WO2001070990A1

WO2001070990A1 - Nucleic acid sequences comprising at least a phage-resistance mechanism, plasmids containing same, lactic acid bacteria and use

Info

Publication number: WO2001070990A1
Application number: PCT/FR2001/000836
Authority: WO
Inventors: Fabien Prevots; Sandrine Tolou
Original assignee: Skw Nature Products Holding France Sas
Priority date: 2000-03-21
Filing date: 2001-03-21
Publication date: 2001-09-27
Also published as: AU2001248412A1; FR2806740A1; FR2806740B1

Abstract

The invention concerns two nucleic acid sequences comprising at least a phage-resistance mechanism, characterised in that they consist of: a) the DNA sequences having chain formations of nucleic acids [SEQ ID No 1] and [SEQ ID No 2]; b) the DNA sequences hybridising with the above sequences or fragments thereof; c) the corresponding mRNA and cDNA sequences. The invention is applicable to: bacteria, in particular phage-resistant lactic acid bacteria.

Description

Nucleic acid sequences comprising at least one mechanism for resistance to phaαes, plasmids containing them, lactic acid bacteria and use

The subject of the present invention is new nucleic acid sequences and plasmids capable of hybridizing with these, carrying at least one phage resistance mechanism, lactic acid bacteria containing these nucleic acid sequences or these plasmids, in particular strains belonging to the species Streptococcus thermophilus, the use of certain strains of these Streptococcus thermophilus to transfer, in particular by conjugation, in particular in the dairy industry, a mechanism of resistance to phages to strains of industrial interest, and the use of certain strains of Streptococcus thermophilus to obtain these plasmids.

Lactic acid bacteria are used for the manufacture and preservation of many products consumed on a large scale, such as cheese, yogurt, butter, sausage or sauerkraut. From a commercial point of view, dairy products occupy a preponderant place. However, the use of increasingly large fermentation tanks goes hand in hand with the increased risk of the appearance of bacteriophages. These are responsible for fermentation accidents with various consequences such as: modification of the characteristics of the final product, in particular in terms of texture, aroma, etc ...; absence of the final product due to too weak acidification; loss of the raw material that is milk. To this is added the need to decontaminate the tanks and all the areas in contact with bacteriophages, which generates a blockage of the industrial tool. It is therefore essential that the dairy industry, faced with these problems, find solutions to make lactic acid bacteria more resistant to bacteriophages.

The bacteriophages capable of attacking S. thermophilus fall into two large groups of homology defined by studies of DNA / DNA hybridization and of major protein composition according to PREVOTS F. et al (1989), vol. 135, 3337-3344. These two groups include only virulent bacteriophages. One of these groups comprises phages having two major proteins of 23 and 29 kDa (group A), and the other group comprises phages having two major proteins of 23 and 40 kDa (group B). Within the same group, the homologies are strong, and from one group to another, the homologies are weak. However, the groups A and B show weak but not zero DNA homology. All of these bacteriophages have an isometric nucleocapsid.

Some authors (see the review on the subject: BRUSSOW et al., Virus genes (1998) vol. 16, 95-109) have demonstrated the presence of temperate bacteriophages. However, these phages belong to the same homology group.

Several mechanisms of phage resistance have been highlighted and described by SANDERS M. in Biochemistry 70, (1988), 411-421, and FORDE M. and

FITZGERALD G. F. in Antonie van Leeuwenhoek 76, (1999), 89-113: interference with the adsorption of bacteriophages; this mechanism makes it possible to inhibit or delay the adsorption of bacteriophages. prevention of injection of bacteriophage DNA; adsorption of the bacteriophage onto the bacteria takes place, but the mechanism prevents the penetration of the bacteriophage DNA into the cell.

- restriction and modification; the bacteriophage DNA, once inside the cell, is degraded by a restriction endonuclease encoded by the cell.

- abortive infection; according to this latter mechanism, a whole series of defenses can prevent the intracellular development of the bacteriophage and the release of bacteriophage particles, by acting on the replication of the genome, the transcription, the translation, or the assembly of bacteriophages. Several so-called unnatural strategies, using genetic engineering techniques, have been developed to develop lactic bacteria resistant to phages and described by MOINEAU S. in Antonie van Leeuwenhoek 76, (1999), 377-382 and FORDE M. and FITZGERALD GF in Antonie van Leeuwenhoek 76, (1999), 89-113: - use of a bacteriophage DNA fragment; this strategy inhibits the development of related bacteriophages by the presence of bacteriophage gene products in an altered form, in excess or expressed at a bad time in the development of the bacteriophage.

- anti-sense technique; a phage DNA fragment, taken in an ORF (Open Reading Frame) is cloned in an antisense orientation with respect to a strong promoter. The RNA produced hybridizes with the corresponding bacteriophage RNA, inhibiting the development of the bacteriophage. - suicide system; one or more restriction systems are cloned downstream of an inducible bacteriophage promoter. During bacteriophage infection, the promoter is induced and causes cell lysis. Other strategies consist solely in transferring by natural plasmids conferring resistance to bacteriophages; On this subject, we can cite the following articles:

- SANDERS et al., Applied and Environ. Microbiol. (1986), vol. 52, 1001-1007.

- HARRINGTON, A., and HILL, C, Applied and Environ. Microbiol. (1991), vol. 57, 3405-3409. - KLAENHAMMER, T.R., and FITZGERALD, G.F. (1994), Genetics and Biotechnology of lactic acid bacteria, (1994), 106-168, ed. Chapman and Hall, London.

- MURPHY, M.C., et al (1988) Applied and Environ. Microbiol., Vol. 54, 1951- 1956. - PREVOTS, F. et al (1996) Le Lait, vol. 76, 417-421.

All these studies have been carried out mainly on the Lactococcus lactis species. Concerning the Streptococcus thermophilus species, few mechanisms of resistance to bacteriophages have been highlighted. Five restriction and modification systems encoded by the chromosome were identified, but were not cloned by MOINEAU, S. (1997) An update. Proc. 34 ^th Marschall ltalian and Specialty cheeses, 9-17, Madison, Wl. . Other authors (LARBI, D., et al (1992) J. of Dairy Research, vol. 59, 349-357) suggest that resistance to abortifacial bacteriophages may be present in Streptococcus thermophilus: these resistances would not be restriction / modification type or involved in the inhibition of phage adsorption. However, these authors have not attempted to clone the possible genes responsible for these resistance phenotypes.

The Applicant has now isolated from strains resistant to the bacteriophages Streptococcus thermophilus FT78 and FT80 deposited at the CNCM (National Collection of Cultures of Microorganisms, Institut Pasteur, Paris) respectively on March 15, 2000 under the number I-2397 and on March 10, 2000 under the number I-2396, two DNA sequences comprising at least one mechanism resistance to bacteriophages; these DNA sequences respectively comprise a functional part of 2256 base pairs (bp) and 3653 bp.

These DNA sequences of 2256 bp and 3653 bp, were isolated from the genomic DNA contained in the strains FT78 and FT80, respectively. More specifically, the fragments of 2256 bp and 3653 bp were isolated by total digestion using the restriction enzyme Hind \\\ of the genomic DNA contained in the strains Streptococcus thermophilus FT78 and FT80, respectively. These fragments carry one or more mechanisms of resistance to bacteriophages. These fragments were entirely sequenced. Subsequently, from these sequences of 2256 bp and 3653 bp, the Applicant has isolated two sequences of, respectively, 1527 bp and 1015 bp which alone confer resistance to phages.

The present invention therefore relates to two new nucleic acid sequences comprising at least one phage resistance mechanism, said sequences having respectively 1527 bp and 1015 bp, and being constituted by: a) the DNA sequences having the sequence nucleic acid [SEQ ID NO: 1] or [SEQ ID NO: 2]; b) DNA sequences hybridizing with the above sequences or a fragment thereof; c) the corresponding mRNA and cDNA sequences.

The sequences [SEQ ID N ° 3] and [SEQ ID N ° 4] are the amino acid sequences deduced respectively from the sequences [SEQ ID N ° 1] and [SEQ

ID No. 2]. The 1527 bp fragment can be obtained by the PCR method from the total DNA of the S. thermophilus FT78 strain using the following two oligonucleotides:

Oligonucleotide C [SEQ ID N ° 5]: 5 'GCGGATCCATTATGGTAACATAGACG 3'

Oligonucleotide D [SEQ ID No. 6]: 5 'GCGGATCCGTAATGCTCTTGTAATTTG 3' The 1015 bp fragment can be obtained by the PCR method from the total DNA of the strain S. thermophilus FT80 using the two oligonucleotides shown below. after:

Oligonucleotide E [SEQ ID N ° 7]: 5 'TATAGGATCCAGAAATTCCTTTGATTAG 3'

Oligonucleotide F [SEQ ID No. 8]: 5 'TATAGGATCCTATTTCAGTTGAATGGTG 3'. The present invention relates in particular to DNA sequences comprising at least one mechanism of resistance to phages which have one of the nucleic sequences [SEQ ID No. 1] or [SEQ ID No. 2].

A subject of the invention is also the DNA sequences which have a high degree of homology with the above DNA sequences [SEQ ID No. 1], [SEQ ID No. 2]. A high degree of homology here means a homology (ratio between identical nucleotides and the total number of nucleotides) of at least 70%, and preferably at least 80%, of the nucleotide sequences, when they are aligned with after the maximum homology, according to the method of optimal alignment of the sequences of Needleman and Wunsch, 1970, J. Mol. Biol., Vol. 48, 443-453. This method is used in particular in the UWGCG software from the University of Wisconsin: Devreux et al., Nucl. Ac. Res., Vol. 12, 8711-8721 - GAP option.

The present invention relates in particular to DNA sequences which hybridize with one of the DNA sequences SEQ ID No. 1 or SEQ ID No. 3 or a fragment thereof.

In the present description, the term “hybridizing with” designates a hybridization under strict conditions, that is to say under the following stringency conditions: 42 ° C. in a hybridization buffer (ECL kit Amersham, reference RPN 3000 ) for 12 hours, then 2 washes at 42 ° C for 20 minutes in primary buffer (Urea 6M, 0.4% SDS, 0.5 X SSC) with gentle agitation, then 2 washes for 5 minutes in secondary buffer ( 2X SSC) at 20 ° C.

The subject of the invention is also the plasmids transformed with one of the nucleic acid sequences according to the invention. These plasmids can be for example the plasmids pPFT78-1 and pPFT80-1 in which we have cloned, according to the usual techniques well known to those skilled in the art, respectively the sequences [SEQ ID No. 1] or [SEQ ID No. 2].

The invention also relates to lactic phage-resistant bacteria, preferably belonging to the species Streptococcus thermophilus, which contain at least one nucleic acid sequence or a plasmid as defined above.

This nucleic acid sequence or this plasmid may have been introduced into lactic acid bacteria by conjugation, transformation, transduction, fusion of protoplasts or by any other method of gene transfer well known to those skilled in the art.

The lactic acid bacteria which can advantageously be transformed using the nucleic acid sequences according to the invention or a plasmid containing them are for example the Streptococcus thermophilus strains.

These strains thus transformed can be used to transmit, by conjugation, transformation, transduction, protoplast fusion or by any other method of gene transfer well known to those skilled in the art, a mechanism of resistance to phages to a strain of industrial interest. . This mechanism can be carried by a plasmid or by another part of the genome of the bacteria. When this is carried by a plasmid, it is advantageous to transfer it by conjugation.

The invention also relates to strains of industrial interest resistant to phages thus obtained. The invention will be better understood with the aid of the following examples, which include experimental results and a discussion thereof. Some of these examples relate to experiments with the aim of carrying out the invention, others to examples of carrying out the invention given of course purely by way of illustration. A large part of the set of techniques described in these examples, well known to those skilled in the art, is explained in detail in the work by Sambrook Fritsch and Maniatis: "Molecular Cloning; a Laboratory Manual" published in 1989 by Cold Spring Harbor Press in New York (2 ^nd edition).

Example 1: Obtaining fragments of 2256 bp and 3653 bp.

The Streptococcus thermophilus FT78 and FT80 strains deposited at the

C.N.C.M. respectively March 15, 2000 under number I-2397 and March 10, 2000 under number I-2396 are naturally very resistant to phages.

This is why a DNA bank was built from the genome of these strains.

Plasmid pLDP10 was used. The plasmid pLDP10 is derived from the plasmid pLDP1 (PREVOTS et al., FEMS Microbiol. Lett. (1996), vol. 142, 295- 299) as follows: amplification of the origin of ori pA15 replication by PCR using the oligonucleotides G [SEQ ID No. 9] and H [SEQ ID No. 10] and the erythromycin resistance gene by PCR using to oligonucleotides I [SEQ ID No 11] and J [SEQ ID No 12] using as plasmid the plasmid pLDP These two fragments are then digested with the restriction enzymes Mlu \ and Sc / I, then ligated together by T4 DNA ligase to then transform E. coli TG1 - (GIBSON IJ, Studies on the Epstein-Barr genome, Ph.D thesis, Cambridge University, Cambridge UK, 1984). The resulting plasmid, named pLDP5, was then digested with the restriction enzyme Mlu \ and dephosphorylated. This plasmid was ligated to the DNA fragment containing the origin of ori pVA replication, itself amplified by PCR using the oligonucleotides K [SEQ ID No. 13] and L [SEQ ID No. 14] using as template, the plasmid pLDPl. This ligating product was used to transform the Lactococcus lactis MG1363 strain, giving the plasmid pLDP8. This new plasmid is digested with the restriction enzyme Bcl \ then dephosphorylated. This plasmid was ligated to the DNA fragment containing the lacZ 'gene fragment, itself amplified by PCR using the oligonucleotides M [SEQ ID No. 15] and N [SEQ ID No. 16] using as template pUC19. This new plasmid, named pLDPIO, is capable of replicating in E. coli thanks to ori pA15, in L. lactis and S. thermophilus thanks to ori pVA. Selection can be made in each of these three species thanks to the erythromycin resistance gene (5 μg / ml for L. lactis and S. thermophilus, 200 μg / ml for E. coli). Cloning of DNA fragments can easily be done in the polylinker present in lacZ '. Finally, lacZ 'makes it possible to visualize the presence of cloned DNA fragments. The DNA of strains FT78 and FT80 was extracted and digested completely with the restriction enzyme Hind \\\, then ligated with DNA ligase T4 to the plasmid pLDPIO itself digested by the restriction enzyme Hind \\\, unique site present in lacZ '. The ligating product served to transform E. coli TG1 by selecting with erythromycin. 7200 and 7500 clones were obtained from strains FT78 and FT80, respectively. These clones were mixed for each bank, the plasmid DNA was extracted and used to transform the Streptococcus thermophilus FT56 strain deposited at the CNCM under the number I-2395 on March 10, 2000. This industrial strain was chosen because it can be transformed by electroporation with correct efficiency (of the order of 10 ⁵ transformants per μg of pLDPIO). This strain contains a small plasmid of approximately 2 kb. The transformants were spread on boxes of M17 + erythromycin 5 μg / ml + at the rate of 100 to 200 clones per box and left in the oven at 40 ° C for 48 hours. The M17 medium is described by TERZAGHI et al (1975), in Appl. About. Microbiol., Vol. 29, 807-813. Then these clones were replicated by the velvet replication technique on boxes of M17 + CaCl ₂ 10 mM on which 10 ⁸ phages φFT56 (this phage of group A attacks the strain FT56) were spread per box. By this method, we found, respectively, 1 and 3 clones resistant to phage respectivementFT56 on 1934 and 5737 clones tested. One clone per bank, named FT90 for bank FT78 and FT87 for bank FT80, was tested by phage typing at 42 ° C: each of them showed resistance to phage φFT56 (partial or total):

= approximate titer, given the very small size of the lysis ranges.

Plasmid pLDPI O present in clones FT90 and FT87 contains a fragment of approximately 2.3 kb and 3.6 kb, respectively. These new plasmids were called pPFT78 and pPFT80. The nucleic acid sequence of these fragments was determined by the method of Sanger et al. (PNAS - USA (1977), vol. 14, 5463): their exact size is 2256 bp and 3653 bp, for the plasmids pPFT78 and pPFT80, respectively.

Analysis of the sequence has shown that these fragments of 2256 and 3653 bp have between one and several open reading phases (ORF) of a size greater than 300 base pairs. Example 2: PCR amplification of internal fragments of the fragments of 2256 and 3653 bp of the plasmids pPFT78 and pPF80, respectively.

The oligonucleotides C [SEQ ID No. 5] and D [SEQ ID No. 6] were used to amplify, by the PCR method, a 1527 bp fragment from the plasmid pPFT78.

The oligonucleotides E [SEQ ID No. 7] and F [SEQ ID No. 8] were used to amplify, by the PCR method, a 1015 bp fragment from the plasmid pPFT80. Each of these fragments was cloned using the restriction enzyme

SamHI in pLDPIO, giving respectively the plasmids pPFT78-1 and pPFTδ0-1. In each of the following examples, no difference concerning the phage resistance was observed between the plasmids pPFT7δ and pPFTδO and their derivative pPFT7δ-1 and pPFTδ0-1.

Example 3: Phage resistance conferred by the 1527 bp and 1015 bp fragments in other S. thermophilus strains.

The plasmids pPFT78-1, pPFT80-1 and pLDPIO were introduced by electroporation into different S. thermophilus strains. The phage resistance of the clones obtained was tested by carrying out a titration (UFP / ml) at 42 ° C. with a phage attacking each of these strains. The results are given below:

Taking into account homology groups A and B, we can summarize the results as follows: _

Phage tested

Plasmid Group A Group B tested φFT28 φFT50 φFT56 φFT38 φFT46 φFT52

pPFT7δ-1 + + + +/- +/- +/- pPFTδ0-1 + + +/- + + +

+: total resistance to phages under the conditions of the experiment. +/-: partial resistance to phages under the conditions of the experiment.

The phage resistance carried by the plasmid pPFT7δ-1 works completely with the 3 phages tested from group A and partially with the

3 phages tested from group B. Finally, the phage resistance carried by the plasmid pPFTδ0-1 works completely with each of the phages tested, except with phage φ56 for which the resistance is partial.

Example 4: Study of phage adsorption.

From a night culture of bacteria, place in a tube

Eppendorf:

- 600 μl of bacterial culture;

- 12 μl of CaCl ₂ , 1 M; - 600 μl of phages (at 6 x 10 ⁷ PFU / ml).

It is left in an oven at 42 ° C for 12 minutes, then the adsorption is stopped by immersing the tube in ice. This tube is then centrifuged in an Eppendorf tube microfuge for 2 minutes at + 4 ° C to get rid of the bacteria and phages adsorbed. The supernatant is removed and diluted at + 4 ° C in M17. The number of phages not adsorbed is determined on mats of the FT56 strain.

This test was carried out on the two FT56 strains containing the plasmids pPFT7δ-1 and pPFT80-1 and the strain FT56 (control) with the phage φFT56 (group A):

Initial phage titer = 2.97 x 10 'PFU / ml

No significant difference in phage adsorption was observed between FT56 without phage resistance and FT56 containing each of the two phage resistances.

Phage adsorption is therefore not involved in the resistance mechanisms carried by these strains. Example 5: Study of the restriction and modification.

In all cases where partial phage resistance was observed (FT56 (pPFT78-1) tested with phages φFT3δ, φFT4δ and φFT52 and FT56 (pPFTδ0-1) tested with phage φFT56), the following experiment was carried out :

The phages φFT33, φFT4δ and φFT52 were propagated on the strain FT56 (pPFT78-1) and the phage φFT56 was propagated on the strain FT56 (pPFT80-1). The phage stocks thus formed were tested by phage typing at 42 ° C on the same strains. No difference in phage titer and appearance of lysis plaques was observed between these new phage stocks and the old phage stocks φFT3δ, φFT48, φFT52 and φFT56 propagated on strains FT38, FT4δ, FT52 and FT56, respectively. , and tested on the strain FT56 (pPFT7δ-1) for the phages φFT33, φFT48 and φFT52 and on the strain FT56 (pPFT80-1) for the phage φFT56. The DNA of these phages was not modified by a modification enzyme. The phage resistance conferred by the plasmids pPFT78-1 and pPFT80-1 are not of the restriction and modification type. This result, as well as the size of the lysis ranges and the fact that phage adsorption is not involved in the resistance, makes it possible to conclude that the phage resistances conferred by the plasmids pPFT78-1 and pPFT80-1 are of the abortive type. .

Example 6: Thermosensitivity of the phage resistance mechanisms.

In order to determine the temperature resistance of these phage resistance mechanisms, the following test was performed:

The bacteria to be tested are grown up to an exponential growth phase (D0 ₆ oo = 0.5). Then these bacteria are preheated to the temperature that we want to test for 15 minutes, as are the dishes of M17 agar medium + CaCl ₂ 5 mM. Then a carpet of these bacteria is poured with soft agar M17 containing CaCl ₂ to 5 mM and phage drops at different dilutions are deposited on this carpet. The Petri dish is then immediately brought to the tested temperature, in an appropriate oven.

The table below collates the results obtained for the two strains FT56 containing the plasmids pPFT78-1 and pPFT80-1 and the strain FT56 containing pLDPIO as a control at temperatures of 30 ° C, 37 ° C and 42 ° C.

= approximate titer, given the very small size of the lysis ranges.

It can be seen that at the three temperatures tested, the two phage resistance mechanisms are active. However, at 37 ° C and 42 ° C, it is observed that the phage resistance contained in FT56 (pPFT80-1) is less active than at 30 ° C.

Claims

claims

1 Nucleic acid sequences comprising at least one phage resistance mechanism, characterized in that they consist of: a) DNA sequences presenting the sequences of nucleic acids [SEQ ID No. 1] and [SEQ ID No. 2]; b) The DNA sequences hybridizing with the above sequences or a fragment thereof, c) The corresponding mRNA and cDNA sequences.

2. DNA sequences comprising at least one phage resistance mechanism characterized in that they have the sequences [SEQ ID No. 1] and [SEQ ID No. 2] or sequences having a high degree of homology with said sequences [SEQ ID No. 1] and [SEQ ID No. 2].

3. Plasmid comprising at least one phage resistance mechanism, characterized in that it comprises a nucleic acid sequence according to claim 1.

4. Plasmid comprising at least one phage resistance mechanism, characterized in that it comprises a nucleic acid sequence according to claim 2.

5. Lactic phage-resistant bacterium, characterized in that it contains at least one plasmid according to one of claims 3 or 4.

6 Use of lactic acid bacteria according to claim 5 to confer a mechanism of resistance to phages to strains of industrial interest.