLE mRNA or polypeptide expression.
- the level of HLE mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptides. Either qualitative or quantitative methods can be used.
- the presence of polypeptide products of an HLE polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
- polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into an HLE polypeptide.
- Such screening can be carried out either in a cell-free assay system or in an intact cell.
- Any cell which expresses an HLE polynucleotide can be used in a cell-based assay system.
- the HLE polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
- Either a primary culture or an established cell line, including neoplastic cell lines such as the colon cancer cell lines HCT116, DLD1, HT29, Caco2, SW837, SW480, and RKO, breast cancer cell lines 21-PT, 21-MT, MDA-468, SK-BR3, and BT-474, the A549 lung cancer cell line, and ..the H392 glioblastoma cell line, can be used.
- compositions of the invention can comprise, for example, an HLE polypeptide, HLE polynucleotide, antibodies which specifically bind to HLE activity, or mimetics, agonists, antagonists, or inhibitors of HLE activity.
- the compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical canier, including, but not limited to, saline, buffered saline, dextrose, and water.
- the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
- compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
- Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
- compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
- disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pynolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
- Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpynolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpynolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
- Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
- Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
- the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
- compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
- Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
- Non-lipid polycationic amino polymers also can be used for delivery.
- the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- the pharmaceutical compositions of the present mvention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
- the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
- compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
- the human HLE gene provides a therapeutic target for decreasing extracellular matrix degradation, in particular for treating or preventing metastatic cancer.
- Cancers whose metastasis can be suppressed according to the invention include adenocarcinoma, melanoma, cancers of the adrenal gland, bladder, bone, breast, cervix, gall bladder, liver, lung, ovary, pancreas, prostate, testis, and uterus. Circulating tumor cells arrested in the capillary beds of different organs must invade the endothelial cell lining and degrade its underlying basement membrane (BM) in order to invade into the extravascular tissue(s) where they establish metastasis (9, 10).
- BM basement membrane
- Metastatic tumor cells often attach at or near the intercellular junctions between adjacent endothelial cells. Such attachment of the metastatic cells is followed by rupture of the junctions, retraction of the endothelial cell borders and migration through the breach in the endothelium toward the exposed underlying BM (9).
- the invading cells must degrade the subendothelial glycoproteins and proteoglycans of the BM in order to migrate out of the vascular compartment.
- heparin sulfate degrading heparanase was found to correlate with the metastatic potential of mouse lymphoma, fibrosarcoma and melanoma cells (8, 11).
- HLE activity therefore can be used to suppress tumor cell invasion and metastasis.
- Fibroblast growth factors are a family of structurally related polypeptides characterized by high affinity to heparin (14). They are highly mitogenic for vascular endothelial cells and are among the most potent inducers of neovascularization (14, 15).
- Basic fibroblast growth factor (bFGF) has been extracted from the subendothelial extracellular matrix produced in vitro (16) and from basement membranes of the cornea (17), suggesting that extracellular matrix may serve as a reservoir for bFGF. Immunohistochemical staining revealed the localization of bFGF in basement membranes of diverse tissues and blood vessels (18).
- bFGF binds to HSPG in the extracellular matrix and can be released in an active form by HS degrading enzymes (13, 17, 19). Heparanase activity expressed by platelets mast cells, neutrophils, and lymphoma cells is involved in release of active bFGF from extracellular matrix and basement membranes (20). This suggests that heparanase activity may not only function in cell migration and invasion, but may also elicit an indirect neovascular response. Thus, displacement of bFGF from its storage within basement membranes and extracellular matrix may therefore provide a novel mechanism for induction of neovascularization in normal and pathological situations.
- Heparanase activity conelates with the ability of activated cells of the immune system to leave the circulation and elicit both inflammatory and autoimmune responses.
- Interaction of platelets, granulocytes, T and B lymphocytes, macrophages, and mast cells with the subendothelial extracellular matrix is associated with degradation'of HS by a specific heparanase activity (6).
- the enzyme is released from intracellular compartments (e.g., lysosomes, specific granules, etc.) in response to various activation signals (e.g., thrombin, calcium ionophore, immune complexes, antigens, mitogens, etc.), suggesting its regulated involvement in inflammation and cellular immunity.
- various activation signals e.g., thrombin, calcium ionophore, immune complexes, antigens, mitogens, etc.
- Heparan sulfate proteoglycans have been identified in the prion protein amyloid plaques of Genstmann-Straussler Syndrome, Creutzfeldt- Jakob disease, and Scrapie (32). HLE may therefore distintegrate these amyloid plaques which are also thought to play a role in the pathogenesis of Alzheimer's disease.
- SMCs smooth muscle cells
- HS is also involved in lipoprotein binding, retention and uptake (34).
- HSPG and lipoprotein lipase participate in a novel catabolic pathway that may allow substantial cellular and interstitial accumulation of cholesterol rich lipoproteins (28). The latter pathway is expected to be highly atherogenic by promoting accumulation of apoB and apoE rich lipoproteins (i.e.
- HLE may be applied to modulate bioavailability of heparin-binding growth factors (5) cellular responses to heparin-binding growth factors (e.g., bFGF, VEGF) and cytokines (IL-8) (27, 26), cell interaction with plasma lipoproteins (28), and cellular susceptibility to certain viral and some bacterial and protozoa infections (29, 30, 31). HLE may thus prove useful for conditions such as wound healing, angiogenesis, restenosis, atherosclerosis, inflammation, neurodegenerative diseases, and viral infections. HLE also can be used to neutralize plasma heparin, as a potential replacement of protamine. Anti-HLE antibodies can be applied for immunodetection and diagnosis of micrometastases, autoimmune lesions, and renal failure in biopsy specimens, plasma samples, and body fluids.
- heparin-binding growth factors e.g., bFGF, VEGF
- IL-8 cytokines
- IL-8 cytokines
- HLE
- This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
- an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a polypeptide- binding partner
- an agent identified as described herein can be used in an animal model to detemiine the efficacy, toxicity, or side effects of treatment with such an agent.
- an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
- this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
- a reagent which affects HLE activity can be administered to a human cell, either in vitro or in vivo, to reduce HLE activity.
- the reagent preferably binds to an expression product of an HLE gene. If the expression product is a polypeptide, for example, the reagent can be an antibody or a small chemical compound.
- a reagent can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
- the reagent is delivered using a liposome.
- the liposome is stable in the animal into which it has been administered for at least about
- a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
- the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung or liver.
- a liposome useful in the present mvention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
- the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmol of liposome delivered to about
- a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
- Suitable liposomes / for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
- a liposome comprises a compound capable of targeting the liposome to a tumor cell, such as a tumor cell ligand exposed on the outer surface of the liposome.
- a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151).
- a reagent such as an antisense oligonucleotide or ribozyme
- from about 0.1 ⁇ g to about 10 ⁇ g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 mmol liposomes.
- antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
- Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE
- a polynucleotide encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
- Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
- effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
- the reagent is preferably an antisense oligonucleotide or a ribozyme.
- Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
- a reagent reduces expression of a HLE gene or the activity of a HLE polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
- the effectiveness of the mechanism chosen to decrease the level of expression of an HLE gene or the activity of an HLE polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to HLE-specific mRNA, quantitative RT-PCR, immunologic detection of a HLE polypeptide, or measurement of HLE activity.
- any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
- the combination of therapeutic agents can act syner- gistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
- a therapeutically effective dose refers to that amount of active ingredient which increases or decreases HLE activity relative to HLE activity which occurs in the absence of the therapeutically effective dose.
- the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
- the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
- Therapeutic efficacy and toxicity e.g., ED5 0 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
- the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 50 /ED 5 o.
- compositions which exhibit large therapeutic indices are preferred.
- the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
- the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
- the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
- the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combinations), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
- Normal dosage amounts of any particular reagent can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for polypeptides or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
- any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
- the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce heparanase-like enzyme polypeptide in yeast.
- the heparanase-like enzyme polypeptide encoding DNA sequence is derived from the complement of
- the DNA sequence Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZB with the corresponding restriction enzymes the modified DNA sequence is ligated into pPICZB.
- This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
- the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
- the bound heparanase-like enzyme polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the heparanase-like enzyme polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human heparanase-like enzyme polypeptide is obtained.
- the activity of the heparanase-like enzyme polypeptide is assessed according to the following procedures: A mixture of 25 ⁇ l of an aqueous solution of porcine intestinal mucosa-derived heparin (Heparin Sodium Salt (Porcive Intestinal Mucosa) manufactured by Sigma) (lOmg/ml), 25 ⁇ l of the heparanase-like enzyme polypeptide solution and 50 ⁇ l of 20 mM acetate buffer (pH 7.0) contaimng 2 mM calcium acetate is incubated at 37°C for 10 minutes. Immediately thereafter, 500 ⁇ l of 0.06 N hydrochloric acid is added and the absorption maximum at 232 mn is measured.
- One unit of activity is defined as the quantity of heparanase-like enzyme polypeptide which causes formation of 1 micromole of unsaturated uronic acid per minute.
- HLE polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
- HLE polypeptides comprise an amino acid sequence shown in SEQ ID NO. 2, 4, 6 or 8.
- the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
- the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to an HLE polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound was not incubated is identified as a compound which binds to an HLE polypeptide.
- Cellular extracts from the human colon cancer cell line HCT116 are contacted with test compounds from a small molecule library and assayed for HLE activity. Control extract in the absence of a test compound also are assayed.
- Cells or cell lysates are incubated on top of an S-labeled extracellular matrix for 18 hours at 37°C in 20 mM phosphate buffer, pH 6.2. The incubation medium is collected and centrifuged at 18,000 x g at 4°C for 3 minutes. Sulfate-labeled material is analyzed by gel filtration on a Sepharose CL-6B column (0.9 x 30 cm). Fractions of 0.2 ml are eluted with PBS at a flow rate of 5 ml hr. See U.S. Patent 5,968,822.
- a test compound which decreases HLE activity of the extract relative to the control extract by at least 20% ⁇ is identified as a HLE inhibitor.
- test compound is administered to a culture of the breast tumor cell line MDA-468 and incubated at 37°C for 10 to 45 minutes.
- a culture of the same type of cells incubated for the same time without the test compound provides a negative control.
- RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
- Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 3 P-labeled HLE-specific probe at 65°C in Express-hyb (CLONTECH).
- the probe comprises at least 11 contiguous nucleotides selected from SEQ ID NO. 1, 3, 5 or 7.
- a test compound which decreases the HLE -specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of HLE gene expression.
- antisense HLE oligonucleotides comprising the following contiguous nucleotides (1-25) of SEQ ID NOS: 1 (CCTAGGCTAAGATCACGCTATGACA),
- oligonucleo- tides are ethanol-precipitated twice, dried, and suspended in phosphate-buffered saline (PBS) at the desired concentration. Purity of these oligonucleotides is tested by capillary gel electrophoreses and ion exchange HPLC. Endotoxin levels in the oligonucleotide preparation are determined using the Limulus Amebocyte Assay (Bang, Biol. Bull. (Woods Hole, Mass.) 105, 361-362, 1953).
- aqueous composition containing the antisense oligonucleotides at a concentration of 0.1-100 ⁇ M is injected directly into a breast tumor with a needle.
- the needle is placed in the tumors and withdrawn while expressing the aqueous composition within the tumor.
- the breast tumor is monitored over a period of days or weeks. Additional injections of the antisense oligonucleotides can be given during that time. Metastasis of the breast tumor is suppressed due to decreased HLE activity of the breast tumor cells.
- RT-PCR Reverse Transcription-Polymerase Chain Reaction
- Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology //, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
- the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci.
- the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
- the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used.
- heparanase-like enzyme is involved in cancer
- expression is determined in the following tissues: adrenal gland, bone marrow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
- Expression in the following cancer cell lines also is determined: DU- 145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung), NCI-H460 (lung), HT-116 (colon), DLD-1 (colon), MDA-MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87. Matched pairs of malignant and normal tissue from the same patient also are tested.
- heparanase-like enzyme is involved in CNS disorders
- tissues are screened: fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypothalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
- RNA extraction and cDNA preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled “from autopsy” are extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
- RNA Fifty ⁇ g of each RNA are treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl 2 ; 50 mM NaCl; and 1 M DTT.
- RNA is extracted once with 1 volume of phenol:chloroform:isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M NaAcetate, pH5.2, and 2 volumes of ethanol.
- RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectro- photometric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/ ⁇ L. Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
- the expected length of the PCR product is -(gene specific length)bp.
- Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
- the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ⁇ l.
- the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA).
- fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
- VEGF vascular endothelial growth factor
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU50331/01A AU5033101A (en) | 2000-02-24 | 2001-02-22 | Regulation of human heparanase-like enzyme |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US18466000P | 2000-02-24 | 2000-02-24 | |
US60/184,660 | 2000-02-24 | ||
US25291300P | 2000-11-27 | 2000-11-27 | |
US60/252,913 | 2000-11-27 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001072973A2 true WO2001072973A2 (fr) | 2001-10-04 |
WO2001072973A3 WO2001072973A3 (fr) | 2002-06-06 |
Family
ID=26880358
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2001/001997 WO2001072973A2 (fr) | 2000-02-24 | 2001-02-22 | Regulation d'une enzyme humaine de type heparanase |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU5033101A (fr) |
WO (1) | WO2001072973A2 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005118808A1 (fr) * | 2004-06-01 | 2005-12-15 | Hadasit Medical Research Services & Development Ltd. | Molecules d'acide nucleique servant d'inhibiteurs puissants d'heparanase, leurs compositions et leurs methodes d'utilisation |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001021814A1 (fr) * | 1999-09-23 | 2001-03-29 | Merck Patent Gmbh | L'heparanase-2, membre de la famille des proteines heparanases |
WO2001046392A2 (fr) * | 1999-12-22 | 2001-06-28 | Oxford Glycosciences (Uk) Ltd. | Substances |
WO2001048161A2 (fr) * | 1999-12-23 | 2001-07-05 | Schering Aktiengesellschaft | Acide nucleique et polypeptide apparentes a l'heparanase humaine |
-
2001
- 2001-02-22 AU AU50331/01A patent/AU5033101A/en not_active Abandoned
- 2001-02-22 WO PCT/EP2001/001997 patent/WO2001072973A2/fr active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001021814A1 (fr) * | 1999-09-23 | 2001-03-29 | Merck Patent Gmbh | L'heparanase-2, membre de la famille des proteines heparanases |
WO2001046392A2 (fr) * | 1999-12-22 | 2001-06-28 | Oxford Glycosciences (Uk) Ltd. | Substances |
WO2001048161A2 (fr) * | 1999-12-23 | 2001-07-05 | Schering Aktiengesellschaft | Acide nucleique et polypeptide apparentes a l'heparanase humaine |
Non-Patent Citations (4)
Title |
---|
DATABASE EMBL [Online] Accession no AG019564, Sequence ID AG019564, 18 October 1999 (1999-10-18) HATTORI M ET AL: "Homo sapiens genomic DNA, chromosome 21q" XP002193531 * |
DATABASE EMBL [Online] Accession no AG019565, Sequence ID AG019565, 18 October 1999 (1999-10-18) HATTORI M ET AL: "Homo sapiens genomic DNA, chromosome 21q" XP002193530 * |
DATABASE EMBL [Online] Accession no AI222323, Sequence ID AI222323, 28 October 1998 (1998-10-28) STRAUSBERG R: "national Cancer Institute, Cancer Genome Anatomy Project" XP002193532 * |
MCKENZIE EDWARD ET AL: "Cloning and expression profiling of Hpa2, a novel mammalian heparanase family member." BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 276, no. 3, 5 October 2000 (2000-10-05), pages 1170-1177, XP002193529 ISSN: 0006-291X * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005118808A1 (fr) * | 2004-06-01 | 2005-12-15 | Hadasit Medical Research Services & Development Ltd. | Molecules d'acide nucleique servant d'inhibiteurs puissants d'heparanase, leurs compositions et leurs methodes d'utilisation |
Also Published As
Publication number | Publication date |
---|---|
WO2001072973A3 (fr) | 2002-06-06 |
AU5033101A (en) | 2001-10-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20020115177A1 (en) | Regulation of human histone deacetylase | |
US20020146407A1 (en) | Regulation of human eosinophil serine protease 1- like enzyme | |
US20040105853A1 (en) | Regulation of human epithin-like serine-protease | |
US20030003488A1 (en) | Regulation of human mitochondrial deformylase | |
US20060141552A1 (en) | Regulation of human caspase-1-like protease | |
WO2001062904A1 (fr) | Regulation de l'enzyme 1 du type b-gelatinase humaine | |
WO2002002755A2 (fr) | Regulation d'enzyme de type thimet oligopeptidase humaine | |
WO2001098340A2 (fr) | Regulation d'une enzyme du type protease mastocytaire humaine 6 | |
WO2001072973A2 (fr) | Regulation d'une enzyme humaine de type heparanase | |
US7049089B2 (en) | Regulation of human PLC delta-1 | |
US20030092664A1 (en) | Regulation of human epithin-like serine protease | |
EP1287124A2 (fr) | Regulation de la serine protease semblable a l'epithine humaine | |
WO2001085959A2 (fr) | Regulation de la protease de type lysostaphine humaine | |
WO2002032938A2 (fr) | Regulation de la proteine humaine de type pgc-1 | |
US20030105059A1 (en) | Regulation of human mast cell protease 6-like enzyme | |
WO2002053756A2 (fr) | Regulation de glucosamine-6-phosphate desaminase humaine | |
WO2001062941A2 (fr) | Regulation de l'enzyme 2 semblable a la gelatinase b humaine | |
WO2002053713A2 (fr) | Regulation de sulfotransferase humaine | |
WO2002053714A2 (fr) | Regulation de la phosphatidylinositol-4-phosphate 5-kinase humaine | |
WO2002033097A2 (fr) | Regulation de la sulfotransferase humaine | |
US20030049670A1 (en) | Regulation of human leucine aminopeptidase-like enzyme | |
WO2002000891A2 (fr) | Regulation de la protease aspartyle humaine de type napsin | |
WO2002040651A2 (fr) | Regulation de l'adenosine desaminase humaine specifique a arnt | |
WO2002024886A2 (fr) | Regulation de la serine protease humaine | |
WO2002004608A2 (fr) | Regulation de l'enzyme similaire a l'oligopeptidase a humaine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |