WO2001070780A1 - A novel polypeptide-human ribosomal sii protein 12 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of human ribosomal SII protein 12 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as cancer, hemopathy, HIV infection, immune diseases and inflammation. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said human ribosomal phosphoprotein 12.

Description

 A new polypeptide-human ribosomal SII protein 12 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology, specifically. The present invention describes a new polypeptide-human ribosomal SII protein 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background

 As a common component of all living cells, the ribosome plays an important role in the cell. It is the site of protein synthesis. Complex and diverse proteins (about 70-90 species) are distributed on the ribosomes of eukaryotes. They are located on their large and small subunits, respectively. The S11 protein is one of them. It is located on the small subunit of the ribosome and plays a very important role in the correct tRNA selection in the initial stage of stem protein synthesis.

 Except for some mitochondrial S11 proteins, the ribosomal protein S11 protein family contains the following more conservative amino acid sequences: [LIVMF] — X— [GSTAC] — [LIVMF] — X (2) — [GSTAL] — X (0, 1 ) — [GSN] ― [LIVMF] —X— [LIVM] —X (4) — [DEN] — X_T— P— X— [PA] —

[STCH] — [DN].

 According to the degree of conservation of amino acid residues, the protein chain of the S11 family can be divided into 4 regions: A, B, C \ D, A and C regions have partially lost their functional constraints during the evolution process; instead, B and D The region remains highly conserved in the proteins of this family, and almost all of the conserved residues are located on these two segments. Even if the amino acid changes, it is replaced by a similar amino acid. Therefore, the B and D regions have an important influence on the structure and function of S11 ^, and the C-terminus is not very important for the function of the entire chain. It is more concerned with the stability of the protein structure.

 The ribosomal S11 protein plays an important role in protein synthesis. During the synthesis process, small ribosomal subunits must be constantly bound to and separated from tRNA, and S11 protein can select the correct tRNA to bind to ribosomes and subunits to avoid mismatches, which is directly related to the organism Passage stability.

 Gene chip analysis found that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, starved L02 cell line, arsenic stimulated L02 for 1 hour In cell lines and prostate tissues, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human ribosomal SII protein 9, so the functions of the two may also be similar. The invention is named human ribosomal SII protein 12.

As mentioned above, the human ribosomal SII protein 12 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes Human ribosomal SII protein 12 protein, especially Kam Determine the amino acid sequence of this protein. New human ribosomal SII protein 12 protein encoding gene also provided a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for disease 1 and therefore the isolation of its coding DNA is a very important disclosure of the invention

 It is an object of the present invention to provide isolated novel polypeptides-human ribosomal SII protein 12 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ribosome SII protein 12:

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human ribosome SII protein 12.

 Another object of the present invention is to provide a method for producing human ribosome S 11 protein 12.

 Another object of the present invention is to provide an antibody against the polypeptide-human ribosomal SII protein 12 of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human ribosomal SII protein 12 of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human ribosome SII protein 12.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having SEQ ID No. 2 amino acid sequence, or a conservative variant, biologically active fragment or derivative thereof, preferably. The The peptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 The polynucleotide sequences of (c) and (a) or (b) have at least 70 »/. Identical polynucleotides.

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 273-605 in SEQ ID NO: 1; and (b) a sequence having 1-1126 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention: a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell: a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention. The invention also relates to a method for screening a compound that mimics, activates, antagonizes or inhibits human nuclear callus SII egg; E: 2 white activity, which comprises using the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human ribosomal SII protein 12 protein in vitro, comprising detecting a mutation in said polypeptide or a polynucleotide sequence encoding the same in a biological sample. Or detecting a biological sample The amount or biological activity of a polypeptide of the invention.

 The present invention also relates to a pharmaceutical composition, which comprises the polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or a bolus preparation, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ribosomal S I I protein 12.

 Other aspects of the present specification are disclosed to the person skilled in the art due to the disclosure of the technology herein. The following terms used in this specification and the claims have the following meanings unless specifically stated:

"Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strands are similar. The term "amino acid sequence" refers to oligopeptide, peptide, polypeptide or protein sequences and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural sequence related to the protein 'molecule. Amino acid.

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having a change in one or more amino acids or nucleosides or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" modifications. The substituted amino acids have similar structural or chemical properties to the original amino acids, such as the replacement of isoleucine variants with leucine, and non-conservative changes, such as tryptophan Acid replaces glycine.

 "Deletion" means a deletion of one or more amino acids or nucleosides in an amino acid sequence or nucleotide sequence,

 "Plug-in" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein with the structural, regulatory, or biochemical function of a natural molecule: Similarly, the term "immunologically active" refers to natural, recombinant, or synthetic proteins and fragments thereof in a suitable manner. Ability to induce specific immune responses and binding to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human ribosomal SII protein 12, can cause the protein to change and thereby regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ribosomal SII protein 12.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human ribosome SII protein 12, can block or regulate the biological or immunological activity of human ribosome SII protein 12. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human ribosomal SII protein 12.

 "Regulation" refers to a change in the function of human ribosome SII protein 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human ribosome SII protein 12.

 "Substantially pure" means substantially free of other proteins, lipids, carbohydrates or other substances naturally associated with it. Those skilled in the art can purify human ribosomal SII protein using standard protein purification techniques. 12. Basically pure Human ribosome SII protein 12 can produce a single main band human ribosome SII protein 12 polypeptide on a non-reducing polyacrylamide gel. The purity of the polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" may be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree and degree of interaction between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity, which can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence of a god that can at least partially inhibit the intersection of a completely complementary sequence with a nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southernt'p trace or Northern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit binding of homologous sequences to target sequences under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALI GN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEG ALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins , DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between the two amino acid sequences "sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence 100 100 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B

 The percent identity of a nucleic acid sequence can also be determined by the Cluster method or by methods known in the art such as Jotim Hein (Hein J., (1990) Methods in erazumology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions. For example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine: glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine

 "Antisense" refers to a nucleotide sequence that interacts with a specific DNA or RNA sequence. "Antisense:" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

 "Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ^ & Fv. It can specifically bind to the epitope of human ribosomal SII protein 12.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen-binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector-or it may be such a polynucleotide or polypeptide that is part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human ribosomal SII protein 12" refers to human ribosomal SII white 12 that is essentially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Technology in the field Humans can use standard protein purification techniques to purify human ribosomal SII protein. 12. A substantially pure peptide can produce a single main band on a non-reducing polyacrylamide gel. The purity of human ribosomal SII protein 12 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human ribosomal SII protein 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human ribosomal SII protein 12: ¾ As used herein, the terms "fragment", "derivative" and "analog" refer to human ribosomes that substantially retain the invention SII protein 12 has the same biological function or activity as a polypeptide. A sheet, derivative, or analog of the polypeptide of the present invention may be: (I) such one. Wherein one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more A amino acid residues is substituted by other groups to include a substituent; or (in) such One, wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol): or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide to form a polypeptide sequence (Such as the leader sequence or secretion sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the sequence of SEQ ID NO: 2 ¾ acid. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1126 bases, and its open reading frames 273-605 encode 110 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human ribosomal SII protein 9, and it can be deduced that the human ribosomal SII protein 12 has similar functions to human ribosomal SII protein 9.

 BE,

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, "degenerate variant" refers to a protein or polypeptide having SEQ ID NO: 2 in the present invention, but is identical to the coding region shown in SEQ ID NO: 1 Differentiated nucleic acid sequences are listed.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: Only the coding s column of the mature polypeptide: the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and any additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to both polynucleotides encoding the polypeptide and polynucleotides including coding and Z or non-coding sequences.

The present invention also relates to a variant of the polynucleotide described above, which encodes a polypeptide having the same amino acid sequence as the present invention, or a fragment, analog, or derivative of a polypeptide. A variant of this polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides. However, it does not change its encoded polypeptide Function ₌

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least 50% between the two sequences. Preferably it has 70% identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides described herein under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at low ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS.60 ° C; or (2) added during hybridization Denaturing agents, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 l icoll. 42 ° C, etc .; (3) only the identity between the two sequences is at least 95%, more Fortunately, hybridization does not occur until 97% or more, and the polypeptide encoded by the hybridizable polynucleotide has the biological function and activity of the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention.-† ¾ The acid fragment "is at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human ribosomal SII protein 12.

 The polypeptide and polynucleotide in the present invention are preferably provided in an isolated form, and are more preferably purified to a homogeneous level: The specific polynucleotide sequence encoding the human ribosome SII protein 12 of the present invention can be applied in a variety of ways. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) table: antibody screening of libraries to detect clones with common structural characteristics Polynucleotide fragment.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolating the double DNA sequence from genomic DNA: 2) Chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct conversion of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. Isolate cDNA of interest The standard method is to isolate niRNA from donor cells that highly express the gene and perform reverse transcription. ¾ into; granules; ¾ phage cDNA library. There are many mature techniques for extracting mRNA. Kits are also available from commercial sources (Qiagene), and constructing cDNA libraries is also a common method (Sambrook, et al.-Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as Uontech's different cDNA libraries. When polymerase reaction technology is used in combination, even very few expression products can be cloned

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) markers: the presence or loss of power; (3): determining the transcript of human ribosomal SII protein 12 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides. Preferably it is at least 30 nucleotides. More preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides. Preferably it is within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized on the basis of the gene sequence of the present invention. The gene itself or the fragment of the present invention can of course be used as a probe. The label of the DNA probe can be a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human ribosomal SII protein 12 gene.

 A method for amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferred for obtaining the gene of the present invention, especially when it is difficult to obtain a full-length cDNA from a library. The RACE method (RACE_cDNA terminal rapid amplification method) is used. The primers for PCR can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by standard methods. Isolation and purification of amplified DNA / RNA fragments by conventional methods such as by gel electrophoresis

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467): Nucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequence must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or directly using a human ribosome SII protein 12 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .

In the present invention, a polynucleotide sequence encoding human ribosomal SII protein 12 may be inserted into a vector. Humans constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacteria well known in the art Plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria: pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it is reconstituted in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ribosomal SII protein 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, leg synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be effectively linked to The appropriate promoter in the expression vector. To guide mRNA synthesis ... Representative examples of these promoters are: E. coli lac or trp promoter; Lambda phage PL, mover; eukaryotic promoter including CMV immediate early Promoters, HSV thymidine kinase promoters, early and late SV40 promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication, etc.

 In addition, the expression vector preferably contains one or more selectable marker genes to enhance the phenotypic traits commonly used to select transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, etc .: Those skilled in the art will know how to choose the appropriate vector / transcription control element (such as promoter, enhancer, etc.) and selectable marker gene.

 In the present invention, a polynucleotide encoding human ribosomal SII protein 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli. Streptomyces: bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transforming a host cell with the DNA sequence of the present invention or a recombinant vector containing the DNA sequence can This is done using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as the large intestine, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with C'aCI i. The steps used are well known in the art. Alternatively, M _g Cl ₂ is used. If necessary, transformation can also be performed by electroporation: When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method. Or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

 The polynucleotide sequences of the present invention can be used to express or produce recombinant human ribosomal SII protein 12 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally, the following steps are taken:

 (1) using the polynucleotide (or variant) encoding human human ribosomal SII protein 12 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide can be coated in the cell, or expressed on the cell membrane, or secreted outside the cell. If necessary, it can be separated and purified by various separation methods using its physical, chemical and other properties. Recombinant protein. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, permeabilis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Brief description of ion exchange chromatography, high performance liquid chromatography (HPLC), and other various liquid layer techniques and these methods in conjunction with the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human ribosomal SII protein 12 and human ribosomal SII protein 9 according to the present invention. The figure is a graph of human ribosomal SII protein 12's expression profile. Expression spectrum chart.

 FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of human ribosomal SII protein 12,

12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention The present invention will be further described in conjunction with specific embodiments. It should be understood that these implementations are not intended to limit the scope of the present invention. The following examples do not indicate the specific conditions of the purchase method, usually according to conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer.

 Example 1: Cloning of human ribosomal SII protein 12

Total RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method. The Quik mRNA Isolation Kit (Qiegene) was used to isolate poly (A) mRNA from total RNA, and 2ug poly (A) mRNA was transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ^ fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5α to form a cDNA library. Dye terminate cycle react ion sequencing kit (Perk in-Elmer) and ABI 377 automatic sequencer (Perkin Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. Comparing the determined c DNA sequence with the existing public DNA sequence database (Genebank), it was found that the c DN A sequence of one of the clones 02 ό 2 d 04 was a new DN A. A series of primers were synthesized to carry out bidirectional determination of the inserted c-c fragment contained in this clone. The results show that the full-length cDNA contained in the 0262d04 clone is 1126b _P (as shown in Seq IDN0: 1), and there is a 332bp open reading frame (0RF) from 273bp to 605bp, which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS-0262d04 and the encoded protein was named human ribosomal SII protein 12. Example 2: Cloning of a gene encoding human ribosomal SII protein 12 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, PCR was performed using the following primers:

 Primer 1: 5'- CAACTGGTAACTCCCGTTGCCAGA-3 '(SEQ ID NO: 3)

 Primer2: 5'- ATTCAGTAAATAATTTAATTCAAC-3 '(SEQ ID NO: 4)

 Priraerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50mmoi / L KC1, 10mmol / L Tris-Cl, (pH8.5), 1.5ramol / L MgCl ₂ , 200 μmol / L dNTP, lOpmol primers in a 50 μ1 reaction volume, 1U of Taq DNA polymerase (product of C 1 on tech). The reaction was performed on a PE 9600 DNA thermal cycler (Perk i n-E 1 mer) for 25 cycles under the conditions listed below: 94 ° C 30sec 55 ° C 30sec; 72 ° C 2min. At the same time, set β-ac tin as a positive control and template blank as a negative control during RT-PCR. Amplification products were purified using QIAGEN kits. Connected with TA cloning kits To the pCR vector (product of Invitrogen). DNA sequence analysis result table The DNA sequence of the PCR product is exactly the same as that of 1 to 1126bp shown in SEQ ID NO: 1. Implementation of Column 3: Northern Indian method analysis of human ribosomal SII protein 12 group expression:

Total RNA was extracted by a one-shot method [Anal. Biochem 1987, 102, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ). Centrifuge after mixing-aspirate the aqueous layer, add octaisopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Wash the obtained RNA precipitate with 70% ethanol, dry and dissolve in water. Using 20 g of RNA, perform electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then transfer to On nitrocellulose membrane. A- ³² P dATP was used to prepare labeled DNA probes by random primers. The DNA probe used was the PCR amplified human ribosome S 11 protein 12 coding region sequence (273b _P to 605bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 C overnight in a solution containing 50 ° / »formyl-25mM κ, ΡΟ , (ρΗ7.4) -5 χ SSC-5 Denhardt's solution and 200 μg / rai salmon sperm DNA. After hybridization, the filter was washed in 1 SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human ribosomal SII protein 12

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer 3: 5'— CATGCTAGCATGCCCCAGGCAATTGATTTGAGA-3 '(Seq ID No:;) Priraer4: 5,-CATGGATCCCTAAAATACACTCCCAAACTTTAA- Γ (Seq ID No: 6) The 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively. Afterwards

And the 3 'end coding sequence, the Nhel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). The pBS-0262d04 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of _P BS-0262d04 plasmid, Primer-3 and Primer-4, and ¹ J was lOpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min. A total of 25 eight cycles. Nhe I and BamH I were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed with colibacillus DH5c by calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / mi), positive colonies were screened by colony PCR method, and sequenced to select the correct positive sequence. clone _(P ET-0262d04) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Novagen Co.). In LB liquid culture medium containing kanamycin (final concentration 30μ _§ / ηιΗ), the host bacteria BL21 (pET-0262d04) was cultured at 37 ° C to the logarithmic growth phase, and the PTG IPTG was finalized to bimoi / L, Continue to cultivate for 5 hours. Centrifuge to collect bacterial cells, ultrasonically break bacteria, and collect the supernatant by centrifugation. Chromatography was performed using His. Bind Quick Cartridge (Novagen) affinity chromatography column capable of binding 6 ^ histidine (6His-Tag) to obtain purified human ribosomal SI I protein 12, After SDS-PAGE electrophoresis, a single band was obtained at 12 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2 ^. Example 5 Production of anti-human ribosomal SII protein 12 antibodies

The following peptides specific for human ribosomal SII protein 12 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-Pro-Gln-Ala-I le-Asp-Leu-Arg-Gln-Tyr-I le-A la-Hi sI le-Tyr- COOH (SEQ ID NO: 7). The peptide was coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avraraeas, et a 1. Immunochemi st ry, 1969; 6: 43, 4 mg of the above hemocyanin polypeptide complex plus complete Freund's Immune immunity. 15 days later, use hemocyanin peptide complex with incomplete adjuvant to boost immunity once. A 15 μg / ml bovine serum albumin peptide complex-coated titer plate was used for EL ISA to determine antibody titers in serum-free serum. Protein A-Sepha r 0 se was used to isolate total IgG from antibody-positive serum. The peptide was bound to cyanogen bromide-activated Se _P harose 4B column II, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human ribosomal SII protein 12. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. The probes can be used to hybridize to the genome or cDNA library of normal tissues or pathological tissues from different sources for identification. Whether it contains a polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathological tissue Whether the expression in the cell is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all based on the same method of immobilizing the polynucleotide sample to be tested on the filter using the same stepwise hybridization. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes, and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of washing steps. This embodiment makes use of higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to enable hybridization The background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The same or complementary oligonucleotide fragment of the polynucleotide SEQ ID NO: 1 is used: In this embodiment, a spot-blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the first type The hybridization between the probe and the sample is the strongest and is retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2. The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further analyzed by computer sequence. This includes the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their The complementary region is compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5- TGCCCCAGGCAATTGATTTGAGACAATATATTGCACACATT -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene sheet f of SEQ ID NO: 1 or its complementary fragment:

 5'- TGCCCCAGGCAATTGATTTGCGACAATATATTGCACACATT -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used manuals of molecular cloning experiments such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

1. Extract DNA from fresh or frozen tissue

 Steps: 1) Put fresh or freshly thawed normal liver tissue on ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (approximately 10 mi / g) with cold homogenization buffer (0.25 moi / L sucrose: 25 mM i / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4'C at full speed with an electric homogenizer until the tissue is completely broken. 5) 1000 g ^ 10 minutes. 6) Resuspend the cell pellet (add 1 to 5 ml per 0.1 g of the initial tissue sample), and then add 1000 g ^ 1 minute. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method.

2, DNA phenol extraction method

Steps: 1) Wash cells with l-10ml cold PBS and centrifuge at 1000g for 10 minutes. 2) solution with cold Cell ¾ resuspend the pelleted cells (1 X 10 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells-4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the aqueous phase to Xinying 8) Equal volume chloroform: Isoamyl alcohol (24: Γ) extraction, and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification of DNA and ethanol precipitation

Steps: 1) Add 180 vol. 2mol / L sodium acetate and 2 vol. Cold 100% ethanol to the DNA solution and mix. Leave at -20 C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or lift out the ethanol and wash it with 500ul of cold ethanol. Centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then suck the T, and invert the paper to make the residual ethanol: ¾L. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA with a small volume of TE or water ^. Simmer at low speed or blow with a dropper while gradually increasing TE, mix until the DNA is fully dissolved, every 1-5 x 10 ° lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

S) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. 37. C. Incubate for 30 minutes 10) Use an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) to extract the reaction solution, centrifuge for 10 minutes 11), remove the aqueous phase by heart, and use an equal volume of chloroform: isoamyl alcohol ( 24: 1) Re-extract, centrifuge for 10 minutes 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix and set-2 (TC 1 hour. 13) with 70% ethanol The precipitate was washed with 100% ethanol, air-dried, and the nucleic acid was resuspended. The process is the same as in steps 3-6. 14) A _{26 was} measured. And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 after packing. C. Preparation of sample film:

1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and lightly mark them with a pencil ' ⁽ Stand-up and sample number, each probe needs two NC cards, so in the next step of buying, do not wash the film with high and strong conditions,

 2) Aspirate ¾ and control 15 microliters each. Spot on the sample membrane, and agitate at room temperature.

 3) Place it in a immersed filter. Imol / LNaOH, 1.5mol / L NaCl filter for 5 minutes (twice). Place it in a filter immersed in 0.5mol / L Tris-HCl (pH7.0)-3mol / L NaCl. 5 minutes on filter paper (twice). Dry

 4) Caught in clean filter paper, wrapped in aluminum foil, vacuum-dried at 00-80 ° C for 2 hours.

 Labeling of probes

1) 5 μ IProbe (0.10D / 10 μ 1), add 2 μ IKinase buffer ¾, 8-10 uCi _y- ^{: j} P-dATP + 2U Kinase. Make up to a final volume of 20 μ 1.

 2) Incubate at 37'C for 2 hours.

 3) P 1/5 volume bromine blue indicator (BPB).

 4) Pass Sephadex G-50 column.

 5) When there is a probe :: The first peak is collected before the first out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

 8) After the collection of the first peak is combined, it is the Probe that needs to be prepared (the second peak is free dATP).

 Pre-hybridization

 Put the sample in a plastic bag and add 3-10mg of pre-hybridization solution (lOxDenhardt-s; 6xSSC. Ϋ. Img / nil

CT DNA (calf thymus DNA). ), After sealing the bag, shake in a 68 C water bath for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal bag G, and shake it at 42 "C in water overnight. Wash the film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (2 times),

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (2 times)-

4) 0.1 x SSC, 0.1% SDS, wash at 55 ° C for 30 minutes (2 times). Dry at room temperature: Low-intensity washing film:

 1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, 37. C wash for 15 minutes (2 times). 3) 0.1xSSC, 0.1% SDS, 37. C wash for 15 minutes (2 times) ...

 4) 0.1xSSC, 0.1% SDS. Wash at 40 ° C for 15 minutes (2 times). Dry at room temperature.-

Χ-τΐ: Self-development:

 -70. X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiment using low-intensity membrane washing conditions has no obvious area for the radioactivity of the above two probe hybrid spots: and the hybridization experiment using high-intensity membrane washing conditions. The radioactive intensity of hybridization spots of probe 1 is significantly stronger than The radioactive intensity of the hybridization spot of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.

Example "DNA Microarray

 The S-chip or DNA Microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases The specific method has been reported in various publications, for example, see the documents DeRisi, JL, Lyer, V. & Brovvn. P.0. (1997) Science 278, 680-686. And the documents Helle, RA, Schema , M .. Chai. A .. Sh lom. D .. (1997) P AS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively, and the concentration of the amplified product was adjusted to about 500ng / ul after purification, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μm. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes; 5. 2 minutes in 95 ° C water:

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

It was extracted with a ho method from human mixed structure with body specific tissue (or via stimulated cell line) total raRNA, and treated with Oligotex mRNA Midi Kit (available from QiaGen Inc.) purified mRNA. The other points ¹ J fluorescence by reverse transcription Cy3dUTP reagent (5-Amino-propargyl-2 -deoxyuridine 5 -tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissues, and the fluorescent reagent Cy5dUTP (5- Amino-propargy BU 2. -deoxyur idine 5--tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamac ia Biotech company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, and prepared probes after purification: refer to specific steps and See:

Schena.

M .. Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-

10619. Schena, M., Shalon, Dari., Davis, R. W. (1995) Science. 270. (20): 467-480. (3) Hybridization

 Combine the probes from the two tissues with the chips in UniHyb ™ Hybridization

Solution (purchased from TeleChem) was used for hybridization for 16 hours, and then washed with a washing solution (1 ^x SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased by General Scanning i>, USA). The image was processed by Imagene software (Biodiscovery Division, USA) to calculate the C'y3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L02 cell line , Arsenic stimulated L02 cell line and prostate tissue for 1 hour. Plot a graph based on these 13 Cy Cy ^ ratios. (figure 1 ) . It can be seen from the figure that the expression profile of human ribosomal SII protein 12 and human ribosomal SII protein 9 according to the present invention are very similar. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases-for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune-free diseases.

Proper translation of proteins requires the cooperation of various aminoacyl-tRNA synthetases, various tRNAs, and ribosomes It is used to complete, in which the ribosome and other cofactors together provide the full cool activity of the translation process. These enzyme activities can only be possessed if the overall structure of the ribosome is complete. Ribosomal protein S 1 1 is one of the proteins in the small subunit of the ribosome. It plays a very important role in the correct t RNA selection in the initial stage of protein synthesis. The S 1 1 protein can select the correct t RNA to make it meet with small ribosomes. Avoiding mismatches is directly related to the stability of the passage of the organism.

 It can be seen here that the abnormal expression of the specific S 11 family protein mo t i f will cause its protein 57 to malfunction, which will cause mistranslation of mRNA and produce related diseases such as tumors, embryonic development disorders, and growth and development disorders.

 It can be seen that the abnormal expression of the human ribosomal S I I protein 12 of the present invention will produce various diseases, which are various tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include, but are not limited to:

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphatic wall, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymal tumor, and cytoplasm !, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer , Colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma

 Embryonic developmental disorders: congenital abortion, cleft palate, facial oblique cleft, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct closure, neural tube defect, congenital cephalic, 21st defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness

 Growth and development disorders: mental retardation, cerebral palsy, brain development disorders. Mental retardation-familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, Alzheimer's disease, congenital keratosis, various metabolic defects such as various basic acid metabolic defects, stunting, dwarfism, sexual retardation

 Various inflammations: allergic reactions, adult respiratory distress syndrome, pulmonary eosinophilia, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, skin-inflammation , Polymyositis, Addison's disease, telangiectasia

 The abnormal expression of the human ribosomal S I I protein 12 of the present invention will also produce certain hereditary, liquid diseases, and immune system diseases.

The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribosomal SII protein 12. Agonist enhances human ribosomal SII protein 12, stimulates cell proliferation, etc. Biological function. Antagonist a stops and treats disorders related to excessive cell proliferation, such as various cancers. Either-can in the presence of drugs, mammalian cells or tritiated preparations expressing human ribosomal SII protein 12 and labeled Human ribosomal SII protein 12 was cultured together. Then measure the ability of the drug to increase or block this interaction

 Antagonists of human ribosomal SII protein 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human ribosome SII protein 12 can bind to human ribosome SII protein 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions:

 In screening compounds as antagonists, human ribosomal SII protein 12 can be added to bioanalytical assays. Whether a compound is an antagonist can be determined by measuring the effect of the compound on the interaction between human ribosome SII protein 12 and its receptor . Receptor deletions and analogues acting as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human ribosomal SII protein 12 are obtained by screening random peptides consisting of various possible combinations of amino acids of IS and solid phases. During screening, generally, human ribosomal SII protein 12 molecules should be processed. mark.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human ribosomal SII protein 12 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries,

 Polyclonal antibodies can be produced by injecting human ribosomal SII protein 12 directly into immunized animals (such as home immunity, mice, mice, etc.). A variety of adjuvants can be used to enhance the immune response. These include, but are not limited to Freund's adjuvants. Techniques for preparing monoclonal antibodies to human ribosomal SII protein 12 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology. Human beta-cell hybridoma technology, EBV- Hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human ribosomal SII protein 12.

 Antibodies against human ribosomal SII protein 12 can be used in immunohistochemical techniques to detect human ribosomal SII protein 12 in biopsy specimens.

 Monoclonal antibodies that bind to human ribosomal SII protein 12 can also be labeled with radioisotopes. Note 8 Location and distribution can be tracked in vivo. This radiolabeled antibody can be used as a non-traumatic enucleation method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. Human ribosomal SII eggs White 12 high-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as white ¾ toxin, ricin,? 1 somatine, etc.). A common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP. The toxin is bound to the antibody through the exchange of diluo bonds. This hybrid can be used to kill ribosome SII protein 12 positive cells. .

 The antibodies in the present invention can be used to treat or prevent human ribosome SII protein 12-related diseases: administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ribosome SII protein 12.

 The invention also relates to diagnostic test methods for quantitative and localized detection of human ribosomal SII protein 12 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human ribosome SII protein 12 detected in the test can be used to explain the importance of human ribosome SII protein 12 in various diseases and to diagnose diseases in which human ribosome SII protein 12 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically 'I' cleaved by physical, chemical or enzyme, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably Spectrum Analysis

 The polynucleotide encoding human ribosomal SII protein 12 can also be used for a variety of therapeutic purposes. Therapeutic techniques can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ribosomal SII protein 12. . Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ribosome SII protein 12 to inhibit endogenous human ribosome SII protein U activity. For example, a mutated human ribosome SII protein 12 It can be shortened human ribosome SII protein 12 lacking the signal transduction energy domain, although it can bind to downstream substrates, but lacks the signal transduction activity † 3 This recombinant gene therapy vector can be used to treat human ribose Diseases caused by abnormal expression or activity of SII protein 12 in the body. Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode human ribosomal SII protein 12 The polynucleotide is transferred into the cell. Methods for constructing a recombinant viral vector carrying a polynucleotide encoding the human ribosomal SII protein 12 can be found in existing literature (Sambrook, et al.). In addition, the recombinant ribosome SII protein 12 ¾ polynucleotide can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or a cell include: Injecting the polynucleotide directly into a tissue in vivo: Or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid). Then the cell Transplanted into the body, etc.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human ribosomal SII protein 12 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation. Antisense RNA, DNA, and ribozymes are available. Any RNA or DNA synthesis technology, such as g-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used. Antisense RNA molecule The DNA sequence is obtained by in vitro or in vivo transcription. This DNA sequence has been integrated downstream of the RNA ¾ synthase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways. ^ Increase the sequence length on both sides. Links between ribonucleosides should use phosphorothioate or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human ribosome SII protein 12 can be used for the diagnosis of diseases related to human ribosome SII protein 12. Polynucleotides encoding human ribosome SII protein 12 can be used to test the expression of human ribosome SII protein 12 or the abnormal expression of human ribosome SII protein 12 under disease conditions _ such as DNA encoding human ribosome SII protein 12 The sequence can be used to hybridize biopsy specimens to determine the expression of new human ribosomal SII protein 12. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, etc. These technical methods are all mature technologies that are publicly available. Related kits are available commercially. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also known as a "gene chip"), and used to analyze gene 5? Heterogeneous expression in tissues and gene diagnosis. . Human ribosomal SII protein 12 specific primers can be used for RNA-polymer release chain reaction (RT-PCR) in vitro amplification to detect human ribosomal SII protein 12 transcription products.

 Detection of mutations in the human ribosome SII protein 12 gene can also be used to diagnose human ribosome SII protein 12-related diseases. Human ribosome SII protein 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribosome SII protein 12 DNA sequence. Available techniques such as Southern blotting, DNA Sequence analysis, PCR and in situ hybridization detect mutations. In addition-mutations may affect protein expression, so Northern blotting and Western blotting are used;

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on chromosome 2 need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, the important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers are then used for PCR screening of somatic hybrid cells containing individual human chromosomes-only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments;

PCR localization method for somatic hybrid cells is a quick way to locate DNA to a specific chromosome. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used. Achieve sub-positioning. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries. Fluorescent in situ hybridization (FISH) of a cDNA clone with a mesochromosome allows precise chromosomal localization in one A: For a review of this technique, see Verma et al. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York ( 1988).

 Once the sequence is located at the exact chromosomal location, where is the sequence physically located on the chromosome? To correlate with gene map data. These data can be found in, for example, V.Mckusick.Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosome 3: domains.

 Next, the cDNA or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is observed in any normal individual-then the mutation may be diseased. Cause. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as visible at the chromosomal level or using PCR based on c DNA sequences. / Bit. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be a H 1 megabase mapping capability among 50 to 500 potentially pathogenic genes And every 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional prompts given by government agencies that manufacture, use, or #:! Pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that manufacture, sell, or sell . In addition, the polypeptide of the present invention can be used in combination with a therapeutic compound.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, subcutaneous, intranasal or intradermal route of administration. Human ribosomal SII protein 12 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human ribosomal SII protein 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician:

Claims

 I. An isolated polypeptide-human ribosomal SII protein 12, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog or derivative of the polypeptide,

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95 amino acid sequences as shown in SEQ ID NO: 2. /. The same.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to the polynucleotide (a); or

 (c) a polynucleotide that is at least 70% identical to (a) or (b):

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of said polynucleotide comprises the sequence of positions 273-605 in SEQ ID NO: 1 or the sequence of positions 1-1126 in SEQ ID NO: 1 .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier,-.

_8. A genetically engineered host cell containing an exogenous polynucleotide, which is characterized in that it is selected from a host cell:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

^9. A method for preparing a polypeptide having human ribosome SII protein 12 activity, characterized in that the method includes:

 (a) culturing the two-way host cell according to claim 8 under the condition of expressing human ribosomal SII protein 12;

 (b) A polypeptide having human ribosomal SII protein 12 activity is isolated from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human ribosomal SII protein 12.

II. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are mimicking, Compounds that antagonize or inhibit the activity of human ribosomal SII protein 12.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human ribosomal SII protein 12 in vitro and in vivo.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes an abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human ribosomal SII protein 12; or for peptides Fingerprint identification.

 16. Use of a nucleic acid molecule according to any one of claims 4 to 6. It is particularly useful as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for a leftover gene Chip or microarray.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11. It is characterized by using said polypeptide, polynucleotide or mimetic, agonist, antagonist Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human ribosomal SII white 12 abnormalities.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing a tumor such as a malignant tumor, Hematopathy. Drugs for HIV infection and immune diseases and various inflammations.