WO2001066802A1 - Systemes et procedes de quantification et amplification a la fois d'elements de signalisation et de sondes, dans des puces d'adnc et des matrices de micro-echantillons d'expression - Google Patents

Systemes et procedes de quantification et amplification a la fois d'elements de signalisation et de sondes, dans des puces d'adnc et des matrices de micro-echantillons d'expression Download PDF

Info

Publication number
WO2001066802A1
WO2001066802A1 PCT/US2001/007508 US0107508W WO0166802A1 WO 2001066802 A1 WO2001066802 A1 WO 2001066802A1 US 0107508 W US0107508 W US 0107508W WO 0166802 A1 WO0166802 A1 WO 0166802A1
Authority
WO
WIPO (PCT)
Prior art keywords
probes
linker
probe
universal
primer
Prior art date
Application number
PCT/US2001/007508
Other languages
English (en)
Inventor
David A. Shafer
Original Assignee
Genetag Technology, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetag Technology, Inc. filed Critical Genetag Technology, Inc.
Priority to US10/380,596 priority Critical patent/US7482443B2/en
Priority to AU2001243523A priority patent/AU2001243523A1/en
Publication of WO2001066802A1 publication Critical patent/WO2001066802A1/fr
Priority to US12/334,036 priority patent/US20090275029A1/en
Priority to US13/403,012 priority patent/US8673570B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C12Q1/6855—Ligating adaptors

Definitions

  • the present invention relates generally to the field of detecting genes and gene expression from biological and medical samples and more particularly it relates to improving both sensitivity and quantification in comparative multi-analyte detection formats such as cDNA chips and expression microarrays.
  • RT-PCR reverse transcriptase polymerase chain reaction
  • gene expression arrays which are commonly called expression microarrays, DNA chips, cDNA chips, or biochips, were first manufactured from gene specific synthetic oligonucleotides that likewise are created or distributed on the array in a two dimensional pattern and that can capture and detect labeled expression products in a somewhat similar manner if they are fragmented into smaller pieces [Fodor et al., U.S. Pat. No. 5,445,934 (1995); Fodor et al., U.S. Pat. No. 5,800,992 (1998)]. These commercial oligo-based DNA chips are called GENECHIPS.
  • microarrays generally refer to miniature arrays on coated glass substrates, however, larger scale arrays on membrane formats employ similar chemistries and target configurations and thus are suitable for and similarly improved by the application of the present invention. While the development of expression microarrays allows a greatly expanded overview and assessment of the relative frequency of different gene transcripts in a sample, current methods are limited by significant deficiencies in both quantification and sensitivity [Duggan et al., Nature Genetics, 21: 10-14 (1999); DiRisi et al., Nature Genetics, 14: 457-460 (1996); Rajeevan et al., Jour. Histochem. Cytochem., 47: 337-42 (1999)].
  • quantification is falsely biased since labeling is proportional to probe length, and thus, short genes give less signaling per probe than long genes.
  • long genes provide limited signaling with cDNA chips when compared to the signaling provided by the far longer segments that are typically used for mapping genes to chromosomes or nuclei.
  • labeling is also limited for expression microarrays because fluorescent compounds, such as Cy3 and Cy5, which are commonly employed for comparative two color labeling, are poorly incorporated by reverse transcriptase.
  • current methods are especially limited in sensitivity when individual genes of interest have been down-regulated or are weakly expressed or when the total sample available for study is quite small.
  • PCR polymerase chain reaction
  • RT-PCR or multiplex PCR methods which employ unique primers, can produce semi-quantitative rather than quantitative results since different primer sets vary considerably in efficiency and since kinetic factors favor copying the smaller and more abundant products with those methods. Therefore, some products may not amplify well, and rare or down-regulated transcripts may be under-represented [Khan et al., Electrophoresis, 20: 223-9 (1999)]. Additionally, mammalian mRNA samples include very large gene transcripts 6 to 12 thousand nucleotides long that cannot be amplified reliably by routine PCR methods.
  • compositions and methods for modular probe and reporter systems that improve the specific detection of genes and mutations and that amplify signaling were disclosed. These disclosed compositions and methods include:
  • Probe methods known as WRAP-PROBEs, that are manufactured from synthetic DNAs, from PCR (polymerase chain reaction) products, or from cloning products, wherein the probes have a central, target-specific sequence that is helically wrapped around the target strand, and wherein they have one or more generic linkers at one or both ends that bind one or more reporters.
  • WRAP-PROBEs By binding separate reporters to the ends of the probes after coiling the probes around the target, the reporters are more effectively tethered, and they thereby provide far more effective signaling than is achieved with simple labeled probes. Indeed, this method can provide multi-fold signal amplification if dual chains or arrays of long labeled reporters are bound to a short WRAP-PROBE of this configuration.
  • This WRAP-PROBE composition also provides an economic advantage in being able to use generic linkers to interchangeably bind either different reporters to the same probe or different probes to the same reporter, wherein a series of generic reporters may be applied that vary in both the type of signaling and in signaling intensity.
  • GENE-TAGs and TINKER-TAGs include liner segments of double stranded DNA or chained and joined polynucleotides with single stranded linkers at one or both ends that can join together in arrays and can join to the linkers of WRAP - PROBEs or related probes to provide amplified signaling.
  • Multi-LINKERs including singular or composite polynucleotide structures that join to the linker of a probe and provide two or more secondary linkers in order to bind multiple reporters to a probe.
  • the related WRAP-PROBE methods and compositions are suitable for making targeted probes that amplify signaling and that more efficiently map or detect a specific gene sequence in a variety of detection formats such as in situ gene mapping, dot blots, etc. In those formats, the target or targets are on the substrate and a small number of labeled probes are individually manufactured in excess quantity to find and label those specific targets. The object is simply to put label on the target, thereby mapping or counting the targets.
  • the present invention provides methods and compositions of matter that allow quantitative, sensitive and rapid analysis of gene expression patterns in different cells and tissues as a means to detect functional changes associated with development and physiology, to diagnose abnormal variations related to disease, and to discover and assess pharmaceutical agents.
  • the invention is designed for and particularly suited to multiple analyte formats such as cDNA chips and expression microarrays where the diagnostic value would be improved by increased signaling and by determining the true frequency of different mRNA transcripts in a sample and not just their approximate frequency - a standard poorly addressed by current methods.
  • the invention is complementary to prior inventions of the applicant which provide a probe construction, known as WRAP probes, for detecting genes and nucleotide sequences, which employ generic reporters such as GeneTAGs or TinkerTAGs that are linked to terminal linkers of the probes, and which may employ multi-linker components to join multiple reporters to each probe.
  • WRAP probes for detecting genes and nucleotide sequences
  • generic reporters such as GeneTAGs or TinkerTAGs that are linked to terminal linkers of the probes, and which may employ multi-linker components to join multiple reporters to each probe.
  • the present invention employs novel primer, linker, adapter, extender and reporter compositions and molecular processing methods to globally transform a mixed pool of mRNAs into a pool of modified cDNA-based probes, called WRAP -Probes, that have common universal linkers at one or both ends for joining reporters, to thereby provide more defined signaling as well as greater signaling potential.
  • the basic principle of these methods is to achieve signaling by affixing generic reporters to the ends of the probe, either directly or via terminal linkers, rather than by labeling the target specific segment which varies in size for each gene.
  • This invention thus allows quantitative analysis of expression since the signaling element is effectively equalized for each transcript detected, and it improves sensitivity since reporters can be affixed that have greater signaling potential than a labeled probe.
  • Alternate embodiments of the probes, the multi-linking units, and the generic reporters have been devised and these components can be used together in a modular manner to achieve different detection and signaling objectives.
  • the set of WRAP-Probes is constructed with common universal linkers on both ends, this configuration creates an opportunity to use these linker sequences as global primers, thereby allowing the duplication of the entire pool of probes by exponential amplification procedures such as PCR.
  • Alternate amplification methods were invented that produce either singular WRAP-Probes from each mRNA transcript or a fragment series of smaller WRAP-Probes from each transcript. These methods include novel compositions and procedures to create truncated probes and to affix double-linker/primer sites so that they can be reliably amplified by exponential methods. The probes are then globally amplified and labeled during PCR with a single primer set. These amplified probes can also achieve signaling quite simply and inexpensively with new compositions called ChipTAGs that are composed of one or more labeled polynucleotides which additionally serve both linker and primer functions.
  • reagents and probe systems that extend the WRAP-PROBE design to expression array applications by globally converting a complex pool of mRNA transcripts into a pool of probes having common universal linkers on one or both ends have been developed.
  • the present invention differs compositionally from the prior invention because the functional product of this invention is not a solitary WRAP- PROBE, but in fact a composite set of WRAP-PROBEs that necessarily contains multiple probes of considerable diversity with important differences in relative frequency.
  • the present invention adds an important second function, exponential amplification, to the universal linkers of the WRAP -PROBE configuration, and it additionally provides methods to globally create and amplify the probe set as a collection of probes. To distinguish this probe set composition, these new probes were intentionally called REX- WRAP probes in the applicant's U.S. Provisional Patent Application Serial No.
  • a basic principle of the present WRAP-Probes invention is to achieve more sensitive and quantitative results with expression arrays by adding equivalent reporter signaling to the terminal linkers of the probe set.
  • This approach contrasts with the current practice of labeling the probes internally - a method causing length-related bias in signaling.
  • This end labeling approach equalizes signaling per probe and provides a truer count of transcript frequency, and it also allows far greater signaling per probe by adding multiple reporters.
  • the dynamic range of linear signaling is improved since the standard method can saturate signaling early for those genes that are both long and abundant.
  • other advantages can accrue from not labeling the target specific segment with bulky signaling molecules that are poorly incorporated, such as Cy3 and Cy5.
  • the most elemental version of the WRAP-Probes method is to create probes with a single universal linker on one end to enable the binding of a generic reporter, such as a GeneTAG or TinkerTAG reporter (previously described as GENE-TAGs and TINKER-TAGs in more detail in International Patent Application Serial No.
  • PCT/US99/16242 Applicant has devised and discovered a preferred embodiment of this method by copying the mRNA from the 3' poly-A end by reverse transcriptase (RT) using a modified poly-T primer with universal linker sequences added to the 5' end.
  • the terminal linker thus created provides a binding site to attach reporters either before or after the probe is hybridized to the expression array.
  • the resulting probes are called One-Linker WRAP-Probes.
  • a variety of such modified poly-T primers are devised to allow a multiplicity of reporter attachments.
  • Double-Linker WRAP-Probes Two linkers
  • These methods similarly create single-stranded or double-stranded cDNA probe components with a modified poly-T primer having a 5' universal linker, and then a second linker is added to the opposite end so that reporters can bind to two linkers - pulling on the helically bound probe from both ends as with a prior WRAP-PROBE.
  • This double-linker configuration provides a structural advantage for tethering longer or multiple reporters, and it additionally enables the amplification of the probe set.
  • Applicant has devised and discovered several methods and compositions for creating such Double-Linker WRAP-Probes based on joining novel adapter compositions to the 3' end or based on applying novel extender compositions to extend the 3' end and form a second universal linker.
  • Adapters consist of paired polynucleotides joined together but with a single stranded overhang, wherein the overhang provides a binding site to join the adapter to a DNA segment with a complementary cohesive end, and wherein the paired segment provides appended sequences that serve a recognition, joining or primer function.
  • the adapters of the present invention have universal linker sequences in the paired segment, and they differ in the overhang.
  • One type of adapter of the present invention called a Specific Adapter, has a small overhang specific to a restriction cut site.
  • Another type called a Random Adapter, has an overhang of a few random bases.
  • a third type called a Homopolymeric Adapter, has an overhang of poly-C or poly-G sequences. These adapters are designed to join and ligate onto the 3' end of a cut or modified probe segment to form a second universal linker.
  • the extenders of the present invention consist of a polynucleotide with universal linker sequences on their 5' end and a 3' end with either random or homopolymeric sequences.
  • the homopolymeric extender of the present invention has 3' poly-C or poly-G sequences and is joined to a 3' probe end of complementary poly-G or poly-C sequences formed with terminal transferase, whereupon the 3' end of the probe may be further extended with the universal linker sequences using the extender product as a template.
  • the present invention provides a novel extender with a random 3' end that is used in a similar manner except that it can join anywhere along the probe. It only functions as an extender in the present invention when it joins to the 3' end of the probe via the random sequences, whereupon the universal linker sequence provides a template for polymerizing a 3' extension of the probe to provide a second linker end.
  • this special extender called a Random End-Linker
  • a Random End-Linker is employed with a novel procedure of the invention, called Back-Tagging, whereupon repeated thermal cycling steps similar to PCR are employed to make many attempts at putting the Random End- Linker at the far 3' end of the probe to extend it, wherein the Random End-Linker is preferentially modified at the 3' end to block forward polymerization on the probe template. Consequently, the Random End-Linker preferentially back-extends the 3' end of the probe to form a second universal linker and it avoids making partial copies of the probe itself by forward polymerization.
  • the above adapter and extender compositions and related procedures of the present invention enable the simultaneous global application of a second universal linker to the 3' ends of the probe set to form Double-Linker WRAP-Probes. While such Double-Linker probes can bind at least twice as many reporters as One-Linker probes, either version gives equivalent signaling per transcript within a sample, and thus true counting of gene expression frequencies.
  • Double-Linker WRAP-Probe methods described above, wherein multiple short probes are created from each mRNA transcript, either by fragmenting the RT products or cutting them with restriction enzymes, and by employing various adapters or extenders to construct a series of short WRAP-Probes from them.
  • Applicant has also devised alternate embodiments of these probe variants wherein the linkers are pre- attached to labeling agents, multi-linkers, or reporter constructs.
  • RNA arrays single tissue preps or tissue arrays
  • FISH mapping fluorescent in situ hybridization
  • Applicant has devised several embodiments by cutting the full length probe components into smaller segments with restriction enzymes, shearing, RNase enzymes and the like and then universal GeneTAG linkers are applied to one or both ends by modifications of the above mentioned procedures for putting the second universal linker on the 3' end of Double-linker WRAP-Probes.
  • the hybridization of these fragment probes to target tissues provides multiple adjacent probes along a target, and thus highly amplified signaling since each probe can bind one or more generic reporters (e.g. GeneTAGs) with greater signaling capacity than a simple labeled probe.
  • Applicant has also devised WRAP-Probes that are created with multiple linkers and or multiple reporters pre-attached to one or both ends. These configurations are achieved by attaching generic reporters such as GeneTAGs or TinkerTAGs to a Multi- Linker or by attaching smaller signaling elements directly to the distal linkers of a Multi-Linker unit.
  • Applicant has devised and discovered signaling compositions, called ChipTAGs, which are short polynucleotides conjugated to one or more labeling agents, that serve as a reporter joined to a universal linker and that additionally serve a primer function. Similar short reporter compositions called OligoTAGs, that only served a linker and labeling function, were previously described in International Patent
  • ChipTAG and Multi-Linkers with different linkers and different labeling, so that two or more samples can be labeled differently and simultaneously compared on an array to determine relative differences in expression levels between samples.
  • Applicant has also devised modified poly-T primers to generate WRAP-Probes that are pre-attached to one or more direct or indirect signaling elements, that are pre- attached to Multi-LINKERs, with or without signaling elements attached, and/or that are pre-attached to labeled GeneTAGs, TinkerTAGs or other generic reporters.
  • the most elemental of these dual function compositions are a modified poly-T primer with a label agent such as Cy3 or Cy5 conjugated to the 5' end of the primer, with a preferred embodiment having a universal linker sequence on the 5' labeled end to add further reporters.
  • the advantage of these methods is that by joining probes and reporters beforehand, one or more hybridization step can be eliminated.
  • Applicant has also devised WRAP-Probes that employ either modified poly-T primers, Multi-LINKERs, GeneTAGs, TinkerTAGs or ChipTAGs, that are not based on fluorescent or radioactive labeling, but rather, they are labeled with refractory or light scattering particles or with metallic or semiconductor based signaling elements - alternatively allowing the detection of microarrays or DNA chips with novel optical or photonic sensors or with micro-electronic circuits or sensors.
  • Double-Linker WRAP-Probe methods also allow a major methodological departure from the general principle of creating labeled cDNA probes from each mRNA transcript. Namely, when a universal linker sequence is created on both ends of each probe, those sequences can be designed and used as generic primer sites for globally copying and amplifying the entire pool of probes with a single primer set or even with a single primer using common PCR methods or related processes. Applicant has devised and discovered methods to make such globally amplified WRAP-Probe probe sets.
  • WRAP- Probe amplification procedures Two preferred WRAP- Probe amplification procedures have been devised; 1) to make a single WRAP-Probe from a shortened 3' end of each transcript, or 2) to cut and transform full length or near full length cDNA copies into a set of multiple short probes called Mini-WRAP -Probes. Either of these procedures produce a pool of short probes all having generic linker/primer sequences at each end so that they are suitable for exponential amplification.
  • the basic principle of the amplified WRAP-Probe method is to construct or reconstruct RT generated cDNA probes as short or shortened probes of similar length, with generic linkers on both ends that provide universal primer binding sites independent of gene specific sequences, so that the entire set of mRNA derived probes can be globally amplified by PCR in a unbiased manner.
  • This invention provides several important advantages. First, expression analyses can be conducted on very small RNA or tissue samples. Second, quantitative signaling can be preserved either by attaching generic reporters to the ends of the amplified probes or by shortening the probes to approximately the same length so that internal labeling becomes more equalized between genes.
  • Applicant has devised and discovered three primary new methods to globally achieve short double-linker probes from mRNA that are suitable for PCR amplification: 1) restriction cutting and adapter ligation, 2) globally truncated RT and probe extension with a random end-linker, and 3) globally truncated RT and random adapter binding. These methods are based upon and modified from the Double-Linker WRAP-Probe methods described above.
  • RT protocols including manufacture of probes for DNA chips, are typically based on one or two hour RT exposures to ensure that the full length of all transcripts is copied since prior work had established that 95% of RT copying is completed in about 50 minutes [Verma et al., Nature New Biology, 235:
  • Short-RT provides a simple, economic method to remove an important barrier to unbiased exponential amplification, gene length variation, which has inhibited the prior development and use of PCR-based protocols for DNA chip applications as well as other global mRNA comparisons.
  • Short-RT products are prepared with a first universal linker, and then the extender reagents described above as Random End-Linkers are applied to create a second universal linker. While these extenders can bind anywhere along a probe, a significant result only occurs when they bind at the 3' end, wherein that 3' probe end is back extended with a linker sequence that forms a primer binding site. Therefore, the protocol called Back-Tagging described above was devised and discovered to increase the opportunity for such an end extension to occur. This novel protocol commonly employs rapid thermal cycling for approximately 100 to 200 cycles that mimic the steps of PCR (1. denaturing at high temperature, 2. annealing at low temperature, and 3.
  • the extenders are repeatedly hybridized to the probe to extend it with a universal linker, thereby providing the second linker/primer site needed for subsequent PCR amplification of the probes.
  • the probes are of randomly truncated length, they can also be internally labeled, during or subsequent to PCR amplification, instead of or in addition to end labeled, without reintroducing signaling bias between different genes.
  • Short-RT products are again prepared with a first universal linker, and the second linker is then applied to the 3' end of the probes with the novel Random Adapter described above which has a short random overhang.
  • the random segment provides a random binding mechanism to anchor the adapter on the 3' end of any probe so that probe and adapter components can be ligated together.
  • the adapter-probe complex is denatured and purified to release the unbound half of the adapter - thus providing probes containing linker/primer sites on both ends suitable for PCR amplification.
  • this sub-method also allows the probes to be internally labeled, instead of or in addition to end labeled, without reintroducing signaling bias between different genes.
  • Elements of the above sub-methods can also be combined together in different ways or combined with pre-existing technologies to alternatively produce double-linker probes from single or double stranded cDNA probes made with a 5' first linker.
  • Short-RT products can be prepared with a modified RT primer, converted to double stranded cDNA probes, and joined to commercial adapter/linker products, e.g. Clontech's Smart or Marathon adapter products, to create a 3' second linker site on the probes.
  • globally truncated Short-RT products can be prepared with a first universal linker using the Modified Poly-T primer, and then, a homopolymeric 3' tail of poly-C or poly-G sequences is provided [Ivanova et. al., Nucleic Acids Res. 23: 2954 (1995)]. Thereafter, an extender polynucleotide with a 3' matching homopolymeric segment is applied to create a second universal linker.
  • an adapter could be made with a 5' universal linker and a homopolymeric 3' end that would allow this product to be ligated to the 3' end of the probe creating a second universal linker.
  • the applicant has devised adapters and extenders applicable to the above methods that provide second linkers on the 3 ' end that mirror the first linker sequences of the 5' end whereupon the probes can be linked similarly via each end as well as amplified by PCR with a single primer rather than a pair of primers.
  • the primers used for global amplification of the WRAP-Probe probe set or the Mini WRAP-Probe probe set can employ simple ChipTAG compositions to generate probes with pre-attached terminal labels. Due to exponential amplification of the probes, such limited signaling can be quite sufficient.
  • the primers can be pre-attached to multi-linkers or reporters such as GeneTAGs that provide greater signaling per probe. Either approach will allow a single hybridization step to apply both probes and reporters.
  • the WRAP-Probe method produces one amplified probe product per transcript and thus preserves the principle of generating equivalent signaling per transcript as with non-amplified WRAP-Probes.
  • the Mini-WRAP -Probe method relaxes that principle for the sake of simplicity and greater signaling, and yet it still does not depart further from the signaling differences per transcript that are inherent in the current art of labeling probes along their length.
  • This Mini-WRAP - Probe method is also well suited to expression arrays based on specific oligonucleotides on the chip vs.
  • these new methods provide the first global procedures to amplify mRNA derived probes for gene expression arrays in an exponential manner. Consequently, these methods are highly advantageous over current art that requires large amounts of mRNA per each microarray assay. In contrast, these exponential amplification methods allow the analysis of very minute samples that may be available from micro dissections, needle biopsies, small blood samples, forensic traces or archived tissue as well as repeated analysis of the same sample. These advantages are particularly relevant for clinical or forensic specimens where only a single, small sample may be available.
  • FIG. 1 One Linker WRAP-Probe method.
  • Figure 1 depicts the creation of cDNA probes with a universal linker from mRNA transcripts and applying them to provide amplified and quantified signaling.
  • Step 1 depicts binding the modified poly-T primer with a universal linker to the poly-A tail of mRNA and polymerizing first strand cDNA probes with a universal linker;
  • Step 2 depicts binding the probes to a cDNA chip;
  • Step 3 depicts binding labeled GeneTAG reporters to the universal linkers of the probes.
  • FIG. 2 Amplified WRAP-Probe method. Sub method One: Restriction cutting and adapter ligation.
  • Step 1 depicts the conversion of mRNA into double stranded cDNA with one universal linker by copying the mRNA with RT and a modified poly-T primer, and by polymerizing a second strand with DNA polymerase and RnaseH.
  • Step 2 depicts cutting the probes with a restriction enzyme and capturing them with magnetic beads via the capture moiety, such as biotin.
  • Step 3 depicts ligating the Specific Adapter to the cut ends of the probe to provide a second universal linker and to form double-linker probes.
  • Step 4 depicts PCR amplification of the probes, wherein the probes are either labeled internally with labeled bases or labeled on the end using labeled primers eg. ChipTAGs. Additionally, GeneTAG or TinkerTAG reporters can be added to the probes after they are bound to the cDNA chips.
  • FIG. 3 Amplified WRAP-Probe method.
  • Sub method Two Applying Short RT and the Random End-Linker to make Double-Linker cDNA probes.
  • Step 1 depicts how the mRNA is converted to first strand cDNA probes with one universal linker and it further depicts the short RT procedure where different transcripts of different lengths are stopped short at approximately the same length.
  • Step 2 depicts binding of the random extender, called the Random End-Linker, to the probes during multi-cycle thermal cycling where the extender binds but does not prime if it binds anywhere along the probes except the 3' end, and where it extends the 3' end with a universal linker when it binds to the 3' end.
  • Step 3 depicts the further step of amplifying the double linker probes by PCR with labeling incorporated either in the bases or by using ChipTAG primers. Labeling can be applied in both ways to the probes, and additional labeling can also be provided by adding GeneTAGs or TinkerTAGs to the universal linkers of the probes.
  • FIG. 4 Amplified WRAP-Probe method. Sub method Three: Applying Short RT and Random Adapter to create double-linker probes. Step 1 depicts how the mRNA is converted to first strand cDNA probes with a 5' universal linker by polymerizing cDNA with a modified poly-T primer, and it further depicts the short RT procedure where different transcripts of different lengths are stopped short at approximately the same length. Step 2 depicts binding of the random adapter by ligation to the 3' end of the probes to form double linker probes. Step 3 depicts amplifying these double linker probes by PCR with labeling incorporated either in the bases or on the ends by using ChipTAG primers. FIG.
  • Step 1 depicts how the mRNA is converted to first strand cDNA probes with one universal linker, and it additionally depicts the short RT procedure where the first strand copy is stopped short for all transcripts.
  • Step 2 depicts alternatively either the binding of the homopolymeric extender on the left or the homopolymeric adapter on the right to extend or append the second universal linker unto the 3' end of the probes to form double linker probes.
  • Step 3 depicts the further step of amplifying these double linker probes by PCR with labeling incorporated either in the bases or on the ends by using ChipTAG primers .
  • FIGs. 6A-6B Images from Example 2.
  • Figure 6A depicts the probes hybridized to the chip that are internally labeled with Cy3 (green).
  • Figure 6B the lower portion, depicts the GeneTAGs hybridized to the probes of 6 A above wherein the GeneTAGs are labeled with Cy5 (red) and showing increased signaling with GeneTAGs.
  • the color array images were converted to black and white and inverted since the array images are artificial, scanned pseudocolor images not true photographic images.
  • FIG. 7 Image from Example 3.
  • Figure 7 depicts PCR amplified probes hybridized to the chip that are internally labeled with Cy3 (green). This image is also converted to black and white and inverted from a pseudocolor green image..
  • FIG. 8 Image from Example 3.
  • Figure 8 depicts GeneTAGs hybridized to the probes of Figure 7. wherein two layers of GeneTAGs are applied and the GeneTAGs are labeled with Cy5 (red) showing increased signaling.
  • Cy5 red
  • FIG. 9 Image from Example 4.
  • Figure 9 depicts a small sample of the probes from Example 2 above that were re-amplified by PCR and applied to another expression microarray.
  • a "Red" ChipTAG primer was employed as a single primer to globally amplify and label all the probe products.
  • labeling was achieved from a single Cy5 fluor that is conjugated to the 5' end of the ChipTAG primer.
  • Additional ChipTAG primer was added back to the probe sample after PCR amplification to increase signaling. This image is also converted to black and white and inverted from the red pseudocolor image.
  • FIG. 10 Images from Example 6. These images demonstrate the use of Amplified WRAP-Probe Sub method Two which employs the Short RT and Random End-Linker procedures followed by PCR amplification of the probes. In this case, gene expression analysis is shown with P-32 labeled probes that are hybridized to membrane-based arrays. Expression profiling is demonstrated that distinguishes between control and IL-13 treated monocyte samples based upon starting with only 1 microgram of total RNA per sample.
  • FIG. 11 Images from Example 7. These images shows P-32 labeled probes hybridized to membrane-based arrays using the Amplified WRAP-Probe Sub method Three that employs the Short RT procedure, the ligation of Random Adapters, and then PCR amplification of the probes. Expression profiling is depicted for Short RT using different RT exposure times of 2 min, 5 min, 10 min and 20 min. The shorter RT exposure times give better results than longer exposures.
  • WRAP-Probe a single DNA based probe affixed with universal linkers on one or both ends to bind generic reporters.
  • WRAP-Probe probe set a pool of WRAP-Probes made from a pool of mRNA species to represent and detect relative RNA transcript frequencies with gene expression arrays.
  • One-Linker probes WRAP-Probes with one universal linker.
  • Double-Linker probes WRAP-Probes with universal linkers on both ends.
  • WRAP-Probes a pool of WRAP-Probes exponentially amplified by PCR or related processes.
  • Mini- WRAP-Probes a series of small WRAP-Probes made from fragmenting first strand cDNAs from a pool of mRNAs.
  • GeneTAG linear generic reporter molecules with terminal universal linkers.
  • TinkerTAG GeneTAGs constructed of partially overlapping polynucleotides that self assemble, with or without single stranded arms for binding labeled oligonucleotides.
  • ChipTAG small multi-function labeled universal linker that also serves as a primer.
  • Universal Linker a single stranded nucleotide sequence that allows the joining of two probe and or reporter elements by complementary nucleotides while the linker sequences are not complementary to the target sequence.
  • Multi-Linker a polynucleotide or complex of polynucleotides that self assemble and that provide a probe linker and two or more reporter linkers.
  • Modified Poly-T Primer a global poly-T primer for RT reactions modified on the 5' end typically with a universal linker and/or a capture moiety, label, reporter or multi-linker.
  • Adapter paired polynucleotides with blunt or cohesive ends for joining to DNA fragments and providing added functions such as a linker, primer or reporter binding functions.
  • Specific Adapter a composite of paired polynucleotides with an overhang of specific sequences that can be joined to restriction cut ends of DNA fragments and that provide a universal linker.
  • Random Adapter paired polynucleotides with an overhang of random sequences that can be joined to any DNA fragment and that provide universal linker sequences.
  • Homopolymeric Adapter paired polynucleotides with a Poly-C or Poly-G overhang that can be joined to a Poly-G or Poly-C sequence and that provide universal linker sequences.
  • Homopolymeric Extender extender polynucleotide with a 5' universal linker end and a 3' Poly-C or Poly-G end that can join to a 3' Poly-G or Poly-C end of a probe and serve as a template to extend the probe with a universal linker sequence.
  • Random End-Linker extender polynucleotide with a universal linker region on the 5' end and a random sequence region on the 3' end that can join to the 3' end of a DNA segment and serve as a template to extend that DNA segment with a universal linker sequence, said extender being preferably modified on the 3' end to block capacity for polymerase extension.
  • Probe Modifier a category representing any of the above adapters and extenders that apply a universal linker to the 5' or 3' end of a probe, including the random adapter and extender, the homopolymeric adapter and extender and the modified poly-T primer, as well as including the ChipTAG labeled primers which add label directly onto to the end of probe when used to amplify a double linker probe.
  • Short-RT modified RT protocol in which all products are stopped short during RT extension to produce similarly short cDNA probes suitable for PCR amplification.
  • RNA messenger RNA transcripts which are a subset of total RNA.
  • Microarray a miniaturized grid of nucleic acid targets to detect a pool of probes.
  • cDNA chip a cDNA based microarray.
  • Expression Array a grid of nucleic acid targets based on cDNA or cDNA sequences
  • PCR polymerase chain reaction to amplify DNA exponentially.
  • RT reverse transcriptase enzyme method to copy RNA.
  • RT-PCR reverse transcriptase plus PCR to copy and amplify a specific mRNA transcript.
  • Hybridize formation of specific hydrogen bonding interactions between complementary strands of nucleic acids.
  • TA site nucleotide sequence reading 5' -3': thymidine, adenine.
  • UNG Uracil-Nucleotide-Glycosylase procedure where Uracil bases are incorporated into DNA to make them labile to glycosylase digestion.
  • Ranges may be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
  • the present invention relates to a number of probe compositions, manufacturing compositions, and signaling compositions and associated methods that improve the preparation, application and detection of probes and reporters for gene expression arrays and related multi-analyte hybridization assays, including but not limited to cDNA chips, oligonucleotide chips, biochips and other microarray formats.
  • the present invention is in part based upon or incorporates prior inventions of the applicant, described in International Patent Application Serial No. PCT/US99/16242 (WIPO Publication WO 00-04192), the disclosure of which is hereby incorporated by reference in its entirety. Composition of Matter:
  • the present invention relates to a universal linker composition suitable for gene expression arrays and related hybridization assays, including a nucleotide linking sequence which can be globally appended to the ends of a set of probes derived from mRNA transcripts of an analyte sample to produce a probe set where the probes have a common linker at one or both ends.
  • These universal linker sequences are not complementary to the target sequences of the assay, and they provide binding sites to join the members of the probe set to common reporters.
  • the universal linkers are also suitable for chemical cross-linking between bound linkers, so that probes, reporters, and any intermediate linking elements, can be pre-attached together and covalently bonded.
  • the universal linkers additionally serve as universal primer binding sites for copying or amplifying the probe set.
  • the universal linkers of the present invention are suited to binding a variety of reporters that may have complementary linkers, particularly reporters such as the GeneTAG and TinkerTAG reporters, and arrays thereof, as referenced and described previously, where the GeneTAG reporters include linear labeled segments of duplex DNA that terminate in single stranded universal linkers and the TinkerTAG reporters that contain a structurally similar linear complex of labeled polynucleotides and that also terminate in single stranded universal linkers. These reporters can also form arrays of reporters joined end to end.
  • the universal linkers are additionally suited to binding multi-linker elements, as referenced and described previously, may include one or more joined polynucleotides that form a probe linker at one end and two or more reporter linkers at the opposite end.
  • the probes of the present invention may employ the universal linkers to bind reporters directly or indirectly, by virtue of binding multi- linkers to the probes, and binding reporters such as GeneTAGs or TinkerTAGs to the linkers of the multi-linkers.
  • the present invention additionally relates to a set of two or more universal linkers containing linker sequences which can bind two or more sets of probes to two or more different common reporters, either directly or via intermediate linkers, to provide different labeling to different sets of probes.
  • These universal linker compositions include but are not limited to: a. A first linker sequence 5'CTACGATACGATAGCGCCTAAGAGTAG
  • 5'CCTAGACCTACGACATAGGTACCCTAC (Seq. ID. No. 2) and its complement, known as the Green universal linker; c.
  • the present invention relates to a probe set composition, called WRAP-Probes, for gene expression arrays and related hybridization assays, to provide common equivalent signaling per probe regardless of length, as contrasted with signaling bias which results from incorporating label along the length of each probe.
  • This probe set includes a pool of modified cDNA probes copied in part from a sample of mRNA transcripts, but appended with terminal universal linkers, as in the prior WRAP- PROBE invention referenced and described previously, where each single stranded probe of the probe set contains a central target specific segment copied from a single mRNA transcript, and a universal linker located on a terminal end of the probe.
  • the universal linkers provide binding sites to join common reporters to each probe, and they also provide primer binding sites to copy and amplify the probes.
  • probe sets are also made with universal linker sequences at both terminal ends.
  • the universal linker sequences at both ends may be different or they may mirror one another, in which case the probe set has a common primer binding site and may be amplified with a single primer.
  • the probes are fragmented to provide multiple probes per mRNA transcript.
  • the probe set of first strand cDNA probes is fragmented and then universal linkers are applied to one or both ends of the fragments to create a final probe set of multiple short probes having universal linkers.
  • each transcript becomes a series of short or Mini WRAP-Probes with one or two terminal linkers, that provide greater signaling in two ways, by amplifying the multiple probe fragments, and by binding reporters to the linkers of the multiple probe fragments.
  • Such fragmentation may be induced randomly by shearing, sonication, RNase, RNase-H, UNG, single strand cutting enzymes, and like treatments, or alternatively at specific sequences with restriction enzymes.
  • two or more probe sets of WRAP-Probes or Mini- WRAP-Probes are provided, having probe sets that can be compared in the same assay, where the probes of each set have different universal linkers, and where the linkers provide binding sites for different multi-linkers, reporters or labeling that distinguish the probe sets from one another.
  • the present invention relates to a series of modified Poly-T Primer compositions for globally initiating the copying and conversion of mRNA transcripts into a set of WRAP-Probes.
  • the modified Poly-T Primer composition contains a polynucleotide in which the 3' end provides a poly-T primer segment to initiate RT polymerization and the 5' end provides a universal linker, wherein the linker can bind reporters to the probe.
  • the Poly-T Primer composition has a poly-T end that also contains an anchor sequence to preferentially bind to the forward end of the poly-A segment of mRNA transcripts.
  • the anchor sequence takes the form 5'- poly-T, V, N - 3', where poly-T is a series of thymidine bases, V is a variable base of adenine, cytosine or guanine, but not thymidine, and N is randomly any base.
  • Other anchor sequences can be employed including the sequence 5'- poly-T, V.
  • the Poly-T Primers are preferably made with about 12 to 20 thymidines in the poly-T segment.
  • a Poly-T Primer composition is manufactured with a capture moiety such as biotin on the 5' end so that the probe units can be captured with magnetic beads or other methods and retained, purified, treated, or reused to copy the original probe set.
  • the modified Poly-T Primer is manufactured with labeling elements attached, or alternatively, one or more reporters are pre-attached prior to use.
  • the modified Poly-T Primer is constructed with a multi-linker pre-attached, wherein reporters can be attached or pre-attached to the multi-linker. Such reporters can include GeneTAGs, TinkerTAGs or arrays of such reporters.
  • a set of two or more Poly-T Primer compositions are provided, that include different universal linkers, multi-linkers, reporters and label or labeling precursor so that each resulting probe subset can be distinguished by different signaling.
  • the present invention also relates to a series of adapter compositions for providing a second universal linker to the probe sets.
  • One product embodiment is a sequence specific adapter composition, called a Specific Adapter that is typically ligated to the 3' end of a DNA probe segment.
  • This adapter product contains two polynucleotides joined together by complementary bases, where the complementary bases are a set of universal linker sequences, and where one end contains an additional single-stranded overhang, typically of 1 to about 6 bases, that can specifically bind to the terminal end of a probe that has been cut with a specific restriction enzyme.
  • These Specific Adapters are also manufactured as a set of two or more such adapter products to allow sample comparisons, where each adapter in the set has a different universal linker sequence that can bind different reporters or multi-linkers.
  • the present invention also relates to a series of random adapter compositions for providing a second universal linker to the probe sets.
  • One embodiment is a Random Adapter product that is typically ligated to the end of a DNA probe segment.
  • the Random Adapter composition contains two polynucleotides joined together by complementary bases, where the complementary bases are a set of universal linker sequences, and where one end has an additional single-stranded overhang of random bases, typically of 1 to about 6 random bases.
  • Such random sequences which are also called degenerate sequences, are typically represented as an "N" in sequence descriptions and are chemically synthesized by providing alternatively and randomly: an adenine (A), thymidine (T), cytosine (C) or guanine (G), at each position in the random sequence.
  • a set of two or more Random Adapters are also provided by the invention to allow sample comparisons, where each adapter in the set has a different universal linker sequence.
  • Another product embodiment is a homopolymeric adapter composition that is also typically ligated to the end of a DNA probe segment, but in this case, the 3' end of the probes are first extended with a poly-C or poly-G sequence.
  • the homopolymeric adapter product contains two polynucleotides joined together by complementary bases, where the complementary bases are a set of universal linker sequences, and where one end contains an additional single-stranded overhang of poly- C or poly-G bases.
  • the homopolymeric adapter binds to a complementary tail of poly- G or poly-C sequences that is previously appended to the probes using terminal transferase and a sole nucleotide.
  • a set of two or more homopolymeric adapters is also provided to allow sample comparisons, where each adapter in the set has a different universal linker sequence.
  • the Specific Adapter, the Random Adapter or the Homopolymeric Adapter is labeled.
  • the present invention also relates to a series of extender products for providing a second universal linker to the probe sets.
  • One random extender composition called a Random End-Linker, binds to the end of a probe at random and extends its sequences as a copy of the linker sequences of the extender.
  • This extender includes a single- stranded polynucleotide with a 5' end containing universal linker sequences, and a 3' end containing random sequences, preferably about 4 to about 10 random sequences (also called degenerate sequences).
  • the Random End- Linker is chemically modified on the 3' end to block or prevent polymerase extension of that end, where one modification practiced is to add a carbon spacer to the 3' end.
  • the present invention provides a set of two or more Random End-Linker products to allow sample comparisons, where each composition in the set has a different universal linker sequence.
  • An alternate extender product of the present invention is a homopolymeric extender that includes a single- stranded polynucleotide with a 5' end containing universal linker sequences, and a 3' end containing poly-C or poly-G sequences, preferably of about 5 to about 15 poly-C or poly-G sequences.
  • the homopolymeric extender binds to a tail of poly-G or poly-C sequences that is previously added to the 3' end of a probe by terminal transferase.
  • the present invention provides a set of two or more homopolymeric extender products to allow sample comparisons, where each composition in the set has a different universal linker sequence.
  • the present invention relates to a universal linker-primer-reporter composition, called a ChipTAG, which includes a single-stranded polynucleotide with universal linker sequences that is manufactured with a label or labeling precursors attached and where the linker sequences provide both a primer function for DNA polymerase activity and a linker function to bind the labeled ChipTAG as a reporter to a probe.
  • ChipTAG compositions are provided to allow sample comparisons, where the ChipTAGs may differ from one another in both their linker sequences and in their pre-attached label or labeling precursors, and where different labeling is provided to different probe sets.
  • the present invention relates to a series of methods for gene expression arrays and related assays that enable the manufacture and application of the related composition of matter inventions described above.
  • These methods attach common reporters to the ends of a probe set, typically by virtue of universal linkers created at one or both ends of the probes, to give each probe in the set an essentially equivalent signaling level, thereby enabling a more effective count of the number of different transcripts in the original RNA sample.
  • these methods also allow internal labeling of the probes by standardmethods, either additionally or alternatively. Since some of the methods truncate the lengths of the probes so that their size variation is reduced or eliminated, these methods can additional enable the normalization of signaling between probes even when they are internally labeled.
  • These methods can additionally amplify the probe sets globally by virtue of the terminal universal linkers so that exponential amplification procedures such as PCR or related methods can be practiced if the probes have linkers at both ends, and so that linear amplification procedures can be practiced if the probes have one linker.
  • the present invention relates to a general method to make and apply WRAP- Probe probe sets for gene expression analysis, where more accurate quantitative detection is achieved by attaching common reporters to one or both ends of each probe, this method comprising: a. Providing RNA from a tissue sample; b. Making cDNA probes from the RNA transcripts with universal linkers at one or both ends; c. Hybridizing the cDNA probes to an array or series of gene specific targets; d. Joining reporters to the cDNA probes; and e. Detecting reporters to determine the expression of genes in the tissue sample.
  • the WRAP-Probe method produces a probe set with a single linker or reporter end, comprising: a. Hybridizing a modified poly-T primer with a universal linker to the mRNA transcripts; b. Polymerizing full or partial first strand cDNA copies of the transcripts to form one linker probes with a common 5' signaling end.
  • step 1 shows the use of the poly-T primer to make a first strand cDNA probe with a 5' universal linker
  • step 2 shows the binding of the probes to the cDNA chip
  • step 3 shows the binding of GeneTAGs to the linkers of the probes.
  • This one-linker WRAP-Probe method can bind multi-linkers and or reporters to the 5' universal linker affixed to the probes, including but not limited to GeneTAGs, TinkerTAGs or reporter arrays thereof, as well as ChipTAGs or commercially available reporters such as the bDNA reporters of Chiron Corp. [Urdea et al. (U.S. Pat. No. 5,124,246)] or the Dendrimer reporters of Polyprobe, Inc. [Nilsen and Prensky, (U.S. Pat. No. 5,487,973)], if such reporters were re-manufactured with nucleotide linking sequences that corresponded to the universal linkers of the WRAP-Probes of the present invention.
  • poly-T primer compositions are provided that have multi-linkers and or reporters and or label pre-attached, where a second step is not required to hybridize these signaling elements to the probes after the probes are hybridized to the targets of the expression assay.
  • the present invention also provides different one-linker probe sets, based upon differences in linker sequence, labeling and reporter attachment so that probe set comparisons can be performed on the same assay.
  • the most common form of the WRAP-Probe method is double-linker probes and the general method to make and apply double-linker WRAP-Probe probe sets comprises: a. Hybridizing the poly-T primercomposition with a universal linker to the mRNA transcripts; b.
  • each probe strand has a 5' and a 3' universal linker, wherein the 5' end is already suitable for effective end-to-end binding to the complementary 5' single stranded linker end of a typical GeneTAG, TinkerTAG or multi-linker. However, the 3' end is less suitable for such end to end binding.
  • the 3' ends of the probe set of the present invention are optionally modified by applying and cross-linking an additional polynucleotide linker that reverses the polarity of the probe end to provide a 5' universal linker end.
  • an additional polynucleotide linker that reverses the polarity of the probe end to provide a 5' universal linker end.
  • the universal linker sequences are typically designed with one or more 5'TA sequences to enable the application of PUVA cross-linking, wherein free psoralen plus UV blacklight treatment covalently joins contra-lateral thymidine bases.
  • a subset of GeneTAG reporters can be pre-made with 3' vs. 5' end linkers in a similar manner, or TinkerTAGs can be made directly with 3 ' end linkers.
  • the double-linker WRAP-Probe method provides several sub-methods to alternatively apply the second universal linker to the 3' ends of the first strand cDNA probes.
  • the first primary double-linker sub-method of the WRAP-Probe method employs restriction enzyme cutting and ligation of the Specific Adapter product to shorten the probes and form universal linkers at both ends, wherein the modifications comprise: a. Providing the Poly-T Primer composition with a capture moiety, such as biotin, at the 5' end; b. Polymerizing first strand cDNA and then second strand cDNA to form double stranded cDNA with a 5' first strand universal linker and a capture moiety. c. Cutting the double stranded cDNA products with a restriction enzyme; d.
  • FIG. 2 illustrates this method in step 1 , where the mRNA is converted to double stranded cDNA with one universal linker by copying the mRNA with RT and a modified poly-T primer, and by then polymerizing a second strand with DNA polymerase and RNase H.
  • Step 2 depicts cutting the probes with a restriction enzyme and capturing them with magnetic beads.
  • Step 3 depicts ligating the Specific Adapter to the 3' cut ends of the captured probes to append a second universal linker and to form double-linker probes.
  • Step 4 also depicts a further step in Step 4 that is not a part of the above method.
  • the probes are amplified by PCR amplification and either labeled internally with labeled bases or labeled on their ends using a ChipTAG labeled primer.
  • two or more restriction enzymes are employed in separate probe aliquots using Specific Adapters matched to the cut sites.
  • This modification is provided to ensure that no gene is unrepresented in a detection sample since the use of one restriction enzyme may cause a particular gene to always be cut at a site too close to the poly-A end of the transcript to produce a viable probe.
  • the separate probe aliquots are then mixed and applied together for analysis.
  • the second primary double-linker sub-method of the WRAP-Probe method employs the new random extender product, called a Random End-Linker, to form a second universal linker on the 3' end of the probes, where the extender is applied with a new thermal cycling procedure called Back-Tagging.
  • This method comprises the following modifications: a. Providing first strand cDNA probes with a 5' universal linker; b. Denaturing and removing the RNA; c. Repeatedly hybridizing the random extender to the probes under rapid thermal cycling conditions similar to PCR, wherein high temperature DNA polymerase and nucleotides are provided along with repeat cycles of high temperature denaturing, low temperature annealing, and moderate temperature but brief extension, to bind the random extender to the 3' ends of the probes via the random segment and to selectively extend the 3' ends of the probes using the universal linker segment of the random extender as a sequence template, to create a second universal linker on the 3' ends of the probes, to form a final double-linker probe set.
  • Step 3 illustrates this method in step 1 and step 2, where step 1 depicts how the mRNA is converted to first strand cDNA probes with one universal linker, although this illustration also depicts the short RT procedure where the first strand copy is stopped short.
  • Step 2 depicts binding of the random extender composition, called the Random End-Linker, to the probes during multi-cycle thermal cycling where the extender binds but does not prime if it binds anywhere along the probes except the 3' end, and where it extends the 3' end with a universal linker when it binds to the 3' end.
  • Step 3 of Figure 3 depicts a further step, not a part of this specific method, where the double linker probesare amplified by PCR with labeling incorporated in the bases or by using ChipTAG primers.
  • the Back-Tagging procedure employs thermal cycling and high temperature polymerase reagents common to the PCR method, it does not practice the PCR procedure to copy or exponentially amplify the products since the 3' end of the Random End-Linker is preferably blocked and cannot serve as a primer. Consequently, when the temperature is lowered each cycle to anneal the Random End-Linker products to the probes, these extenders will bind at random but will not function unless they happen to bind to the 3' end of the probe fragment. Indeed, the annealing step can be practiced at lower temperatures than would be employed for PCR since the goal is to force as many Random End-Linkers onto the probe strand as possible to increase the chances that one will bind to the 3' end.
  • the extenders will come off again each high temperature cycle in an unmodified state they will be reused on the next annealing cycle whereupon they might again bind to the 3 ' end.
  • it will extend 3' by polymerization using the linker sequences of the Random End-Linker as a template to form a 3 ' universal linker.
  • the blocked end of the random end-linker prevents copying any portion of the first strand fragments.
  • the formation of spurious fragments is avoided and the rapid use of nucleotides and enzyme is prevented. Therefore, thermal cycling can be continued for hundreds of cycles to effectively apply second universal linkers to the first strand probes.
  • This principle and method has multiple uses in the present invention and for other applications.
  • the third double-linker sub-method of the WRAP-Probe method employs the
  • Random Adapter product to append the second universal linker comprising the following modifications: a. Providing first strand cDNA probes with a 5' universal linker; b. Denaturing and removing the RNA; c. Joining the random adapter to the 3 ' end of the probes to append a second universal linker, to create a final double-linker probe set.
  • step 1 depicts how the mRNA is converted to first strand cDNA probes with one universal linker, although this illustration also depicts the short RT procedure where the first strand copy is stopped short.
  • step 2 depicts binding of the random adapter by ligation to the 3' end of the probes to form double linker probes.
  • step 3 of Figure 4 depicts a further step, not a part of this specific method, where the double linker probesare amplified by PCR with labeling incorporated either in the bases or on the ends by using ChipTAG primers.
  • the fourth double-linker sub method of the WRAP-Probe method employs homopolymeric tailing and application of the homopolymeric adapter product to append the second universal linker, comprising the following modifications: a. Providing first strand cDNA probes with a 5' universal linker; b. Denaturing and removing the RNA; c. Extending the 3' end of the probe fragments with a homopolymeric tail of poly-C or poly-G sequences using terminal transferase and one nucleotide; d. joining a matching homopolymeric adapter to the homopolymeric tail on the 3' ends of the probes to append a second universal linker and to create a final double-linker probe set.
  • homopolymeric extender can be substituted in the above procedure wherein this modification comprises the steps of: a. providing first strand cDNA probes with a 5' universal linker and a 3' homopolymeric tail of poly-C or poly-G sequences; b. joining a matching homopolymeric extender to the homopolymeric tail on the 3' ends of the probes and polymerizing a 3' extension, wherein the universal linker segment of the extender provides a sequence template for extending the 3' end of the probes with a second universal linker sequence, to create a final double-linker probe set.
  • step 1 and 2 of Figure 5 depict these methods using homopolymeric adapters or extenders.
  • step 1 depicts how the mRNA is converted to first strand cDNA probes with one universal linker, although this illustration also depicts the short RT procedure where the first strand copy is stopped short.
  • step 2 depicts alternatively either the binding of the homopolymeric extender on the left or the homopolymeric adapter on the right to extend or append the second universal linker unto the 3 ' end of the probes to form double linker probes.
  • step 3 of Figure 3 depicts the further step of amplifying these double linker probes by PCR with labeling incorporated either in the bases or on the ends by using ChipTAG primers.
  • the RT copying of the mRNAs is intentionally truncated by greatly reducing the duration of exposure to the enzyme to purposefully produce very short RT products, generally less than 1000 bases in length and preferably less than 500 bases.
  • Brief RT exposure times of several minutes or seconds are herein employed as contrasted with one hour or more of RT exposure by standard cDNA chip labeling methods.
  • Short-RT This radical modification of the RT protocol, called Short-RT, results in first strand cDNA probe components that are randomly and arbitrarily short such that pre-existing size differences between genes and gene transcripts are effectively eliminated, wherein the method normalizes the lengths of the probes, improves the ability to affix random end-linkers to the probe components, improves the kinetics of probe binding to the expression assay, and allows the internal labeling of the probes as a supplement to reporter binding without reintroducing bias in signaling between genes due to inherent differences in transcript length. Short probes also provide more efficient amplification of the double-linker probes by exponential procedures such as PCR.
  • the Short RT procedure is generally employed in conjunction with the double- linker WRAP-Probe methods described above that don't require a specific cut site to apply a second linker, wherein the modified steps comprise: a. Hybridizing a modified poly-T primer with a universal linker to the mRNA transcripts; b. Polymerizing truncated first strand cDNA copies of the transcripts by abruptly terminating RT polymerase progression by time, to form an initial set of shortened probe fragments with a 5' universal linker; c. Applying a second universal linker to the 3' ends of the shortened probes to create a final double-linker probe set.
  • the Short RT procedure is improved or augmented by additional treatments, including but not limited to cold, heat, alkali, enzymes such as RNase and RnaseH, single stranded cutting enzymes, UNG, shearing, sonication or like treatments.
  • additional treatments including but not limited to cold, heat, alkali, enzymes such as RNase and RnaseH, single stranded cutting enzymes, UNG, shearing, sonication or like treatments.
  • the present invention also relates to a modification of the double-linker WRAP- Probes method, called the Amplified WRAP-Probes method, to provide improved assay sensitivity, wherein the universal linkers affixed to both ends of the probes are used as primer sites to globally and exponentially amplify the probe set, the amplification method comprising: a. Providing a double-linker probe set with universal linker-primer sites on both ends; b. Providing primers that match or complement the universal linker-primer sequences of the probes; c. Amplifying the set of probes exponentially by PCR or related processes,; d. Denaturing and hybridizing the probes to an array or series of gene specific targets.
  • probe labeling may be incorporated enzymatically during PCR either by using bases conjugated directly with labeling agents, such as Cy3 or Cy5 fluorescent compounds, or by incorporating bases with labeling haptens such as amines, biotin or digoxygenin, whereupon labeling is added to the haptens in a second processing step.
  • labeling agents such as Cy3 or Cy5 fluorescent compounds
  • labeling haptens such as amines, biotin or digoxygenin
  • probe labeling employed direct labeling with Cy3-dCTP or Cy5-dCTP, or indirect labeling with amino-allyl dUTP (Sigma) to make amino-conjugated bases, whereupon the probes are then coupled to Cy dyes using Cy3 or Cy5 mono-functional reactive dye packs (AP Biotech).
  • the probe sets are alternatively or additionally labeled via the primers, such as the linker-primer- reporter products called ChipTAGs that comprise labeled universal linkers.
  • the primers such as the linker-primer- reporter products called ChipTAGs that comprise labeled universal linkers.
  • ChipTAG primers are manufactured with Cy5 on their 5' ends and provide the sole labeling for the probes. Since ChipTAGs can be labeled more efficiently than probes can be labeled internally, ChipTAG labeling can fully substitute for internal enzymatic labeling with just a few steps of probe amplification. By labeling the ends of the probes, ChipTAGs also improve quantification of signaling per probe.
  • the probes may be labeled by binding GeneTAG or TinkerTAG reporters to the universal linkers of the probes, generally after the probes are hybridized to the targets on the expression assay, such as in the Examples 2 and 3 below which employ GeneTAGs labeled directly with Cy5-dCTP bases.
  • multi-linkers as described previously could be applied to the probes to increase the number of reporters bound, and furthermore, the labeled primers, called ChipTAGs can be added to the probes before or after the probes are hybridized to the targets, so that any matching linker ends not having label will bind ChipTAGs and add label. This was practiced in Example 4 where an aliquot of ChipTAGs was added back to the probes denatured and applied to the expression arrays, thereby adding a second ChipTAG to the 3' end of each single stranded probe.
  • the modified poly-T primer product with a 5' capture moiety is employed to allow high fidelity re- amplification of the probe set.
  • the original double-linker probe products have a 5' capture moiety and they are then captured, separated and retained, so that these original copies may be selectively reused for additional amplifications of the probe set, such as in Examples 3 and 4 below.
  • This procedure can be applied to any of the double-linker probe methods to selectively capture, retain and reuse the first strand cDNA probes with linkers on both ends to amplify and re-amplify the first copy of the probes from the mRNA transcripts.
  • Examples 5, 6 and 7 employ Short RT to reduce probe length, wherein Examples 5 and 6 additionally employ the Random End-Linker and rapid thermal cycling with the Back-Tagging procedure to provide the second linker needed for PCR amplification, and wherein Example 7 additionally employs the Random Adapter to provide the second universal linker needed for amplification. Run on a gel, these amplified products form smears of shortened probes in the size ranges described above.
  • Additional embodiments of the Amplified WRAP-Probes method create and employ two or more sets of double-linker WRAP-Probes which differ in labeling, wherein multiple probe sets may be compared in the same assay.
  • the various WRAP-Probe methods described above, including the single and double-linker methods, the amplified methods, and the fragmented probes methods are additionally or alternatively provided direct signal amplification by applying various reporters to the universal linkers of the probe sets, wherein such reporters include, but are not limited to, GeneTAGs, TinkerTAGs, arrays thereof, and multi-linker and reporter constructs thereof as previously described.
  • reporters include, but are not limited to, GeneTAGs, TinkerTAGs, arrays thereof, and multi-linker and reporter constructs thereof as previously described.
  • the probes labeled with Cy3 fluorescence are applied to the expression arrays and then one or more GeneTAGs labeled with Cy5 fluorescence are added to each probe in a second hybridization. Therefore, the labeling provided by the probes and the added labeling provided by the GeneTAGs is evident since the two dyes are separately excited, scanned and detected in different channels as independent signals.
  • the present invention also embodies the application of commercial labeling agents, such as fluorescent reagents, electron transfer dyes, radioactive isotopes, the color emitting quantum dot products of Quantum Dot Corp., gold, Nanogold, or other metallic labeling agents, as well as various labeling haptens such as amines, thiols, biotin, digoxygenin, dinitrophenol, FITC, etc., wherein such products may be attached to the reagents of the present invention including the modified poly-T primers, the various adapters and extenders and the ChipTAGs, GeneTAGs, TinkerTAGs, and reporter arrays thereof as previously described.
  • commercial labeling agents such as fluorescent reagents, electron transfer dyes, radioactive isotopes, the color emitting quantum dot products of Quantum Dot Corp., gold, Nanogold, or other metallic labeling agents, as well as various labeling haptens such as amines, thiols, biotin, digoxygenin, dinitro
  • Oligonucleotide based expression arrays such as the GENECHIPs of Affymetrix, Inc., have different capabilities and limitations relative to cDNA based chips. Reflecting these differences, oligonucleotide-based arrays are less suited for probes made primarily from the poly-A end of gene transcripts since such oligo-based arrays frequently target upstream as well as downstream gene regions and fail to score expression for a gene if all the oligonucleotides on the chip representing that gene do not show labeling. Therefore, the present invention alternatively provides methods to generate probes that better represent the entire gene transcript.
  • the principle of this approach is to copy all or most of the entire transcripts, fragment the cDNA copies to make multiple probe fragments, and then use the methodsand compositions developed and described here to append universal linkers to all the fragments so that the fragment set can be globally amplified and applied to expression arrays.
  • the present invention thus relates to a method for gene expression analysis that is devised for oligonucleotide-based arrays, called the Mini- WRAP-Probes method, wherein multiple double-linker probes are made from each transcript, the method comprising the steps of: a. making first strand cDNA probes from a RNA sample; b. fragmenting the probes with a fragmenting agent, the fragmenting agent selected from the group consisting of restriction enzymes,
  • the random extender comprising the same universal linker sequence and the blocked 3' end to the probe fragments, wherein repeated thermal cycling is performed as described above to preferentially extend the 3' end of the second strand cDNA probe copies with a second universal linker sequence, to form double-linker probes from each probe fragment suitable for PCR amplification, labeling and application to expression assays, particularly oligonucleotide-based arrays.
  • Other embodiments of the Mini-WRAP-Probes methods employ these same procedures and reagents to create universal linkers on fragmented probes or fragmented DNA thus enabling either the amplification of the probes or fragments or the use of GeneTAGs and other reporters to increase probe signaling from small fragments.
  • DNA in preserved or frozen tissues such as clinical, pathological or forensic specimens
  • DNA fragments also appear in clinical specimens of blood and bodily fluids that are important indicators of disease or cancer but are difficult to concentrate or identify. Identifying degraded DNA is a particularly acute problem in studying Ancient DNA samples such as Egyptian and Etruscan mummies or biological samples preserved in glaciers, bogs, amber, etc.
  • the present invention provides additional modifications of the Mini-WRAP-Probe method to amplify and identify any DNA fragment or set of fragments, wherein the following steps are applied to make and analyze the sample: a. providing a sample of unknown DNA fragments; b.
  • a random probe modifier to the 3' end of the fragments to append a common universal linker, the random probe modifier selected from the group consisting of the random adapter composition and the random extender composition; c. polymerizing a second strand cDNA copy of the fragments with a primer comprising the universal linker sequence; d. applying the random extender composition, further comprising the same universal linker sequence and the blocked 3' end, to the fragments with repeated thermal cycling to preferentially extend the 3' end of the second strand cDNA copies with a second universal linker sequence, to form double-linker fragments suitable for PCR amplification; and e. amplifying the fragments and sequencing them to determine their sequence identity.
  • the probe modifier used to append the first universal linker is less critical, since there is only one potential 3' target for each probe fragment.
  • the random adapter is the simplest approach.
  • the random extender composition provides an important advantage since it will favor extending a 3' end which lacks a universal linker. Once a universal linker has been applied to a 3' end, another random extender attempting to anneal to that end will preferential bind the universal linker end of the random extender to the matching universal linker sequence already there - thus inactivating that extender molecule for that cycle. Consequently, the random extender composition will preferentially apply only one universal linker to each 3 ' end.
  • Mini-WRAP-Probes methods enable improved sensitivity with tissue microarrays or RNA arrays, wherein a cDNA probe prepared for such applications are modified by the above methods to append universal linkers to the probes, wherein the steps to make the probes comprise the following steps: a. providing a fragmented cDNA probe; b. applying a random probe modifier to append a first universal linker to the 3' end of the fragments; c. polymerizing a second strand cDNA copy of the fragments; d.
  • the random extender composition further comprising the same universal linker sequence and the blocked 3 ' end, to the fragments with repeated thermal cycling to preferentially extend the 3' end of the second strand cDNA copies with a second universal linker sequence, to form double-linker probe fragments; e. hybridizing the probes to an array of RNA targets; f. hybridizing reporter units to the linkers of the probes, the reporter units selected from the group of linker-primer-reporter compositions, multi-linkers, and reporters, the reporter comprising linear segments of label DNA or joined polynucleotides with a single stranded universal linker end; and g. detecting the reporter units to detect the RNA targets.
  • the purpose of this method is to maximize signaling by creating a fractured set of probes, each of which can be labeled internally during PCR amplification or by binding reporters to the universal linkers of the probes, wherein such reporters could include multi-linkers, GeneTAGs and GeneTAG arrays.
  • a very important need of molecular biology and drug discovery research is the necessity of determining the sequences at the 5' end of gene transcripts which are frequently under-represented or lost in common procedures (some of these procedures are called 5' RACE). Such information is needed to determine the functional full- length sequences of a gene for drug discovery and patenting issues.
  • the present invention provides a modified Mini-WRAP-Probe method wherein the Random Extender and the Back-Tagging procedure are employed to find and duplicate the absolute 3' end of first strand cDNA copies of a specific gene, wherein the steps of this procedure comprise the steps of: i) providing a set of mRNA transcripts wherein the 5' end of the gene of interest has been copied as first strand antisense cDNA by reverse transcriptase using a gene specific primer, wherein the gene specific primer additionally comprises a universal linker sequence and a capture moiety; ii) capturing and purifying the first strand cDNA copies of the targeted transcript; iii) applying the random extender composition with rapid thermal cycling to extend the 3' end of the cDNA product with a universal linker sequence, wherein a double-linker product is formed suitable for PCR amplification; and iv) amplifying and sequencing the double-linker cDNA product to determine the sequences of the 5' end of the gene.
  • PCR polymerase chain reaction
  • the protocol for PCR is set forth in Saiki et al., Science 230: 1350 (1985) and U.S. Pat. Nos. 4,683,195 and 4,683,202.
  • a PCR adapter-linker method is set forth in Saunders et al. (1990); Johnson (1990) and PCT 90/00434.
  • Another PCR method employing a mixture of primers is described in Meltzer et al., Nature - Genetics, 1 (1): 24-28 (April 1992).
  • Probe and reporter components of the present invention are also synthesized by conventional methods on a commercially available automated DNA synthesizer, e.g. an Applied Biosystems (Foster City, Calif.) model 380B, 392 or 394 DNA/RNA synthesizer.
  • a commercially available automated DNA synthesizer e.g. an Applied Biosystems (Foster City, Calif.) model 380B, 392 or 394 DNA/RNA synthesizer.
  • phosphoramidite chemistry is employed according to, e.g., Beaucage et al., Tetrahedron, 48:2223-2311 (1992); Molko et al., U.S. Pat. No. 4,980,460; Koster et al., U.S. Pat. No. 4,725,677; Caruthers et al., U.S. Pat. Nos.
  • the probe has a nuclease resistant backbone.
  • nuclease resistant backbone Many types of modified oligonucleotides are available that confer nuclease resistance, e.g. phosphorothioate, phosphorodithioate, phosphoramidate.
  • phosphorothioates see, e.g., Stec et al., U.S. Pat. No. 5,151,510; Hirschbein, U.S. Pat. No. 5,166,387; or Bergot, U.S. Pat. No. 5,183,885.
  • modified oligonucleotides are synthesized with internal spacers, commonly composed of carbon chains, which separate different functional regions of the oligonucleotide.
  • spacers derived from phosphoramidite precursors such as the carbon chain Spacer Phosphoramidites C9 or C18 from Glen Research, Inc.
  • modified oligonucleotides of the invention can be conveniently synthesized with commercial automated DNA synthesizers, e.g. Applied Biosystems, Inc. (Foster City, Calif.) model 394.
  • commercial automated DNA synthesizers e.g. Applied Biosystems, Inc. (Foster City, Calif.) model 394.
  • Spacer length may vary significantly depending on the nature of the probe and primer sequence.
  • spacer moieties are synthesized using conventional phosphoramidite and/or hydrogen phosphonate chemistries.
  • phosphoramidite or hydrogen phosphonate monomers suitable for use in the present invention are set forth in Newton et al., Nucleic Acid Research, 21 :1155-1 162 (1993); Griffin et al., J. Am. Chem.
  • the preferred linking agent is a ligase, such as T4 DNA ligase, using well-known procedures (Maniatis, T. in Molecular
  • T4 DNA ligase may also be used when the test substance is RNA [Engler, M.J. et al., The Enzymes, Vol. 15, pp. 16-17 (1982), Higgins, N. P. et al., Methods in Enzymology, Vol. 68, pp. 54-56 (1979)].
  • Ligases from thermophilic organisms e.g. Tth DNA ligase, Gene, Vol. 109, pp. 1-11(1991), New England Biolabs, (Beverly,
  • the linking agent may be a chemical agent which will cause the probe components to link together.
  • T4 DNA ligase As the linking agent. This enzyme requires the presence of a phosphate group on the 5' end of one polynucleotide and a 3' OH group on the neighboring polynucleotide.
  • the preferred cross linking agent is a bi- or tri-functional psoralen compound such as 4, 5', 8-trimethylpsoralen which intercalates the bases of hybridized DNA strands and causes covalent cross linking between them when treated with long wave ultraviolet light, preferably in the range of 312 to 360 nanometers.
  • Site specific cross-linking can also be facilitated by synthesizing an oligonucleotide probe component with a terminal psoralen molecule tethered by a carbon chain.
  • Commercial reagents such as C2 psoralen and C6 psoralen from Glen Research, Inc.
  • the probe and reporter molecules of this invention can be labeled during PCR amplification in the presence of appropriately modified dNTPs, or they can be labeled after completion of the PCR reaction by chemical or enzymatic modification of the PCR products.
  • the reporters are constructed of synthetic oligonucleotides, they can be labeled directly or indirectly by incorporating modified bases that either carry labeling agents or provide chemical or immunological means for the attachment of labeling agents.
  • such reporters may contain secondary linkers for binding short oligonucleotides that are conjugated to labeling agents - usually at one end.
  • modified dNTPs include but are not limited to Cy3 or Cy5 labeled derivatives of dUTP or dCTP, biotin- 16-dUTP; digoxigenin-11-dUTP; biotin derivatives of dATP; fluoresceinated-dUTP; rhodamine labeled derivatives of dUTP or dCTP; hydroxy coumarin-labeled derivatives of dUTP; resorufin-1 l-2'-dUTP, and thiol or amine modified dNTPs, e.g.
  • probe or reporter components include but are not limited to: (1) gold and silver particles; e.g. monomaleimido Nanogold, LI Silver, etc., Nanoprobes, Inc., (Stony Brook, NewYork); Colloidal Gold, Sigma Chemical Co. (Saint Louis, Missouri); (2) chemiluminescent or bioluminescent molecules such as aequorin, e.g.
  • probes or reporters may be amplified with a variety of systems, including but not limited to fluorochrome conjugated avidin and/or labeled antibodies.
  • fluorochrome conjugated avidin and/or labeled antibodies include but not limited to fluorochrome conjugated avidin and/or labeled antibodies.
  • other known detection schemes such as labeling of probe molecules with enzymes, sulfur or mercury may be applied in order to suit special experimental conditions.
  • oligonucleotide functionalizing reagents or to introduce one or more sulfhydryl, amino or hydroxyl moieties into probe or reporter sequences are described in U.S. Pat. No. 4,914,210.
  • modified nucleotides can provide multiple signaling sites by incorporating them along the length of the probe or reporter molecule or at the ends of attached oligonucleotides.
  • a 5' phosphate group can be introduced as a radioisotope by using polynucleotide kinase and gamma 32P- ATP to provide a reporter group.
  • Biotin can be added to the 5' end by reacting an aminothymidine residue, or a 6-amino hexyl residue, introduced during synthesis, with an N-hydroxysuccinimide ester of biotin.
  • Labels at the 3' terminus may employ polynucleotide terminal transferase to add the desired moiety, such as for example, cordycepin 35S-dATP, and biotinylated dUTP.
  • the present invention provides and contemplates the combination of the novel compositions of matters describe above, such as the Modified poly-T primers the various adapters and extenders, and the probe set compositions, wherein different variations may be created that are not specifically describe herein.
  • compositions of matter and methods of the present invention are contemplated to be employed in combination with other commercial probe and signaling systems such as the dendrimers of Polyprobe, Inc. (Media, Perm.) [U.S. Pat. No. 5,487,973] and the branch DNA (bDNA) components of Chiron Corp. (Emeryville, Calif.) [U.S. patent 5,124,246].
  • the probes and reporters of the present invention can be employed as diagnostic or drug discovery assays for a wide range of biomedical samples, including detection of nucleic acids and gene expression profiles in human diagnostics, forensics, and genomic analyses. See, e.g., .Schena et al., Science, 270: 467-470 (1995); Schena, et al., Proc. Natl. Acad. Sci., 93:10614-9 (1996); Shalon et al, Genome Res., 6: 639-45 (1996); DeRisi et al, Nature Genetics, 14: 457-60, (1996); Heller et al, Proc. Natl. Acad.
  • compositions and methods of the present invention can be readily employed in a variety of membrane formats such as expression macro and microarrays, dot blots, and Northern blots; in gels such as agar or polyacrylamide; in a variety of in situ formats to detect or map genes or RNA transcripts in sectioned tissue and tissue microarrays; in cultures or microwell plates to detect infectious microorganisms or unbound DNA fragments extracted from bodily fluids or wastes; and in various solid substrate chip formats that detect genes, mutations or mRNA expression levels, including but not limited to oligonucleotide microarrays, cDNA microarrays, and molecular detection chips employing fluorescence, radioactivity, optical interferometry, Raman spectometry or semi-conductor electronics.
  • membrane formats such as expression macro and microarrays, dot blots, and Northern blots
  • gels such as agar or polyacrylamide
  • in situ formats to detect or map genes or RNA transcripts in section
  • Example 1 Sample molecular compositions of the present invention:
  • Double-Linker WRAP-Probe Set 1 Showing one probe strand with Red and
  • Random Adapter Version with Blue Universal Linker: a first polynucleotide with blue linker, a random overhang sequence, typically of 2N's (indicated by Nl...Nn),and a second complementary polynucleotide preferably 5' phosphorylated: (Seq. ID. No. 3, 6)
  • Random End-Linker Version with Blue Universal Linker: Showing a polynucleotide with Blue linker sequences, a random overhang sequence, typically of 6 to 9N's (indicated by Nl...Nn), and a blocked 3' end. (Seq. ID. No. 3)
  • Homopolymeric Adapter Version with Blue Universal Linker: Showing a first polynucleotide with Blue linker sequences and a poly-C or poly-G sequence (indicated by Cl...Cn),and a second polynucleotide which is complementary to the first nucleotide and preferably 5' phosphorylated: (Seq. ID. No. 3, 6)
  • Green and Orange Linker/Primers with Cy3 fluor Green 5'-cy3-CCTAGACCTACGACATAGGTACCCTAC (Seq. ID. No. 2)
  • RNA is extracted from A549 lung cancer cells by standard methods.
  • Reverse transcriptase (RT) is then employed to copy the mRNA transcripts to cDNA using a Modified poly-T Primer known as R-GT-RTP (Seq. ID. No. 8) having a 3' end of 15 poly-T's and a 5' end with a universal linker sequence that is similar to but differing in part from the Red Universal Linker of Example 1.
  • R-GT-RTP Modified poly-T Primer
  • G-GT-RTP G-GT-RTP
  • RNA was combined with 2 ul of 100 picomol/ul R-GT-RTP (Seq. ID. No. 8), lOx PCR buffer II, 25 mm MgC12, 1 ul each of 10 mM dATP, dGTP and dTTP, 6 ul of 1 mM dCTP, 3 ml of 1 mM Cy3 dCTP (AP Biotech), and dH2O, and the mixture was placed in a 70 degrees C. waterbath for 10 min and allowed to cool at room temperature for 5 min.
  • MuVL reverse transcriptase enzyme Perkin Elmer
  • RNase inhibitor Perkin Elmer
  • Type I GeneTAGs with a First-RED linker on the proximal end and Type II GeneTAGs with a First-GREEN linker on the proximal end were made and both types were labeled "red" with Cy5-dCTP by PCR amplification of an arbitrary MTB template, 600 bp long, using 2 ul of .25 ug/ul of template.
  • the primers employed for Type I GeneTAGs are RR-SPC-F (SEQ ID NO. 10, 11) and GR-SPC-R: (SEQ ID NO. 12, 13) using 2 ul each at 10 pmol/ul.
  • the primers employed for Type II GeneTAGs are GR-SPC-F: (SEQ ID NO.
  • RR-SPC-R (SEQ ID NO. 15, 13) using 2 ul each at 10 pmol/ul.
  • the internal spacers are identified as 99 indicating two C9 phosphoramidite spacers (Glen Research). Fluorescent labeling is accomplished during PCR amplification of the reporters wherein nucleotides are added with low dCTP (6 ul of 1 mM) plus normal dATP, dTTP and dGTP (1 ul each of 10 mM) plus 3 ul of 25 uM Cy5-dCTP. Taq, lOx buffer and dist. H2O were added and the mixture cycled 40 times at 94 degrees C, 55 degrees C and 72 degrees C for about 1 min per step. The products were purified twice with a Centri-Sep spin column.
  • the probes were hybridized overnight at 65 degrees C. to cDNA chips arrayed on poly-L-lysine coated glass slides with a Genetic Microsystems spotter using 5 ul of probe mixed with 7 ul of hybridization buffer, said buffer consisting of 3.5 x SSC and .2% SDS and containing Cot 1 DNA, poly-A RNA, and tRNA. Each gene location on these chips are duplicated 5 times in vertical columns. After a brief wash with hybridization buffer, GeneTAGs were hybridized for an additional 2 hours under the same conditions. The chips were gently washed for 5 min each in three steps: 1) 2xSSC, 0.1% SDS, 2) IxSSC, and 3) 0. IxSSC.
  • GeneTAG Modified Poly-T Primers a) First-RED Linker version R-GT-RTP (Seq. ID. No. 8) 5' CTACGATACGATAGGGCCTAAGAGTAG-TTTTTTTTTTTTTTTTTTTT b) First-GREEN Linker version G-GT-RTP (Seq. ID. No. 9) 5' GCCTAGACCTAGGGGTAGCTAGGCTAC-TTTTTTTTTTTTTTTTTTTTT Type I GeneTAG Spacer Ohgomers: a) Proximal Spacer Oligomer RR-SPC-F: (SEQ ID NO. 10, 11) 5' CTACTCTTAGGCCCTATCGTATCGTAG-
  • Type II GeneTAG Spacer Ohgomers a) Proximal Spacer Oligomer GR-SPC-F: (SEQ ID NO. 14, 1 1)
  • the chips are scanned with a Genetic Microsystems laser scanner and produce two gene expression profiles from the "green” channel and the “red” channel showing, respectively, differential signaling with both the labeled probes and with the labeled GeneTAGs bound to the probes. Since each gene target arrayed on these chips is duplicated in vertical columns five times, it is easy to see and confirm true differences in gene expression between genes. Approximately 20 gene locations on the chip show highly significant "green” labeling indicating specific gene expression levels for these cells, and approximately 200 gene locations showed significant "red” labeling indicating additional gene expression labeling provided by the GeneTAGs bound to the probes. Labeling intensity varies per each vertical set of gene targets for both the green and red channels indicating gene expression monitoring. See Figure 6A and B.
  • Example 3 Double-linker WRAP-Probe Method with Restriction Cutting and Adapter Ligation
  • a 40 ug sample was treated with reverse transcriptase (RT) and a Modified Poly-T Primer to make ds cDNA copies of the mRNAs with a first linker, to cut and capture the end fragments, and to add a second linker by ligating an adapter.
  • the following steps were employed to make the probes and perform a chip analysis: 1. Full length first strand cDNAs were made with one hour exposure to MuVL RT (Gibco) at 37 degrees C. using a Modified Poly-T Primer (Seq. ID. No. 16) having a 5' biotin capture moiety, an overlap linker sequence and a poly-T segment. Nucleotides including Cy3-dCTP (AP Biotech) were incorporated as described above to provide "green" labeling.
  • RT reverse transcriptase
  • Modified Poly-T Primer to make ds cDNA copies of the mRNAs with
  • Double stranded cDNA was made with E. coli DNA polymerase I, Rnase H and DNA ligase (Gibco kit) with a two hour exposure at 16 degrees C.
  • the ds cDNAs were treated with the restriction enzyme Nla III (New England Nuclear) for 7 hours at 37 degrees C. and purified twice with Centi-Sep spin columns.
  • a pre-annealed First-RED Specific Adapter (Seq. ID. No. 17, 18) was prepared and ligated to the fragments with T4 DNA ligase (Boehringer Mannheim) for 30 min. at 37 degrees C. providing a first 5' First-RED Linker sequence.
  • the adapter modified fragments were again captured on magnetic beads, denatured with .2 M NaOH, and the eluted probes retained and neutralized.
  • a two part overlap linker (Seq. ID. No. 19) was annealed and cross linked to the ss probes to form a second 5' First-RED-Linker.
  • Such probes are double-linker WRAP probes.
  • PCR amplification was initially accomplished with a set of primers consisting of a first primer, which is the First-RED version of GeneTAG Modified Poly-T Primer used above (Seq. ID. No. 8), (this binds to the poly- A segment of the sense cDNA), and of a second primer, which is the First-RED Linker- primer (Seq. ID. No. 20) which contains the same sequences as the 5' end of the first primer.
  • PCR is conducted for 10 cycles at 94 degrees 30', 48 degrees 30' and 72 degrees 45'. Then PCR amplification is repeated for 30 cycles using only the GeneTAG First-RED primer.
  • a pre-annealed First- GREEN Specific Adapter (Seq. ID. No. 21, 22) could be employed for ligation to the cut sites, and thus, the resulting probes could be PCR amplified with the First-GREEN Modified Poly-T Primer (Seq. ID. No. 9). and a First-GREEN primer (Seq. ID. No. 23) in the same manner as described above using the First-RED compositions.
  • the above GeneTAG First-GREEN or First-RED compositions could be employed together such that one primer would employ the First-GREEN linker/primer sequence and the other would employ the First-RED linker/primer sequence.
  • Type III GeneTAGs have a proximal linker which binds to the First-RED Linker sequences of the WRAP-Probes and two distal linkers that bind to the proximal linker of Type IV GeneTAGs.
  • the chips are washed once and then Type IV GeneTAGs are applied for two additional hours.
  • the chips are then washed three times as described in Example 2 above. These chips are similarly prepared with vertical duplications of different gene targets, but in this case, four sets of targets vs.
  • GeneTAG Components Modified RT primer (Seq. ID. No. 16)
  • Example 4 WRAP-Probe method with restriction cutting, adapter ligation and ChipTAG labeling
  • a 10 microliter probe sample from Step 7b. of Example 3 above was re- amplified by PCR and applied to chips as described in Examples 2 and 3 above.
  • the First-RED ChipTAG primer (Seq. ID. No. 24) was employed as a single primer to globally amplify all probe products.
  • internal labeling was not employed, and thus bound labeling was achieved from a single Cy5 fluor being attached to the 5' end of each single stranded probe component.
  • RT reactions used Superscript II RT and 5x RT buffer (Gibco kit), dNTPs, and 0. IM DTT and no labeling reagents.
  • Step 2 The above Control and ANT-1 samples were added to separate 30 ul reactions containing 100 picomoles of the First-GREEN version GeneTAG Random End-Linker (Seq. ID. No. 26), plus 1 OxPCR buffer, dNTPs, Taq polymerase and dH2O.
  • the GeneTAG End-Linkers are 3' modified to prevent forward copying. Because of this modification, they are only effective in this reaction if they bind partially to the 3' end of the probes via the random segment and serve as a template to back extend the probes with a GeneTAG linker/primer sequence.
  • PCR thermal cycling is then performed at 94 degrees C. for 10 sec, 42 degrees C. for 30 sec, and 72 degrees for 10 sec, for a total of 198 cycles.
  • the products are purified with spin columns. This sub- procedure commonly extends the 3' ends of the probes with the First-GREEN GeneTAG linker sequence providing a second linker/primer site.
  • the First-RED version GeneTAG End-Linker (Seq. ID. No. 27) is employed to put a First-RED GeneTAG linker sequence on the 3' end.
  • the N's listed in the End-Linker sequences below indicate bases which are randomly incorporated during oligonucleotide synthesis as either A, T, G, or C.
  • Step 3 The above Control and ANT-1 samples are again subjected to PCR cycling, but this time with conditions allowing the exponential amplification and labeling of the probes using the double-linker sites as primer sites.
  • the samples are added to 100 ul PCR reactions containing 100 picomoles of the GeneTAG First- GREEN primer (Seq. ID. No.
  • the amino-conjugated bases of the Control probes are then coupled to Cy3 dye and the amino-conjugated bases of the ANT-1 probes are coupled to Cy5 dye using Cy3 or Cy5 monofunctional reactive dye packs from APBiotech.
  • the reactions are quenched with hydroxylamine to prevent cross coupling. Unincorporated or quenched Cy dyes are removed by purification with QiaQuick columns (Qiagen) and the labeled probes are concentrated by drying with a SpeedVAC.
  • the probes were combined and one fifth the resulting sample was hybridized to mouse expression microarrays at 65 degrees C for 16 hrs in 3.5xSSC plus 2% SDS and washed as described above. This sampling is essentially equivalent to starting with 10 nanograms of poly-A mRNA per sample. This procedure gave very short probes with limited chip signaling suggesting the need to reduce hybridization temperature and increase RT timing.
  • the Short RT and Random End-Linker method was more effective with longer RT extension periods.
  • the following examples were prepared from experiments with human monocytes (derived from Red Cross buffy coat preps) to compare Control monocytes and IL-13 Treated monocytes.
  • Step 1 Essentially the same procedures from Step 1 of Example 5 above were employed except that the starting samples consisted of 1 microgram of total RNA per sample and the RT reaction for the Control RNA used the First-GREEN Modified
  • the RT reactions of 20 microliters contained 100 picomoles of GeneTAG Modified Poly-T Primer, 1 ul RT enzyme (Superscript II) and 4 ul 5xbuffer (Gibco kit), 1 ul dNTPs, 2 ul 0.1 M DTT and dH2O.
  • the primers and RNA templates were mixed at 72 degrees C. for 5 min, and then the enzyme and other components were added and maintained at 42 degrees C. for various Short RT times of either 2, 5, 10 or 20 minutes, followed by 75 degree C. treatment for 15 min to stop the cDN A copying reaction prematurely from all transcripts regardless of gene specific differences in transcript length.
  • the products were purified with Bio-Spin P-30 chromatography columns (Bio-Rad).
  • Step 2 This multi-cycle step was performed essentially the same as in Example 5 above except that the Control samples employed the First-GREEN Random End- Linker (Seq. ID. No. 26) while the IL-13 Treated samples employed the First-RED Random End-Linker (Seq. ID. No. 27). Thus the Control probes would have First- GREEN linker/primer sites at both ends while the IL-13 Treated probes would have First-RED linker/primer sites at both ends.
  • Step 3 This step was performed essentially the same as in Example 5 above except that the probes from the 20 min Short RT procedure were labeled with P-32 dCTP vs.
  • the Control probes were amplified by PCR using the GeneTAG First-GREEN primer (Seq. ID. No. 20), and the IL-13 Treated probes were PCR amplified with the GeneTAG First-RED primer (Seq. ID. No. 23).
  • 30 ul of probe template was employed with 100 picomoles of First-GREEN or First-RED for a total of 30 PCR cycles. Both products were purified, counted and adjusted to yield probes with an activity of one million cpm/ml.
  • Nylon membranes were arrayed with 10 gene target samples that were arranged in vertical columns of five slot blots per column. Each membrane of approximately 6 by 10 cm duplicated this 10 gene array pattern twice in a side by side arrangement. Each dot contained 200 nanograms each of plasmid cDNA from 6 candidate and 4 control targets: candidates: 5-LO, 12-LO, FLAP, COX-1, COX-2, 15-LO, controls: Leptin, TNF-alpha, yeast and h- Actin. The target samples were denatured with 0.1 N NaOH, neutralized with Tris-HCl buffer, and UV crosslinked.
  • Membranes were prehybridized for 4 hours in rotating roller bottles with 20 ml of hybridization solution (Rapid-hyb buffer, Amersham Life Science). The labeled and amplified probes were then added for overnight hybridization at 48 degrees C. with the same solutions, and then they were washed sequentially with 2xSSC and 0.1 % SDS for 15 min , 0.2xSSC for 15 min 2 times, and 0. IxSSC for 15 min also at 48 degrees C. Expression profiling was obtained by exposing x-ray film for 12 hours. The repeated patterns evident within membranes also differed slightly between control and IL-13 treated monocytes, and as expected, IL-13 treatment up-regulated the expression activity of 15-LO. See FigurelO.
  • Example 7 Amplified WRAP-Probe method with Short RT and random Adapter (on membrane arrays)
  • Example 6 The same samples prepared for Example 6 above were also employed for an alternate method of attaching the second linker /primer sequence with a ligated GeneTAG Adapter.
  • the PCR extension time was also increased from 30 sec to 1.5 min to allow more representation of the longer RT products in the sample of amplified probes. This change also shifts the sampling that will appear on the chip. Since all prior methods for expression microarrays are biased in signaling relative to probe length, further study is needed to determine which profiling pattern will prove to be more accurate.
  • Step 1 Essentially the same procedures from Step 1 of Example 6 were employed with starting samples consisting of 1 microgram of total RNA per sample. All samples were from monocyte controls and the RT reactions used the First-GREEN Modified Poly-T Primer (Seq. ID. No. 9) to produce the first linker/primer site. Alternatively, the First-RED Modified Poly-T Primer (Seq. ID. No. 8) could be employed for other comparisons. Short RT was conducted as described above with reduced RT exposure times of 2, 5, 10 or 20 minutes.
  • Step 2 This step was performed quite differently from that of Example 4 above since, in this case, the second linker/primer site was affixed to the 3' ends of the probes by direct ligation of First-GREEN Random Adapters.
  • These random Adapters are composed of two oligonucleotides that are annealed together and of which one component provides a two base overhang of random sequences.
  • These Random Adapters consist of a first oligonucleotide with First-GREEN linker sequences on the 5' end and two N's on the 3' end (Seq. ID. No. 28), and of a second oligonucleotide (Seq. ID. No.
  • Adapters 29 with sequences complementary to the First-GREEN linker sequences and with the 5' end phosphorylated during synthesis to facilitate ligation.
  • a First-RED version of such Adapters could be employed which is made of a first oligonucleotide with First-RED linker sequences on the 5' end and two N's on the 3' end (Seq. ID. No. 30), and of a second oligonucleotide (Seq. ID. No. 31) with sequences complementary to the First-RED linker sequences.
  • the two Random Adapter oligonucleotides were mixed together at a concentration of 100 picomoles/ul per product and then annealed for 2 hours at 37 degrees C.
  • Step 1 The probes can be amplified and labeled by PCR with standard methods.
  • a 100 ul reaction of 20 cycles is conducted with 10 ul of probe product (after Adapter ligation), 1 ul of First-GREEN Linker (Seq. ID. No. 23) at 100 pmols/ul, 10 ul of lOx PCR buffer, 8 ul of dNTPs, 1 ul of Taq polymerase and dH2O.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne une série de compositions de réactifs ainsi que des procédés de préparation et d'amplification de nouveaux ensembles de sondes à base d'ADNc, à partir d'échantillons d'ARN, aux fins d'amélioration de l'analyse à l'aide de matrices d'expression de gènes. Ces procédés permettent globalement de produire des ensembles de sondes au moyen de segments de liaison universels communs, au niveau d'une ou des deux extrémités des sondes, ces ensembles étant dénommés sondes 'WRAP'(enroulement de séquence autour du brin cible) et caractérisés en ce que les segments de liaison ne se lient pas aux séquences cibles et peuvent lier de manière efficace des marqueurs ajoutés, aux sondes. Les segments de liaison universels sont également conçus en tant que sites de liaison d'amorces, aux fins de copie et d'amplification des sondes, soit linéairement au moyen d'un segment de liaison, soit exponentiellement au moyen de segments de liaison doubles. La capacité d'amplifier globalement et exponentiellement l'ensemble de sondes par une réaction PCR constitue un premier avantage. L'ajout de marqueurs au moyen de segments de liaison terminaux améliore également la quantification étant donné que chaque sonde obtient une signalisation équivalente. L'invention permet l'analyse d'expression de petits échantillons de recherche, cliniques et médico-légaux, contribuant à l'établissement de meilleurs diagnostics, à la découverte de médicaments, à la surveillance thérapeutique ainsi qu'à une recherche générale, médicale et agricole.
PCT/US2001/007508 1999-07-16 2001-03-09 Systemes et procedes de quantification et amplification a la fois d'elements de signalisation et de sondes, dans des puces d'adnc et des matrices de micro-echantillons d'expression WO2001066802A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US10/380,596 US7482443B2 (en) 2000-03-09 2001-03-09 Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays
AU2001243523A AU2001243523A1 (en) 2000-03-09 2001-03-09 Systems and methods to quantify and amplify both signaling and probes for cdna chips and genes expression microarrays
US12/334,036 US20090275029A1 (en) 1999-07-16 2008-12-12 Systems and Methods to Quantify and Amplify Both Signaling and Probes for CDNA Chips and Gene Expression Microarrays
US13/403,012 US8673570B2 (en) 2000-03-09 2012-02-23 System and methods to quantify and amplify both signaling and probes for cDNA chips and gene expression microarrays

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US60/187,982 2000-03-09
US74409701A 2001-01-16 2001-01-16

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/US1999/016242 Continuation-In-Part WO2000004192A1 (fr) 1998-07-17 1999-07-16 Procedes de detection et de mappage de genes, de mutations et de sequences de polynucleotides du type variant
US74409701A Continuation-In-Part 1999-07-16 2001-01-16

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10380596 A-371-Of-International 2001-03-09
US12/334,036 Continuation US20090275029A1 (en) 1999-07-16 2008-12-12 Systems and Methods to Quantify and Amplify Both Signaling and Probes for CDNA Chips and Gene Expression Microarrays

Publications (1)

Publication Number Publication Date
WO2001066802A1 true WO2001066802A1 (fr) 2001-09-13

Family

ID=24991415

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/007508 WO2001066802A1 (fr) 1999-07-16 2001-03-09 Systemes et procedes de quantification et amplification a la fois d'elements de signalisation et de sondes, dans des puces d'adnc et des matrices de micro-echantillons d'expression

Country Status (1)

Country Link
WO (1) WO2001066802A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002028876A2 (fr) * 2000-10-05 2002-04-11 Riken Lieurs oligonucleotidiques comprenant une partie cohesive variable et procede de preparation de banques de polynucleotides au moyen desdits lieurs
DE10355593A1 (de) * 2003-11-28 2005-07-07 Advalytix Ag Verfahren zur Hybridisierung biologischer Makromoleküle auf an einer Festkörperoberfläche gebundene PCR-Produkte
WO2008119072A1 (fr) * 2007-03-28 2008-10-02 Illumina, Inc. Procédés pour détecter de petites espèces d'arn
US8076067B2 (en) * 2006-08-15 2011-12-13 Genetag Technology, Inc. Probe-antiprobe compositions and methods for DNA or RNA detection
EP2677039A3 (fr) * 2006-05-10 2014-02-19 Dxterity Diagnostics Détection de cibles d'acides nucléiques au moyen de sondes oligonucléotidiques chimiquement réactives
US10508304B2 (en) 2011-07-07 2019-12-17 Children's Medical Center Corporation High throughput genome-wide translocation sequencing
US10640820B2 (en) 2014-11-20 2020-05-05 Children's Medical Center Corporation Methods relating to the detection of recurrent and non-specific double strand breaks in the genome
WO2020113569A1 (fr) * 2018-12-07 2020-06-11 深圳华大生命科学研究院 Procédé de séquençage d'acide nucléique à long fragment
EP4017978A4 (fr) * 2019-08-20 2023-09-13 DOTS Technology Corp. Sondes d'acide nucléique optimisées pour la détection d'analytes

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5618712A (en) * 1985-11-12 1997-04-08 Boehringer Ingelheim Zentrale Gmbh Human lysozyme
WO1998051699A1 (fr) * 1997-05-12 1998-11-19 Life Technologies, Inc. Procedes permettant de produire et de purifier les molecules d'acide nucleique
US5866336A (en) * 1996-07-16 1999-02-02 Oncor, Inc. Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
US5876932A (en) * 1995-05-19 1999-03-02 Max-Planc-Gesellschaft Zur Forderung Der Wissenschaften E V. Berlin Method for gene expression analysis
WO2000004192A1 (fr) * 1998-07-17 2000-01-27 Emory University Procedes de detection et de mappage de genes, de mutations et de sequences de polynucleotides du type variant

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5618712A (en) * 1985-11-12 1997-04-08 Boehringer Ingelheim Zentrale Gmbh Human lysozyme
US5876932A (en) * 1995-05-19 1999-03-02 Max-Planc-Gesellschaft Zur Forderung Der Wissenschaften E V. Berlin Method for gene expression analysis
US5866336A (en) * 1996-07-16 1999-02-02 Oncor, Inc. Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
WO1998051699A1 (fr) * 1997-05-12 1998-11-19 Life Technologies, Inc. Procedes permettant de produire et de purifier les molecules d'acide nucleique
WO2000004192A1 (fr) * 1998-07-17 2000-01-27 Emory University Procedes de detection et de mappage de genes, de mutations et de sequences de polynucleotides du type variant

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002028876A2 (fr) * 2000-10-05 2002-04-11 Riken Lieurs oligonucleotidiques comprenant une partie cohesive variable et procede de preparation de banques de polynucleotides au moyen desdits lieurs
WO2002028876A3 (fr) * 2000-10-05 2002-08-01 Riken Lieurs oligonucleotidiques comprenant une partie cohesive variable et procede de preparation de banques de polynucleotides au moyen desdits lieurs
US8809518B2 (en) 2000-10-05 2014-08-19 Riken Oligonucleotide linkers comprising a variable cohesive portion and method for the preparation of polynucleotide libraries by using said linkers
DE10355593A1 (de) * 2003-11-28 2005-07-07 Advalytix Ag Verfahren zur Hybridisierung biologischer Makromoleküle auf an einer Festkörperoberfläche gebundene PCR-Produkte
DE10355593B4 (de) * 2003-11-28 2005-12-01 Advalytix Ag Verfahren zur Hybridisierung biologischer Makromoleküle auf an einer Festkörperoberfläche gebundene PCR-Produkte
EP2677039A3 (fr) * 2006-05-10 2014-02-19 Dxterity Diagnostics Détection de cibles d'acides nucléiques au moyen de sondes oligonucléotidiques chimiquement réactives
US8076067B2 (en) * 2006-08-15 2011-12-13 Genetag Technology, Inc. Probe-antiprobe compositions and methods for DNA or RNA detection
WO2008119072A1 (fr) * 2007-03-28 2008-10-02 Illumina, Inc. Procédés pour détecter de petites espèces d'arn
US10508304B2 (en) 2011-07-07 2019-12-17 Children's Medical Center Corporation High throughput genome-wide translocation sequencing
US10640820B2 (en) 2014-11-20 2020-05-05 Children's Medical Center Corporation Methods relating to the detection of recurrent and non-specific double strand breaks in the genome
WO2020113569A1 (fr) * 2018-12-07 2020-06-11 深圳华大生命科学研究院 Procédé de séquençage d'acide nucléique à long fragment
EP4017978A4 (fr) * 2019-08-20 2023-09-13 DOTS Technology Corp. Sondes d'acide nucléique optimisées pour la détection d'analytes

Similar Documents

Publication Publication Date Title
US20090275029A1 (en) Systems and Methods to Quantify and Amplify Both Signaling and Probes for CDNA Chips and Gene Expression Microarrays
CN111032881B (zh) 核酸的精确和大规模平行定量
US6268147B1 (en) Nucleic acid analysis using sequence-targeted tandem hybridization
US6613516B1 (en) Preparation of nucleic acid samples
JP4860869B2 (ja) 固相支持体上の複数のポリヌクレオチドを増幅し、検出する方法
EP1564306B1 (fr) Procédé de fragmentation et de marquage d'ADN
US20170354967A1 (en) Lab-on-chip system for analyzing nucleic acid
WO2000026412A1 (fr) Analyse d'acides nucleiques par hybridation en tandem ciblee sur des sequences
WO2009065355A1 (fr) Procédé et système de séquençage de l'adn
JP2008017853A (ja) 分析物の検出、定量及び増幅のための新規な組成物および方法
US20020127575A1 (en) Partially double-stranded nucleic acids, methods of making, and use thereof
WO2007106802A2 (fr) Procédé d'amplification linéaire d'adn modifié au bisulfite
JPH05502594A (ja) オリゴヌクレオチドの酵素的合成
WO2000004192A1 (fr) Procedes de detection et de mappage de genes, de mutations et de sequences de polynucleotides du type variant
WO2001066802A1 (fr) Systemes et procedes de quantification et amplification a la fois d'elements de signalisation et de sondes, dans des puces d'adnc et des matrices de micro-echantillons d'expression
WO2020193769A1 (fr) Procédé et kit de séquençage à haut débit
US8673570B2 (en) System and methods to quantify and amplify both signaling and probes for cDNA chips and gene expression microarrays
CN117730155A (zh) 用于核酸杂交的增强子寡核苷酸
EP1573057A2 (fr) Analyse d'expression genique dirigee a l'aide d'oligonucleotides
EP1136568A1 (fr) Procede de detection d'acide nucleique
US20100113298A1 (en) Detection of rna with micro-arrays
EP3798318A1 (fr) Procédé et kit de séquençage à haut débit
Kamau-Gatogo Development of RNA microchip for pathogen and cancer direct detection
JPH08322598A (ja) Ｄｎａ分子索引法
JP2006180755A (ja) 核酸標識方法、該方法に用いるプライマー・セット、ならびに、該方法によって調製される標識化された核酸

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 10380596

Country of ref document: US

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP