WO2001066724A1 - A novel polypeptide, a human actin 14 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a human actin 14, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammations etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human actin 14.

Description

 A new polypeptide-human actin 14 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human actin 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique

 Actin plays an important role in cell structure, cell movement, and the formation of contractile forces between muscle cells and non-muscle cells. Actin and actin isomers are found in many organs. Although the amino acid sequences of these actins are very similar, they are different protein products produced by different genes [Peter A. Rubenstein, BioEssay, 1990 , 12: 309—315].

 There are three actin isomers in spinal animals: a, and a. "Actin is found in muscle tissue and plays an important role in muscle contraction; P and gamma actin are expressed in many cells, such as components of the cytoskeleton and mediators of intracellular movement. Actin Protein not only plays an important role in the formation of muscle contractile force, but also plays an important role in the physiological process of non-muscle cells, such as: cytoplasmic circulation, cell morphogenesis, and cell wall deposition.

 Different actin isomers have obvious tissue-specific expression, which indicates that these proteins have important physiological functions in different tissues. In muscle cells, they are specifically related to the structure and function of mitochondria and neuromuscular junctions. These proteins are also related to various physiological functions of microvascular adventitial cells and intestinal epithelial cells [Rubenstein PA, BioEssay, 1990, 12: 309-315] ... Therefore, abnormal expression of these proteins in organisms will cause the above organs and Cells are dysfunctional, which causes various diseases of the above-mentioned tissues.

Actin exists either as a monomer or as a polymer. Each actin monomer can bind a molecule of ATP. During protein polymerization, ATP is hydrolyzed to provide the energy required for protein action. Actin usually contains the following three conserved consensus sequences, Sequence 1: [ FY]-[LIV] -G- [DE]-EAQX- [RQ] (2) -G; Sequence 2: W- [IV]-[STA]-[RK] -X- [DE] -Y- [ DNE]-[DE] ¾ Sequence 3: [LM]-[LIVM] -TE- [GAPQ] -X- [LIVMFYWHQ] -N- [PSTAQ] -X (2)-N- [KRL First two conservative sequences Specific for all actins, the third conserved sequence is present in both actin and actin-like proteins. These conserved sequence fragments are the sites where the protein functions physiologically. Mutations in some specific sites in these three sequence fragments will lead to abnormal protein function and cause various diseases of related tissues, such as diseases of the microvascular system, intestinal tissue diseases and some related diseases. Diseases related to the motor system.

 The new human protein of the present invention also contains two conserved sequence pieces f¾ of the actin family, which is a new member of the human actin family and is similar to other members of the family and has similar biological functions-its Abnormal expression may be related to the occurrence of some diseases of the microvascular system, diseases of the intestinal tissue, and some diseases related to the motor system.

 Analysis by gene chip revealed that in the thymus, testis nine, muscle, spleen, lung, skin, thyroid, liver, PMMA 10 Ec v 304 cell line, PM.4-Ec v 304 cell line, non-starved L 02 Cell line-In the L 02 cell line and prostate tissue stimulated by arsenic for 1 hour, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human actin 41, so the functions of the two may also be similar. The invention is named human actin 14,

 Tian Yu As mentioned above, the human actin 14 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be involved in these processes in the art. Isolation of the human actin 1 4 protein, especially the identification of the amino acid sequence of this protein, the isolation of the new human actin 14 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing disease and / or therapeutic drugs, so isolating its coding DNA is important. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human actin 14 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human actin 14

 It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding human actin 14.

 Another object of the present invention is to provide a method for producing human actin 14.

 Another object of the present invention is to provide antibodies against the polypeptide-human actin 14 of the present invention. Another object of the present invention is to provide mimetic compounds against the polypeptide-human actin 14 of the present invention, Antagonists, agonists, inhibitors.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to human actin 14 abnormalities.

The present invention relates to an isolated polypeptide. The polypeptide is of human origin and comprises: SEQ ID No. 2 ,,. The peptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to the polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 22 0-5 to 97 in SEQ ID NO: 1; and (b) a sequence of 1 in SEQ ID NO: 1 -246 7-bit sequence.

 The invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention: a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell: a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human actin 14 protein activity, which comprises utilizing the polypeptide of the present invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human actin 14 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human actin 14.

 Other aspects of the present invention will be apparent to those skilled in the art due to the disclosure of the technology herein.

The following terms used in this specification and claims have the following meanings unless specifically stated otherwise: "Nucleic acid sequence" means an oligonucleotide, a nucleotide or a polynucleotide, and a fragment or part thereof. It may also refer to a genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides or protein sequences and fragments or portions thereof-when the invention Where the "amino acid sequence" in reference to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" is not meant to limit the amino acid sequence to the protein Molecularly related complete natural amino acids.

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide modifications or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as using color Glycine.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to proteins with the structural, regulatory, or biochemical functions of natural molecules. Similarly, the term "immunological activity" refers to natural, recombinant, or synthetic proteins and fragments thereof that induce specific Immune response and ability to bind specific antibodies.

 An "agonist" refers to a molecule that, when combined with human actin 14, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human actin 14.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human actin 14, can block or regulate the biological or immunological activity of human actin 14. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human actin 14.

 "Regulation" refers to a change in the function of human actin 14, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human actin 14.

 "Substantially pure" means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human actin 14 using standard protein purification techniques. Substantially pure human actin 14 produces a single main band on a non-reducing polyacrylamide gel. The purity of human actin 14 peptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" may be combined with the complementary sequence "G-A-C-T"-the complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" One,

Crossing: This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Laser gene software package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Cluster method divides each group of sequences by checking the distance between all pairs. Arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (Hein J., (1990) Methods in emzumology 183: 625-645). "Similarity" refers to amino acids The degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to the epitope of human actin 14.

"Humanized antibody" means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody ,.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the coexisting substances in the natural system. Such a polynucleotide may be part of a vector-or it may be such a polynucleotide or polypeptide that is part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, in the natural state of living cells, polynucleotides and peptides are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state. .

As used herein, "isolated human actin 14" means that human actin 14 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human actin 14 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human actin protein purity 14 polypeptide amino acid sequence analysis _can,:,

 The present invention provides a new polypeptide, human actin 14, which basically consists of the amino acid sequence shown in SEQ II) NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the starting methionine residue:

The invention also includes fragments, derivatives and analogs of human actin 14. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of human actin 14 of the present invention. A fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution is The amino acid may or may not be encoded by a genetic codon; or (II) such a type in which an A group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as the previous sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art. The present invention provides an isolated nucleic acid (nucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ II) NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue; it contains a full-length polynucleotide sequence of 2467 bases, and its open reading frame 220-597 encodes 125 amino acids, according to the gene chip Comparison of expression profiles revealed that this peptide has a similar expression profile to human actin 41, and it can be deduced that the human actin 14 has a similar function to human actin 41.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. A variant of this polynucleotide can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50% identity between the two sequences, preferably 70¾ identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /. (V / v) formamide, 0.1% calf serum / 0.1 lF i co ll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% or better, which is better Hybridization does not occur until 97% or more. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, "core "To 10, to 20-30, to 50-60 nucleotides, and preferably at least 100 nucleotides to two. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to determine and / or A polynucleotide encoding human actin 14 is isolated.

 The polypeptide and polynucleotide in the present invention are preferably provided in an isolated form, and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human actin 14 of the present invention can be obtained by various methods. Polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridizing a probe to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) antibodies expressing the library Screen to detect cloned polynucleotide fragments having common structural characteristics.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also available from commercial sources (Qiagene). The construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of human actin 14 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The gene itself or the fragment of the present invention can of course be used as a probe. The label of the DNA probe can be a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human actin 14 gene expression.

A method for amplifying DNA / RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. Especially difficult to get from the library The primers of c, -c, can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The gene of the present invention obtained as described above by the conventional methods such as gel electrophoresis for isolation and purification of amplified DNA / RNA fragments, or the polynucleotide sequences of various DNA fragments, etc. can be performed by conventional methods such as dideoxy chain termination (Sanger et al. PNAS, 1977, 74: 5463-5467) Assays: Commercially available sequencing kits can also be used for this type of polynucleotide sequence determination. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence:

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human actin 14 coding sequence, and a method for producing the polypeptide according to the present invention by recombinant technology .

 In the present invention, a polynucleotide sequence encoding human actin 14 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; MSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct recombinant expression vectors. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human actin 14 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant technology (Sambroook, et al. Molecular Cloning , a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989) the DNA sequence may be ₀ operably linked to expression An appropriate promoter in the vector to direct mRNA synthesis. Representative examples of these promoters are: lac or U _P E. coli promoter; [lambda] phage PL promoter; eukaryotic promoters include the CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Inserting the enhancer sequence into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs. They act on promoters to enhance genes. Transcription. Examples include 100 on the late side of the origin of replication. , One

Toxic enhancer and so on.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, etc. It will be clear to those skilled in the art how to select the appropriate vector / transcription control element (such as promoter, enhancer, etc.) and selectable marker gene.

 In the present invention, a polynucleotide encoding human actin 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaC I. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant human actin 14 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally, the following steps are taken:

(1) using the polynucleotide (or variant) encoding human human actin 14 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing the host cell in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include but Not limited to: regular sexual treatment, egg sink treatment (), cardiac, permeation, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high

Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human actin 14 and human actin 41 of the present invention. The upper graph is a graph of the expression profile of human actin 14 and the lower sequence is the graph of the expression profile of human actin 41.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human actin 14 isolated. 14 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention will be further described in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the description and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are usually performed according to the conventional conditions such as Sarabrook et al., Molecular Cloning: Laboratory Manual (New York: told Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human actin 14

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. A Smart cDNA cloning kit (purchased from C Ion tech) was used to insert the 01) ^ fragment into a multi-cloning site of a pBSK (+) vector (Clontech) to transform DH5 α to form a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elraer) and ABI 377 automatic sequencer (Perkin-Eier) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined c DNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0423el0 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full-length cDNA contained in the 0423el0 clone is 2467b _P (as shown in Seq IDNO: 1), and has a 377bp open reading frame (0RF) from 220bp to 597b _P , which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS_0423el 0 and the encoded protein was named human actin 14.

I Example 2: Cloning of a gene encoding human actin 14 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Primer 1: 5'- ATGGGGTTCTTAAATATGACACCA-3 '(SEQ ID NO: 3)

 Primer 2: 5'- CTGTGCCTGTTGGCGTTTCCGGGT-3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;

 Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50-leg ol / L KC1, 10mraol / L Tris-CI, (pH8.5), 1.5mmol / L MgCl ₂ , 200 μmol / L dNTP, lOpmol in a reaction volume of 50 μ 1 Primer, 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elraer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, (3-act in was used as a positive control and template blank was used as a negative control. Amplification products were purified using QI AGEN's kit, and TA cloning kit was used to connect to the pCR vector (Invitrogen)). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l_2467bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human actin 14 gene expression:

Total RNA was extracted by a one-step method [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA was precipitated at 70 ° / °. Wash with ethanol, dry and dissolve in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare labeled DNA probes by random primer method. The DNA probe used was the PCR-amplified human actin 14 coding region sequence (220b _P to 597bp) shown in Figure 1. The 32P-labeled probe (about 2 x 10 ⁶ cpm / nil) was transferred with RNA nitrocellulose membrane hybridized overnight at 42 ° C in a solution, the solution comprising 50% formamide _{-25niM KH, P0 4 (pH7.4)} -5 χ SSC-5 x Denhardt's solution, and 200 μ g / ml Salmon sperm DNA. After hybridization, the filters were washed in 1 SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human actin 14

According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed. 歹¹ J is as follows:

Primer 3: 5'-CATGCTAGCATGGACAATAAGCACACGAAAAGA_3, (Seq ID No: 5) Primer 4: 5,-CCCAAGCTTTTAACCCACTGAAGCACATTTAGG-3 '(Seq ID No: 6) The 5 ′ ends of these two primers contain Nhel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The pBS-0423el0 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing _P BS_0423elO quality fel0pg, primers Primer-3 and Primer- 4 points, and ¹ J was lOpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 C 20s, 60 ° C 30s, 68 C 2 min for a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28, respectively, and large fragments were recovered. T4 ligase was used for ligation. . The ligated product was transformed into E. coli DH5cx by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 () μ ₈ / _ηΐ 1), positive clones were selected by colony PCR method and sequenced: A positive clone (pET-0423elO) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In a LB liquid medium containing kanamycin (final concentration 30 g / ml), the host bacteria BL21 (pET-0423elO) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. Continue incubation for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using His. Bind Quick Cartridge (product of Novagen) with 6 histidines (6His-Tag binding). Purified target protein human actin 14. After SDS-PAGE electrophoresis, a single band was obtained at 14kDa (Figure 2) «The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method As a result, the 15 amino acids at the N-terminus are exactly the same as the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of an anti-human actin 14 antibody

 The following peptides specific for human actin 14 were synthesized using a peptide synthesizer (product of PE):

 NH2-Met-Asp-Asn-Lys-Hi s-Thr-Lys-Arg-Cys-Ser-Thr-Ser-Leu-Va 1-Thr-

C00H (SEQ ID NO: 7). The peptide is coupled to hemocyanin and bovine serum albumin to form a complex-see: Avrameas, et a 1. Immunochemistry, 1969; 6: 43. Rabbits were immunized with ½ g of the above-mentioned hemocyanin white peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15A titer plate coated with 15 μg / m 1 bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation showed that the purified antibodies could specifically interact with Human / Dynamic White 14 Combination Buying Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 The selection of suitable oligonucleotide fragments from the polynucleotides of the invention has many uses as hybridization probes. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal or pathological tissue from different sources.

'J. Determine whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence Whether the expression in normal or pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide from the polynucleotide SEQ ID NO: 1 of the present invention-and use it as a hybridization probe, and use a filter hybridization method to identify whether some tissues contain the multicore of the present invention. Nucleotide sequence or its homologous polynucleotide sequence: Filter hybridization methods include dot printing, Sou thern printing: i, Nor thern blotting and copying methods, etc., all of which are polynucleotide samples to be tested After immobilizing on the second membrane, the same step hybridization was used. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps: This embodiment uses higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and Only strong specific signals are retained. The probes selected in this embodiment include two types: the first type of probes are oligonucleotide fragments that are identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially similar to this The same or complementary oligonucleotide fragment of the polynucleotide SEQ ID NO: 1 of the invention. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe is Needle-to-sample hybridization has the strongest specificity and is retained.

First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1-The probe size preferably ranges from 18 to 50 nucleotides;

 2-GC content is β Ο ^ ί ί, non-specific hybridization increases;

 3, there should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as preliminary selection probes, and then subjected to computer sequence analysis, including the selected probes and their source sequence regions (ie, SEQ ID NO: 1) and other known genomic sequences and The complementary regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are over 15 consecutive bases, then the primary probe should not be used; 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments to select and synthesize the following two probes after completing the above analysis:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene chip of SEQ ID NO: 1 (41Nt):

 TGGACAATAAGCACACGAAAAGATGCTCAACATCATTAGTC -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'- TGGACAATAAGCACACGAAACGATGCTCAACATCATTAGTC -3 '(SEQ ID NO: 9) For other common reagents not listed in the following specific experimental procedures and their preparation methods, please refer to the following: DNA PROBES GH Ke i ler; MM Manak; Stockton Press , 1989 (USA) and more commonly used molecular cloning laboratory manuals such as the Guide to Molecular Cloning Experiments (Second Edition 1998) [US] Sambruck et al., Science Press

 † Preparation:

 1.Extract DNA from fresh or frozen tissue

 Steps: 1) Place fresh or freshly thawed normal liver tissue in ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. The tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenization buffer (0.25mol / L sucrose; 25 let ol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mmol / L MgCl ₂ ) to suspend the precipitate (about 10ml / g 4) at 4 C Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1 to 5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method.

 2, DNA phenol extraction method

Ho steps of: 1) with l-10ml cold PBS washed cells, 1000 _g centrifugation for 10 min. 2) with cold cell lysate pelleted cells were resuspended (1 ¹⁰⁸ cells / nil) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ral. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the aqueous phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) The DNA-containing aqueous phase is transferred to a new tube and then the DNA is purified and ethanol precipitated. 3- DNA purification and ethanol precipitation

Essence: 1) Add 1/10 volume of 2moi / L sodium acetate and 2 volumes of cold 100% ethanol to NA solution. Mix well and leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or ii '::: ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol, wash the pellet with 500ul of cold ethanol, and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, and then invert on the absorbent paper to dry the residual ethanol with air for 10-15 minutes to evaporate the surface ethanol. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet with a small volume of TE or water _:, vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully dissolved, 1- 5 χ 1ϋ. Approximately lui extracted from cells

 The following steps 8-13 are only used when pollution must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution at a final concentration of 100ug / mi, and incubate at 37 ° C for 30 minutes-9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 C for 30 minutes. 10) Equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) Extract the reaction solution and centrifuge for 10 minutes. 11) '> Remove the aqueous phase with an equal volume of chloroform: isoamyl alcohol (24: 1 ) Re-extract and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol ZL sodium acetate and 2.5 volumes of cold ethanol, and mix well for -WC i hours. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid, the process is the same as step 6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Preparation of -20 '' sample film after packing:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film was washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5raol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0. IOD / ΊΟ μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² Ρ- (1ΑΤΡ + 2Γ Kinase, to make up to a final volume of 20 μ 1.

 2) 37 Γ for 2 hours:

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

4) Pass Sephadex G-50 column. -ro e one on tor.

 b) 5 drops / tube, collect 10-15 tubes.

 -) Monitor liquid isotope with liquid scintillator

8) After the collection solution of the first peak is combined, the ³² P_Probe (the second peak is free γ- ³² Ρ_dATP) to be prepared,

 Pre-hybridization

 Place the sample membrane in a plastic bag, add 3-10 mg of pre-hybridization solution (10xDenhardf s; 6xSSC, ϋ. Lmg / ml CT DNA (calf thymus DNA).), Seal the bag, 68. C water bath for 2 hours. Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash the membrane:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) ϋ. LxSSC, 0.1% SDS, 40. Wash for 15 minutes (twice) and dry at room temperature.

X-ray auto-development:

 -70X, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactivity of the hybridization spots of the above two probes; while the hybridization experiments conducted under high-intensity membrane washing conditions, the radioactivity of the hybridization spots of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. 7 DNA Microarray croarray

The companies are starting to develop and develop new technology. It refers to the orderly and high-density arrangement of a large number of target gene fragments on sloped glass, silicon and other carriers, and then uses fluorescence detection and computer software to compare and analyze data. In order to achieve the purpose of fast, efficient and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the literature Helle, RA, Schema, M Chai, A., Shalom, I)., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of different full-length cDNAs were prepared as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul. A Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA) was used for the glass media. The distance between them is 280 μ _ηΐ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

Were extracted with a ho method from human mixed structure with body specific tissue (or via stimulated cell line) total mRNA, and treated with Oligotex mRNA Midi Kit (available from QiaGen Inc.) purified mRNA, the other points ¹ J to burn by reverse transcription Cy3dUTP (5-Amino-pr opargy 1-2 '-deoxyur i dine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissues, and the fluorescent reagent Cy5dUTP (5 -Amino-propargy 1-2 · -deoxyur idine 5--triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. With :

 Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science .270. (20): 467-480. (3) Hybridization

 Probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. The scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L 02 cell line , Arsenic stimulated L 02 cell line and prostate tissue for 1 hour. Plot a graph based on these 13 C y 3 / C y 5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human actin 14 and human actin 41 according to the present invention are very similar. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 Actin and actin isomers α, β, and γ are found in many organs. Alpha actin plays an important role in the formation of muscle contractile force. Beta and diaphragm actin are expressed in many cells, such as components of the cytoskeleton and mediators of intracellular movement, in non-muscle cells. Physiological processes play important roles, such as: cytoplasmic circulation, cell morphogenesis, and cell wall deposition.

 Studies have found that in muscle cells, actin isomers are specifically related to the structure and function of mitochondria and neuromuscular junctions. Actin isomers are also related to various physiological functions of microvascular adventitial cells and intestinal epithelial cells [Rubenstein P. Α., BioEssay, 1990, 12: 309-315]. Therefore, the expression of these proteins in vivo is abnormal Will cause the above organs and cells to function abnormally, thereby causing various diseases of the above-mentioned tissues. The actin isoform-specific motif-containing polypeptide of the present invention has the above functions.

It can be seen that the abnormal expression of human actin 14 of the present invention will cause various diseases, especially skeletal muscle, cardiac muscle, and smooth muscle dyskinesia caused by dyskinesia of myoblasts. These diseases include but are not limited to :

 Rhabdomyotrophy: Atrophic atrophy, neurotrophy such as myasthenia gravis, spinal muscular atrophy, muscular pseudohypertrophy, primary muscular dystrophy such as Duchemie muscular dystrophy, tonic muscular dystrophy, myasthenia, retardation Dyskinesia, dystonia

 Myositis: Myocarditis such as autoimmune myocarditis, cardiomyopathy such as tonic cardiomyopathy, hypertrophic cardiomyopathy, restricted cardiomyopathy

 Dysfunction of smooth muscles caused by autonomic disorders: autonomic disorders gastrointestinal dyspepsia, irritable bowel

 Tumors and Tumor-like Lesions of Muscle Tissue: Leiomyoma and Rhabdomyosarcoma

 Because actin isomers are also related to various physiological functions of microvascular adventitial cells, abnormal expression of human actin 14 of the present invention will cause microvascular dysfunction diseases, including but not limited to: Raynaud's disease Vasculitis

 The abnormal expression of human actin 14 of the present invention will also produce certain hereditary, hematological diseases and immunity. The present invention also provides screening compounds to identify improving (agonist) or repressing (antagonist) human actin 1 4 methods of medicament. Agonists enhance human actin 14 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human actin 14 can be cultured with labeled human actin 1 4 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human actin 14 include selected antibodies, compounds, receptor deletions and analogues. Antagonists of human actin 14 can bind to human actin 14 and eliminate its function, or inhibit the function. The production of a polypeptide, or binding to the active site of the polypeptide prevents the polypeptide from performing biological functions. When screening compounds as antagonists, human actin 1 4 can be added to the bioanalytical assay-by measuring the compound against humans The effect of the interaction between actin 14 and its receptors to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human actin 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human actin 14 molecules should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human actin 14 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fa b fragments, and fragments produced by Fa b expression libraries,., It can be obtained by the method of muscle 14 (, small, rat, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc. Techniques for preparing monoclonal antibodies to human actin 14 include, but not Limited to hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human actin 14.

 Anti-human actin 14 antibodies can be used in immunohistochemical techniques to detect human actin 14 in biopsy specimens.

 Monoclonal antibodies that bind to human actin 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human actin 14 high-affinity monoclonal antibodies can be co-conjugated with bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to use a thiol crosslinking agent such as SPDP, By attacking the amino group of the antibody, the toxin is bound to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human actin 14 positive cells.

 The antibodies in the present invention can be used to treat or prevent human actin 14-related diseases. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human actin 14.

 The invention also relates to diagnostic test methods for quantitative and localized detection of human actin 14 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human actin 14 detected in the test can be used to explain the importance of human actin 14 in various diseases and to judge the diseases in which human actin 14 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis, for example, the polypeptide can be specifically cleaved by physical, chemical or enzyme, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding human actin 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or abnormality caused by the non-expression or abnormal / inactive expression of human actin 14. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human actin 14 to inhibit endogenous human actin 14 activity. For example, a variant of human actin 14 is shortened and lacks signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, recombinant gene therapy vectors can be used to treat human actin 14 ;,, Adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human actin 14 into a cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human actin 14 can be found in the literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human actin 14 can be packaged into liposomes and transferred into cells.

 Methods for introducing polynucleotides into tissues or cells include: Injecting the polynucleotides directly into tissues in the body: Or, first introduce the polynucleotides into cells through a vector (such as a virus, phage, or plasmid) in vitro-and then transplant the cells Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human actin 14 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and using phosphoric acid for the linkage between ribonucleosides. A thioester or peptide bond instead of a phosphodiester bond.

 The polynucleotide encoding human actin 14 can be used for the diagnosis of diseases related to human actin 14. The polynucleotide encoding human actin 14 can be used to detect the expression of human actin 14 or the abnormal expression of human actin 14 in a disease state. For example, the DNA sequence encoding human actin 14 can be used to hybridize biopsy specimens to determine the expression of human actin 14. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue. Human actin 14 specific primers can also be used to detect human actin 14 transcripts by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).

 Detection of mutations in the human actin 14 gene can also be used to diagnose human actin 14-related diseases. Human actin 14 mutations include point mutations and translocations compared to normal wild-type human actin 14 DNA sequences , Deletions, reorganizations, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so Northern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.

The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. At present, the specificity of each gene on the chromosome needs to be identified Site. Now, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome positions. According to the present invention, in order to correlate these sequences with disease-related genes, the important first step is to associate these with The DNA sequence is located on the chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. Then, these primers are used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those that contain corresponding primers Hybrid cells of the human gene will produce amplified fragments:

 The somatic hybrid cell PCR mapping method is a fast method for mapping DNA to a specific chromosome. Using the oligonucleotide primers of the present invention, a set of fragments from a specific chromosome or a large number of genomic clones can be used by similar methods Achieve sub-positioning. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific cDNA libraries. ''

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step. For a review of this technique, see Vernm et al., Human Chroraosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988)

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the cDNA or genomic sequence differences between the affected and the affected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with a PCA based on cDNA sequence. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there can be medicines manufactured, used or sold by ,, Or the government agency that sells it allows it to be administered to humans. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human actin 14 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human actin 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Book

I. An isolated polypeptide-human actin 14, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: la) encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, an analog, Derivative polynucleotide

 (b) a polynucleotide complementary to the polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of said polynucleotide comprises the sequence of positions 220-597 in SEQ II) NO: 1 or the sequence of positions 1-2467 in SEQ ID NO: 1 .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier:

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide of any of claims 4-6:

 9. A method for preparing a polypeptide having human actin 14 activity, characterized in that the method includes:

(a) culturing the engineered host cell of claim 8 under the condition of expressing human actin 14;

(b) A polypeptide having human actin 14 activity is isolated from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human actin 14.

II. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human actin 14.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID D NO: 1.

 13. An application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human actin 14 in vivo and in vitro.

14. A method for detecting a disease or disease associated with a polypeptide according to any one of claims 1-3, comprising detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is applied to a mimetic, agonist, antagonist or inhibitor of human actin 14; or for peptides Fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used for manufacturing a gene core. ^ Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human actin 14 abnormality.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.