WO2001068683A2

WO2001068683A2 - Peptide fragments of the equine arteritis virus m protein and their use in diagnostic tests

Info

Publication number: WO2001068683A2
Application number: PCT/CA2001/000349
Authority: WO
Inventors: Denis Archambault; Célia JERONIMO
Original assignee: Universite Du Quebec A Montreal
Priority date: 2000-03-17
Filing date: 2001-03-16
Publication date: 2001-09-20
Also published as: WO2001068683A3; CA2301207A1; AU2001242162A1

Abstract

This invention relates to recombinant DNA and polypeptides encoded thereby which have use in the provision of diagnostic test kits and methods of diagnosis for equine arteritis virus (EAV).

Description

PEPTIDE FRAGMENTS OF THE EQUINE ARTERITIS VIRUS M PROTEIN AND THEIR USE IN DIAGNOSTIC TESTS

FIELD OF THE INVENTION

The present invention relates to the field of Equine aiteritis virus (EAV). More specifically, the present invention relates to recombinant DNA and peptides encoded thereby having use in provision of diagnostics test kits for EAV.

BACKGROUND OF THE INVENTION

Equine arteritis virus (EAV) is the causative agent of equine viral arteritis (EVA), a contagious viral disease of equids. The EAV was first isolated in 1953 during an outbreak of abortion and respiratory tract disease on a farm near Bucyrus, Ohio. The clinical outcome following infection of horses with EAV varies widely from subclinical infection to systemic EVA disease which may result in abortion of pregnant mares. A high percentage of the stallions infected with EAV become persistently infected long-term carriers and, consequently, are believed to play an important role in perpetuation and venereal dissemination of the virus.

EAV is the prototype member of the family Arteriviridae in the order Nidovirales together with lactate deshydrogenase-elevating virus (LDV), porcine reproductive and respiratory syndrome virus (PRRSV) and simian hemorrhagic fever virus (SHFV). The EAV genome is a positive, single-stranded, polyadenylated RNA molecule of 12.7 kb in length. It contains, in the direction 5'- 3', two large open reading frames (ORFs), ORFs 1a and 1b, which represent approximately two-third of the genome, and seven smaller ORFs designated 2a, 2b and 3 to 7. During cell infection, the ORFs 2a, 2b and 3 to 7 are expressed as a nested set of leader- containing subgenomic viral RNAs. ORFs 1a and 1b encode, amongst others, viral proteases, transcription factors and replication enzymes, whereas the known EAV structural proteins E, G_s, G_L, M and N are encoded by ORFs 2a, 2b, 5, 6 and 7, respectively. ORFs 3 and 4 encode glycosylated membrane proteins GP3 and GP4, respectively.

The major components of the EAV envelope, the nonglycosylated membrane protein M (16 kDa) and the large envelope glycoprotein G (30-42 kDa), which expresses the known neutralization determinants of the virus, are present in virions as disulfide- linked heterodimers. In LDV, the breakage of disulfide bonds between the M protein and the VP-3P (which is the counterpart of the EAV Gι_ protein) is associated with the loss of viral infectivity. The EAV M protein accumulates in the endoplasmic reticulum (ER) and forms disulfide-linked homodimers. However, these homodimers are absent in the virion. The remarkable conserved hydrophobicity profile among nidovirus M proteins suggests that this protein has a similar structure in all members of the viral order. Thus, the M protein of EAV putatively contains a short amino- terminal domain at the external surface of the virion, three hydrophobic transmembrane segments close to the N-terminal and a long carboxy-terminal domain inside the virion, typical of the conventional N-exo, C-endo topology described for analogous proteins of others nidoviruses. Finally, the nidovirus M protein is believed to be a key factor for virion assembly and the intracellular budding process.

The diagnosis of EAV infection based on clinical signs only is difficult to achieve because symptoms of infection are variable and infection may remain clinically unapparent. Although enzyme-linked immunosorbent assays (ELISA) in which whole virions or recombinant G , M and/or N proteins were used as test antigens have been reported (Chirnside, E.D et al (1995). Journal of Virological Methods 54, 1-13; Chirnside, E.D., et al. (1995). Virus Research 39, 277-280; Cho, H.J., et al (2000). Canadian Journal of Veterinary Research 64, 38-43.), the serum neutralization (SN) test, which detects antibodies to the Gι_ glycoprotein, is the assay currently recognized as the international standard test for determination of the serological status of horses infected with EAV. However, the SN test, although reliable, is relatively expensive and laborious and it takes days to obtain results. In addition, antigenic differences are more likely to be found in the FAV G_L protein. Thus, to determine the presence of EAV antibodies in the serum of infected horses, it is relevant to search for antibodies which are specific to conserved amino acid regions of EAV proteins. Because high degrees of amino acid sequence homology have been reported in M and N proteins of geographically distinct EAV isolates (Chirnside et al., 1994. Journal of General Virology 75, 1491-1497.), the M and N proteins represent suitable candidates to be used as test antigens in a serological assay to detect EAV-infected horses.

Analyses of the humoral immune response of horses elicited during natural and experimental EAV infections have repeatedly shown that the M protein is the structural protein that is the most consistently recognized by the SN positive equine sera tested (Hedges et al., 1998 Journal of Virological Methods 76, 127-137.; MacLachlan et al., 1998. Journal of Veterinary Diagnostic Investigation 10, 229- 236.). As shown in JP patent no. 11127858, the M protein is a suitable antigen to be used for serological diagnosis of EAV infection. However, little is known on the antigenic structure of the M protein in all arteriviruses, and such a knowledge would in fact provide improvements to EAV diagnostic tests and therefore result to the advancement within the present field.

There is therefore a need for new diagnostic approaches for the detection of EAV antibodies. More particularly, it would be highly desirable to provide diagnostic methods or kits comprising a peptide fragment which includes an antigenic region composed of several epitopes of the M protein.

SUMMARY OF THE INVENTION

An object of the present invention is to satisfy the above mentioned need. More particularly, the present invention aims at an antigenic peptide fragment suitable for use in a method for testing for the presence of antibodies to equine arteritis virus. More specifically, the antigenic peptide fragment is a peptide fragment of equine arteritis virus (EAV) membrane (M) and comprises a sequence of amino acid residues having at least 90% homology to SEQ ID NO:2.

Preferably, the antigenic peptide fragment comprises a sequence of amino acid located within the C-terminal region of SEQ ID NO: 2.

More preferably, the antigenic peptide fragment is selected from the group consisting of: a) amino acid residues 88 to 162 of EAV M (SEQ ID NO: 3); b) amino acid residues 130 to 162 of EAV M (SEQ ID NO: 4); c) amino acid residues 121 to 139 of EAV M (SEQ ID NO: 5); and d) a sequence of amino acid residues having at least 90% homology to anyone of sequences (a), (b) or (c).

The present invention also concerns a composition which comprises as an active ingredient an antigenic peptide fragment as defined above conjugated to glutathione- s-tranferase (GST) to form a peptide conjugate.

According to another aspect of the invention, there is provided a method for testing for the presence of antibodies to equine arteritis virus (EAV) which comprises the steps of: a) selecting a peptide fragment or a peptide fragment conjugate as defined above as a specific binding agent; b) incubating a sample to be screened for EAV antibodies in contact with the specific binding agent; and c) identifying any EAV antibodies present.

Preferably, the test is an ELISA or a blot-related immunoassay. Also preferably, the peptide fragment or the peptide fragment conjugate may be used as immobilized binding agent or as a labeled secondary binding agent in a so called sandwich assay. In accordance with a further aspect of the present invention there are provided test kits for use in carrying out the assay of the invention characterized in that the kits comprise a peptide fragment or peptide-conjugate of the invention, together with optional agents and items necessary for performing such assays. Such agents and items may include other binding agents or colour forming agents such as labelled antibodies, eg. biotinylated anti-horse IgG, horseradish peroxidase, streptavidin- peroxidase conjugate and o-phenylenediamine dihydrochloride.

An advantage of the present invention is that the peptide fragment comprising the C-terminal region of the EAV M protein contains linear epitopes which are generally composed of sequential contiguous amino acid residues, whereas conformational epitopes are formed from segments of the protein brought together by its folded conformation. Thus, denaturation of the protein (which often occur during its isolation and purification) will usually affect more the binding of antibodies raised against conformational epitopes than those raised against linear epitopes. This fact may directly affect the efficiency of the diagnostic tests. Another advantage provided with a peptide fragment located within the C-terminal region of the M protein is that the

C-terminal region is hydrophilic whereas the N-terminal region of the M protein is rather strongly hydrophobic. Therefore, peptide fragments comprising only the hydrophilic C-terminal region are easier to purify and their expression levels or production yields through expression vectors are higher.

BRIEF DESCRIPTION OF THE DRAWINGS

The present invention and its advantages will be more easily understood after reading the following non-restrictive description of a preferred embodiment thereof, made with reference to the following drawings wherein:

Figure 1a shows the deduced amino acid sequence of the EAV M protein (SEQ ID NO:2). The amino acid sequence of the M protein of the Bucyrus strain of EAV is indicated by the single-letter amino-acid code. Figure 1b shows the hydropathy profile of the EAV M protein. The hydropathy profile of the translation product of EAV ORF 6 was generated by the method of Kyte & Doolittle (1982. Journal of Molecular Biology 157, 105-132.) with a seven-residue moving window. Hydrophobic domains appear above the middle line and hydrophilic regions are shown below the line. The amino acid (aa) residue numbers are indicated on the horizontal axis.

Figure 2a shows a schematic diagram of the structure of the M protein plasmid constructs. The amino acid sequence of the EAV M protein (SEQ ID NO:2) with the triple membrane spanning regions (TM) (de Vries et al., 1992. Journal of Virology 66, 6294-6303.) (shaded boxes) is shown at the top. Bellow is a schematic representation of the full-length (wt) and various M protein deletion constructs. The names (wt, A-O) and amino acid positions of individual M fragments are also shown, wherein wt and Fragments C, E and L having the sequence of SEQ ID NO; 2, SEQ ID NO; 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

Figure 2b is a plot showing expression of GST and GST-M fusion proteins as analyzed by SDS-PAGE. Each lane represents purified GST and GST-M proteins (wt, and A to O fragments) stained with Coomassie brilliant blue. Molecular weight standards (kDa) are indicated on the left.

Figure 3 are two plots showing the immune reactivity of GST-M fusion proteins with rabbit anti-MBP-M and anti-EAV sera by immunoblotting assay. Each plot represents the reactivity of the EAV wild-type (wt) and mutant (fragments A-O) M proteins to MBP-M fusion protein- and whole EAV-specific rabbit antisera used at a 1 :100 dilution. Molecular weight standards (kDa) are indicated on the left.

Figure 4 are two plots showing the immune reactivity of GST-M fusion proteins with horse anti-EAV sera by immunoblotting assay. Each plot represents the reactivity of the EAV wild-type (wt) and mutant (fragments A-O) M proteins to EAV experimentally and naturally infected horse serum samples. Sera from a horse experimentally infected with the EAV Bucyrus reference strain (SN titer = 256) and from a horse naturally infected with EAV (SN titer > 512) were used at a 1 :50 dilution. Molecular weight standards (kDa) are indicated on the left.

Figure 5 is a plot showing the reactivity of the peptide fragment having the sequence of SEQ ID NO:3 conjugated with the GST-protein (GST-peptide fragment) with sera of EAV infected horses in an ELISA assay. A 100 ul of diluted sera obtained from a horse naturally infected with EAV (SN > 512), from an experimetally infected horse with the IL94 EAV isolate (SN = 128) or from a serum of a pre-infected horse (SN < 4) were added in the wells of an ELISA plate containing approximately 10 ng of the GST-peptide fragment.

DETAILED DESCRIPTION OF THE INVENTION

In order to provide a clearer and more consistent understanding of the specification and the claims, including the scope given herein to such terms, it will be understood that the term peptide and peptide conjugate as used herein will encompass oligopeptides, polypeptides and proteins as long as they fulfil the criteria of the invention with regard to immunological activity and content of epitopic sequences. Furthermore, it will be understood that the term "conjugate" designates conjugation to any physiologically acceptable entity and that the term "fragment" refers to a section of a molecule, such as a protein or a nucleic acid, and is meant to refer to any portion of the amino acid or nucleotide sequence.

Brief overview of the invention

The unglycosylated membrane (M) protein, which is composed of 162 amino acids (see SEQ ID NO: 2), is a major target of equine antibody to EAV. In order to determine the linear antigenic structure of the M protein, the cDNA encoding the M gene of a Bucyrus strain of EAV (SEQ ID NO:1) was inserted into the prokaryotic expression vector pGEX-4T-1 to produce recombinant glutathione S-transferase (GST)-M fusion protein. Various deletion mutant clones, which covered the entire sequence of the M protein, were then generated by inverse polymerase chain reaction (iPCR) and expressed in Eschehchia coli to examine, by using a Western blot assay, the antigenic reactivity of the clone-derived M truncated proteins with rabbit antisera directed against EAV M fusion protein or to whole virions, and with sera from horses either experimentally or naturally infected with EAV.

Deletion of the hydrophobic N-terminal 87 amino acid (aa) residues did not abolish immune reactivity of the protein with serum antibodies to EAV, thereby demonstrating the antigenicity of the C-terminal region (aa 88 to 162; SEQ ID NO: 3) of the M protein. Although results from further truncations of the M protein C- terminal domain defined several linear epitope-containing amino acid sequence regions, only the M protein C-terminal region was readily recognized by all EAV- specific horse antisera tested in the present invention. Finally, the extreme N- terminal domain (aa 1-18), which is believed to be exposed at the surface of EAV particles, did not react with the EAV-specific rabbit or horse antisera, thereby indicating the absence of linear epitopes in that portion of the M protein.

The aspects of the present invention, such as the peptide fragments and methods for testing the presence of EAV antibodies will be described by way of example.

Example 1

Material and methods

Viruses and cell culture

A laboratory cell-passaged Bucyrus strain of EAV (Doll et al., 1957. Cornell Veterina^ήan 47, 3-41 . ) and the EAV T1329 Canadian isolate (Lepage et al., 1996. Virus Genes 13, 87-91.) were propagated in confluent monolayers of rabbit kidney (RK-13; ATCC no. CCL37) cells. Virions were pelleted by centrifugation through a 25% sucrose cushion as previously described (St-Laurent et al., 1994. Journal of Clinical Microbiology 32, 658-665.).

Construction of pGex-ORF 6 recombinant plasmid and deletion mutant clones The procedures involved in the reverse transcription-PCR amplification and cloning of EAV ORF 6 coding sequence into the pCR II TA cloning vector have been previously described (Kheynr et al., 1997. Clinical Diagnostic Laboratory Immunology 4, 648-652.). The resulting ORF 6 cDNA fragment was excised from the pCR II TA vector with the appropriate restriction enzymes, purified by using a low-melting- temperature agarose gel, and ligated into the procaryotic expression vector pGEX- 4T-1 (Pharmacia Biotech). This procedure allowed the ORF 6 encoding the EAV M protein to be in frame with the glutathione S-transferase (GST) gene, generating the recombinant plasmid pGex-ORF6 which then could express the GST-M fusion protein. The recombinant plasmid was sequenced by the chain termination method (Sanger et al., 1977. Proceedings of the National Academy of Sciences, USA 74, 5463-5467.) to confirm that the junction sequence was in the appropriate reading frame.

Deletion mutant plasmid clones derived from the pGex-ORF6 were generated by iPCR using two 5'-phosphorylated primers in inverted tail-to-tail directions to amplify the entire pGex-ORF6 plasmid, except for each ORF 6-coding region to be deleted. The ORF 6 primer pairs were selected according to the published sequence of the EAV Bucyrus strain genome (den Boon et al., 1991. Journal of Virology 65, 2910- 2920.). The nucleotide sequence of the primers and the DNA fragments used as templates for iPCR amplification are shown in Table 1. All iPCR reactions were performed by using the Pfu DNA polymerase (Stratagene), which exhibits 3'→5' exonuclease proof-reading activity and generates blunt-ended amplification products. The resulting iPCR products were re-circularized by self-ligation with the T4 DNA ligase and then used to transform E. coli (DH5c). The deletion mutant clones (pGex- ORF6m) were sequenced across the deletion junctions as described above to localize the sites of deletion, and to confirm that the deletion mutant clones were in the appropriate reading frame for expression. Expression and purification of fusion proteins

The procedures used for the expression and purification of intact and truncated M fusion proteins were similar to those commonly employed by a person skilled in the field. Briefly, cultures of E. coli (DH5α) containing the parental plasmid pGex-ORF6, or each of the generated deletion mutants pGex-ORF6m, were grown in 2X YT medium containing ampicillin (200 μg/ml), and induced with isopropyl β-D- thiogalactoside (IPTG) (0.1 mM) for 4 h at 37°C. After incubation, the bacterial cells were pelleted, resuspended in loading buffer, and boiled for 5 minutes before fractionation by SDS-12% polyacrylamide gel electrophoresis (SDS-PAGE). When partially insoluble, fusion proteins were solubilized from inclusion bodies using N- lauroyl-sarcosine (sarkosyl), as described by Frangioni & Neel (1993. Analytical Biochemistry 210, 179-187.). Fusion proteins were purified either by using the Glutathione Sepharose 4B affinity matrix (Pharmacia Biotech) or by electroelution of the proteins (Microeluter, Bio-Rad) from a SDS-PAGE gel (Kheyar et al., 1997. Clinical Diagnostic Laboratory Immunology 4, 648-652.).

Sera

Hyperimmune antisera to the EAV M were raised in New Zealand White rabbits using, as immunogenic antigens, either the bacterially expressed affinity-purified maltose-binding-M (MBP-M) fusion protein (Kheyar et al., 1997. Clinical Diagnostic Laboratory Immunology 4, 648-652.) or the pelleted cell-derived EAV (T1329 Canadian isolate). Animals were inoculated by the subcutaneous route three times with 150 μg of the MBP-M fusion protein or the pelleted viruses (approximately 10⁹ median tissue culture infective dose, TCID₅₀) mixed each with an equal volume of Freund's adjuvant (Gibco BRL) for the first injection and with Freund's incomplete adjuvant for the last two injections performed at three-weeks intervals.

To investigate the reactivity of equine anti-EAV antibodies with the GST-M fusion proteins, a total of 15 EAV positive horse antisera were tested. Six EAV-positive antisera were from EAV naturally-infected horses while the other nine were from horses that were convalescent from experimental EAV infection with the reference Bucyrus strain, or the field isolates KY84, IL93 or IL94. As an additional control, another serum positive for EAV antibodies was obtained from a horse at day 96 after experimental infection with the EAV Bucyrus reference strain. All horse serum samples used in this study were initially tested by the SN assay for the presence of EAV neutralization antibodies. The SN titers of the various EAV positive sera ranged from 4 to > 512. As negative controls, anti-EAV-negative horse sera and field antisera from horses naturally infected with equine herpesvirus type 1 and equine influenza virus type were used. A porcine serum anti-PRRSV was used as an additional negative control.

Immunoreactivity of the fusion proteins by Western immunoblotting

The immunological reactivity of the rabbit and horse antisera to the fusion M proteins was determined by Western immunoblotting. Purified proteins were separated by SDS-12% PAGE as described above, and then electrotransferred onto nitrocellulose membranes. Immunoblots were performed as described before (Kheyar et al., 1997. Clinical Diagnostic Laboratory Immunology 4, 648-652.) by using, as the blocking reagent solution, 5% non-fat dried milk solids and 0.05% Tween 20 in phosphate- buffered saline solution (PBSS), pH 7.5. The rabbit (anti-EAV T1329 isolate and anti- MBP-M) and horse serum samples were used at a final dilution of 1:100 and 1 :50, respectively. Where appropriate, a preincubation step of the diluted horse antisera for 90 min at 37°C with an excess of purified GST (0.1 μg/ml) was carried out prior to the immunoblot to reduce background staining due to reactivities of certain horse sera to the GST portion of the fusion protein (Abed et al., 1999. Clinical Diagnostic Laboratory Immunology 6, 168-172.).

An ELISA test for the detection of EAV specific antibodies using peptide fragment of the present invention

According to a preferred embodiment of the invention, 10 ng of the peptide fragment of SEQ ID NO: 3 in 100 μl of 50 mM carbonate-bicarbonate buffer, pH 9.6 (CBB), was adsorbed to each well of a microtitre plate (Costar EIA/RIA plate, Bio-Rad, Palo Alto, California) overnight or 18 hours at 4 °C. Then, the wells were washed 3 times with an ELISA wash buffer [PBS-T:phosphate buffered saline (PBS) solution, pH 7.2,

^F i -*"** ^s. * »r* containing 0.05 % (v/v) Tween 20)]. Residual adsorption sites were saturated with 100 μl of an ELISA blocking buffer [CBB plus 1 % (p/v) of Carnation skim milk powder] for 1 hour at 37 °C and the wells were washed 4 times with PBS-T. Then, a 100 μl of serum samples, used at a dilution of 1 :50 or 1 :100 in CBB, was then allowed to react for 90 min at 37 °C. After washing the wells 4 times with PBS-T, a 100 μl volume of 2,2-azino-di(3-ethyl-benzthiazoline sulfate)-H₂O₂ (ABTS: Horseradish peroxydase substrate kit, Bio-Rad) is added to each well and incubated in the dark for 30 min at 37 °C. The reaction was stopped with 100 μl of oxalic acid 2% (p/v) from Sigma Chemical Co.. All test samples need to be assayed in duplicate, and the results are determined spectrophotometrically (at 415 nm absorbance) by using a microplate ELISA reader (model 550, Bio-Rad). An optical density (OD) having a two-fold increase over the negative control sample was considered positive.

Results

Generation and analysis of different M protein-encoding cDNA fragments expressed in E. coli

In order to delineate the antigenic regions of EAV M protein, full-length and truncated M proteins of the EAV Bucyrus strain were produced in the pGEX-4T-1 expression vector as GST fusion proteins. The EAV ORF 6 encoding sequence was inserted into the pGEX-4T-1 vector where the tac promoter could be adequately controlled by IPTG. It is noteworthy that six amino acid substitutions (L→S³⁸, F→L⁴⁹, V→A⁷¹, M→T⁸¹, F→C¹⁵⁰, T→M¹⁵⁴) were found when the EAV M protein sequence of SEQ ID NO:2 was compared with the published sequence of EAV (den Boon et al., 1991. Joumal of Virology 65, 2910-2920; GenBank accession number AF320572). Fifteen deletion mutants of the recombinant plasmid pGEX-ORF6 which covered the entire M protein encoding-sequence (Fig. 1A) were then geneiated by iPCR in order to express several ORF 6-encoded overlaping fragments. In addition, the plasmid mutant constructs were also designed by taking into consideration the predicted hydropathy profile of the EAV M protein (Fig. 1B). The length of the M protein fragments (A to O) varied from 15 to 87 aa (Fig. 2A). The various GST-M fusion proteins expressed in E. coli were then obtained from each mutant clone, purified, and analyzed by Coomassie brilliant blue staining of SDS-polyacrylamide gels. The levels of expression obtained for the wild-type (wt) M protein and the larger M mutant protein fragment A were reproducibly less than those obtained for the other fusion protein fragments (data not shown). This lower degree of protein expression was believed to be related to the predicted low solubility index of the M protein N-terminus (aa 1-87), as suggested by the predominant presence of three highly hydrophobic domains in this region of the protein (Fig. 1 B). Because the larger M protein fragments (wt, SEQ ID NO: 2; A and C, SEQ ID NO: 3) were insoluble, these fusion proteins were electro-purified as described in the materials and methods section. Moreover, fragments D and I were also found mostly insoluble, confirming the predicted hydrophobic profile of amino acid residues 100 to 105 (Fig. 1B). In contrast, the M protein fragments B, E (SEQ ID NO:4) to H and J to O could be easily solubilized, thereby demonstrating the hydrophilicity of this C-terminal region (aa 105-162) of the EAV M protein.

Fig. 2B shows the protein bands (wt M and fragments A to 0) which were obtained following IPTG induction and purification. These recombinant proteins were larger that the GST (29 kDa) fusion partner with size increases over the native GST ranging approximately from 2 to 14 kDa. The sizes of the protein bands observed on SDS- PAGE gels were in agreement with the predicted molecular mass for each expressed protein, except for the full-length M and the M protein hydrophobic N-terminal fragment (aa 1-87) (believed to contain the traπsmembrane domains of the M protein) whose molecular weights were less than predicted.

Antiqenicitv of the GST-M fusion proteins as determined by Western immunoblotting using rabbit EAV-specific antisera

The antigenicity of EAV recombinant M protein and the various fragments of M protein expressed as GST fusion proteins was investigated by Western immunoblotting. To do this, each fusion protein was allowed to react with MBP-M fusion protein- or EAV (whole virus)-specific rabbit antisera. As shown in Fig. 3, both rabbit antisera readily recognized the full-length (wt) M fusion protein. These EAV M protein-positive rabbit antisera did not react with the GST fusion partner alone, thereby showing the specificity of the antibody binding to the EAV M protein (data not shown). No immune reactivity was obtained when the GST, the wt and also each of the truncated GST-M fusion proteins were allowed to react with the rabbit sera prior to immunization (data not shown). Deletion of the hydrophobic N-terminal 87 amino acid residues did not abolish immune reactivity of the resulting mutant protein (fragment C; SEQ ID NO: 2) with the EAV rabbit antisera, thereby demonstrating the antigenicity of the C-terminal region of the M protein. In contrast, no immune reactivity was obtained when the M mutant protein region spanning aa 1 to 87 (fragment A) was allowed to react with EAV-specific rabbit antisera. In addition, no immune reactivity was obtained with fragment B (aa 1-18), a hydrophilic portion located in the M protein extreme N-terminal region, and believed to be exposed at the surface of EAV particles.

A more precise location of the M protein linear antigenic regions was then obtained by using several mutant clones which presented further truncations of the M protein C-terminal sequence. The results showed that the rabbit EAV-positive sera recognized the C-terminus truncation mutants corresponding to fragments D-E but not fragment I (aa 88-107) (Fig. 3). Based on these results, it was concluded that linear epitopes were present in the last 55 aa (residues 108 to 162) of the M protein. Further truncation mutants (mutant clones F to O) were then made targeting this particular aa region to better delineate the M protein domains containing the linear epitopes. Whereas both rabbit antisera bound to fragments K and M which spanned aa 108 to 130, and 130 to 147, respectively, no immune reactivity was observed with the extreme C-terminal fragments H, N and O (aa 139-162). Finally, in contrast to rabbit whole virus (EAV T1329 isolate) antiserum, the MBP-M fusion protein rabbit antiserum reacted with fragment J (aa 105-121) (Fig. 3). Although no immune reactivity was obtained with the L fragment, the overall results obtained from the use of the two rabbit EAV-specific antisera suggested the presence of linear epitopes within a M protein region encompassing aa 108 to 139. Immune reactivity of the GST-M fusion proteins with eguine EAV-specific antisera After the demonstration of the reactivity of certain amino acid regions of the M protein with the rabbit antisera, the immune reactivity pattern of the M fusion proteins to EAV-specific horse antisera was determined. Fig.4 shows the results obtained with antisera of two different horses that were experimentally (with the Bucyrus reference strain) or naturally infected with EAV. As for the rabbit antisera, no immune reactivity was observed when both horse antisera were allowed to react with the N-terminal fragments A and B of the M protein. However, the EAV-positive horse serum samples readily recognized the C-terminus truncation mutant fragments C-E, but not fragment I, thereby demonstrating again the presence of linear epitopes within the C-terminal region (aa 108 to 162) of the M protein. Finally, all EAV M-specific fusion proteins (fragments H, J-O) encompassing the C-terminal amino acid sequence (aa 105-162) were recognized by the naturally infected horse antiserum (titer SN > 512) whereas three of these fragments (J, M and O) displayed no reactivity with the serum sample (titer SN = 256) from the EAV experimentally infected horse.

To investigate furthermore the antigenicity of the M protein, different fragments of the carboxy-terminus of the EAV M protein, which appeared to contain the M protein linear epitopes, were probed with a panel of sera from EAV naturally or experimentally infected horses. These serum samples were selected from horses seropositive (by the SN test) for EAV and seronegative to GST alone (data not shown). As shown in Table 2, all tested horse EAV antisera reacted with the C- terminal region C fragment (aa 88-162) of the M protein. The E fragment (aa 130 to 162) immunoreacted with 93% of the horse serum samples. The L fragment (aa 121- 139) was found to be the shorter most immunoreactive M fragment described in this study, as shown by its ability to react with 80% of the EAV horse antisera. In contrast, fragments I (aa 88-107) and O (aa 148-162) were the least immunoreactive regions of the M protein fragments which reacted with less than 15% of the sera tested. ). The immunoblotting results (Table 2) also showed that all but one EAV antibody containing horse antisera reacted with one or more of the fragments K, L, M and/or N of the M protein. As controls, no immune reactivity was obtained when the various GST-M fusion proteins targeting the C-terminal region of the M protein were allowed to react with the horse sera prior to EAV experimental exposure or to horse sera that were shown to be negative for EAV antibodies by the SN test (data not shown). No cross- reactions were detected when the C-terminal fragments of the M protein were allowed to react with horse antisera specific to equine herp°svirus type 1 and equine influenza virus type 1 , and with a porcine antiserum specifi'- to PRSS virus (data not shown).

Detection of EAV antibodies by ELISA

EAV antibodies present in horses infected naturally or experimentally were detected by an ELISA test comprising the peptide fragment having the sequence of SEQ ID NO:3 conjugated with the GST protein. As shown in Fig. 5, the purified GST-peptide fragment of SEQ ID NO:3 has reacted specifically with the serum of a horse infected naturally with EAV (SN>512) whereas no reaction was observed with the serum of a pre-infected horse (SN < 4).

The purified GST-protein did not react with the serum sample of the naturally infected horse. When EAV antibodies were present in a serum of a horse experimentally infected with the IL94 EAV isolate (SN=128), a week reaction was observed with the GST-protein.

Table 1. Nucleotide sequences of primers used in iPCR for EAV M truncated proteins

Template

M protein fragment* Sequencet Positions (nt)J pGex-ORF6§

A (+) 5' pTGACCTACTGCGCCTGCAGGA 3^* 487-(+18) (1-489)

(-) 5' pCATACCTACAATCATCCTCGT 3' 261-241

B (+) 5' pTGACCTACTGCGCCTGCAGGA 3' 487-(+18) (1-262)

(-) 5' pATCTAGATACTCACCTAAAAT 3' 54-34

C (+) 5' pATGCCTCGTCTTCGGTCCATT 3' 262-282 (1-489)

(-) 5' pGGATCCACGCGGAACCAGATC 3' (-1M-21)

D (+) 5' pTGACCTACTGCGCCTGCAGGA 3' 487-(+18) (262-489)

(-) 5' pGGTGTACCCGTTGCCGCGAAC 3' 390-370

E (+) 5' pACCGCAGTTGGTAACAAGCTT 3' 388-408 (262-489)

(-) 5' pGGATCCACGCGGAACCAGATC 3' (-1M-21)

F (+) 5' pTTTGTGGACACACCTAGTGGA 3' 313-333 (262-489)

(-) 5' pGGATCCACGCGGAACCAGATC 3' (-1H-21)

Table 1. Nucleotide sequences of primers used in iPCR for EAV M truncated proteins (Cont'ed)

* The amino acids positions of individual M protein fragments are shown in Fig. 2A. 3 f All primers are 5^'-phosphorylated (p); (+) sense primers; (-) antisense primers.

X The nucleotide position corresponds to the first nucleotide of the EAV ORF 6 coding sequence cloned into pCR II TA vector

(Kheyar et al, 1997). The negative or positive number indicated in parentheses corresponds to additional nucleotides cloned into pGex expression vector which are not encoded by ORF 6.

§ Plasmids constructs used as templates for iPCR amplification. The nucleotide position of the coding region of ORF 6 deletion mutants is indicated in parentheses.

Table 2. Horse immune reactivity to various proteinic fragments targeting the C-terminal region of the EAV M protein by immunoblotting assay

Immune reactivity* with C-terminal region- > of the M proteint

Serum EAV

Titer SNf C D E H I J K L M N O

Number infection§

4 > 512 natural + - + . + + - -

7 ≥ 512 natural + + + + - + + + + + +

8 > 512 natural + - + - - + - - o

9 ≥ 512 natural + + + + + + - -

16 32 natural + - + . + + - -

18 4 natural + -r + + + - - -

12 16 KY84 + - + + + - + -

13 16 KY84 + - + + - - - + - + -

30 64 KY84 -i- - + + - - - + + + -

15 256 Bucyrus + + + + - - + + - + -

Table 2. Horse immune reactivity to various proteinic fragments targeting the C-terminal region of the EAV M protein by immunoblotting assay (Cont'ed)

Immune reactivity* with C-terminal regions of the M proteint

Serum EAV

Titer SNJ C D E H I J K L M N O

Number infection§

02 64 IL93 + + + + + + -

05 64 IL93 + + + + + + + + +

06 64 IL93 + + + + + + + + + - t

59 128 IL94 NA + - + + - -

X > 4 96 dpi + + + + + + -

* Immune reactivity of the fusion M proteins was determined by immunoblotting as described in Materials and Methods.

-, No immune reactivity; +, positive immune reactivity. NA: not available. t The amino acids positions of EAV M protein fragments fused to the GST protein are shown in Fig. 2A.

J SN assay for the presence of EAV neutralization antibodies.

Claims

What is claimed is:

1. An antigenic peptide fragment of equine arteritis virus (EAV) membrane (M), the antigenic peptide fragment comprising a sequence of amino acid residues having at least 90% homology to SEQ ID NO:2.

2 An antigenic peptide fragment according to claim 1 , comprising the C-terminal region of SEQ ID NO: 2.

3. An antigenic peptide fragment according to claim 2, selected from the group consisting of: a) amino acid residues 88 to 162 of EAV M (SEQ ID NO: 3); b) amino acid residues 130 to 162 of EAV M (SEQ ID NO: 4); c) amino acid residues 121 to 139 of EAV M (SEQ ID NO: 5); and d) a sequence of amino acid residues having at least 90% homology to any one of sequences (a), (b) or (c).

4. The peptide fragment according to any one of claim 1 to 3, wherein the peptide fragment is attached to a label selected from the group consisting of: a radiolabel, a chemical label, an enzyme and a cofactor.

5. A test kit for testing for the presence of antibodies to equine arteritis virus (EAV), the kit comprising a peptide fragment according to any one of claims 1 to 3.

6. A method for testing for the presence of antibodies to equine arteritis virus (EAV), comprising the steps of: a) selecting a peptide fragment as defined in any one of claims 1 to 3 as a specific binding agent; b) incubating a sample to be screened for EAV antibodies in contact with the specific binding agent; and c) identifying any EAV antibodies present.

7. The method according to claim 6, wherein the EAV antibodies are identified by ELISA.

8. The method according to claim 6, wherein the specific binding agent is selected from the group consisting of an immobilized binding agent and labeled secondary binding agent.

9. The method according to claim 7 or 8, wherein the peptide fragment is labeled with a label selected from the group consisting of: a radiolabel, a chemical label, an enzyme and a cofactor.

10. A composition comprising as an active ingredient an antigenic peptide fragment according to any one of claims 1 to 3, the peptide fragment being conjugated to glutathione-s-transferase (GST) to form a peptide conjugate.

11. A composition according to claim 10, wherein the peptide conjugate is attached to a label selected from the group consisting of: a radiolabel, a chemical label, an enzyme and a cofactor.

12. A test kit for testing for the presence of antibodies to equine arteritis virus (EAV), the kit comprising a peptide conjugate according to claim 11.

13. A method for testing for the presence of antibodies to equine arteritis virus (EAV), comprising the steps of: a) selecting a peptide conjugate as defined in claim 11 as a specific binding agent; b) incubating a sample to be screened for EAV antibodies in contact with the specific binding agent; and c) identifying any EAV antibodies present.

14. The method according to claim 13, wherein the EAV antibodies are identified by ELISA.

15. The method according to claim 13, wherein the specific binding agent is selected from the group consisting of an immobilized binding agent and labeled secondary binding agent.

16. The method according to claim 14 or 15, wherein the peptide conjugate is labeled with a label selected from the group consisting of: a radiolabel, a chemical label, an enzyme, and a cofactor.