WO2001068807A2 - Identification de sites de liaison d'adn in vivo de proteines de chromatine au moyen d'une enzyme de modification de nucleotide fixee - Google Patents

Identification de sites de liaison d'adn in vivo de proteines de chromatine au moyen d'une enzyme de modification de nucleotide fixee Download PDF

Info

Publication number
WO2001068807A2
WO2001068807A2 PCT/US2001/008590 US0108590W WO0168807A2 WO 2001068807 A2 WO2001068807 A2 WO 2001068807A2 US 0108590 W US0108590 W US 0108590W WO 0168807 A2 WO0168807 A2 WO 0168807A2
Authority
WO
WIPO (PCT)
Prior art keywords
chromatin
dna
protein
loci
nucleotide
Prior art date
Application number
PCT/US2001/008590
Other languages
English (en)
Other versions
WO2001068807A3 (fr
WO2001068807A8 (fr
Inventor
Bas Van Steensel
Steven Henikoff
Original Assignee
Fred Hutchinson Cancer Research Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fred Hutchinson Cancer Research Center filed Critical Fred Hutchinson Cancer Research Center
Priority to US10/221,865 priority Critical patent/US20030212455A1/en
Priority to AU2001249245A priority patent/AU2001249245A1/en
Publication of WO2001068807A2 publication Critical patent/WO2001068807A2/fr
Publication of WO2001068807A8 publication Critical patent/WO2001068807A8/fr
Publication of WO2001068807A3 publication Critical patent/WO2001068807A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites

Definitions

  • Chromatin is the highly complex structure consisting of DNA and hundreds of directly and indirectly associated proteins. Most chromatin proteins exert their regulatory and structural functions by binding to specific chromosomal loci. Knowledge of the nature of the in vivo target loci is essential for the understanding of the functions and mechanisms of action of chromatin proteins. Interactions between protein complexes and DNA are at the heart of essential cellular processes such as transcription, DNA replication, chromosome segregation, and genome maintenance. High-resolution, genome- wide maps of binding sites of these proteins can provide a valuable resource for researchers studying chromosome organization, chromatin structure, and gene regulation, but such comprehensive maps are currently unavailable. Therefore, techniques are needed to identify DNA loci that interact in vivo with specific proteins.
  • Another method employs in vivo targeting of a nuclease to mark binding sites of a specific protein (Lee et al., Proc. Natl. Acad. Sci. USA 95:969-974 (1998)).
  • This method has the disadvantage that the introduction of DNA breaks is likely to cause major changes in chromatin structure and activation of DNA-damage checkpoint pathways.
  • Systemic large-scale mapping of in vivo protein binding sites in higher eukaryotes has not been reported, presumably because of technical difficulties due to the higher genome complexity and the large number of cells required for detection by, for example, immunoprecipitation.
  • the present invention provides methods and compositions for identifying the binding loci of chromatin proteins using a tethered nucleotide modification enzyme.
  • the nucleotide modification enzyme is tethered to the chromatin protein as a fusion protein.
  • the fusion protein can also include a peptide linker sequence between the chromatin protein and the nucleotide modification enzyme.
  • the fusion protein can also comprise a fragment, derivative or analog of the chromatin protein which can bind specifically to the chromatin site recognized by the wild type chromatin protein. Still further the fusion protein can comprise fragments, derivatives or analogs of the nucleotide modification enzyme which retain the enzymatic activity of the native enzyme.
  • a cell or population of cells is transfected with an expression vector which comprises a polynucleotide which encodes a low efficiency promoter operatively associated with a polynucleotide which encodes the chromatin protein and the nucleotide modification enzyme.
  • the vector can further encode a peptide linker operatively associated between the chromatin protein and the nucleotide modification enzyme.
  • the linker sequence is the myc epitope tag.
  • Nucleotide modification enzymes useful in the present invention include adenine methyltransferase, cytosine methyltransferase, thymidine hydroxylase, hydroxymethyluracil ⁇ glucosyl transferase, and adenosine deaminase.
  • a polynucleotide encoding Escherichia coli DNA adenine methyltransferase was used as the tethered nucleotide modification enzyme.
  • the nucleotide modification enzyme can modify nucleotides of the chromatin in the region of the binding site. These modifications of the nucleotides can be detected by various methods including immunochemistry, Southern blot, PCR, and various types of macro- and micro-arrays.
  • the binding loci of the chromatin protein can be identified by determining the location of the detected nucleotide modifications within the chromatin. In a specific embodiment, the loci or the chromatin proteins heterochromatin binding protein 1 , GAGA factor and Drosophila DmSir2-l gene was determined by immunocytochemistry.
  • the methods of the present invention also provide methods for large scale mapping of loci of chromatin proteins.
  • the methods can be used to obtain detailed genome- wide maps of the binding patterns of chromatin proteins in, for example, cell populations grown in culture, tissues, or in cells isolated from an entire multicellular organism.
  • the chromatin profiles can provide information into the functions and mechanisms of action of chromatin proteins on an individual cellular basis, at the tissue level, and the organism level.
  • pairwise comparison of profiles of different chromatin proteins in the same cell type can be used to determine functional interactions (or lack thereof) between these proteins.
  • the profiles can be used to compare the profiles between different organisms or between different states (e.g. i developmental stages) of an organism.
  • the present invention further provides methods for producing a profile of chromatin protein loci for a cell population of interest which method comprises; transfecting the cell population with a plurality of expression vectors capable of expressing a plurality of different chromatin protein-nucleotide modification enzyme fusion proteins, each expression vector comprising a nucleic acid encoding a low efficiency promoter operatively associated with a nucleic acid encoding the different chromatin proteins and a nucleic acid encoding a nucleotide modification enzyme; culturing the transfected cells for a period of time sufficient for expression of and binding of each of the plurality of chromatin protein-nucleotide modification enzyme fusion polypeptides; and detecting the loci for each of the nucleotide modifications within the chromatin of the cell population.
  • the profile of chromatin protein loci for the cell population is determined from the location of the DNA modifications.
  • the present invention also encompasses methods for comparing the profile determined for one chromatin protein to a profile determined for the same chromatin protein, or a different chromatin protein, after the cell population has been treated with an agent. Still further, the present invention encompasses methods for comparing profiles determined for a chromatin protein at, for example, different developmental stages, or for cell populations from different tissues, different organisms, or to compare differences between the binding site profiles between normal and malignant cells.
  • the information provided by use of the methods of the present invention can be used for diagnostic or prognostic methods, for disease or predisposition for disease. Still further, the methods can be used for various other methods for screening for agents which can effect a disease state or modulate the development and differentiation of a cell population.
  • Fig. 1A through Fig. ID depict targeting of Dam to a specific DNA sequence.
  • Fig. 1 A depicts a schematic of Dam and GALDam fusion protein constructs.
  • Fig. IB indicates the position of the probed GATCs at the EP(2)0750 insertion site. The EP element is indicated by the white bar; genomic DNA by a single line. Numbers indicate distances (in base pairs (bp)) from the UAS14 array.
  • Fig. IC provides methylation frequencies of GATCs at indicated distances from the UAS14 array. Numbers above error bars indicate the number of individual flies tested.
  • Fig. 2 provides a schematic of Dam-HPl and Dam-myc fusion protein constructs.
  • Fig. 3 A through Fig. 3C depicts HP- 1 -targeted methylation of specific genomic loci.
  • Fig. 3 A provides an overview of genomic locations of the probes used in the present study.
  • White areas represent euchromatin, black areas heterochromatin; hatched areas are Vietnameseromatic regions that are decorated with HPl in polytene chromosomes 18.
  • Black boxes mark heterochromatic loci, open boxes Vietnamese loci, boxes mark loci of which HPl -association was difficult to predict beforehand (see infra).
  • Fig. 3B demonstrates the methylation frequencies (calculated as % .DpnI-released fragment) of various loci after transfection with Dam-myc (open bars) or Dam-HPl (black bars).
  • 3C provides ratios of methylation in Dam-HPl transfected cells and Dam-myc transfected cells, calculated from the data in Fig. 3B. Shading is the same as the boxes in Fig. 3 A. Bullets indicate ratios that are significantly different (one, p ⁇ 0.05; two, p ⁇ 0.01; three, p ⁇ 0.001 according to the Mann- Whitney U-test) from the pooled ratios of the four heterochromatic loci (black bullets) or the five Vietnamese loci (white bullets). Error bars represent standard deviations. The number of observations is indicated in parentheses.
  • Fig. 4A and Fig. 4B depict mapping of HPl target loci.
  • Fig. 4A demonstrates a chromosomal map of Cy3:Cy5 ratios (representative experiment). Probed loci are indicated by their approximate position on the cytogenetic map. Centromeres are indicated by ovals. The large heterochromatic proximal region of the X chromosome is depicted as a rectangle to the left of the centromere (not to scale). Some genes with relatively high levels of HPl binding are labeled.
  • Fig. 4B depicts dispersed repetitive elements (mostly transposons).
  • Fig. 5 A through Fig. 5C depict the mapping of GAF target loci.
  • Fig. 5 A provides a chromosomal map of Cy3:Cy5 ratios (average of two experiments) using a GAF- Dam fusion protein. Some genes with relatively high levels of GAF binding are labeled.
  • Fig 5B depicts dispersed repetitive elements (mostly transposons).
  • Fig. 5C depicts a box plot showing the relative abundances of GAGAG (SEQ ID NO: 4) and GAGAGAG (SEQ ID NO: 5) sequence elements in probed regions with low (open boxes) and high (filled boxes) levels of GAF binding. Horizontal lines represent the 10th, 25th, 50th (median), 75th and 90th percentiles. p-values are according to the Mann- Whitney U-test.
  • Fig. 6 A and Fig. 6B depict the. mapping of DmSir2-l target loci.
  • Fig. 6A provides a chromosomal map of Cy3:Cy5 ratios (average of two experiments) for chromosomes 2, 3 and 4, and the X chromosome.
  • Fig. 6B depicts dispersed repetitive elements (mostly transposons). Some genes of particular interest or with high levels of DmSir2-l are labeled.
  • polynucleotide and nucleic acid refer to a polymer composed of a multiplicity of nucleotide units (ribonucleotide or deoxyribonucleotide or related structural variants) linked via phosphodiester bonds.
  • a polynucleotide or nucleic acid can be of substantially any length, typically from about six (6) nucleotides to about 10 9 nucleotides or larger.
  • Polynucleotides and nucleic acids include RNA, cDNA, genomic DNA.
  • polynucleotides and nucleic acids of the present invention refer to polynucleotides encoding a chromatin protein, a nucleotide modifying enzyme and/or fusion polypeptides of a cl romatin protein and a nucleotide modifying enzyme, including mRNAs, DNAs, cDNAs, genomic DNA, and polynucleotides encoding fragments, derivatives and analogs thereof.
  • Useful fragments and derivatives include those based on all possible codon choices for the same amino acid, and codon choices based on conservative amino acid substitutions.
  • Useful derivatives further include those having at least 50% or at least 70% polynucleotide sequence identity, and more preferably 80%, still more preferably 90% sequence identity, to a native chromatin binding protein or to a nucleotide modifying enzyme.
  • oligonucleotide refers to a polynucleotide of from about six (6) to about one hundred (100) nucleotides or more in length. Thus, oligonucleotides are a subset of polynucleotides. Oligonucleotides can be synthesized manually, or on an automated oligonucleotide synthesizer (for example, those manufactured by Applied BioSystems (Foster City, CA)) according to specifications provided by the manufacturer or they can be the result of restriction enzyme digestion and fractionation.
  • an automated oligonucleotide synthesizer for example, those manufactured by Applied BioSystems (Foster City, CA)
  • primer refers to a polynucleotide, typically an oligonucleotide, whether occurring naturally, as in an enzyme digest, or whether produced synthetically, which acts as a point of initiation of polynucleotide synthesis when used under conditions in which a primer extension product is synthesized.
  • a primer can be single- stranded or double-stranded.
  • nucleic acid array refers to a regular organization or grouping of nucleic acids of different sequences immobilized on a solid phase support at known locations.
  • the nucleic acid can be an oligonucleotide, a polynucleotide, DNA, or RNA.
  • the solid phase support can be silica, a polymeric material, glass, beads, chips, slides, or a membrane. The methods of the present invention are useful with both macro- and micro-arrays.
  • chromatin refers to a complex of DNA and protein, both in vitro and in vivo. This includes all proteins that are directly contacting DNA, and also proteins that are part of a protein or ribonucleoprotein complex that may be associated with DNA. A chromatin protein may or may not directly contact DNA. Chromatin also includes proteins that are transiently associated with DNA, with DNA-protein, or with DNA- ribonucleoprotein complexes, i.e., only during apart of the cell cycle.
  • Chromatin protein includes, but is not limited to histones, transcriptional factors, centromere proteins, heterochromatin proteins, euchromatin proteins, condensins, cohesins, origin recognition complexes, histone kinases, dephosphorylases, acetyltransferases, deacetylases, methyltransferases, demethylases, and other enzymes that covalently modify histone, DNA repair proteins, proteins involved in DNA replication, proteins involved in transcription, proteins part of dosage compensation complexes and X- chromosome inactivation, proteins that are part of chromatin remodeling complexes, telomeric proteins, and the like.
  • Chromatin protein-enzyme fusion polypeptide refers to a polypeptide encoded by a polynucleotide encoding the chromatin protein operatively associated with a polynucleotide which encodes a nucleotide modification enzyme. Also encompassed within this definition are polynucleotides which encode a functionally active fragment, derivative or analog of the chromatin protein or nucleotide modification enzyme.
  • polypeptide refers to a polymer of amino acids and its equivalent and does not refer to a specific length of the product; thus, peptides, oligopeptides and proteins are included within the definition of a polypeptide.
  • a “fragment” refers to a portion of a polypeptide having typically at least 10 contiguous amino acids, more typically at least 20, still more typically at least 50 contiguous amino acids of the chromatin protein.
  • a “derivative” is a polypeptide which is identical or shares a defined percent identity with the wild-type chromatin protein or nucleotide modification enzyme. The derivative can have conservative amino acid substitutions, as compared with another sequence. Derivatives further include, for example, glycosylations, acetylations, phosphorylations, and the like.
  • polypeptide for example, polypeptides containing one or more analogs of an amino acid (e.g., unnatural amino acids, and the like), polypeptides with substituted linkages as well as other modifications known in the art, both naturally and non-naturally occurring.
  • amino acid e.g., unnatural amino acids, and the like
  • polypeptides with substituted linkages as well as other modifications known in the art, both naturally and non-naturally occurring.
  • polypeptides will be at least about 50% identical to the native chromatin binding protein or nucleotide modification enzyme acid sequence, typically in excess of about 90%, and more typically at least about 95% identical.
  • the polypeptide can also be substantially identical as long as the fragment, derivative or analog displays similar functional activity and specificity as the wild-type chromatin protein or nucleotide modification enzyme.
  • amino acid or “amino acid residue”, as used herein, refer to naturally occurring L amino acids or to D amino acids as described further below.
  • amino acids are commonly used one- and three-letter abbreviations for amino acids (see, e.g., Alberts et al, Molecular Biology of the Cell, Garland Publishing, Inc., New York (3d ed. 1994)).
  • isolated refers to a nucleic acid or polypeptide that has been removed from its natural cellular environment.
  • An isolated nucleic acid is typically at least partially purified from other cellular nucleic acids, polypeptides and other constituents.
  • “Functionally active polypeptide” refers to those fragments, derivatives and analogs displaying the functional activities associated with a full length chromatin protein or nucleotide modifying enzyme (e.g., binding the chromatin protein locus in the case of the fragments, derivatives of the chromatin protein and those fragments, derivatives and analogs of the nucleotide modifying enzyme which are capable of modifying a nucleotide in the case of the nucleotide modification enzyme, and the like).
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms, or by visual inspection.
  • substantially identical in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 60%, typically 80%, most typically 90-95% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms, or by visual inspection.
  • An indication that two polypeptide sequences are "substantially identical” is that one polypeptide is immunologically reactive with antibodies raised against the second polypeptide.
  • Similarity or “percent similarity” in the context of two or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or conservative substitutions thereof, that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms, or by visual inspection.
  • a first amino acid sequence can be considered similar to a second amino acid sequence when the first amino acid sequence is at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or even 95% identical, or conservatively substituted, to the second amino acid sequence when compared to an equal number of amino acids as the number contained in the first sequence, or when compared to an alignment of polypeptides that has been aligned by a computer similarity program known in the art, as discussed below.
  • polypeptide sequences indicates that the polypeptide comprises a sequence with at least 70% sequence identity to a reference sequence, or preferably 80%, or more preferably 85% sequence identity to the reference sequence, or most preferably 90% identity over a comparison window of about 10- 20 amino acid residues.
  • substantially similarity further includes conservative substitutions of amino acids.
  • a polypeptide is substantially similar to a second polypeptide, for example, where the two peptides differ only by one or more conservative substitutions.
  • a “conservative substitution” of a particular amino acid sequence refers to substitution of those amino acids that are not critical for polypeptide activity or substitution of amino acids with other amino acids having similar properties (e.g., acidic, basic, positively or negatively charged, polar or non-polar, and the like) such that the substitution of even critical amino acids does not substantially alter activity.
  • Conservative substitution tables providing functionally similar amino acids are well known in the art.
  • the following six groups each contain amino acids that are conservative substitutions for one another: 1) alanine (A), serine (S), threonine (T); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); and 6) phenylalanine (F), tyrosine (Y), tryptophan (W).
  • A alanine
  • S serine
  • T aspartic acid
  • E glutamic acid
  • Q asparagine
  • arginine R
  • lysine K
  • I isoleucine
  • L leucine
  • M methionine
  • V valine
  • W tryptophan
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm of Smith & Waterman (Adv. Appl. Math.
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show the percent sequence identity. It also plots a tree or dendrogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle (J. Mol. Evol. 25:351-60 (1987), which is incorporated by reference herein). The method used is similar to the method described by Higgins & Sharp (Comput. Appl. Biosci. 5:151-53 (1989), which is incorporated by reference herein). The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids.
  • the multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments.
  • the program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters. For example, a reference sequence can be compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
  • BLAST algorithm Another example of algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described by Altschul et al. (J. Mol. Biol. 215:403-410 (1990), which is incorporated by reference herein). (See also Zhang et al, Nucleic Acid Res. 26:3986-90 (1998); Altschul et al, Nucleic Acid Res. 25:3389-402 (1997), which are incorporated by reference herein). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
  • This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990), supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
  • HSPs high scoring sequence pairs
  • Extension of the word hits in each direction is halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873-77 (1993), which is incorporated by reference herein).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more typically less than about 0.01, and most typically less than about 0.001.
  • a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • transformation is generally applied to microorganisms, while “transfection” is used to describe this process in cells derived from multicellular organisms.
  • other nomenclature used herein and many of the laboratory procedures in cell culture, molecular genetics and nucleic acid chemistry and hybridization, which are described below, are those well known and commonly employed in the art. (See generally Ausubel et al. (1996) supra; Sambrook et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, New York (1989), which are incorporated by reference herein).
  • Standard techniques are used for recombinant nucleic acid methods, polynucleotide synthesis, preparation of biological samples, preparation of cDNA fragments, isolation of mRNA and the like. Generally enzymatic reactions and purification steps are performed according to the manufacturers' specifications.
  • the present invention provides methods and compositions for use in identifying the in vivo target loci of chromatin proteins in a living cell or in populations of living cells including, for example, specific tissues or cell populations isolated from an entire multicellular organism.
  • the methods and compositions comprise the use of the chromatin protein, or chromatin binding proteins, and chromatin binding fragments or derivatives thereof, linked or fused to an enzyme which modifies at least one, and typically more than one, nucleotide in the region associated with the target loci.
  • the modification enzyme is DNA adenine methyl transferase (Dam).
  • Nucleotide sequences which have been modified are identified using, for example, an antibody specific for the modified nucleotide, restriction enzymes specific for particular modified nucleotide sequences, or by DNA micro-array methods.
  • DamID for DNA adenine methyl transferase IDentification
  • Chromatin is a complex of DNA and protein, e.g., in the nucleus of a cell in interphase. Many of these interactions require the presence of chromatin proteins which exert their regulatory and structural functions by binding to, or complexing with other proteins or nucleic acids, with a specific chromosomal loci.
  • the chromatin protein, or a specific binding fragment or derivative thereof is used to direct a nucleotide modification enzyme to the specific loci recognized by the chromatin protein. Any chromatin protein, or protein which recognizes a specific loci or sequence of nucleotides can be used to produce the fusion protein of the present invention.
  • nucleotide sequences encoding Heterochromatin protein 1 (HPl), which binds predominantly to pericentric genes and transposable elements, GAGA factor (GF) which associates with Vietnamese genes that are enriched in (GA) n motifs, and a Drosophila homolog of the yeast Sir2 gene (DmSir2-l) which associates with certain active genes were used to construct exemplary fusion proteins of the invention.
  • a specific binding fragment or derivative of a chromatin protein comprises that portion of the chromatin protein or protein-nucleic acid complex required to recognize and bind the chromosomal loci or region recognized by the native chromatin protein.
  • a specific binding fragment of a Heterochromatin protein 1 (HPl) which binds predominantly to pericentric genes and transposable elements
  • GAGA factor (GF) which associates with Vietnamese genes that are enriched in (GA) n motifs
  • Drosophila homolog of the yeast Sir 2 gene DmSir2-l
  • Fragments, derivatives or analogs of a chromatin protein or protein complex can be tested for the desired activity by procedures known in the art, including but not limited to the functional assays to determine whether the fragment recognizes and binds the target loci or nucleotide sequence recognized by the native full length chromatin binding protein.
  • the affinity or avidity of the binding to the target loci or nucleotide sequence can be the same, less or greater than the affinity or avidity of the native full length protein. It is only necessary that the fragment, derivative or analog recognize and bind the target loci or sequence.
  • the chromatin polypeptide fragment, derivative, or analog can be tested for the desired activity in the fusion protein to ensure localization to the appropriate loci.
  • Polypeptide derivatives include naturally-occurring amino acid sequence variants as well as those altered by substitution, addition or deletion of one or more amino acid residues that provide for functionally active molecules.
  • Polypeptide derivatives include, but are not limited to, those containing as a primary amino acid sequence all or part of the amino acid sequence of a native chromatin polypeptide including altered sequences in which one or more functionally equivalent amino acid residues (e.g. , a conservative substitution) are substituted for residues within the sequence, resulting in a silent change.
  • polypeptides of the present invention include those peptides having one or more consensus amino acid sequences shared by all members of the chromatin protein family members, but not found in other proteins. Database analysis indicates that these consensus sequences are not found in other polypeptides, and therefore this evolutionary conservation reflects the nucleotide target binding-specific function of chromatin polypeptides. Chromatin polypeptide family members, including fragments, derivatives and/or analogs comprising one or more of these consensus sequences, are also within the scope of the invention.
  • a polypeptide consisting of or comprising a fragment of a chromatin polypeptide having at least 5 contiguous amino acids of the chromatin polypeptide which recognize the specific target nucleotide sequence is provided.
  • the fragment consists of at least 20 or 50 contiguous amino acids of the chromatin polypeptide.
  • the fragments are not larger than 35, 100 or even 200 amino acids.
  • Fragments, derivatives or analogs of chromatin polypeptide include, but are not limited to, those molecules comprising regions that are substantially similar to a chromatin polypeptide or fragments thereof (e.g., in various embodiments, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or even 95% identity or similarity over an amino acid sequence of identical size), or when compared to an aligned sequence in which the alignment is done by a computer sequence comparison/alignment program known in the art, as described above, or whose coding nucleic acid is capable of hybridizing to a nucleic acid sequence encoding a chromatin protein, under high stringency, moderate stringency, or low stringency conditions.
  • hybridization conditions will generally be guided by the purpose of the hybridization, the type of hybridization (DNA-DNA or DNA-RNA), and the level of relatedness between the sequences.
  • Methods for hybridization are well established in the literature; See, for example: Sambrook, supra.; Hames and Higgins, eds, Nucleic Acid Hybridization A Practical Approach, IRL Press, Washington DC, (1985); Berger and Kimmel, eds, Methods in Enzymology, Vol.
  • Hybridization stringency can be altered by: adjusting the temperature of hybridization; adjusting the percentage of helix-destabilizing agents, such as formamide, in the hybridization mix; and adjusting the temperature and salt concentration of the wash solutions.
  • the stringency of hybridization is adjusted during the post- hybridization washes by varying the salt concentration and/or the temperature. Stringency of hybridization may be reduced by reducing the percentage of formamide in the hybridization solution or by decreasing the temperature of the wash solution.
  • High stringency conditions involve high temperature hybridization (e.g., 65-68 °C in aqueous solution containing 4 to 6X SSC, or 42 °C in 50% formamide) combined with washes at high temperature (e.g., 5 to 25 °C below the T m ) at a low salt concentration (e.g., 0.1X SSC).
  • Reduced stringency conditions involve lower hybridization temperatures (e.g., 35-42 °C in 20-50% formamide) with washes at intermediate temperature (e.g., 40 to 60°C) and in a higher salt concentration (e.g., 2 to 6X SSC).
  • Moderate stringency conditions involve hybridization at a temperature between 50 °C and 55 °C and washes in 0.1X SSC, 0.1% SDS at between 50 °C and 55 °C.
  • Nucleotide modifying enzymes, fragments, derivatives and analogs thereof useful in the present invention are those which can modify one or more nucleotides in a nucleic acid sequence, such as an RNA, DNA, or the like, under conditions found in a live cell and in a manner which is detectable.
  • the enzyme must also modify the nucleotides in a manner which is not toxic to the cell. In other words, the cell or organism must be able to continue to proliferate and differentiate in a normal manner.
  • an enzyme is selected which modifies the nucleotide in a manner which is not typical of a modification commonly found in the cell being assayed.
  • nucleotide modification enzymes useful in the present invention include, for example, but are not limited to, adenine methyltransferases, cytosine methyltransferases, thymidine hydroxylases, hydroxymethyluracil ⁇ -glucosyl transferases, adenosine deaminases, and the like.
  • a modification of the method of the present invention relies on an endogenous modification enzyme to modify DNA in a cell, the sites of such modifications are then determined by a variety of detection means, including the use of nucleic acid arrays.
  • the DNA modification enzyme, fragment, derivative, or analog thereof is targeted to the loci associated with the binding of the chromatin protein by the chromatin protein, fragment, derivative or analog thereof, as a fusion protein.
  • the polypeptides which comprise the chromatin protein and the DNA modification enzyme are separated from one another by one or more amino acid residues which comprise a linker sequence.
  • the linker can be from about 1 to about 1000 amino acid residues, or more.
  • the linker sequence is from about 3 to about 300 amino acid residues.
  • the amino acid sequence can be from another polypeptide or can be an artificial sequence of amino acid residues, such as, for example, Gly and Ser residues which provide a flexible linear amino acid sequence allowing the amino acid sequences for the chromatin polypeptide and the nucleotide modification enzyme to fold into an active configuration.
  • a linker peptide comprising the myc-epitope tag GluGlnLysIleSerGluGluAspLeu (SEQ LD NO: 1) was inserted between the chromatin polypeptide and the nucleotide modification enzyme DNA adenine methyl transferase.
  • the nucleotide sequence coding for a chromatin polypeptide-nucleotide modification enzyme fusion protein, or a functionally active derivative, analog or fragment thereof, can be inserted into an appropriate expression vector (i.e., a vector which contains the necessary elements for the transcription and translation of the inserted polypeptide- coding sequence).
  • an appropriate expression vector i.e., a vector which contains the necessary elements for the transcription and translation of the inserted polypeptide- coding sequence.
  • the necessary transcriptional and translational signals can also be supplied by a native gene and/or its flanking regions.
  • a variety of vector systems can be utilized to express the polypeptide fusion-coding sequence. The choice of vector will be dependent on the cell to be transfected.
  • the expression elements of vectors vary in their strengths and specificities.
  • any one of a number of suitable transcription and translation elements can be used.
  • fusion proteins of the HPl, GAF and DmSir2-l chromatin proteins fused with the nucleotide modification enzyme, E. coli DNA adenine methyl transferase, genes are expressed, or a nucleic acid sequence encoding a functionally active portion of the fusion proteins are expressed in, for example, Drosophila cells.
  • any of the methods previously described for the insertion of DNA fragments into a vector can be used to construct expression vectors containing a chimeric gene consisting of appropriate transcriptional/translational control signals and the polypeptide coding sequences. These methods include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of a nucleic acid sequence encoding a fusion protein of the present invention or a fragment thereof can be regulated by a second nucleic acid sequence so that the fusion polypeptide or specific binding fragment is expressed in a host transformed with the recombinant DNA molecule. For example, expression of a fusion polypeptide can be controlled by any promoter/enhancer element known in the art.
  • Promoters typically used in the present invention are those which provide low levels of expression of the fusion protein. Low levels of expression of the fusion protein are desired to avoid high background modification of non-targeted sequences. Suitable promoters can be selected empirically for each fusion protein by routine methods well known to the skilled artisan. Promoters suitable for use in the present invention include, but are not limited to, most heat shock promoters, for example, the hsp70 promoter, and various modified promoters, such as a truncated CMV promoter, and the like.
  • the chromatin protein-nucleotide modification enzyme fusion protein when expressed migrates to the loci or binding site recognized by the chromatin protein. Once bound, the nucleotide modification enzyme modifies the appropriate nucleotides within a distance of the loci recognized by the chromatin protein. It is important that the modification of a sufficient number of nucleotide residues to provide a detectable signal is not toxic to the cells, tissues or organism being tested. Therefore, as above, promoters which provide for low levels of expression are used and nucleotide modification enzymes which provide non-toxic nucleotide modifications are used.
  • chromatin protein Several methods are available for the detection of modified nucleotides in the vicinity of the binding loci recognized by the chromatin protein. These include, but are not limited to, immunohistochemistry, Southern blot analysis, PCR analysis and array (i.e., macro- and micro-array) analysis.
  • cells are grown or collected on a solid phase appropriate for microscopy.
  • transformed cells can be cultured on a glass microscope cover slip. The cells are then fixed and washed.
  • An antibody specific for the nucleotide modification carried out by the nucleotide modification enzyme of the fusion protein is added.
  • the antibody can be either polyclonal antisera or a monoclonal antibody.
  • Antibody can be labeled directly or a second labeled antibody can be used to detect the nucleotide modification. Following an incubation period the cells are washed and the antibody is detected providing a location within the nucleus where the chromatin protein complexes within the chromatin. In one particular embodiment the cells are prepared as mitotic spreads by methods well known to the skilled artisan.
  • labels can be employed for detection of the nucleotide modification.
  • the label can be, chemiluminescent, enzyme, fluorophor, or a radioactive moiety, and the like.
  • fluorescent labels such as, fluorescein, phycoerythrin (PE), Cy3, Cy5, Cy7, Texas Red, allophycocyanin (APC), Cy7APC, Cascade
  • Southern blot can be used to map the region of the chromatin where a nucleotide modification has occurred.
  • genomic DNA is isolated from a population of cells transformed with the vector capable of expressing the chromatin binding protein-nucleotide modification enzyme fusion polypeptide by methods well known to the skilled artisan.
  • the population of cells useful in the methods of the present invention can be isolated from cells grown in vitro, isolated from a single tissue, or isolated from a multicellular organism. The isolated DNA is digested with a restriction enzyme specific for the enzyme modification.
  • Dpnl which recognizes the nucleotide sequence G m6 A ⁇ TC
  • DpnII which recognizes the nucleotide sequence GA ⁇ TC
  • Other restriction enzymes and their associated methylases which can be used in the present invention are well known in the art (See, for example, Roberts and Macelis, Nuc. Acids Res. 26:338-350 (1998) incorporated herein by reference).
  • the DNA can be separated by size by any of a number of methods known in the art. Typically, 1.5 % agarose electrophoresis is used. Detection of regions of methylation can be accomplished using labeled probes specific for a particular GATC sequence of a gene of interest.
  • PCR methods can be used to detect region of the chromatin recognized by a chromatin binding protein.
  • This method comprises isolation and extraction of the genomic DNA from a cell sample.
  • the genomic DNA is digested with a restriction enzyme specific for a modified nucleotide sequence and compared to a digest with a restriction enzyme which recognizes the unmodified nucleotide sequence.
  • Primers are selected to hybridize with nucleotide sequences either on each side of a known restriction site or on each side of a restriction site pair and the nucleotide sequence containing the restriction site(s) is amplified in the presence of labeled nucleotide residues. The levels of methylation can then be determined for each site of interest.
  • the methylation of GATC sequences were determined by this method using the HPl -DNA adenine methyl transferase fusion protein for, but not limited to, the histone gene cluster repeat HisC), the 28S gene in the rDNA repeat, the cubitus interruptus (cis) gene and the S-adenosyl decarboxylase gene.
  • HisC histone gene cluster repeat
  • cis cubitus interruptus
  • the methods of the present invention can be used in combination with DNA microarray technology (Pease et al., Proc. Natl. Acad. Sci. USA 91:5022-5026 (1994); Schena et al., Science 270:467-470 (1995)). Genomic regions that contain modified nucleotides are purified, labeled, and used to probe a DNA array. Such an approach allows the identification of target genes of specific proteins at a genome- wide scale.
  • genomic DNA is isolated from cells transfected with an expression vector which can produce a chromatin binding protein-nucleotide modification enzyme fusion protein and, as a control, cell which have not been transfected.
  • the isolated genomic DNA is digested with a restriction enzyme specific for the nucleotide sequence containing the nucleotide modification.
  • the digested DNA is size fractionated and fragments smaller than about 2.5 kb are typically added to a test array.
  • Arrays useful in the present invention include, but are not limited to cDNA, DNA, DNA selected to contain primarily chromatin binding regions or protein binding regions, and the like.
  • Each sample of methylated and control fractionated DNA can be labeled with, for example, a different fluorescent label.
  • the labeled samples are mixed and applied to the array under condition conducive for hybridization using methods well known in the art.
  • the arrays are scanned for the detection of the two labels and the loci recognized by the chromatin protein can be mapped.
  • Additional methods for the purification of methylated DNA regions which can be applied separately or used in various combinations in order to further increase the purity of the isolated methylated regions include the following:
  • Methylated DNA fragments can be affinity purified using antibodies against A.
  • Monoclonal antibody for example, clone P1A8 which specifically recognize methyl- 6-adenine ( 6 A) have been generated using a procedure previously described (Bringmann et al., FEBSLett. 213:309-315 (1987)).
  • the antibody obtained can be used in conjunction with the restriction endonuclease Dpnl to affinity purify methylated DNA fragments.
  • purified genomic DNA is digested with Dpnl, which results into exposure of 6 A at the blunt ends of the digestion products. Antibody was allowed to bind to the exposed A.
  • Antibody-DNA complexes were then isolated using (for example) protein A - sepharose beads (Amersham) pre-coated with rabbit-anti-mouse antibody. After purification, methylated DNA fragments were eluted from the antibody by incubation with 20 mM free methyl-6-adenosine.
  • methylation-specific PCR amplification has been used to isolate methylated DNA fragments.
  • an excess of double-stranded adaptor oligonucleotide (with non-phosphorylated 5' ends to prevent self-ligation of the oligonucleotide) were ligated to the exposed blunt DNA ends using T4 DNA ligase.
  • Dpnl cuts only methylated GATC sequences
  • the adaptor only ligated to methylated DNA ends.
  • the ligated fragments were specifically amplified by PCR using a primer complementary to the adaptor sequence. The specificity of this procedure can be further enhanced using either of two modifications.
  • genomic DNA is treated with a DNA phosphatase such as alkaline phosphatase.
  • a DNA phosphatase such as alkaline phosphatase.
  • the ligated DNA sample can be digested with Dpn l, which cuts only unmethylated GATCs. Any ligation products containing unmethylated GATCs will be destroyed by this treatment; the hemi-methylated ligation junctions were found to be resistant to DpnU.
  • a cDNA library comprising randomly selected ESTs from Drosophila, and a library of 140 cDNA and 20 genomic DNA fragments cloned and selected to be unique were used.
  • PCR amplification products of the selected clones were "spotted" onto a coated solid phase (ploy L-lysine coated glass microscope slides) by methods well known to the skilled artisan.
  • Purified methylated and fractionated DNA from a test sample and a control were labeled with Cy3- or Cy5-DTP by random priming the samples were mixed prior to adding them to the array for hybridization with yeast tRNA and unlabeled Z pnl-digested plasmid DNA encoding the fusion protein.
  • Arrays were scanned using a fluorescent scanner and the data processed to provide a ratio of Cy3:Cy5 binding.
  • Analysis of microarrays using methods of the present invention used cDNA probes. Thus, the analysis focused on transcribed regions. Arrays of genomic fragments systematically covering promoter and enhancer regions can provide detailed insight into the associations of chromatin proteins with cis-acting elements.
  • the disclosed in vivo methods of the present invention demonstrate that methylation by tethered Dam spread over about 2 to about 5 kb from a discrete protein-binding sequence (Example 1), indicating that binding sites can be mapped with a resolution of a few kb. In certain cases, sequence comparison of all identified target loci can reveal common sequence elements that potentially mediate the recruitment of the chromatin protein, thus effectively increasing the mapping resolution.
  • the methods of the present invention provide simple and straight forward methods for large scale mapping of target loci of chromatin proteins yielding highly reproducible results.
  • the amount of data that can be obtained with this approach was primarily limited by the size of the DNA microarray.
  • the method can be used to obtain extremely detailed genome- wide maps of the binding patterns of chromatin proteins, for example in cell populations grown in culture, tissues, or in cells isolated from an entire multicellular organism.
  • Such 'chromatin profiles' can yield unprecedented insights into the functions and mechanisms of action of chromatin proteins on an individual cellular basis, at the tissue level, and the organism level.
  • pairwise comparison of profiles of different chromatin proteins in the same cell type can reveal functional interactions (or lack thereof) between these proteins.
  • the profiles can be used to compare the profiles between different organisms or between different states (e.g. t developmental stages) of an organism.
  • the power of the present approach is illustrated by comparative profiling of HPl and DmSir2-l, which indicated that DmSir2-l was not a heterochromatin protein.
  • Chromatin profiling can become a powerful tool in the analysis of cellular differentiation. It is anticipated that chromatin profiles made available using the methods disclosed herein for many proteins will be unique for specific cell types. Systematic mapping of such profiles can provide fundamental new insights into the mechanisms of cellular differentiation and transformation to a malignant condition.
  • the methods as disclosed herein based on chromatin protein targeting of a nucleotide modification enzyme can be particularly useful in mammalian cells, in which other global mapping approaches based on chromatin immunoprecipitation methods (Blat and Kleckner, Cell 98:249-259 (1999)) may fail due to the high complexity of the genome and insufficient specificity of antibodies.
  • chromatin profiles can be used in studies of cellular pathology.
  • One important application can be in the discovery and prediction of cancer types. Different classes of tumor cells are likely to display distinct chromatin profiles, and these profiles may therefore have high analytic and diagnostic value.
  • the wide variety of chromatin proteins can allow a much more detailed and robust classification of cancer types than expression profiling, which relies on only one data set (i.e., mRNA abundances) per cell type.
  • Methods of the present invention can also be used to provide chromatin profiles of individuals with immune deficiency or auto immune conditions as well as examining chromatin changes in reaction to various drugs and other agents.
  • chromatin binding profiles can be constructed for responses to various disease causing organisms and expression profiles can be constructed for any transcription factor of other regulatory molecule or agent.
  • the described methods can be applied to obtaining a methylation profile.
  • genomic DNA is obtained from a cell, tissue or organism of interest and from a control cell, tissue, or organism of interest.
  • the genomic DNA having been methylated by endogenous methylases, is digested by incubation with a methylation-sensitive restriction endonuclease in the same manner as described for chromatin profiling.
  • Subsequent steps are identical to those used for chromatin profiling described above, with the exception that the comparison made is between two different cell types or genotypes or between a cell, tissue or organism and a control cell, tissue, or organism, respectively.
  • the methylation sensitive endonuclease useful in this embodiment of the present invention can be those that either cut at a methylation site or fail to cut at a particular methylation site.
  • an endonuclease that cuts at a methylation site is used, smaller sized fractions from, for example, sucrose gradient centrifugation or another fractionation procedure contain molecules that are hypermethylated relative to larger sized fractions.
  • the larger sized fractions contain the molecules that are hypermethylated relative to smaller sized fractions.
  • the restriction enzyme Hpall fails to cut -CCGG- sites methylated on the second C, where -CG- sites are naturally methylated in many organisms, including humans. Therefore, genomic regions that are densely methylated will be protected from cleavage relative to genomic regions that are weakly methylated.
  • Cancer cells display characteristic differences in CpG methylation patterns, and thus one application of methylation profiling is to characterize methylation differences between cancer and non- cancer cells for diagnostic purposes, hi this example, genomic DNA from cancer cells that is cleaved with Hpall (or some other methylation-sensitive endonuclease) is labeled with the Cy3 dye, and that from normal cells similarly cleaved with Hpall is labeled with the Cy5 dye (or vice versa).
  • Hpall or some other methylation-sensitive endonuclease
  • the samples are mixed in equal proportions and the mixture is used to probe arrays, e.g., a microarray, displaying human genomic sites.
  • arrays e.g., a microarray
  • methylation profile of the cancer cells By reading out the differential hybridization as evidenced by differential detection of the label, one can compare and contrast the methylation profile of the cancer cells relative to the non-cancer cells. Methylation profiling is thus similar to chromatin profiling, except that no fusion protein is needed and different restriction endonucleases are employed.
  • chromatin protein fusion protein with E. coli DNA adenine methyl transferase linked with Heterochromatin protein 1 was used to identify DNA loci that interact with HPl in D. melanogaster.
  • the Dam open reading frame was amplified by PCR from plasmid YCpGAL-EDAM (Wines et al., Chromosoma 104:332-340 (1996)) and cloned into pCaSpeR-hs followed or preceded by a linker oligonucleotide encoding the yc-epitope tag GluGlnLysIleSerGluGluAspLeu (SEQ ID NO: 1). Resulting in vectors pNDamMyc and pCMycDam, respectively.
  • Vector pNDamMyc carries a stop codon 15 amino acid residues after the yc-tag, and was used to express the Dam-myc protein.
  • a fragment encoding amino acid residues 1-145 of GAL4 was amplified by PCR from plasmid pSPGALl-145 (provided by S. M. Parkhurst, Fred Hutchinson Cancer Research Center, Seattle, WA) and cloned in-frame into vector pCMycDam, resulting in plasmid pGALDam.
  • the full-length ORF of D. melanogaster UP I was amplified by PCR from plasmid pTH5 (Eissenberg et al., Proc. Natl. Acad. Sci. USA 87:9923-9927 (1990), incorporated herein by reference) and cloned in-frame into pNDamMyc, resulting in plasmid pDamHPl.
  • transfected Kc cells were grown on glass coverslips, fixed in methanol/acetic acid (3:1) for 10 minutes, washed in 70% ethanol followed by 2X SSC, denatured in 70% formamide in 2X SSC at 80°C for 10 minutes, washed in phosphate buffered saline, and stained with antibody RI 280 (Bringmann and Luhrmann, FEBSLett. 213:309-315 (1987), incorporated herein by reference) following the same procedure as for proteins. Mitotic spreads were prepared by incubating harvested cells 12 minutes in 1% sodium citrate at room temperature, followed by fixation in methanol/acetic acid. Fixed cells were spread on coverslips, air-dried, and stained as described above, except that denaturation was carried out for 1 minute at 60 °C.
  • Fig. 3D The percentage fragment released was calculated by normalization to an equal amount of .Dpnll-digested DNA from cells transfected with empty vector. The low level of fragment release was attributed, in part, to the low transfection efficiency, which was 10-30 % (estimated by immunofluorescence microscopy). Probes were made by PCR-amplification from Kc genomic DNA (Table 1). A mixture of two end- labeled oligonucleotides (5' to 3') GTTAGCACTGGTAATTAGCTGCTCAAAACAG (SEQ LD NO: 2) and AGGAGGGGGGTCATCAAAATTTGC (SEQ ID NO: 3) was used to probe the 359 bp repeat.
  • samples were diluted 1:10 or 1:100 and assayed by TaqMan quantitative PCR (Li et al., Curr. Opin. Biotechnol. 9:43-48 (1998) on an ABI7700 Sequence Detection System (PE Biosystems, Foster City, CA) according to the manufacturer's recommendations. Fluoro genie oligonucleotides were obtained from
  • Synthegen (Houston, TX). A standard dilution series of genomic DNA from w; EP(2)0750 flies was included in every experiment to allow relative quantitation of each sample. PCR primers were chosen to flank one single GATC.
  • DNA adenine methyl transferase was chosen because endogenous methylation of adenine does not occur in DNA of most eukaryotes. Moreover, Dam is active when expressed in yeast (Gottschling, Proc. Natl Acad. Sci. USA 89:4062-4065 (1992); Singh et al., Genes Dev. 6:186-196 (1992); Kladde et al., Proc. Natl. Acad. Sci. USA 91:1361-1365 (1994)) and Drosophila (Wines et al., Chromosome 104:332-340 (1996)) and has no detectable effects on.
  • yeast Gottschling, Proc. Natl Acad. Sci. USA 89:4062-4065 (1992); Singh et al., Genes Dev. 6:186-196 (1992); Kladde et al., Proc. Natl. Acad. Sci. USA 91:1361-1365 (1994)
  • Drosophila Wang
  • GAL4 DBD DNA-binding domain of GAL4
  • a binding sequence for GAL4 was introduced by crossing GALDaml flies to line EP(2)0750, which carries a P-element with 14 tandem binding sites for GAL4 (UAS 14 ) (Rorth, Proc. Natl Acad. Sci. USA 93 : 12418- 12422 (1996)) inserted into a sequenced region of chromosome 2 (Fig IB).
  • EP(2)0750 was crossed to the fly line Me4, which expresses Dam alone (Wines et al., Chromosoma 104:332-340 (1996)). The progenies of these crosses were used to test whether GAL4 DBD was able to target Dam to GATCs in the vicinity of the UAS 14 array.
  • the methylation frequencies of individual GATC sequences was determined using an assay based on quantitative PCR (Li et al., Curr. Opin. Biotechnol. 9:43-48 (1998)). This sensitive assay allowed for the measurement of methylation levels in single flies.
  • Several GATC sequences at various distances from the UAS 14 array (Fig. IB and Fig. IC) were tested.
  • the methylation levels of two remote loci was first measured.
  • GATC sequences were chosen in the pericentric Bari-1 element (Caizzi et al., Genetics 133:335-345 (1993)), which is located more than 10 Mb away, and in the blastopia element, which was present in 10-20 copies scattered throughout the genome (Frommer et al., Chromosoma 103:82-89 (1994)).
  • the methylation ratio (GalDaml/Me4) were about 0.2-0.3 (Fig. IC and Fig. ID).
  • HP 1 Heterochromatin Protein 1
  • a myc-epitope tagged Dam-HPl fusion protein construct driven by a heat-shock promoter (Fig. 2) was transfected into Drosophila Kc cells, and the resulting methylation patterns were mapped.
  • myc-tagged Dam (Dam-myc) was expressed.
  • the Dam-HPl fusion protein (detected with an antibody against the myc epitope) showed a subnuclear distribution pattern that strongly resembled that of endogenous HPl. Both the large compartment, closely associated with the DAPI-bright regions, and a few small dots scattered throughout the nucleus were observed. This indicated that the fusion protein was correctly targeted to natural HPl binding sites. In contrast, after heat-shock induction the Dam-myc protein showed a very weak staining throughout the cell, with no indication of subnuclear targeting. In the absence of heat shock induction the Dam-HPl or Dam-myc proteins were not detectable by immunofluorescence, indicating very low expression levels under those conditions.
  • Targeted methylation was tested to determine if it could be exploited to identify genomic loci that are associated with HPl .
  • Quantitative Southern blot assay (Boivin et al., Genetics 150:1539-1549 (1998), incorporated herein by reference) was used to determine the methylation level of pairs of GATCs in individual loci. Initially, methylation levels were quantitated in four known heterochromatic and five known Vietnamese regions (Fig. 3A and Fig. 3B). After transfection with Dam-HPl, Vietnamese loci showed similar levels of methylation as after Dam-myc transfection (76 ⁇ 23% of Dam-myc values). This indicated that the methyltransferase activity of Dam-HPl was comparable to that of Dam-myc.
  • heterochromatic loci displayed much higher methylation levels in cells transfected with Dam-HPl than in cells transfected with Dam-myc.
  • Direct comparison of methylation levels of each locus by Dam-HPl and Dam-myc (by calculating the ratio Dam-HPl methylation/Dam-myc methylation; Fig. 3C), showed a clear and consistent distinction between eu- and heterochromatic loci.
  • Dam-HPl/Dam-myc methylation ratios were approximately 10-fold higher in heterochromatic regions compared to euchromatin regions (p ⁇ 0.0001, Mann- Whitney U-test).
  • methylation by Dam-HPl was dete ⁇ nined to be a good criterion for the identification of genomic loci that are associated with HPl in vivo.
  • HisC histone gene cluster repeat
  • the rDNA repeat has been mapped to the heterochromatic part of the X chromosome (Hilliker et al., Cell 21:607-619 (1980)), yet during interphase it is packaged inside the transcriptionally active nucleolus (Scheer et al., Opin. Cell. Biol. 11 :385-390 (1999)).
  • both loci displayed Dam- HP 1/Dam methylation ratios that were intermediate between euchromatin and heterocl romatin (Fig. 3C). Since both loci are tandem repeats, it is possible that only a fraction of the repeats was associated with HPl. Alternatively, the association of HPl with these loci may be cell cycle regulated. A similar level of Dam-HPl targeted methylation was observed for sequence tag STS Dm0328, which is located in the banded region proximal to HisC. Possibly, HPl 'spreads' from pericentric heterochromatin into the flanking euchromatin to include HisC.
  • ci cubitus interruptus
  • S-adenosyl decarboxylase S-adenosyl decarboxylase genes. These genes are located in the banded part of chromosome 4 and in region 31 on chromosome 2, respectively. Both regions are decorated by antibodies against HPl (James et al., Eur. J. Cell. Biol. 50:170-180 (1989)). ci showed levels of HPl -targeted methylation that were lower than in heterochromatic loci, but significantly higher than in euchromatic loci (Fig. 3B and Fig. 3C), indicating that HPl is associated with this gene. In contrast, SamDC showed low levels of targeted methylation, suggesting that this gene was not abundantly associated with HPl. A detailed map of HPl associations can be obtained in the future by systematic analysis of a large number of sequences throughout the genome.
  • DamLO can be used to identify sequences that interact in vivo with specific proteins.
  • Targeting of Dam leads to up to an approximately 10-fold enrichment of methylation in the vicinity of binding sites of the Dam fusion partner, which is sufficient for positive identification of most target sequences, and for detecting quantitative differences in protein-target interactions.
  • the 'background' methylation throughout the genome by Dam fusion proteins was attributed to the intrinsic DNA binding activity of Dam, which would compete with the sequence- or locus-specific interactions of its fusion partner.
  • chromatin proteins are rather promiscuous in their interactions in vivo.
  • DamID has a number of important advantages over other current methods for identification of target sequences. First, DamLD detects protein-DNA interactions as they occur in living cells.
  • DamID works best when the Dam fusion protein was expressed at very low levels, making it unlikely that the fusion protein itself interfered with the functions of the endogenous protein or its targets.
  • DamID can be used both in cell cultures and in whole organisms. Since endogenous methylation of adenine is not detectable in DNA from most eulcaryotes, this technique should be widely applicable. Preliminary results indicate that Dam is active, yet has no obvious toxic effects, when expressed in HeLa cells.
  • the present example provides large-scale mapping of in vivo binding sites of chromatin proteins, using a combination of targeted DNA modification and microarray detection.
  • Three distinct chromatin proteins in Drosophila Kc cells were mapped and each were found to associate with specific sets of genes.
  • HPl was found, as above, binds predominantly to pericentric genes and transposable elements, GAGA factor associates with eucliromatic genes that are enriched in (GA) n motifs.
  • GA a Drosophila homolog of yeast Sir2 was found to associate with several active genes and was excluded from heterochromatin.
  • the materials and methods used for microarray detection of modified DNA regions peripheral to the binding loci of the DNA binding protein were as follows.
  • Plasmids Vectors for expression of myc-tagged Dam and Dam-HP 1 were described above.
  • a cDNA encoding full-length DmSir2-l (GenBank accession AF068758) was obtained by PCR amplification from a Drosophila ovary cDNA library and cloned into pCMycDam as above, resulting in plasmid pSir2 ⁇ -MDam.
  • Sequencing of the cloned PCR product revealed that six nucleotides encoding Phe 289 and Gln 290 were missing. The same polymorphisms were also present in a genomic sequence (Genbank AE003639).
  • Full length GAF (the 519 amino acid isoform (Benyajati et al., Nucleic Acids Res. 25:3345-3353 (1997), incorporated herein by reference) was amplified from plasmid pAR-GAGA (Soeller et al, Mol Cell. Biol. 13:7961-7970 (1993)) and cloned either into pCMycDam (resulting in pGAF-MDam) or pNDamMyc (resulting in pDamM-GAF).
  • Drosophila Kc cells were grown and transfected as described by Henikoff et al. (Proc. Natl. Acad. Sci. USA 97:716-721 (2000), incorporated herein by reference). Expression of the Dam proteins was driven by the low constitutive activity of the uninduced hsp70 promoter, ensuring very low expression levels. After 24 hours, genomic DNA was isolated as described by de Lange et al. (Mol. Cell. Biol. 10:518- 827 (1990), incorporated herein by reference), except that an RNase incubation was included before the second proteinase K treatment.
  • this procedure yielded 20 to 50 ⁇ g methylated DNA.
  • Genomic DNA from control cells transfected without plasmid was processed in parallel and generally gave a 5 to 10 fold lower yield of ⁇ 2.5 kb fragments, indicating that the methylated DNA was about 80 to 90 % pure.
  • An estimated 20 to 50 % of the methylated DNA consisted of plasmid DNA that was taken up by the cells during transfection. This plasmid DNA does not interfere with the subsequent labeling and hybridization procedure.
  • Microarrays and hybridizations Microarray construction and hybridization protocols were modified and optimized from those described elsewhere (DeRisi et al., Science 278:680-686 (1997), incorporated herein by reference). Briefly, Drosophila microarrays were constructed employing a set of 192 cDNAs randomly selected from the LD and CK EST libraries (Berkeley Drosophila Genome Project) (Rubin et al., Science 287:2222-2224 (2000); Kopczynski et al., Proc. Natl. Acad. Sci. USA 95:9973-9978 (1998)) (Research Genetics, Huntsville, AL), together with about 140 cDNA and about 20 genomic DNA fragments provided by members of the Northwest Fly Consortium.
  • PCR products were purified using Arraylt 96-well PCR purification kits (TeleChem International, Sunnyvale, CA) and mechanically "spotted” in 3X SSC (450 mM NaCl and 45 mM sodium citrate, pH 7.0) onto poly-lysine coated microscope slides using an OmniG rid high- precision robotic gridder (GeneMachines, San Carlo, CA).
  • Hybridization was performed at 63 °C for 16 hours followed by sequential washings in IX SSC, 0.03% SDS, IX SSC, 0.2X SSC, and 0.05X SSC. Washed arrays were spun dry in a centrifuge and immediately scanned using a GenePix 4000 fluorescent scanner (Axon Instruments, Inc., Foster City, CA).
  • Cy3:Cy5 ratios were normalized using Drosophila total genomic DNA (spotted 16 times on each microarray slide) as an internal standard. Thus, a Cy3:Cy5 value of 1 represents the average level of binding of the chromatin protein along the entire genome.
  • GAGAG SEQ ID NO: 4
  • GAGAGAG SEQ ID NO: 5
  • sequences were counted in both orientations; partially overlapping elements were counted separately (e.g., the sequence TGAGAGAGC (SEQ ID NO: 6) contains two GAGAG (SEQ ID NO: 4) and one GAGAGAG (SEQ ID NO: 5) element).
  • Drosophila Kc cells were transfected either with a Dam fusion protein or with Dam only. The latter served as a reference to normalize for local differences in chromatin accessibility to methylation by Dam. Twenty-four hours after transfection, genomic DNA was isolated and methylated regions were purified. Purified methylated DNA samples from experimental and control cells were labeled with the fluorochromes Cy3 and Cy5, respectively, mixed, and co-hybridized to microarrays of approximately 300 Drosophila cDNAs, most of which were randomly chosen from two different embryonic cDNA libraries. Target sequences of the chromatin proteins of interest were identified based on the Cy3:Cy5 fluorescence ratio, which indicated the relative targeted methylation level of each probed sequence.
  • Heterochromatin Protein 1 was selected to test the mapping technique of the present invention because of its unique chromosomal distribution. Immunocytochemistry of polytene chromosomes has indicated that HPl is predominantly associated with pericentric heterochromatin, and additionally with chromosome ends and several bands scattered throughout the euchromatic arms (James et al., Eur. J. Cell Biol. 50:170-180 (1989); Fanti et al., Mol. Cell 2:527-538 (1998)). HPl is thought to be recruited to its target loci by other chromatin proteins (Platero et al., EMBO J.
  • a scatter diagram of the hybridization signals measured for Cy3 (Dam-HPl) vs Cy5 (Dam) showed that the majority of cDNAs display an almost identical Cy3:Cy5 ratio (i.e., were located on a single diagonal in the scatter diagram), indicating no detectable association of the corresponding genes with HPl.
  • a distinct set of cDNAs demonstrated a clear offset from this diagonal towards higher Cy3:Cy5 ratios.
  • These cDNAs must represent target loci of HPl.
  • the absence of data points with lower Cy3:Cy5 ratios demonstrated that tethering of Dam to HPl caused an increase in methylation of HPl target loci, but not a decrease in methylation levels of non-target loci.
  • the probed loci are represented in Fig. 4A on the standard polytene chromosome map, showing their relative HPl binding (i.e., Cy3:Cy5 ratios).
  • Most loci display a constant Cy3:Cy5 ratio (approximately 0.5-0.6), which was interpreted as non- targeted 'background' methylation.
  • several loci demonstrated a considerably higher ratio, implying HPl binding.
  • the cutoff between 'target' and 'non-target' Cy3:Cy5 ratios was arbitrary, it is important to note that the differences in Cy3:Cy5 ratios between probed loci were highly reproducible. Pair- wise comparisons of three independent experiments showed correlation coefficients between 0.95 and 0.99.
  • HPl was found to bind to a wide variety of transposable elements. Of 12 different transposons present on the microarray, 11 showed moderate to strong association with HPl (Fig. 4A). HPl binding was consistent with the enrichment of most transposable elements in pericentric heterochromatin (Charlesworth et al, Genet. Res. 64:183-197 (1994); Pimpinelli et al, Proc. Natl Acad. Sci. USA 92:3804-3808 (1995); Carmena et al., Chromosoma 103:676-684 (1995)). The 412 element demonstrated no detectable HPl association.
  • Target loci of GAF Similar assays were performed with GAF as the targeting protein to investigate the general applicability of the mapping technique of the present invention.
  • GAF is different from HPl in many ways. For example, GAF binds directly to GA-rich DNA sequences, and has been implicated in the regulation of several Drosophila genes (Wilkins et al, Nuc. Acids Res. 25:3963-3968 (1997); Granok et al, Curr. Biol. 5, 238-241 (1995)).
  • GAF target loci were mapped using a fusion protein (GAF-Dam) comprising Dam linked to the C-terminus of full-length GAF.
  • GAF-Dam a fusion protein
  • identical assays were carried out with Dam fused to the N-terminus of GAF. Again, results were reproducible, with r in pairwise comparisons of three experiments ranging from 0.81-0.93.
  • GAF Genes that appear to strongly bind GAF have no common function or expression pattern. Because in vitro binding assays and in vivo cross-linking studies have shown that GAF binds GA-rich regulatory elements (Biggin et al., Cell 53:699-711(1988); Soeller et al, Mol. Cell Biol. 13:7961-7970 (1993); Strutt et al., EMBO J. 16:3621-3632 (1997); O'Brien et al, Genes Dev. 9: 1098-1110(1995)), the GAF target loci identified by the mapping were investigated to determine whether they were enriched in such elements.
  • loci that display moderate to strong GAF binding have significantly higher average densities of GAGAG (SEQ ID NO: 4) and GAGAGAG (SEQ ID NO: 5) sequences than loci with low GAF binding (Fig. 5B) providing strong evidence that bona fide target loci of GAF were identified.
  • Target loci of DmSir2-l were mapped by the methods of the present invention.
  • Sir2 plays a role in silencing of genes in the silent mating-type loci, telomeric regions, and the rDNA locus (Guarente, Genes Dev. 14:1021-1026 (2000); Schmberg, Curr. Opin. Microbiol. 3:132-137 (2000*'.
  • five Sir2-like proteins have been predicted by sequence analysis (Frye, Biochem. Biophys. Res. Commun. 273:793-798 (2000)).
  • the Sir2-like protein that was found to be most closely related to S. cervisiae Sir2 was chosen.
  • the selected protein has been referred to herein as DmSir2-l .
  • the homology to yeast Sir2 suggested that DmSir2-l might be associated with heterochromatin in Drosophila, but no experimental studies of DmSir2-l have been reported.
  • DmSir2-l-Dam fusion protein Mapping results obtained with a DmSir2-l-Dam fusion protein are shown in Fig. 6.
  • DmSir2-l binding loci were several euchromatic, constitutively expressed genes such as genes encoding translation factors, putative ribosomal proteins, -tubulin, hsc4 and ELP40. This suggests that DmSir2- 1 binds to active genes, unlike yeast Sir2.
  • the binding of DmSir2-l to active genes was not simply due to the 'open' chromatin conformation of these genes, because the binding data were corrected for local differences in accessibility.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne une nouvelle technique, appelée DamID, destinée à l'identification de locus d'ADN qui interagissent in vivo avec des protéines nucléaires spécifiques dans des eucaryotes. Une enzyme de modification d'ADN, et notamment une méthyltransférase intervenant sur l'adénine de l'ADN d'E. coli (Dam), est fixée à une protéine de chromatine. Cette enzyme de modification d'ADN (Dam) peut être ciblée in vivo vers les locus de liaison natifs de la protéine, d'où une modification locale d'ADN. Les sites de modification d'ADN peuvent ensuite être cartographiés au moyen d'enzymes de restriction spécifiques aux modifications, d'anticorps ou de méthodes utilisant des réseaux d'ADN. Cette technique d'identification de modification d'ADN (DamID) permet de cartographier, à l'échelle du génome, des sites de liaison cibles in vivo de protéines de chromatine dans de nombreux eucaryotes.
PCT/US2001/008590 2000-03-16 2001-03-16 Identification de sites de liaison d'adn in vivo de proteines de chromatine au moyen d'une enzyme de modification de nucleotide fixee WO2001068807A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/221,865 US20030212455A1 (en) 2000-03-16 2001-03-16 Identification of in vivo dna binding loci of chromatin proteins using a tethered nucleotide modification enzyme
AU2001249245A AU2001249245A1 (en) 2000-03-16 2001-03-16 Identification of in vivo dna binding loci of chromatin proteins using a tethered nucleotide modification enzyme

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US19036200P 2000-03-16 2000-03-16
US60/190,362 2000-03-16
US27284701P 2001-03-01 2001-03-01
US60/272,847 2001-03-01

Publications (3)

Publication Number Publication Date
WO2001068807A2 true WO2001068807A2 (fr) 2001-09-20
WO2001068807A8 WO2001068807A8 (fr) 2001-12-27
WO2001068807A3 WO2001068807A3 (fr) 2004-08-12

Family

ID=26886029

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/008590 WO2001068807A2 (fr) 2000-03-16 2001-03-16 Identification de sites de liaison d'adn in vivo de proteines de chromatine au moyen d'une enzyme de modification de nucleotide fixee

Country Status (1)

Country Link
WO (1) WO2001068807A2 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001083732A2 (fr) * 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Base de donnees de sequences regulatrices, leurs procedes d'elaboration et d'utilisation
WO2001083793A2 (fr) * 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Modification ciblee de la structure de chromatine
US6511808B2 (en) 2000-04-28 2003-01-28 Sangamo Biosciences, Inc. Methods for designing exogenous regulatory molecules
US7186512B2 (en) 2002-06-26 2007-03-06 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
US7459274B2 (en) 2004-03-02 2008-12-02 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
JP2009510198A (ja) * 2005-09-26 2009-03-12 インヴィトロジェン コーポレーション 紫色レーザー励起性色素及びその使用方法
US7901880B2 (en) 2003-10-21 2011-03-08 Orion Genomics Llc Differential enzymatic fragmentation
US7923542B2 (en) 2000-04-28 2011-04-12 Sangamo Biosciences, Inc. Libraries of regulatory sequences, methods of making and using same
WO2019060907A1 (fr) * 2017-09-25 2019-03-28 Fred Hutchinson Cancer Research Center Profilage pangénomique in situ ciblé de haute efficacité
WO2024065721A1 (fr) * 2022-09-30 2024-04-04 Peking University Méthodes de détermination de sites de liaison à une protéine de liaison à l'adn à l'échelle du génome par reconnaissance à l'aide d'une adn désaminase double brin
GB2629129A (en) * 2023-01-09 2024-10-23 Cornell Univ m6A antibody

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KIM ET AL: 'Chimeric restriction endonuclease' PNAS vol. 91, February 1994, pages 883 - 887, XP002020280 *
LEE ET AL: 'Studying the recruitment of Sp1 to the beta-globin promoter with an in vivo method: Protein position identification with nuclease tail (PIN*POINT)' PNAS vol. 95, February 1998, pages 969 - 974, XP002978080 *
ORLANDO ET AL: 'Analysis of Chromatin Structure byin VivoFormaldehyde Cross-Linking' METHODS vol. 11, February 1997, pages 205 - 214, XP004466476 *
VAN STEENSEL ET AL: 'Identification of in vivo DNA targets of chromatin protein using tethered Dam methyltransferase' NATURE BIOTECHNOLOGY vol. 18, April 2000, pages 424 - 428, XP002187507 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001083732A2 (fr) * 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Base de donnees de sequences regulatrices, leurs procedes d'elaboration et d'utilisation
WO2001083793A2 (fr) * 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Modification ciblee de la structure de chromatine
WO2001083732A3 (fr) * 2000-04-28 2002-06-06 Sangamo Biosciences Inc Base de donnees de sequences regulatrices, leurs procedes d'elaboration et d'utilisation
WO2001083793A3 (fr) * 2000-04-28 2002-06-20 Sangamo Biosciences Inc Modification ciblee de la structure de chromatine
US6511808B2 (en) 2000-04-28 2003-01-28 Sangamo Biosciences, Inc. Methods for designing exogenous regulatory molecules
US7001768B2 (en) 2000-04-28 2006-02-21 Sangamo Biosciences, Inc. Targeted modification of chromatin structure
US7217509B2 (en) 2000-04-28 2007-05-15 Sangamo Biosciences, Inc. Databases of regulatory sequences; methods of making and using same
US8071370B2 (en) 2000-04-28 2011-12-06 Sangamo Biosciences, Inc. Targeted modification of chromatin structure
US7785792B2 (en) 2000-04-28 2010-08-31 Sangamo Biosciences, Inc. Targeted modification of chromatin structure
US7923542B2 (en) 2000-04-28 2011-04-12 Sangamo Biosciences, Inc. Libraries of regulatory sequences, methods of making and using same
US7186512B2 (en) 2002-06-26 2007-03-06 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
US8273528B2 (en) 2002-06-26 2012-09-25 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
US7910296B2 (en) 2003-10-21 2011-03-22 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US8361719B2 (en) 2003-10-21 2013-01-29 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US7901880B2 (en) 2003-10-21 2011-03-08 Orion Genomics Llc Differential enzymatic fragmentation
US8163485B2 (en) 2003-10-21 2012-04-24 Orion Genomics, Llc Differential enzymatic fragmentation
US8088581B2 (en) 2004-03-02 2012-01-03 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US7459274B2 (en) 2004-03-02 2008-12-02 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US8415477B2 (en) 2005-09-26 2013-04-09 Life Technologies Corporation Violet laser excitable dyes and their method of use
JP2009510198A (ja) * 2005-09-26 2009-03-12 インヴィトロジェン コーポレーション 紫色レーザー励起性色素及びその使用方法
US8822695B2 (en) 2005-09-26 2014-09-02 Life Technologies Corporation Violet laser excitable dyes and their method of use
US9644099B2 (en) 2005-09-26 2017-05-09 Life Technologies Corporation Violet laser excitable dyes and their method of use
WO2019060907A1 (fr) * 2017-09-25 2019-03-28 Fred Hutchinson Cancer Research Center Profilage pangénomique in situ ciblé de haute efficacité
US11733248B2 (en) 2017-09-25 2023-08-22 Fred Hutchinson Cancer Center High efficiency targeted in situ genome-wide profiling
US11885814B2 (en) 2017-09-25 2024-01-30 Fred Hutchinson Cancer Center High efficiency targeted in situ genome-wide profiling
WO2024065721A1 (fr) * 2022-09-30 2024-04-04 Peking University Méthodes de détermination de sites de liaison à une protéine de liaison à l'adn à l'échelle du génome par reconnaissance à l'aide d'une adn désaminase double brin
GB2629129A (en) * 2023-01-09 2024-10-23 Cornell Univ m6A antibody

Also Published As

Publication number Publication date
WO2001068807A3 (fr) 2004-08-12
WO2001068807A8 (fr) 2001-12-27

Similar Documents

Publication Publication Date Title
EP2821413B2 (fr) Séquences de reconnaissance nucléotidique spécifique pour effecteurs TAL de concepteur
Klose et al. DNA binding selectivity of MeCP2 due to a requirement for A/T sequences adjacent to methyl-CpG
EP2376632B1 (fr) Compositions, procédés et utilisations correspondantes permettant de couper l'adn modifié
Yu et al. Mechanisms and functions of RNA-guided RNA modification
US20040014083A1 (en) Detection of heteroduplex polynucleotides using mutant nucleic acid repair enzymes with attenuated catalytic activity
US20120088677A1 (en) Methods and compositions for analysis of regulatory sequences
US10801017B2 (en) Nucleotide-specific recognition sequences for designer TAL effectors
WO2001068807A2 (fr) Identification de sites de liaison d'adn in vivo de proteines de chromatine au moyen d'une enzyme de modification de nucleotide fixee
CN109384833B (zh) 特异性识别甲基化修饰dna碱基的tale rvd及其应用
US20030212455A1 (en) Identification of in vivo dna binding loci of chromatin proteins using a tethered nucleotide modification enzyme
CN111278848B (zh) 特异性识别甲基化修饰dna碱基的tale rvd及其应用
EP1711635A1 (fr) Genes associes a l'osteoarthrite canine et procedes et compositions connexes
CA2267642A1 (fr) Procede de detection de mutation dans une sequence de bases
CN109295055B (zh) 基于C2c2的肿瘤相关突变基因的gRNA、检测方法、检测试剂盒
US20080248958A1 (en) System for pulling out regulatory elements in vitro
Yoo et al. An optimized method for the construction of a DNA methylome from small quantities of tissue or purified DNA from arabidopsis embryo
US20240240234A1 (en) Methods for measuring protein-dna interactions with long-read dna sequencing
Pal et al. Epigenetics and DNA methylation
Seymour et al. Histone H1 Limits DNA Methylation in
Hohenstatt et al. PWO1 interacts with PcG proteins and histones to regulate Arabidopsis flowering and development
Ottaniani The genomic anchors of the human major histocompatibility complex
Vogel Genomic mapping of heterochromatin components using DamID
Hsu Chromatin changes associated with the mammalian β-globin switch
CA2284481A1 (fr) Procede de realisation d'echantillotheque soustractive

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: C1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: PAT. BUL. 38/2001 UNDER (30) REPLACE "60/" BY "60/272847"

WWE Wipo information: entry into national phase

Ref document number: 10221865

Country of ref document: US

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)