FR2806740A1 - NUCLEIC ACID SEQUENCES INCLUDING AT LEAST ONE PHAGE RESISTANCE MECHANISM, PLASMIDS CONTAINING THEM, LACTIC BACTERIA AND USE - Google Patents

Abstract

The subject of the invention is two nucleic acid sequences comprising at least one mechanism of resistance to phages, characterized in that they consist of: a) DNA sequences exhibiting the sequences of nucleic acids SEQ ID Ndegre1 and SEQ ID Ndegre 2; b) The DNA sequences hybridizing with the above sequences or a fragment thereof; c) The corresponding mRNA and cDNA sequences. Application: bacteria, in particular lactic acid bacteria resistant to phages.

Description

<Desc / Clms Page number 1>

 The subject of the present invention is novel nucleic acid sequences and plasmids capable of hybridizing therewith carrying at least one phage resistance mechanism, the lactic acid bacteria containing these nucleic acid sequences or those plasmids, in particular strains belonging to the species Streptococcus thermophilus, the use of certain strains of these Streptococcus thermophilus for transferring, in particular by conjugation, in particular in the dairy industry, a phage resistance mechanism to strains of industrial interest, and the use of certain strains of Streptococcus thermophilus to obtain these plasmids.

 Lactic acid bacteria are used for the manufacture and preservation of many products consumed on a large scale, such as cheese, yoghurt, butter, sausage or sauerkraut. From a commercial point of view, dairy products have a prominent place. However, the implementation of increasingly important fermentation tanks goes hand in hand with the increased risk of appearance of bacteriophages. These are responsible for fermentation accidents with different consequences such as: modification of the characteristics of the final product, especially in terms of texture, aroma, etc ...; absence of the final product due to too weak acidification; loss of the raw material that is milk. Added to this is the need to decontaminate the tanks and all the areas in contact with the bacteriophages, which causes a blockage of the industrial tool. It is therefore essential that the dairy industry, faced with these problems, find solutions to make lactic acid bacteria more resistant to bacteriophages.

 The bacteriophages capable of attacking S. thermophilus fall into two broad homology groups defined by DNA / DNA hybridization studies and major protein composition according to PREVOTS F. et al (1989), vol. 135, 3337-3344. These two groups include only virulent bacteriophages. One of these groups comprises phages having two major proteins of 23 and 29 kDa (group A), and the other group comprises phages having two major proteins of 23 and 40 kDa (group B). Within the same group, the homologies are strong, and from one group to another, the homologies are weak. However, groups A and B have low but non-zero DNA homology. All these bacteriophages have an isometric nucleocapsid.

<Desc / Clms Page number 2>

 Some authors (see the review on the subject: BRUSSOW et al., Virus Genes (1998) 16,95-109) have demonstrated the presence of temperate bacteriophages. However, these phages belong to the same homology group.

 Several mechanisms of phage resistance have been demonstrated and described by SANDERS M. in Biochemistry 70, (1988), 411-421, and FORDE M. and FITZGERALD GF in Antonie van Leeuwenhoek 76, (1999), 89-113: - interference with the adsorption of bacteriophages; this mechanism makes it possible to inhibit or delay the adsorption of bacteriophages.

- prevention of the injection of the DNA of the bacteriophage; bacteriophage adsorption on the bacterium takes place, but the mechanism prevents the penetration of bacteriophage DNA into the cell.

- restriction and modification; the bacteriophage DNA, once inside the cell, is degraded by a restriction endonuclease coded by the cell.

- abortion infection; according to this last mechanism, a whole series of defenses can prevent the intracellular development of the bacteriophage and the release of bacteriophagic particles, by acting on the replication of the genome, the transcription, the translation, or the assembly of the bacteriophages.

 Several so-called unnatural strategies, using genetic engineering techniques, have been developed to develop phage-resistant lactic acid bacteria described by MOINEAU S. in Antonie van Leeuwenhoek 76, (1999), 377-382 and FORDE M. and FITZGERALD GF in Antonie van Leeuwenhoek 76, (1999), 89-113: - use of a bacteriophage DNA fragment; this strategy makes it possible to inhibit the development of bacteriophages related to the presence of bacteriophage gene products in an altered form, in excess or expressed at the wrong moment in the development of the bacteriophage.

- antisense technique; a phage DNA fragment taken from an ORF (Open Reading Frame) is cloned in an antisense orientation with respect to a strong promoter. The produced RNA hybridizes with the corresponding bacteriophage RNA, inhibiting the development of the bacteriophage.

- suicide system; one or more restriction systems are cloned downstream of an inducible bacteriophage promoter. During bacteriophage infection, the promoter is induced and causes cell lysis.

<Desc / Clms Page number 3>

 Other strategies consist solely in transferring by natural plasmid conferring resistance to bacteriophage; in this regard, the following articles may be cited: SANDERS et al., Applied and Environ. Microbiol. (1986), vo1.52, 1001-1007.

- HARRINGTON, A., and HILL, C., Applied and Environ. Microbiol. (1991), vol.

 57.3405-3409.

- KLAENHAMMER, TR, and FITZGERALD, GF (1994), Genetics and
Biotechnology of Lactic Acid Bacteria, (1994), 106-168, ed. Chapman and Hall,
London.

MURPHY, MC, et al (1988) Applied and Environ. Microbiol., Vol. 54,1951-
1956.

PREVOTS, F. et al (1996) Milk, vol. 76, 417-421.

 All of these studies were done primarily on the species Lactococcus lactis. Concerning the species Streptococcus thermophilus, few mechanisms of resistance to bacteriophages have been demonstrated. Five chromosome-coded restriction and modification systems have been identified but not cloned by MOINEAU, S. (1997) An update. Proc. 34th Marschall Italian and Specialty Cheeses, 9-17, Madison, WI .. Other authors (LARBI, D., et al (1992) J. of Dairy Research, 59, 499-357) suggest that resistance to bacteriophages Abortive type could be present in Streptococcus thermophilus: these resistances would not be of the restriction / modification type or involved in the inhibition of phage adsorption. However, these authors did not attempt to clone any genes responsible for these resistance phenotypes.

 The Applicant has now isolated from strains resistant to bacteriophages Streptococcus thermophilus FT78 and FT80 deposited at the CNCM (National Collection of Cultures of Microorganisms, Institut Pasteur, Paris) respectively on March 15, 2000 under the number 1-2397 and March 10, 2000 No. I-2396, two DNA sequences comprising at least one bacteriophage resistance mechanism; these DNA sequences respectively comprise a functional portion of 2256 base pairs (bp) and 3653 bp.

 These 2256 bp and 3653 bp DNA sequences were isolated from the genomic DNA contained in the FT78 and FT80 strains, respectively.

<Desc / Clms Page number 4>

 Specifically, the 2256 bp and 3653 bp fragments were isolated by total digestion using the HindIII restriction enzyme of the genomic DNA contained in Streptococcus thermophilus strains FT78 and FT80, respectively. These fragments carry one or more bacteriophage resistance mechanisms. These fragments were entirely sequenced.

Subsequently, from these sequences of 2256 bp and 3653 bp, the Applicant has isolated two sequences of 1527 bp and 1015 bp, respectively, which alone confer phage resistance.

 The subject of the present invention is therefore two new nucleic acid sequences comprising at least one phage resistance mechanism, said sequences having 1527 bp and 1015 bp respectively, and being constituted by: a) the sequences of DNA presenting the sequence nucleic acid [SEQ ID N 1] or [SEQ ID N 2]; b) DNA sequences hybridizing with the above sequences or a fragment thereof; c) the corresponding mRNA and cDNA sequences.

 The sequences [SEQ ID No. 3] and [SEQ ID No. 4] are the deduced amino acid sequences, respectively, of the sequences [SEQ ID No. 1] and [SEQ ID No. 2].

The 1527 bp fragment can be obtained by PCR method from the total DNA of S. thermophilus strain FT78 using the following two oligonucleotides: Oligonucleotide C [SEQ ID No. 5]: 5 'GCGGATCCATTATGGTAACATAGACG 3 Oligonucleotide D [SEQ ID NO: 6]: 5 'GCGGATCCGTAATGCTCTTGTAATTTG 3'
The 1015 bp fragment can be obtained by PCR method from the total DNA of S. thermophilus strain FT80 using the following two oligonucleotides: Oligonucleotide E [SEQ ID No. 7]: 5 'TATAGGATCCAGAAATTCCTTTGATTAG 3 Oligonucleotide F [SEQ ID NO: 8]: 5 'TATAGGATCCTATTTCAGTTGAATGGTG 3'.

 The present invention particularly relates to DNA sequences comprising at least one phage resistance mechanism that have one of the nucleic sequences [SEQ ID N 1] or [SEQ ID N 2].

<Desc / Clms Page number 5>

 The subject of the invention is also the DNA sequences which have a high degree of homology with the above DNA sequences [SEQ ID No. 1], [SEQ ID No. 2]. A high degree of homology here means homology (ratio of identical nucleotides to total number of nucleotides) of at least 70%, and preferably at least 80%, of nucleotide sequences, when aligned with each other. after maximal homology, according to the optimal sequence alignment method of Needleman and Wunsch, 1970, J. Mol.

Biol., Vol. 48.443-453. This method is especially used in UWGCG software from the University of Wisconsin: Devreux et al., Nucl. Ac. Res., Vol. 12, 8711-8721 - GAP option.

 The present invention particularly relates to DNA sequences that hybridize with one of SEQ ID N 1 or SEQ ID N 3 DNA sequences or a fragment thereof.

 In the present description, the term "hybridizing with" refers to hybridization under stringent conditions, ie under the following stringency conditions: 42 C in hybridization buffer (Amersham ECL kit, reference RPN 3000) for 12 hours, then 2 washes at 42 ° C. for 20 minutes in primary buffer (6M urea, 0.4% SDS, 0.5 × SSC) with gentle stirring, then 2 washes for 5 minutes in secondary buffer (2 × SSC) ) at 20 C.

 The subject of the invention is also the plasmids transformed with one of the nucleic acid sequences according to the invention. These plasmids may be, for example, the plasmids pPFT78-1 and pPFT80-1 in which the sequences [SEQ ID No. 1] or [SEQ ID No. 2] have been cloned according to the usual techniques well known to those skilled in the art. .

 The invention also relates to lactic acid bacteria resistant to phages, preferably belonging to the species Streptococcus thermophilus, which contain at least one nucleic acid sequence or a plasmid as defined above.

 This nucleic acid sequence or plasmid may have been introduced into lactic acid bacteria by conjugation, transformation, transduction, protoplast fusion or by any other method of gene transfer well known to those skilled in the art.

<Desc / Clms Page number 6>

 The lactic acid bacteria which can advantageously be converted using the nucleic acid sequences according to the invention or a plasmid containing them are, for example Streptococcus thermophilus strains.

 These strains thus transformed can be used to transmit by conjugation, transformation, transduction, protoplast fusion or any other method of gene transfer well known to those skilled in the art, a phage resistance mechanism to a strain of industrial interest. . This mechanism can be carried by a plasmid or by another part of the genome of the bacterium. When this is carried by a plasmid, it is advantageous to transfer it by conjugation.

 The invention also relates to the phage resistant strains of industrial interest thus obtained.

 The invention will be better understood from the following examples, which include experimental results and a discussion of them. Some of these examples relate to experiments for the purpose of carrying out the invention, others examples of embodiments of the invention given of course for purely illustrative purposes.

 Many of the techniques described in these examples, well known to those skilled in the art, are described in detail in the book by Sambrook Fritsch and Maniatis: "Molecular Cloning; a Laboratory Manual" published in 1989 by Cold Spring Harbor Press in New York (2nd edition).

Example 1: Obtaining Fragments of 2256 bp and 3653 bp.

 Strains Streptococcus thermophilus FT78 and FT80 deposited at C. N.C.M. respectively March 15, 2000 under the number I-2397 and March 10, 2000 under the number I-2396 are naturally very resistant to phage.

This is why a DNA library was built from the genome of these strains.

 Plasmid pLDP10 was used. Plasmid pLDP10 is derived from plasmid pLDP1 (PREVOTS et al., FEMS Microbiol Lett (1996), vol 142,295-299) as follows: amplification of the origin of replication ori pA15 by PCR using oligonucleotides G [SEQ ID N 9] and H [SEQ ID N 10] and the gene

<Desc / Clms Page number 7>

 resistance to erythromycin by PCR with oligonucleotides I [SEQ ID No. 11] and J [SEQ ID No. 12] using the plasmid pLDP1 as template. These two fragments are then digested with the restriction enzymes MluI and BclI, then ligated together with T4 DNA ligase and then transformed E. coli TG1- (GIBSON IJ, Studies on the Epstein-Barr genome, Ph.D. D thesis, Cambridge University Cambridge UK, 1984). The resulting plasmid, named pLDP5, was then digested with the MluI restriction enzyme and dephosphorylated.

facilement dans le polylinker présent dans lacZ'. Enfin, lacZ' permet de visualiser la présence de fragments d'ADN clonés. This plasmid was ligated to the DNA fragment containing the origin of replication ori pVA, itself amplified by PCR with oligonucleotides K [SEQ ID N 13] and L [SEQ ID N 14] using as template, the plasmid pLDP1. This ligating product was used to transform the strain Lactococcus lactis MG1363, giving the plasmid pLDP8. This new plasmid is digested with the restriction enzyme BclI and then dephosphorylated. This plasmid was ligated to the DNA fragment containing the lacZ gene fragment, itself amplified by PCR using oligonucleotides M [SEQ ID N 15] and N [SEQ ID N 16] using pUC19 as the template. This new plasmid, called pLDP10, is able to replicate in E. coli by ori pA15, in L. lactis and S. thermophilus thanks to ori pVA. The selection can be done in each of these three species thanks to the erythromycin resistance gene (5 g / ml for L. lactis and S. thermophilus, 200 g / ml for E. colt). Cloning of DNA fragments can be done

easily in the polylinker present in lacZ '. Finally, lacZ 'makes it possible to visualize the presence of cloned DNA fragments.

 The DNA of the FT78 and FT80 strains was extracted and digested completely with the restriction enzyme Hind III and then ligated with the T4 DNA ligase to the plasmid pLDP10 itself digested with the restriction enzyme Hind III, a unique site present in lacZ '. The ligating product was used to transform E. coli TG1 by selecting with erythromycin. 7200 and 7500 clones were obtained from strains FT78 and FT80, respectively. These clones were mixed for each library, the plasmid DNA was extracted and was used to transform the strain Streptococcus thermophilus FT56 deposited at C.N.C.M. under number 1-2395 on March 10, 2000.

 This industrial strain was chosen because it is transformable by electroporation with a correct efficiency (of the order of 105 transformants per g of pLDP10). This strain contains a small plasmid of about 2 kb. The

<Desc / Clms Page number 8>

The transformants were plated on M17 + erythromycin 5 g / ml + plates at a rate of 100-200 clones per dish and left in an oven at 40 ° C. for 48 hours. M17 medium is described by TERZAGHI et al (1975), in Appl. About. Microbiol., Vol. 29.807-813. These clones were then replicated by the velvet replica technique on 10 mM M17 + CaCl2 plates on which 108 # FT56 phages (this group A phage attack the FT56 strain) were plated per dish. By this method, 1 and 3 phage resistant clones # FT56 of 1934 and 5737 clones tested were found, respectively. One clone per bank, named FT90 for the FT78 library and FT87 for the FT80 library, was tested by phage typing at 42 C: each of them shows resistance to phage <j) FT56 (partial or total):

<Tb>
<tb> Strain <SEP> Title <SEP> phage <SEP> with <SEP># FT56 <SEP> and <SEP> size <SEP> of <SEP> ranges
<tb> FT56 <SEP> (pLDP10) <SEP> 1.2 <SEP> x <SEP> 109 <SEP> UFP <SEP> / <SEP> ml, <SEP><SEP> ranges of <SEP> 1, 5 <SEP> mm
<tb> FT90 <SEP> = <SEP> FT56 <SEP> (pPFT78) <SEP><<SEP> 2 <SEP> x <SEP> 102 <SEP> UFP <SEP> / <SEP> ml
<tb> FT87 <SEP> = <SEP> FT56 <SEP> (pPFT80) <SEP> 108 <SEP> UFP <SEP> / <SEP> ml *, <SEP> ranges <SEP> punctiform
<Tb>
* = approximate title, given the very small size of the lysis ranges.

 Plasmid pLDP10 present in clones FT90 and FT87 contains a fragment of about 2.3 kb and 3.6 kb, respectively. These new plasmids were called pPFT78 and pPFT80. The nucleic acid sequence of these fragments was determined by the method of Sanger et al. (PNAS - USA (1977), vol 14,5463): their exact size is 2256 bp and 3653 bp, for plasmids pPFT78 and pPFT80, respectively.

 Sequence analysis showed that these 2256 and 3653 bp fragments have between one and more open reading (ORF) phases larger than 300 base pairs.

Example 2: PCR amplification of internal fragments of the 2256 and 3653 bp fragments of plasmids pPFT78 and pPF80, respectively.

 Oligonucleotides C [SEQ ID No. 5] and D [SEQ ID No. 6] were used to amplify by PCR a fragment of 1527 bp from the plasmid pPFT78.

<Desc / Clms Page number 9>

 Oligonucleotides E [SEQ ID No. 7] and F [SEQ ID No. 8] were used to amplify by PCR a 1015 bp fragment from plasmid pPFT80.

 Each of these fragments was cloned by BamHl restriction enzyme in pLDP10, yielding plasmids pPFT78-1 and pPFT80-1, respectively. In each of the following examples, no differences in phage resistance were observed between plasmids pPFT78 and pPFT80 and their derivative pPFT78-1 and pPFT80-1.

 Example 3: Phage resistance conferred by the 1527 bp and 1015 bp fragments in other S. thermophilus strains.

 Plasmids pPFT78-1, pPFT80-1 and pLDP10 were introduced by electroporation into different S. thermophilus strains. The phage resistance of the clones obtained was tested by performing a titration (UFP / ml) at 42 C with a phage attacking each of these strains.

The results are given below:

<Tb>
<tb> Title <SEP> phage <SEP> with <SEP># FT28 <SEP> and <SEP> appearance <SEP> of <SEP> ranges
<tb> FT28 <SEP> (pPFT78-1) <SEP><<SEP> 2 <SEP> x <SEP> 102 <SEP> UFP <SEP> / <SEP> ml
<tb> FT28 <SEP> (pPFT80-1) <SEP><<SEP> 2 <SEP> x <SEP> 102 <SEP> UFP <SEP> / <SEP> ml
<tb> FT28 <SEP> (pLDP10) <SEP> 2 <SEP> x <SEP> 108 <SEP> UFP / <SEP> ml, <SEP> normal <SEP> ranges
<tb> Title <SEP> phage <SEP> with <SEP> FT38 <SEP> and <SEP> appearance <SEP> of <SEP> ranges
<tb> FT38 <SEP> (pPFT78-1) <SEP> 107 <SEP> UFP / <SEP> ml, <SEP> ranges <SEP> punctiform
<tb> FT38 <SEP> (pPFT80-1) <SEP><<SEP> 2 <SEP> x <SEP> 102 <SEP> UFP <SEP> / <SEP> ml
<tb> FT38 <SEP> (pLDP10) <SEP> 108 <SEP> UFP / <SEP> ml, <SEP> normal <SEP> ranges
<tb> Title <SEP> phage <SEP> with <SEP># FT48 <SEP> and <SEP> appearance <SEP> of <SEP> ranges
<tb> FT48 <SEP> (pPFT78-1) <SEP> 2.6 <SEP> x <SEP> 107 <SEP> UFP <SEP> / <SEP> ml <SEP>
<tb> FT48 <SEP> (pPFT80-1) <SEP><<SEP> 2 <SEP> x <SEP> 102 <SEP> UFP <SEP> / <SEP> ml <SEP>
<tb> FT48 <SEP> (pLDP10) <SEP> 4x107 <SEP> UFP / <SEP> ml, <SEP> normal <SEP> ranges
<Tb>

<Desc / Clms Page number 10>

<Tb>
<tb> Title <SEP> phage <SEP> with <SEP># FT50 <SEP> and <SEP> appearance <SEP> of <SEP> ranges
<tb> FT50 <SEP> (pPFT78-1) <SEP><<SEP> 2 <SEP> x <SEP> 102 <SEP> UFP / <SEP> ml
<tb> FT50 <SEP> (pPFT80-1) <SEP><<SEP> 2 <SEP> x <SEP> 10 <SEP> 2 <SEP> UFP <SEP> / <SEP> ml <SEP>
<tb> FT50 <SEP> (pLDP10) <SEP> 4 <SEP> x <SEP> 108 <SEP> UFP / <SEP> ml, <SEP> normal <SEP> ranges
<tb> Title <SEP> phage <SEP> with <SEP># FT52 <SEP> and <SEP> appearance <SEP> of <SEP> ranges
<tb> FT52 <SEP> (pPFT78-1) <SEP> 4 <SEP> x <SEP> 107 <SEP> UFP / <SEP> ml, <SEP> ranges <SEP> punctiform
<Tb>

FT52 (pPFT80-1) < 2 x 10 UFP / ml FT52(pLDP10)1,5 x 10 UFP / mi, plages normales
En tenant compte des groupes d'homologie A et B, on peut résumer les résultats de la façon suivante :
Phage testé

FT52 (pPFT80-1) <2 x 10 PFU / ml FT52 (pLDP10) 1.5 x 10 PFU / ml, normal ranges
Taking into account homology groups A and B, the results can be summarized as follows:
Phage tested

<Tb>
<tb> Plasmid <SEP> Group <SEP> A <SEP> Group <SEP> B
<Tb>

testé ~~~~~~~~~~~~~ ~~~~~~~~~~~~ ())FT28 ())FT50 zut56 (j)FT38 zut48 FT52

tested ~~~~~~~~~~~~~ ~~~~~~~~~~~~ ()) FT28 ()) FT50 zut56 (j) FT38 zut48 FT52

<Tb>
<tb> pPFT78-1 <SEP> + <SEP> + <SEP> + <SEP> +/- <SEP> +/- <SEP> + / pPFT80-1 <SEP> + <SEP> + <SEP> + / - <SEP> + <SEP> + <SEP> +
<Tb>
+: total resistance to phages in the conditions of the experiment.

+/-: partial resistance to phages under the conditions of the experiment.

 The phage resistance carried by the plasmid pPFT78-1 functions completely with the 3 phage tested group A and partially with the 3 phages tested group B. Finally, the phage resistance carried by the plasmid pPFT80-1 works completely with each of the phages tested, except with phage # 56 for which the resistance is partial.

<Desc / Clms Page number 11>

Example 4: Study of phasia adsorption.

 From a night culture of bacteria, one places in an Eppendorf tube: 600 μl of bacterial culture; - 12 l CaCl2, 1M; 600 μl of phages (at 6 × 10 7 PFU / ml).

 It is left in an oven at 42 ° C. for 12 minutes, then the adsorption is stopped by immersing the tube in the ice. This tube is then centrifuged in an Eppendorf tube microfuge for 2 minutes at +4 ° C to get rid of adsorbed bacteria and phages. The supernatant is removed and diluted to +4 ° C. in M17. The number of unadsorbed phages is determined on mats of strain FT56.

This test was carried out on the two FT56 strains containing the plasmids pPFT78-1 and pPFT80-1 and the strain FT56 (control) with FT56 as phage (group A):

<Tb>
<tb> Strain <SEP> tested <SEP> Adsorption titre <SEP> supernatant <SEP>% <SEP>
<tb> (initial <SEP> title <SEP> of <SEP> phages <SEP> - <SEP> title
<tb> supernatant <SEP> strain <SEP> tested /
<tb> title <SEP> initial <SEP> of <SEP> phages)
<Tb>

FT56 3,45 x 10b UFP / ml 98,8 %

FT56 3.45 x 10b PFU / ml 98.8%

<Tb>
<tb> FT56 <SEP> (pPFT78-1) <SEP> 6.70 <SEP> x <SEP> 105 <SEP> UFP / <SEP> ml <SEP> 97.7 <SEP>% <SEP>
<tb> FT56 <SEP> (pPFT80-1) <SEP> 7.50 <SEP> x <SEP> 105 <SEP> UFP / <SEP> ml <SEP> 97.4 <SEP>% <SEP>
<Tb>
Initial titre of phages = 2.97 x 10 PFU / ml
No significant phage adsorption difference was observed between FT56 without phage resistance and FT56 containing each of the two phage resistances.

Phage adsorption is therefore not involved in the resistance mechanisms carried by these strains.

<Desc / Clms Page number 12>

(pPFT78-1) testée avec les phages FT38, (j)FT48 et <))FT52 et FT56 (pPFT80-1) testée avec le phage FT56), l'expérience suivante a été réalisée : Les phages FT38, (j)FT48 et <))FT52 ont été propagés sur la souche FT56 (pPFT78-1) et le phage #FT56 a été propagé sur la souche FT56 (pPFT80-1). Example 5: Study of the restriction and modification. In all cases where partial resistance to phages has been observed (FT56

(pPFT78-1) tested with FT38 phage, (j) FT48, and <)) FT52 and FT56 (pPFT80-1) tested with FT56 phage), the following experiment was performed: FT38 phages, (j) FT48 and FT52) were propagated on strain FT56 (pPFT78-1) and phage # FT56 was propagated on strain FT56 (pPFT80-1).

stocks de phages FT38, FT48, ())FT52 et (t)FT56 propagés sur les souches FT38, FT48, FT52 et FT56, respectivement, et testés sur la souche FT56 (pPFT78-1) pour les phages FT38, <j)FT48 et <))FT52 et sur la souche FT56 (pPFT80-1) pour le phage #FT56. L'ADN de ces phages n'a pas été modifié par une enzyme de modification. Les résistance aux phages conférées par les plasmides pPFT78-1 et pPFT80-1 ne sont pas de type restriction et modification. The phage stocks thus constituted were tested by phage typing at 42 C on the same strains. No difference in phage titer and lysis range appearance was observed between these new phage stocks and the old ones.

FT38, FT48, ()) FT52 and (t) FT56 phage stocks propagated on the FT38, FT48, FT52 and FT56 strains, respectively, and tested on the FT56 strain (pPFT78-1) for FT38 phages, <j) FT48 and <)) FT52 and strain FT56 (pPFT80-1) for phage # FT56. The DNA of these phages was not modified by a modifying enzyme. The phage resistance conferred by plasmids pPFT78-1 and pPFT80-1 are not of the restriction and modification type.

This result, as well as the size of the lysis plaques and the fact that the phage adsorption is not involved in the resistance, makes it possible to conclude that the phage resistance conferred by the plasmids pPFT78-1 and pPFT80-1 are of the abortive type. .

Example 6: Thermosensitivity of phage resistance mechanisms.

In order to determine the temperature resistance of these phage resistance mechanisms, the following test was performed:
The bacteria to be tested are grown to an exponential growth phase (OD 600 = 0.5). These bacteria are then preheated to the temperature that is to be tested for 15 minutes, as are the boxes of M17 medium agar + 5 mM CaCl 2. Then a carpet of these bacteria is cast with soft agar M17 containing 5 mM CaCl2 and drops of phages at different dilutions are deposited on this carpet. The Petri dish is then immediately put to the tested temperature, in a suitable oven.

 The following table gathers the results obtained for the two FT56 strains containing the plasmids pPFT78-1 and pPFT80-1 and the strain

<Desc / Clms Page number 13>

FT56 containing pLDPIO as a control at temperatures of 30 C, 37 C and 42 C.

<Tb>
<Tb>

Strain <SEP> tested <SEP> Temperature <SEP> Title <SEP> phage <SEP> Size <SEP> and <SEP> aspect
<tb> tested <SEP> of <SEP><SEP> ranges of <SEP> lysis <SEP>
<tb> FT56 <SEP> (pLDP10) <SEP> 30C <SEP> 1.4 <SEP> x <SEP> 109 <SEP> UFP / <SEP> ml <SEP> 1.5 <SEP> mm <SEP > - <SEP> circular
<tb> FT56 <SEP> (pPFT78-1) <SEP> 30C <SEP><<SEP> 10 <SEP> 2 <SEP> UFP <SEP> / <SEP> ml <SEP>
<tb> FT56 <SEP> (pPFT80-1) <SEP> 30C <SEP><<SEP> 10 <SEP> 2 <SEP> UFP <SEP> / <SEP> ml <SEP>
<tb> FT56 <SEP> (pLDP10) <SEP> 37C <SEP> 1.4 <SEP> x <SEP> 109 <SEP> UFP <SEP> / <SEP> ml <SEP> 1.5 <SEP> mm <SEP> - <SEP> circular
<tb> FT56 <SEP> (pPFT78-1) <SEP> 37C <SEP><<SEP> 10 <SEP> 2 <SEP> UFP <SEP> / <SEP> ml <SEP>
<tb> FT56 <SEP> (pPFT80-1) <SEP> 37C <SEP> 108 <SEP> UFP <SEP> / <SEP> ml <SEP><<SEP> 0.25 <SEP> mm
<tb> punctiform
<tb> FT56 <SEP> (pLDP10) <SEP> 42 C <SEP> 2.6 <SEP> x <SEP> 109 <SEP> UFP <SEP> / <SEP> ml <SEP> 1.5 <SEP> mm <SEP> - <SEP> circular
<tb> FT56 <SEP> (pPFT78-1) <SEP> 42C <SEP><<SEP> 10 <SEP> 2 <SEP> UFP <SEP> / <SEP> ml <SEP>
<tb> FT56 <SEP> (pPFT80-1) <SEP> 42C <SEP> 108 <SEP> UFP <SEP> / <SEP> ml <SEP> * <SEP><<SEP> 0.25 <SEP> mm
<tb> punctiform
<Tb>
* = approximate title, given the very small size of the lysis ranges.

 It is found that at the three temperatures tested, the two phage resistance mechanisms are active. However, at 37 ° C. and 42 ° C., it is observed that the resistance to phages contained in FT56 (pPFT80-1) is less active than at 30 ° C.

Claims (6)

 1. Nucleic acid sequences comprising at least one mechanism for phage resistance, characterized in that they consist of: a) The DNA sequences having the nucleic acid sequences [SEQ ID No. 1] and [ SEQ ID N 2]; b) DNA sequences hybridizing with the above sequences or a fragment thereof; c) The corresponding mRNA and cDNA sequences. 2. DNA sequences comprising at least one phage resistance mechanism characterized in that they have the sequences [SEQ ID No. 1] and [SEQ ID No. 2] or sequences having a high degree of homology with said sequences [SEQ ID N 1] and [SEQ ID N 2]. Plasmid comprising at least one phage resistance mechanism, characterized in that it comprises a nucleic acid sequence according to claim 1. 4. Plasmid comprising at least one phage resistance mechanism, characterized in that it comprises a nucleic acid sequence according to claim 2. 5. Lactic acid bacterium resistant to phages, characterized in that it contains at least one plasmid according to one of claims 3 or 4. 6. Use of the lactic acid bacteria according to claim 5 for conferring a phage resistance mechanism on strains of industrial interest.