WO2001068690A1 - Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001068690A1 WO2001068690A1 PCT/CN2001/000165 CN0100165W WO0168690A1 WO 2001068690 A1 WO2001068690 A1 WO 2001068690A1 CN 0100165 W CN0100165 W CN 0100165W WO 0168690 A1 WO0168690 A1 WO 0168690A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- zinc finger
- finger protein
- human zinc
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human zinc finger protein 15, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Proteins containing zinc fingers are known to be involved in the development of a variety of organisms (yeast, fruit fly, xenopus, mouse, human) and the growth and differentiation of normal cells and tumor proliferation.
- the nucleic acid binding characteristics of the zinc finger mode are due to its third-fold folding being equal to the tetrahedron of zinc ions.
- the folded structure interacts with nucleic acids through some hydrophilic residues.
- Plant zinc finger proteins are characterized by different spacing and a highly conserved sequence between adjacent zinc fingers.
- One putative DNA-contacting surface per designated site they specifically identify the target DNA.
- Some eukaryotic and viral proteins contain a preserved 40-60 residue cysteine-rich region, which binds two atoms of zinc, and may be involved in coordinating protein-protein interactions.
- the 3D structure of the zinc complex system contributes to the circular region. Said to be unique, the spacing of cysteine in such a region is the C3HC4 arrangement.
- zinc finger protein genes are considered basic features of biological importance in different species, and homologous genes have common ancestors and folds, which is special evidence for zinc finger proteins.
- Our new gene speculates that it may be a transcription factor, which is involved in regulating gene expression through a series of different specific DNA recognition and binding.
- the research idea is to use the zinc finger region of this gene as a probe to screen a human eukaryotic gene bank, identify its cDNA clones, and then use RT-PCR to detect the cell line to which it belongs to reveal its function.
- the zinc finger protein encoded by our new gene has a cysteine-rich region that binds two zinc atoms. From a cellular biology perspective, basic nutrients like cysteine, zinc, copper and vitamins C and E are essential to maintain optimal (immune) cell function. The optimal distribution of these nutrients that can be used in evolutionary development generally prevents disease. Of course, it depends on genetic and environmental factors.
- the right amount of cysteine, copper and zinc ions are used in the right place at the right time and in the right way to prevent HIV reproduction.
- Zinc and copper ions inhibit / prevent the activation of basic proteolytic enzymes, like HIV protease,
- zinc ions directly or indirectly regulate the antiviral activity of T cells, and zinc ions and copper ions are kept in sufficient quantities through cysteine and glutathione to be effective natural inhibitors of HIV To prevent chronic viral diseases
- the expression profile of the polypeptide of the present invention is very similar to the expression profile of human zinc finger protein 25, so their functions may also be similar.
- the invention is named human zinc finger protein 15.
- the human zinc finger protein 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
- Human zinc finger protein 15 protein particularly the amino acid sequence of this protein. Isolation of the new human zinc finger protein 15 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human zinc finger protein 15.
- Another object of the present invention is to provide a method for producing human zinc finger protein 15.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human zinc finger protein 15.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human zinc finger protein 15.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 15. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 336-746 in SEQ ID NO: 1; and (b) a sequence having 1-2823 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 15 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human zinc finger protein 15 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human zinc finger protein 15.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human zinc finger protein 15 and human zinc finger protein 25 according to the present invention.
- the upper graph is a graph of the expression profile of human zinc finger protein 15 and the lower graph is the graph of the expression profile of human zinc finger protein 25.
- Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human zinc finger protein 15 isolated.
- 1 5KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human zinc finger protein 15 can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human zinc finger protein 15.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human zinc finger protein 15 when combined with human zinc finger protein 15.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human zinc finger protein 15.
- Regulation refers to a change in the function of human zinc finger protein 15, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human zinc finger protein 15.
- substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human zinc finger protein 15 using standard protein purification techniques.
- Substantially pure human zinc finger protein 15 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human zinc finger protein 15 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Cluster method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method checks all The distance arranges each group of sequences into clusters. The clusters are then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in enzymo logy 183: 625-645). 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; have uncharged Amino acids with similar hydrophilicity in the head group may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylpropyl And tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? It can specifically bind to the epitope of human zinc finger protein 15.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human zinc finger protein 15 means that human zinc finger protein 15 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 15 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of human zinc finger protein 15 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human zinc finger protein 15, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human zinc finger protein 15.
- fragment refers to a human zinc finger protein that substantially retains the invention
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) Such a type, in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide, resulting in a polypeptide sequence (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, and their derivatives and analogs are considered to be within the amino acid residues are substituted with conservative or non
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2823 bases, and its open reading frame 336-746 encodes 1 36 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human zinc finger protein 25, and it can be deduced that the human zinc finger protein 15 has a similar function to human zinc finger protein 25.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not Change the function of the polypeptide it encodes.
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42'C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97 ° /. Promiscuity only occurs during the above.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human zinc finger protein 15.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human zinc finger protein 15 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect multinucleated clones with common scab characteristics Nucleotide fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human zinc finger protein 15 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human zinc finger protein 15 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human zinc finger protein 15 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human zinc finger protein 15 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human zinc finger protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human zinc finger protein 15 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- Zinc finger proteins can regulate gene expression by binding to specific DM sequences, can bind RNA to regulate RNA metabolism, and can also regulate gene expression by binding to certain proteins.
- C3HC4 type zinc finger protein can be expressed in almost every tissue and organ of human.
- Members of the C 3HC4 type zinc finger protein family have a variety of functions, including but not limited to the following in terms of these functions: activation and rearrangement of immunoglobulins and T cell receptors, regulation of the interleukin- 2 receptor alpha chain activation region or HI V-1 LTR promoter region gene expression, regulating human sperm cell development, linking rf p protein N-terminus with tyrosine kinase to produce re t transforming protein, related to mammalian breast cancer, stabilizing CDK kinase and cyclin H complex As a transcription factor, it is involved in a variety of tumorigenesis.
- the human zinc finger protein 15 of the present invention is a C3HC4 type zinc finger protein. It has similar functions as C3HC4 zinc finger protein.
- the abnormal expression of the human zinc finger protein 15 of the present invention will produce various diseases, especially diseases of the immune system, various tumors, HIV, and reproductive system diseases. These diseases include, but are not limited to:
- Immune system diseases Human major histocompatibility antigen related diseases such as rheumatoid arthritis, chronic active hepatitis, primary dry syndrome, acute anterior uveitis, arthritis after gonococcal infection, ankylosing spondylitis, Immune complex glomerulonephritis, myocarditis after gonococcal infection; autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis, scleroderma, polymyositis, xerostomia, Nodular polyarteritis, Wegener's granulomatosis, myasthenia gravis, Guillain-Barre syndrome, autoimmune hemolytic anemia, immune thrombocytopenic purpura; immunodeficiency disease: U) Primary immunodeficiency disease: Primary T lymphocyte immunodeficiency diseases such as congenital thymic hypoplasia, nucleoside phosphorylase deficiency, combined immunodeficiency disease
- Tumors of various tissues breast cancer, breast benign tumors, stomach cancer, liver cancer, lung cancer, esophageal cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glue Cytoplasmoma, colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, Gallbladder cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Abnormal expression of the human zinc finger protein 15 of the present invention may also cause certain hereditary, hematological diseases, and the like.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc finger protein 15.
- Agonists enhance human zinc finger protein 15 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human zinc finger protein 15 can be cultured with labeled human zinc finger protein 15 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human zinc finger protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human zinc finger protein 15 can bind to human zinc finger protein 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human zinc finger protein 15 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human zinc finger protein 15 and its receptor.
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human zinc finger protein 15 can be screened by each A possible combination of amino acids was obtained by binding to a random peptide library composed of a solid phase. During screening, 15 molecules of human zinc finger protein should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human zinc finger protein 15 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human zinc finger protein 15 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies against human zinc finger protein 15 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morri et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 15.
- Antibodies against human zinc finger protein 15 can be used in immunohistochemistry to detect human zinc finger protein 15 in biopsy specimens.
- Monoclonal antibodies that bind to human zinc finger protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human zinc finger protein 15 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human zinc finger protein 15 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human zinc finger protein 15. Administration of an appropriate amount of antibody can stimulate or block the production or activity of human zinc finger protein 15.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human zinc finger protein 15 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the level of human zinc finger protein 15 detected in the test can be used to explain the importance of human zinc finger protein 15 in various diseases and to diagnose diseases in which human zinc finger protein 15 plays a role.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzyme, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human zinc finger protein 15 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein 15.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 15 to inhibit endogenous human zinc finger protein 15 activity.
- a variant human zinc finger protein 15 may be a shortened human zinc finger protein 15 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human zinc finger protein 15.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human zinc finger protein 15 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human zinc finger protein 15 can be found in the literature (Sambrook, et al.). In addition, the polynucleotide encoding human zinc finger protein 15 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human zinc finger protein 15 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human zinc finger protein 15 can be used for the diagnosis of diseases related to human zinc finger protein 15.
- the polynucleotide encoding human zinc finger protein 15 can be used to detect the expression of human zinc finger protein 15 or the abnormal expression of human zinc finger protein 15 in a disease state.
- the DM sequence encoding human zinc finger protein 15 can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 15.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be fixed as a probe on a microarray or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human zinc finger protein 15 specific primers can also be used to detect human zinc finger protein 15 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification. Detection of mutations in the human zinc finger protein 15 gene can also be used to diagnose human zinc finger protein 15-related diseases.
- Human zinc finger protein 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human zinc finger protein 15 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c-leg bank.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human zinc finger protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human zinc finger protein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) m was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA forms CDM by reverse transcription.
- the Smart cDNA Cloning Kit purchased from Clontech was used to insert the cDM fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a.
- the bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0297c06 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDM was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, PCR was performed using the following primers:
- Primer 1 5'- TGGGATTACAGGTGTGAGCCACCG -3 '(SEQ ID NO: 3)
- Primer2 5 — CCCCCCCCTAAGCTTCGTCTTCTC — 3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Conditions for the amplification reaction 50 mmol / L ⁇ , ⁇ ol / L Tris-HCl, pH 8.5, 1.5 ramol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DNA in a reaction volume of 50 ⁇ 1 Polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- ⁇ -actin was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2828bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human zinc finger protein 15 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA 2 ⁇ g was used for electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0) -5 mM sodium acetate-IraM EDTA-2.2M formaldehyde. Then Transfer to a nitrocellulose membrane. A 32 P-dATP was used to prepare a 32 P-labeled DNA probe by random primers. The DNA probe used was the PCR amplified human zinc finger protein 15 coding region shown in Figure 1 Sequence (336bp to 746bp).
- 32P-labeled probe (approximately 2 x 10 6 cpra / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50 ° / Formamide-25mM KH 2 P0 4 (pH 7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was placed in 1 ⁇ SSC-0.1% SDS at 55. Wash for 30 min at C. Then, analyze and quantify with Phosphor Imager.
- Example 4 In vitro expression, isolation and purification of recombinant human zinc finger protein 15
- Primer3 5,-CCCCATATGATGGAAAACCCAATATGTAGAAAC -3, (Seq ID No: 5)
- Primer4 5,-CCCGAATTCTCAAGACCATCCTGGCCAATGTGG -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- PCR reaction was performed using the pBS-0297c06 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS- 0297c06 containing 10pg, primer Primer- 3 and Primer- 4 are lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles in total.
- Nde I and EcoRI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into colibacillus DH5a by the calcium chloride method. After culturing overnight on LB plates containing kanamycin (final concentration 3 (g / ml)), positive colonies were screened by colony PCR and sequenced. The sequence was selected correctly The positive clone (pET-0297C06) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following human zinc finger protein 15-specific peptides:
- NH2-Met-Glu-Asn-Pro-Ile-Cys-Arg-Asn-Gln-Asp-Arg-Gly-Val-Arg-Cys-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polymorphic complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- the titer of antibody in rabbit serum was determined by ELISA using a titer plate coated with 15 ⁇ ⁇ A ⁇ 1 bovine serum albumin polypeptide complex. Separate from antibody-positive rabbit serum with protein A-Sepharose Off total IgG. The polypeptide bound to cyanogen bromide-activated S e pharose4B column, by affinity chromatography and isolated from the total I gG anti-polypeptide antibody. The immunoprecipitation method proved that the purified antibody could specifically bind to human zinc finger protein 15.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% or more than 15 Two consecutive bases are completely the same, the primary probe should generally not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardfs; 6xSSC, 0.1 lrag / ml CT DM (calf thymus DM)) was added. After closing the bag, 68. C water bath for 2 hours.
- 3-1 Omg pre-hybridization solution (1 OxDenhardfs; 6xSSC, 0.1 lrag / ml CT DM (calf thymus DM)
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Example 7 DM Microarray
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
- the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see the references DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5-Araino-propargy 1-2- -deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 — Amino— propargyl— 2'— deoxyur idine 5 '-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamac ia Biotech The company) labeled the body's specific tissue (or stimulated cell line) tnRM, and purified the probe to prepare it.
- Probes from the two types of tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a wash solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000 The scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human zinc finger protein 15 and human zinc finger protein 25 according to the present invention are very similar.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU39111/01A AU3911101A (en) | 2000-03-15 | 2001-02-26 | A new polypeptide-human zinc finger protein 15 and the polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00114909A CN1313325A (zh) | 2000-03-15 | 2000-03-15 | 一种新的多肽——人锌指蛋白15和编码这种多肽的多核苷酸 |
CN00114909.1 | 2000-03-15 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001068690A1 true WO2001068690A1 (fr) | 2001-09-20 |
Family
ID=4584384
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000165 WO2001068690A1 (fr) | 2000-03-15 | 2001-02-26 | Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1313325A (fr) |
AU (1) | AU3911101A (fr) |
WO (1) | WO2001068690A1 (fr) |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996011267A1 (fr) * | 1994-10-07 | 1996-04-18 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Adn et proteine a doigts de zinc et leur utilisation |
WO1998053061A1 (fr) * | 1997-05-23 | 1998-11-26 | Amrad Operations Pty Ltd | Nouveaux genes codant une proteine a doigt de zinc, un facteur d'echange de nucleotides guaniniques, une proteine du stress ou une proteine de liaison du stress |
WO1999021991A1 (fr) * | 1997-10-29 | 1999-05-06 | Shanghai Second Medical University | Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse |
WO1999046293A1 (fr) * | 1998-03-12 | 1999-09-16 | Shanghai Second Medical University | Proteine a doigt de zinc derivee de cellules hematopoietiques |
WO1999062952A1 (fr) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | Gene de proteine humaine a doigts de zinc (bmzf2) |
WO1999062951A1 (fr) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | Gene humain de proteine a doigts de zinc (bmzf3) |
-
2000
- 2000-03-15 CN CN00114909A patent/CN1313325A/zh active Pending
-
2001
- 2001-02-26 AU AU39111/01A patent/AU3911101A/en not_active Abandoned
- 2001-02-26 WO PCT/CN2001/000165 patent/WO2001068690A1/fr active Application Filing
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996011267A1 (fr) * | 1994-10-07 | 1996-04-18 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Adn et proteine a doigts de zinc et leur utilisation |
WO1998053061A1 (fr) * | 1997-05-23 | 1998-11-26 | Amrad Operations Pty Ltd | Nouveaux genes codant une proteine a doigt de zinc, un facteur d'echange de nucleotides guaniniques, une proteine du stress ou une proteine de liaison du stress |
WO1999021991A1 (fr) * | 1997-10-29 | 1999-05-06 | Shanghai Second Medical University | Bmzf12: gene a doigt de zinc clone a partir de la moelle osseuse |
WO1999046293A1 (fr) * | 1998-03-12 | 1999-09-16 | Shanghai Second Medical University | Proteine a doigt de zinc derivee de cellules hematopoietiques |
WO1999062952A1 (fr) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | Gene de proteine humaine a doigts de zinc (bmzf2) |
WO1999062951A1 (fr) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | Gene humain de proteine a doigts de zinc (bmzf3) |
Non-Patent Citations (4)
Title |
---|
CLAVERIE J.M. AND MAKALOWSKI W.: "Alu alert", NATURE, vol. 371, no. 6500, 1994, pages 752 * |
CLAVERIE J.M.: "Identifying coding exons by similarity search: alu derived and other potentially misleading protein sequences", GENOMICS, vol. 12, no. 4, 1992, pages 838 - 841 * |
JURKA J. AND MILOSAVLJEVIC A.: "Reconstruction and analysis of human Alu genes", J. MOL. EVOL., vol. 32, no. 2, 1991, pages 105 - 121 * |
QUENTIN Y.: "The alu family developed through successive waves of fixation closely connected with primate lineage history", J. MOL. EVOL., vol. 27, no. 3, 1988, pages 194 - 202 * |
Also Published As
Publication number | Publication date |
---|---|
CN1313325A (zh) | 2001-09-19 |
AU3911101A (en) | 2001-09-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068690A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant pour ce polypeptide | |
WO2001083743A1 (fr) | Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001055381A1 (fr) | Nouveau polypeptide, facteur regulateur 80 de la transcription humaine, et polynucleotide codant pour ce polypeptide | |
WO2001066583A1 (fr) | Nouveau polypeptide, proteine humaine 14 a doigt de zinc, et polynucleotide codant pour ce polypeptide | |
WO2001075054A2 (fr) | Nouveau polypeptide, facteur humain de regulation 30 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001096384A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 15, et polynucleotide codant ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001081382A1 (fr) | Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001079280A1 (fr) | Nouveau polypeptide, proteine humaine 16 associee au represseur catabolique du carbone, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001064721A1 (fr) | Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide | |
WO2001049727A1 (fr) | Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide | |
WO2001066589A1 (fr) | Nouveau polypeptide, element de beta-transduction 11, et polynucleotide codant pour ce polypeptide | |
WO2001068692A1 (fr) | Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide | |
WO2001083728A1 (fr) | Nouveau polypeptide, proteine humaine de transport d'acides amines excitateurs 9, et polynucleotide codant pour ce polypeptide | |
WO2001046243A2 (fr) | Nouveau polypeptide, proteine annulaire 8, et polynucleotide codant pour ce polypeptide | |
WO2001074887A1 (fr) | Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001079425A2 (fr) | Nouveau polypeptide, canal ionique humain 10 pour le chlore, et polynucleotide codant pour ce polypeptide | |
WO2001075059A2 (fr) | Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide | |
WO2001088154A1 (fr) | Nouveau polypeptide, facteur humain de regulation 17 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001068691A1 (fr) | Nouveau polypeptide, fd11 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001072800A1 (fr) | Nouveau polypeptide, proteine humaine d'echange nucleotidique 13 contenant un domaine de liaison atp/gtp, et polynucleotide codant pour ce polypeptide | |
WO2001072789A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 10, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
NENP | Non-entry into the national phase |
Ref country code: JP |