WO2001062904A1

WO2001062904A1 - Regulation of human gelatinase b-like enzyme 1

Info

Publication number: WO2001062904A1
Application number: PCT/EP2001/001926
Authority: WO
Inventors: Shyam Ramakrishnan
Original assignee: Bayer Aktiengesellschaft
Priority date: 2000-02-24
Filing date: 2001-02-21
Publication date: 2001-08-30
Also published as: AU4415501A

Abstract

Reagents which regulate human gelatinase B-like enzyme 1 activity and reagents which bind to human gelatinase B-like enzyme 1 gene products can be used to regulate extracellular matrix degradation. Such regulation is particularly useful for treating metastasis of malignant cells, tumor angiogenesis, inflammation, atherosclerosis, neurodegenerative diseases, and pathogenic infections.

Description

REGULATION OF HUMAN GELATINASE B-LIKE ENZYME 1

TECHNICAL FIELD OF THE INVENTION

The invention relates to the area of regulation of extracellular matrix degradation. More particularly, the invention relates to the regulation of human gelatinase B-like enzyme 1 activity to increase or decrease extracellular matrix degradation.

BACKGROUND OF THE INVENTION

Metastasizing cancer cells invade the extracellular matrix using plasma membrane protrusions that contact and dissolve the matrix with proteases such as gelatinase. Agents which inhibit such protease activity can be used to suppress metastases. Proteases also are expressed during development, when degradation of the extracellular matrix is desired. In cases where appropriate extracellular matrix degradation does not occur, supplying a molecule with a protease activity can provide the necessary enzymatic activity. Thus, there is a need in the art for identifying new proteases and methods of regulating extracellular matrix degradation.

SUMMARY OF THE INVENTION

It is an object of the invention to provide reagents and methods of regulating extracellular matrix degradation These and other objects of the invention are provided by one or more of the embodiments described below.

One embodiment of the invention is a gelatinase B-like enzyme 1 polypeptide comprising an amino acid sequence selected from the group consisting of amino acid sequences which are at least about 50'% identical to the amino acid sequence shown in SEQ ID NO 2 and the amino acid sequence shown in SEQ ID NO 2 Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a gelatinase B-like enzyme 1 polypeptide comprising an amino acid sequence selected from the group consisting of amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2 and the amino acid sequence shown in SEQ ID NO. 2. Binding between the test compound and the gelatinase B-like enzyme 1 polypeptide is detected. A test compound which binds to the gelatinase B-like enzyme 1 polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation. The . agent can work by decreasing the activity of the gelatinase B-like enzyme 1.

Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a polynucleotide encoding a gelatinase B-like enzyme 1 polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence shown in SEQ ID NO. 1. Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation. The agent can work by decreasing the amount of the gelatinase B-like enzyme 1 through interacting with the gelatinase B- like enzyme 1 mRNA.

Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation. A test compound is contacted with a gelatinase B-like enzyme 1 polypeptide comprising an amino acid sequence selected from the group consisting of amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2 and the amino acid sequence shown in SEQ ID NO. 2. A gelatinase B-like enzyme 1 activity of the polypeptide is detected. A test compound which increases gelatinase B-like enzyme 1 activity of the polypeptide relative to gelatinase B-like enzyme 1 activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation. A test compound which decreases gelatinase B-like enzyme 1 activity of the polypeptide relative to gelatinase B-like enzyme 1 activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.

Even another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation. A test compound is contacted with a gelatinase B-like enzyme 1 product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence shown in SEQ ID NO. 1. Binding of the test compound to the gelatinase B-like enzyme 1 product is detected. A test compound which binds to the gelatinase B-like enzyme 1 product is thereby identified as a potential agent for decreasing extracellular matrix degradation.

Still another embodiment of the invention is a method of reducing extracellular matrix degradation. A cell is contacted with a reagent which specifically binds to a polynucleotide encoding a gelatinase B-like enzyme 1 polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence shown in SEQ ID NO. 1. Gelatinase B-like enzyme 1 activity in the cell is thereby decreased.

The invention thus provides reagents and methods for regulating extracellular matrix degradation which can be used inter alia, to suppress metastatic activity of malignant cells and to enhance extracellular matrix degradation during development. BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 shows the DNA-sequence encoding a gelatinase B-like enzyme 1.

Fig. 2 shows the amino acid sequence of a gelatinase B-like enzyme 1.

DETAILED DESCRIPTION OF THE INVENTION

The invention relates to an isolated polynucleotide encoding a gelatinase B-like enzyme 1 polypeptide and being selected from the group consisting of:

a) a polynucleotide encoding a gelatinase B-like enzyme 1 polypeptide comprising an amino acid sequence selected from the group consisting of amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2 and the amino acid sequence shown in

SEQ ID NO. 2;

b) a polynucleotide comprising the sequence of SEQ ID NO. 1;

c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b);

d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code; and

e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d).

Furthermore, it has been discovered by the present applicant that regulators of a human gelatinase B-likc cn/ynic 1 can be used to regulate degradation of the extracellular matrix. Gelatinase B-like enzyme 1 contains a typical zinc metalloprotease domain, HEIGH (SEQ ID NO. 4). Gelatinase B-like enzyme 1 degrades extracellular matrix proteins. This activity can be suppressed, inter alia, by molecules which bind to the enzyme, particularly to its metalloprotease domain, or by suppressing expression of the gene encoding the enzyme. Alternatively, if desired a gelatinase B-like enzyme 1 function can be supplied to a cell by introducing a gelatinase B-like enzyme 1 -encoding polynucleotide into the cell.

Gelatinase B-Like Enzyme J Polypeptides

Gelatinase B-like enzyme 1 polypeptides according to the invention comprise an amino acid sequence as shown in SEQ ID NO. 2, a portion of that amino acid sequence, or a biologically active variant of the amino acid sequence shown in SEQ ID NO. 2, as defined below. The asterisks in SEQ ID NO:2 represent the positions of stop codons introduced into SEQ ID NO. 1, which encodes SEQ ID NO. 2, by sequencing errors. A gelatinase B-like enzyme 1 polypeptide of the invention therefore can be a portion of a gelatinase B-like enzyme 1 molecule, a full-length gelatinase B-like enzyme 1 molecule, or a fusion protein comprising all or a portion of a gelatinase B-like enzyme 1 molecule.

Most preferably, a gelatinase B-like enzyme 1 polypeptide has a metalloprotease activity. Thus, gelatinase B-like enzyme 1 polypeptides preferably comprise the zinc metalloprotease domain HEIGH (SEQ ID NO. 4) or a biologically active variant of that domain.

Biologically Active Variants

Gelatinase B-like enzyme 1 variants which are biologically active, i.e., retain a gelatinase B-like enzyme 1 activity, also are gelatinase B-like enzyme 1 polypeptides. Preferably, naturally or non-naturally occurring gelatinase B-like enzyme 1 variants have amino acid sequences which are at least about 50, preferably about 75, 90, 96, or 98% identical to an amino acid sequence shown in SEQ ID NO.

2. Percent identity between a putative gelatinase B-like enzyme 1 variant and an amino acid sequence of SEQ ID NO. 2 is determined using the Blast2 alignment program.

Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.

Amino acid insertions or deletions are changes to or within an amino acid sequence. Insertions or deletions can be the result of , for example, alternative splicing. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active gelatinase B-like enzyme 1 polypeptide can readily be determined by assaying for gelatinase B-like enzyme 1 activity, as described, for example, in the above Examples.

Fusion Proteins

Fusion proteins can comprise at least 5, 6, 8, 10, 25, or 50 or more contiguous amino acids of the amino acid sequence shown in SEQ ID NO. 2 or a biologically active variant of that sequence. Fusion proteins are useful for generating antibodies against gelatinase B-like enzyme 1 amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a gelatinase B-like enzyme 1 polypeptide, including its metalloprotease domain (HEIGH, SEQ ID NO. 4). Methods such as protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.

A gelatinase B-like enzyme 1 fusion protein comprises two protein segments fused together by means of a peptide bond. The first protein segment comprises at least 5,

6, 8, 10, 25, or 50 or more contiguous amino acids of SEQ ID NO. 2. Preferably, a fusion protein comprises the metalloprotease domain of a gelatinase B-like enzyme 1 molecule. Contiguous amino acids for use in a fusion protein can be selected from the amino acid sequence shown in SEQ ID NO. 2 or from a-ibiologically active variant of that sequence, such as those described above. The first protein segment also can comprise full-length gelatinase B-like enzyme 1.

The second protein segment can be a full-length protein or a protein fragment or polypeptide. Proteins commonly used in fusion protein construction include - galactosidase, -glucuronidase, green fluorescent protein (GFP), auto fluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV- G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the gelatinase B-like enzyme 1 polypeptide-encoding sequence and the heterologous protein sequence, so that the gelatinase B-like enzyme 1 polypeptide can be cleaved and purified away from the heterologous moiety.

A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two protein segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO. 1 in proper reading frame with nucleotides encoding the second protein segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).

Identification of Species Homologs

Species homologs of human gelatinase B-like enzyme 1 can be obtained using gelatinase B-like enzyme 1 polynucleotides (described below) to make suitable probes or primers to screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of gelatinase B-like enzyme 1, and expressing the cDNAs as is known in the art.

Gelatinase B-Like Enzyme 1 Polynucleotides

A gelatinase B-like enzyme 1 polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a gelatinase B-like enzyme 1 polypeptide. A partial coding sequence of a gelatinase B- like enzyme 1 polynucleotide is shown in SEQ ID NO. 1.

Degenerate nucleotide sequences encoding human gelatinase B-like enzyme 1 polypeptides, as well as homologous nucleotide sequences which are at least about

50, preferably about 75, 90, 96, or 98% identical to the nucleotide sequence shown in SEQ ID NO. 1 also are gelatinase B-like enzyme 1 polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.

Complementary DNA (cDNA) molecules, species homologs, and variants of gelatinase B-like enzyme 1 polynucleotides which encode biologically active gelatinase B-like enzyme 1 polypeptides also are gelatinase B- like enzyme 1 polynucleotides.

Identification of Variants and Homologs of Gelatinase B-Like Enzyme 1 Polynucleotides

Variants and homologs of the gelatinase B-like enzyme 1 polynucleotides disclosed above also are gelatinase B-like enzyme 1 polynucleotides. Typically, homologous gelatinase B-like enzyme 1 polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known gelatinase B-like enzyme 1 polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions— 2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50 °C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each— homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15- 25% basepair mismatches, even more preferably 5-15% basepair mismatches.

Species homologs of the gelatinase B-like enzyme 1 polynucleotides disclosed herein can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of gelatinase B-like enzyme 1 polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T_m of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973). Variants of human gelatinase B-like enzyme 1 polynucleotides or gelatinase B-like enzyme 1 polynucleotides of other species can therefore be identified by hybridizing a putative homologous gelatinase B-like enzyme 1 polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO. 1 to form a test hybπd. The melting temperature of the test hybrid is compared with the melting temperature of a hybπd comprising gelatinase B-like enzyme 1 polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.

Nucleotide sequences which hybridize to gelatinase B-like enzyme 1 polynucleotides or their complements following stringent hybridization and/or wash conditions are also gelatinase B-like enzyme 1 polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.

Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated T_m of the hybrid under study. The T_m of a hybrid between a gelatinase B- like enzyme 1 polynucleotide having a nucleotide sequence shown in SEQ ID NO. 1 and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to that nucleotide sequence can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962): T_m = 81.5°C - 16.6(log,₀[Na⁺]) + 0.41(%G + C) - 0.63(%formamide) - 60011), where / = the length of the hybrid in basepairs.

Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.

Preparation of Gelatinase B-Like Enzyme 1 Polynucleotides

A naturally occurring gelatinase B-like enzyme 1 polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or synthesized using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated gelatinase B- like enzyme 1 polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprise gelatinase B-like enzyme 1 nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.

Gelatinase B-like enzyme 1 cDNA molecules can be made with standard molecular biology techniques, using gelatinase B-like enzyme 1 mRNA as a template. Gelatinase B-like enzyme 1 cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of gelatinase B-like enzyme 1 polynucleotides, using either human genomic DNA or cDNA as a template.

Alternatively, synthetic chemistry techniques can be used to synthesize gelatinase B- like enzyme 1 polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a gelatinase B-like enzyme 1 polypeptide having, for example, the amino acid sequence shown in SEQ ID NO. 2 or a biologically active variant of that sequence.

Obtaining Full-Length Gelatinase B-Like Enzyme 1 Polynucleotides

The partial sequence of SEQ ID NO. 1 can be used to identify the corresponding full length gene from which they were derived. The partial sequences can be nick- translated or end-labeled with ³²P using polynucleotide kinase using labeling methods known to those with skill in the art (BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al, eds., Elsevier Press, N.Y., 1986). A lambda library prepared from human tissue can be directly screened with the labeled sequences of interest or the library can be converted en masse to pBluescript (Stratagene Cloning Systems, La Jolla, Calif. 92037) to facilitate bacterial colony screening (see Sambrook et al, 1989, pg. 1.20).

Both methods are well known in the art. Briefly, filters with bacterial colonies containing the library in pBluescript or bacterial lawns containing lambda plaques are denatured, and the DNA is fixed to the filters. The filters are hybridized with the labeled probe using hybridization conditions described by Davis et al, 1986. The partial sequences, cloned into lambda or pBluescript, can be used as positive controls to assess background binding and to adjust the hybridization and washing stringencies necessary for accurate clone identification. The resulting autoradio- grams are compared to duplicate plates of colonies or plaques; each exposed spot corresponds to a positive colony or plaque. The colonies or plaques are selected and expanded, and the DNA is isolated from the colonies for further analysis and sequencing.

Positive cDNA clones are analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence and the other primer from the vector. Clones with a larger vector-insert PCR product than the original partial sequence are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert of the same size or similar as the mRNA size determined from Northern blot Analysis.

Once one or more overlapping cDNA clones are identified, the complete sequence of the clones can be determined, for example after exonuclease III digestion (McCombie et al, Methods 3, 33-40, 1991). A series of deletion clones are generated, each of which is sequenced. The resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence. Various PCR-based methods can be used to extend the nucleic acid sequences encoding the disclosed portions of human gelatinase B-like enzyme 1 to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.

Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68°-72°C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.

Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991). In this method, multiple restriction enzyme digestions and ligations arc used to place an engineered double-stranded sequence into an unknown fragment of the

DNA molecule before performing PCR.

Another method which can be used to retrieve unknown sequences is that of Parker et al, Nucleic Acids Res. 19, 3055-3060, 1991. Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA. This process avoids the need to screen libraries and is useful in finding intron/exon junctions.

When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Also, random-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.

Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.

Obtaining Gelatinase B-Like Enzyme 1 Polypeptides

Gelatinase B-like enzyme 1 polypeptides can be obtained, for example, by purification from human cells, by expression of gelatinase B-like enzyme 1 polynucleotides, or by direct chemical synthesis. Protein Purification

Gelatinase B-like enzyme 1 polypeptides can be purified from human cells, such as primary tumor cells, metastatic cells, or cancer cell lines (e.g., colon cancer cell lines HCT116, DLDl, HT29, Caco2, SW837, SW480, and RKO, breast cancer cell lines

21-PT, 21-MT, MDA-468, SK-BR3, and BT-474, the A549 lung cancer cell line, or the H392 glioblastoma cell line). A purified gelatinase B-like enzyme 1 polypeptide is separated from other compounds which normally associate with the gelatinase B- like enzyme 1 polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis. A preparation of purified gelatinase B-like enzyme 1 polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS- polyacrylamide gel electrophoresis. Enzymatic activity of the purified preparations can be assayed, for example, as described in Example 2.

Expression of Gelatinase B-Like Enzyme 1 Polynucleotides

To express a gelatinase B-like enzyme 1 polypeptide, a gelatinase B-like enzyme 1 polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding gelatinase B-like enzyme 1 polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y, 1989. A variety of expression vector/host systems can be utilized to contain and express sequences encoding a gelatinase B-like enzyme 1 polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors

(e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.

The control elements or regulatory sequences are those non-translated regions of the vector — enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses

(e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a gelatinase B-like enzyme 1 polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.

Bacterial and Yeast Expression Systems

In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the gelatinase B-like enzyme 1 polypeptide. For example, when a large quantity of a gelatinase B-like enzyme 1 polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene), in which the sequence encoding the gelatinase B-like enzyme 1 polypeptide can be ligated into the vector in frame with sequences for the amino- terminal Met and the subsequent 7 residues of -galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264, 5503- 5509, 1989 or pGEX vectors (Promega, Madison, Wis.) can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.

In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et al, Methods Enzymol. 153, 516- 544, 1987.

Plant and Insect Expression Systems

If plant expression vectors are used, the expression of sequences encoding gelatinase B-like enzyme 1 polypeptides can be driven by any of a number of promoter:. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu EMBO J. 6, 307-31 1, 1987). Alternatively, plant promoters such as the small sυbunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671- 1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl. Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (see, for example, Hobbs or Murry, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).

An insect system also can be used to express a gelatinase B-like enzyme 1 polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding gelatinase B-like enzyme 1 polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of gelatinase B-like enzyme 1 polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which gelatinase B-like enzyme 1 polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-

3227, 1994).

Mammalian Expression Systems

A number of viral-based expression systems can be utilized in mammalian host cells.

For example, if an adenovirus is used as an expression vector, sequences encoding gelatinase B-like enzyme 1 polypeptides can be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a gelatinase B-like enzyme 1 polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells. Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).

Specific initiation signals also can be used to achieve more efficient translation of sequences encoding gelatinase B-like enzyme 1 polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a gelatinase B-like enzyme 1 polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl Cell Differ. 20, 125-162, 1994).

Host Cells

A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process an expressed gelatinase B-like enzyme 1 polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g. , CHO, HeLa, MDCK, HEK293, and

WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.

Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express gelatinase B-like enzyme 1 polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced gelatinase B-like enzyme 1 sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type.

Any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980). Genes which can be employed in tk^' or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci. 77, 3567-70, 1980); npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1- 14, 1981); and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, 1992 supra). Additional selectable genes have been described, for example trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988). Visible markers such as anthocyanins, -glucuronidase and its substrate GUS, and luciferase and its substrate lucifenn, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol Biol. 55, 121-131, 1995).

Detecting Expression of Gelatinase B-Like Enzyme 1 Polypeptides

Although the presence of marker gene expression suggests that the gelatinase B-like enzyme 1 polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a gelatinase B-like enzyme 1 polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a gelatinase B-like enzyme 1 polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a gelatinase B-like enzyme 1 polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the gelatinase B-like enzyme 1 polynucleotide.

Alternatively, host cells which contain a gelatinase B-like enzyme 1 polynucleotide and which express a gelatinase B-like enzyme 1 polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.

The presence of a polynucleotide sequence encoding a gelatinase B-like enzyme 1 polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a gelatinase B-like enzyme 1 polypeptide. Nucleic acid amplification-based assays involve the use of ohgonucleotides selected from sequences encoding a gelatinase B- like enzyme 1 polypeptide to detect transformants which contain a gelatinase B-like enzyme 1 polynucleotide. A variety of protocols for detecting and measuring the expression of a gelatinase B- like enzyme 1 polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a gelatinase B-like enzyme 1 polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and Maddox et al, J. Exp. Med. 158, 1211-1216, 1983).

A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding gelatinase B-like enzyme 1 polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a gelatinase B-like enzyme 1 polypeptide can be cloned into a vector for the production of an mRNA pre'- - _^" ..:.. vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate

RNA polymerase, such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.

Expression and Purification of Gelatinase B-Like Enzyme 1 Polypeptides

Host cells transformed with nucleotide sequences encoding a gelatinase B-like enzyme 1 polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode gelatinase B-like enzyme 1 polypeptides can be designed to contain signal sequences which direct secretion of gelatinase B-like enzyme 1 polypeptides through a prokaryotic or eukaryotic cell membrane.

Other constructions can be used to join a sequence encoding a gelatinase B-like enzyme 1 polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine- tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp.,

Seattle, Wash.). The inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the gelatinase B-like enzyme 1 polypeptide can be used t^ α ! ta r purification. One such expression vector provides for expression of a fusion protein containing a gelatinase B-like enzyme 1 polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography as described in Porath et al, Prot. Exp. Purif 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the gelatinase B-like enzyme 1 polypeptide from the fusion protein. Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993).

Chemical Synthesis

Sequences encoding a gelatinase B-like enzyme 1 polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a gelatinase B-like enzyme 1 polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence. For example, gelatinase B-like enzyme 1 polypeptides can be produced by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154,

1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Various fragments of gelatinase B-like enzyme 1 polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.

The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic gelatinase B-like enzyme 1 polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequent ^■,- < :- gelatinase B-like enzyme 1 polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.

Production of Altered Gelatinase B- Like Enzyme 1 Polypeptides

As will be understood by those of skill in the art, it may be advantageous to produce gelatinase B-like enzyme 1 polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence. The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter gelatinase B-like enzyme 1 polypeptide-encoding sequences for a variety of reasons, including modification of the cloning, processing, and/or expression of the gene product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic ohgonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.

Antibodies

Any type of antibody known in the art can be generated to bind specifically to an epitope of a gelatinase B-like enzyme 1 polypeptide. "Antibody" as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab,

F(ab')₂, and Fv, which are capable of binding an epitope of a gelatinase B-like enzyme 1 polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve ncvcc; £ .IOU , amino acids may require more, e.g., at least 15, 25, or 50 amino acids.

An antibody which specifically binds to an epitope of a gelatinase B-like enzyme 1 polypeptide can be used therapeutically, as well as in immunochemical assays, including but not limited to Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen. Typically, an antibody which specifically binds to a gelatinase B-like enzyme 1 polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to gelatinase B-like enzyme 1 polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a gelatinase B-like enzyme 1 polypeptide from solution.

Gelatinase B-like enzyme 1 polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a gelatinase B-like enzyme 1 polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Gueri ) and Corynebacterium parvum are especially useful.

Monoclonal antibodies which specifically bind to a gelatinase B-like enzyme 1 polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).

In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al, Proc. Natl. Acad Sci. 81, 6851 -6855, 1984; Neuberger et al, Nature 312, 604-608,

1984; Takeda et al, Nature 314, 452-454, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, one can produce humanized antibodies using recombinant methods, as described in GB2188638B. Antibodies which specifically bind to a gelatinase B-like enzyme 1 polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.

Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to gelatinase B-like enzyme 1 polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).

Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in

Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.

A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology. Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J. Immunol. Meth. 165, 81- 91.

Antibodies which specifically bind to gelatinase B-like enzyme 1 polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).

Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.

Antibodies of the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a gelatinase B-like enzyme 1 polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.

Antisense Ohgonucleotides

Antisense ohgonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of gelatinase B-like enzyme 1 gene products in the cell.

Antisense ohgonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Ohgonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5¹ end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.

Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.

Modifications of gelatinase B-like enzyme 1 gene expression can be obtained by designing antisense ohgonucleotides which will form duplexes to the control, 5', or regulatory regions of the gelatinase B-like enzyme 1 gene. Ohgonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are prefeπed. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND

IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.

Precise complementarity is not required for successful duplex formation between an antisense oligonucleotide and the complementary sequence of a gelatinase B-like enzyme 1 polynucleotide. Antisense ohgonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a gelatinase B-like enzyme 1 polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent gelatinase B-like enzyme 1 nucleotides, can provide targeting specificity for gelatinase B-like enzyme 1 mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular gelatinase B-like enzyme 1 polynucleotide sequence.

Antisense ohgonucleotides can be modified without affecting their ability to hybridize to a gelatinase B-like enzyme 1 polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and or sugars, such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified ohgonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol 10, 152-158, 1992; Uhlmann et al,

Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett. 215, 3539-3542, 1987.

Ribozymes

Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g , Haseloff el al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.

The coding sequence of a gelatinase B-like enzyme 1 polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the gelatinase B-like enzyme 1 polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al.

Nature 334, 585-591, 1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).

Specific ribozyme cleavage sites within a gelatinase B-like enzyme 1 RNA target are initially identified by scanning the RNA molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the gelatinase B-like enzyme 1 target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. The suitability of candidate targets also can be evaluated by testing accessibility to hybridization with complementary ohgonucleotides using ribonuclease protection assays. The nucleotide sequence shown in SEQ ID NO.l and its complement provide sources of suitable hybridization region sequences. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related; thus, upon hybridizing to the gelatinase B-like enzyme 1 target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target. Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease gelatinase B-like enzyme 1 expression. Alternatively, if it is desired that the cells stably retain the DNA construct, it can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. The DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.

As taught in Haseloff et al, U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of gelatinase B-like enzyme 1 mRNA occurs only when both a ribozyme and a target gene are induced in the cells.

Screening Methods

The invention provides methods for identifying modulators, i.e., candidate or test compounds which bind to gelatinase B-like enzyme 1 polypeptides or polynucleotides and/or have a stimulatory or inhibitory effect on, for example, expression or activity of the gelatinase B-like enzyme 1 polypeptide or polynucleotide, so as to regulate degradation of the extracellular matrix. Decreased extracellular matrix degradation is useful for preventing or suppressing malignant cells from metastasizing. Increased extracellular matrix degradation may be desired, for example, in developmental disorders characterized by inappropriately low levels of extracellular matrix degradation or in regeneration.

The invention provides assays for screening test compounds which bind to or modulate the activity of a gelatinase B-like enzyme 1 polypeptide or a gelatinase B- like enzyme 1 polynucleotide. A test compound preferably binds to a gelatinase B- like enzyme 1 polypeptide or polynucleotide. More preferably, a test compound decreases a gelatinase B-like enzyme 1 activity of a gelatinase B-like enzyme 1 polypeptide or expression of a gelatinase B-like enzyme 1 polynucleotide by at leastabout 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.

Test Compounds

Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule iiDranct of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.

Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc.

Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al, J. Med. Chem. 37, 2678,

1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed Engl.

33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl 33, 2061; Gallop et al, J.

Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (.see, , Houghten, Biolechniques 13, 412-421 , 1992), or on beads (Lam, Nature

354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci. U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Science 249, 404-406, 1990); Cwirla et al, Proc. Natl. Acad. Sci. 97, 6378-6382, 1990; Felici, J. Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409).

High Throughput Screening

Test compounds can be screened for the ability to bind to gelatinase B-like enzyme 1 polypeptides or polynucleotides or to affect gelatinase B-like enzyme 1 activity or gelatinase B-like enzyme 1 gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.

Alternatively, "free format assays," or assays that have no physical baπ^ ..■.ween samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by

Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.

Another example of a free format assay is described by Chelsky, "Strategies for

Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in

Philadephia, Pa. (Nov. 7-10, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.

Yet another example is described by Salmon et al, Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.

Another high throughput screening method is described in Beutel et al, U.S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.

Binding Assays

For binding assays, the test compound is preferably a small molecule which binds to the gelatinase B-like enzyme 1 polypeptide and preferably occupies the active site, thereby making the domain inaccessible to substrate such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules. In binding assays, either the test compound or the gelatinase B-like enzyme 1 polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the gelatinase B-like enzyme 1 polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropπate substrate to a detectable product. Alternatively, binding of a test compound to a gelatinase B-like enzyme 1 polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a target polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light- addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a gelatinase B- like enzyme 1 polypeptide. (McConnell et al, Science 257, 1906-1912, 1992).

Determining the ability of a test compound to bind to a gelatinase B-like enzyme 1 polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA). Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol 5, 699-705, 1995. BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g. , BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.

In yet another aspect of the invention, a gelatinase B-like enzyme 1 polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, Biotechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent W094/10300), to identify other proteins which bind to or interact with the gelatinase B-like enzyme 1 polypeptide and modulate its activity.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct a polynucleotide encoding a gelatinase B-like enzyme 1 polypeptide is fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence that encodes an unidentified protein ("prey" or "sample") is fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the gelatinase B-like enzyme 1 polypeptide.

It may be desirable to immobilize either the gelatinase B-like enzyme 1 polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the gelatinase B-like enzyme 1 polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the gelatinase B-like enzyme 1 polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a gelatinase B- like enzyme 1 polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes. In one embodiment, a gelatinase B-like enzyme 1 polypeptide is a fusion protein comprising a domain that allows the gelatinase B-like enzyme 1 polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed gelatinase B-like enzyme 1 polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.

Other techniques for immobilizing polypeptides or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a gelatinase B-like enzyme 1 polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated gelatinase B-like enzyme 1 polypeptides or test compounds can be prepared from biotin-NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a gelatinase B-like enzyme 1 polypeptide polynucleotides, or a test compound, but which do not interfere with a desired binding site, such as the metalloprotease domain of the gelatinase B-like enzyme 1 polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.

Methods for detecting such complexes, in addition to those described above for the

GST-immobilized complexes, include immunodetection of complexes using antibodies which specifically bind to the gelatinase B-like enzyme 1 polypeptide (or polynucleotides) or test compound, enzyme-linked assays which rely on detecting a gelatinase B-like enzyme 1 activity of the gelatinase B-like enzyme 1 polypepu .. and SDS gel electrophoresis under non-reducing conditions.

Screening for test compounds which bind to a gelatinase B-like enzyme 1 polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a gelatinase B-like enzyme 1 polynucleotide or polypeptide can be used in a cell-based assay system. A gelatinase B-like enzyme 1 polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, including neoplastic cell lines such as the colon cancer cell lines HCT116, DLDl, HT29,

Caco2, SW837, SW480, and RKO, breast cancer cell lines 21-PT, 21-MT, MDA- 468, SK-BR3, and BT-474, the A549 lung cancer cell line, and the H392 glioblastoma cell line, can be used. An intact cell is contacted with a test compound. Binding of the test compound to a gelatinase B-like enzyme 1 polypeptide or polynucleotide is determined as described above, after lysing the cell to release the gelatinase B-like enzyme 1 polypeptide-test compound complex.

Gelatinase B-Like Enzyme 1 Assays

Test compounds can be tested for the ability to increase or decrease a gelatinase B- like enzyme 1 activity of a gelatinase B-like enzyme 1 polypeptide. Gelatinase B- like enzyme 1 activity can be measured, for example, using the method described in Example 2. Gelatinase B-like enzyme 1 activity can be measured after contacting either a purified gelatinase B-like enzyme 1 polypeptide, a cell extract, or an intact cell with a test compound. A test compound which decreases gelatinase B-like enzyme 1 activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential agent for decreasing extracellular matrix degradation. A test compound which increases gelatinase B-like enzyme 1 activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential agent for increasing extracellular matrix degradation. Gelatinase B-Like Enzyme 1 Gene Expression

In another embodiment, test compounds which increase or decrease gelatinase B-like enzyme 1 gene expression are identified. A gelatinase B-like enzyme 1 poly- nucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the gelatinase B-like enzyme 1 polynucleotide is determined. The level of expression of gelatinase B-like enzyme 1 mRNA or polypeptide in the presence of the test compound is compared to the level of expression of gelatinase B- like enzyme 1 mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of gelatinase B-like enzyme 1 mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of gelatinase B-like enzyme 1 mRNA or polypeptide is less expression. Alternatively, when expression of the mRNA or protein is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of gelatinase B-like enzyme 1 mRNA or polypeptide expression.

The level of gelatinase B-like enzyme 1 mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or protein. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a gelatinase B-like enzyme 1 polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a gelatinase B-like enzyme 1 polypeptide.

Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell which expresses a gelatinase B-like enzyme 1 polynucleotide can be used in a cell-based assay system. The gelatinase B-like enzyme 1 polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, including neoplastic cell lines such as the colon cancer cell lines HCT116, DLDl, HT29, Caco2, SW837, SW480, and RKO, breast cancer cell lines 21-PT, 21-MT, MDA- 468, SK-BR3, and BT-474, the A549 lung cancer cell line, and the H392 glioblastoma cell line, can be used.

Pharmaceutical Compositions

The invention also provides pharmaceutical compositions which can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise a gelatinase B-like enzyme 1 polypeptide, gelatinase B-like enzyme 1 polynucleotide, antibodies which specifically bind to a gelatinase B-like enzyme 1 polypeptide, or mimetics, agonists, antagonists, or inhibitors of a gelatinase B-like enzyme 1 polypeptide. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.

In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.

Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.

Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.

Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.

Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free bas<= forms In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.

Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration. Therapeutic Indications and Methods

1. Tumor Cell Invasion and Metastasis. The human gelatinase B-like enzyme 1 gene provides a therapeutic target for decreasing extracellular matrix degradation, in particular for treating or preventing metastatic cancer.

Cancers whose metastasis can be suppressed according to the invention include adenocarcinoma, melanoma, cancers of the adrenal gland, bladder, bone, breast, cervix, gall bladder, liver, lung, ovary, pancreas, prostate, testis, and uterus. Circulating tumor cells arrested in the capillary beds of different organs must invade the endothelial cell lining and degrade its underlying basement membrane (BM) in order to invade into the extravascular tissue(s) where they establish metastasis (1, 2). Metastatic tumor cells often attach at or near the intercellular junctions between adjacent endothelial cells. Such attachment of the metastatic cells is followed by rupture of the junctions, retraction of the endothelial cell borders and migration through the breach in the endothelium toward the exposed underlying BM (1).

Once located between endothelial cells and the BM, the invading cells must degrade the subendothelial glycoproteins and proteoglycans of the BM in order to migrate out of the vascular compartment. Several cellular enzymes

(e.g., collagenase IV, plasminogen activator, cathepsin B, elastase) are thought to be involved in degradation of BM (2). Suppression of human gelatinase B-like enzyme 1 activity therefore can be used to suppress tumor cell invasion and metastasis.

2. Tumor Angiogenesis. Basic fibroblast growth factor (bFGF) has been extracted from the subendothelial extracellular matrix produced in vitro (3) and from basement membranes of the cornea (4), suggesting that extracellular matrix may serve as a reservoir for bFGF. Immunohistochemical staining revealed the localization of bFGF in basement membranes of diverse tissues and blood \ esscls (5) Despite the ubiquitous presence of bFGF in noπnal tissues, endothelial cell proliferation in these tissues is usually very low, which suggests that bFGF is somehow sequestered from its site of action. It is possible, therefore, that suppression of human gelatinase B-like enzyme 1 activity can suppress release of active bFGF from extracellular matrix and basement membranes. In addition, displacement of bFGF from its storage within basement membranes and extracellular matrix may therefore provide a novel mechanism for induction of neovascularization in normal and pathological situations. Restriction of endothelial cell growth factors in the extracellular matrix may prevent their systemic action on the vascular endothelium, thus maintaining a very low rate of endothelial cells turnover and vessel growth. On the other hand, release of bFGF from storage in the extracellular matrix may elicit localized endothelial cell proliferation and neovascularization in processes such as wound healing, inflammation and tumor development (6, 7).

3. Inflammation and Cellular Immunity. Gelatinase B-like enzyme 1 activity may be involved in the ability of activated cells of the immune system to leave the circulation and elicit both inflammatory and autoimmune responses. Thus, inflammation and cellular immunity may be regulated by regulating activity of gelatinase B-like enzyme 1.

4. Viral infection. Removal of the cell surface components by gelatinase B-like enzyme 1 may influence the ability of viruses to attach to the cell surface. Regulation of gelatinase B-like enzyme 1 may therefore be used to treat viral infections.

5. Neurodegenerative diseases. It is also possible that gelatinase B-like enzyme 1 activity can be used to degrade, for example, prion protein amyloid plaques of Genstmann-Straussler Syndrome, Creutzfeldt-Jakob disease, and Scrapie. 6. Restenosis and Atherosclerosis. Proliferation of arterial smooth muscle cells (SMCs) in response to endothelial injury and accumulation of cholesterol rich lipoproteins are basic events in the pathogenesis of atherosclerosis and restenosis (8). It is possible that gelatinase B-like enzyme 1 may be involved in the catabolic pathway that may allow substantial cellular and interstitial accumulation of cholesterol rich lipoproteins. The latter pathway is expected to be highly atherogenic by promoting accumulation of apoB and apoE rich lipoproteins (i.e. LDL, VLDL, chylomicrons), independent of feedback inhibition by the cellular sterol content. Altered levels of human gelatinase B-like enzyme 1 activity therefore may inhibit both SMC proliferation and lipid accumulation and thus may halt the progression of restenosis and atherosclerosis.

7. Other therapeutic and diagnostic indications. Anti-human gelatinase B-hke enzyme 1 antibodies can be applied for immunodetection and diagnosis of micrometastases, autoimmune lesions, and renal failure in biopsy specimens, plasma samples, and body fluids.

The invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a polypeptide- binding partner) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.

A reagent which affects gelatinase B-like enzyme 1 activity can be administered to a human cell, either in vitro or in vivo, to reduce gelatinase B-like enzyme 1 activity. The reagent preferably binds to an expression product of a human gelatinase B-like enzyme 1 gene. If the expression product is a polypeptide, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.

In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung or liver.

A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 μg of DNA per 16 nmole of liposome delivered to about 10⁶ cells, more preferably about 1.0 μg of DNA per 16 nmol of liposome delivered to about 10⁶ cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about 10⁶ cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.

Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More prefeπed liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a tumor cell, such as a tumor cell ligand exposed on the outer surface of the liposome.

Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.

In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol 11, 202-05 (ι993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE

TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et α/., J Biol. Chem. 266, 338-42 (1991).

If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun," and DEAE- or calcium phosphate-mediated transfection.

Determination of a Therapeutically Effective Dose

The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases extracellular matrix degradation relative to that which occurs in the absence of the therapeutically effective dose.

For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.

Therapeutic efficacy and toxicity, e.g., ED₅₀ (the dose therapeutically effective in

50% of the population) and LD₅₀ (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD₅₀/ED₅o.

Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.

Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation. Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.

Effective in vivo dosages of an antibody are in the range of about 5 μg to about

50 μg/kg, about 50 μg to about 5 mg/kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA.

If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides which express antisense oligo- nucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.

Preferably, a reagent reduces expression of a gelatinase B-like enzyme 1 polynucleotide or activity of a gelatinase B-like enzyme 1 polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a gelatinase B-like enzyme 1 polynucleotide or the activity of a gelatinase B-like enzyme 1 polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to gelatinase B-like enzyme 1- specific mRNA, quantitative RT-PCR, lmmunologic detection of a gelatinase B-like enzyme 1 polypeptide, or measurement of gelatinase B-hke enzyme 1 activity. In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.

Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.

The above disclosure generally describes the present invention, and all patents and patent applications cited in this disclosure are expressly incorporated herein. A more complete understanding can be obtained by reference to the following specific examples which are provided for purposes of illustration only and are not intended to limit the scope of the invention.

EXAMPLE 1

Detection of gelatinase B-like enzyme 1 activity

The polynucleotide of SEQ ID NO.1 was inserted into pGEX vector and expressed as a fusion protein with glutathione S-transferase. The fusion protein was purified from lysed cells by adsorption by glutathion-agarose-beads followed by elution in the presence of free glutathione. The activity of the fusion protein (gelatinase B-like enzyme 1 polypeptide of SEQ ID NO. 2) is assessed according to the following procedures:

The fusion protein is activated with 4-aminophenylmercuric acetate (APMA). The enzymatic assay is carried out with the peptide-like substrate, DnpProChaGlyCys(Me)HisAlaLys(Nma)NH₂ (SEQ ID NO. 3). This substrate is cleaved between the glycine and cysteine so as to produce a fluorescent derivative, as described by Bickett et al, Anal. Biochem. 212, 58-64 (1993). The reactions are carried out in 50 mM Tris buffer containing 200 mM NaCl, 5 mM CaCl₂, 0.1% Brij, pH 7.7. The reactions are initiated with 20 μM substrate in a total volume of 100 μl at 37°C. Fluorescence is read after 6 hours using a fluorimeter with a 340 nm filter for excitation and a 440 nm filter for emission. By comparing the fluorescence of the fusion protein to the fluorescence of a negative standard such a heat-inactivated enzyme and to a positive standard such as gelatinase B-like enzyme 1 the gelatinase B-like enzyme 1 activity of the fusion protein (gelatinase B-like enzyme 1 polypeptide of SEQ ID NO. 2) is demonstrated.

EXAMPLE 2

Identification of a test compound which binds to a gelatinase B-like enzyme 1 polypeptide

Purified gelatinase B-like enzyme 1 polypeptides comprising a glutathione-S- transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. Gelatinase B-like enzyme 1 polypeptides comprise an amino acid sequence shown in SEQ ID NO. 2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.

The buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a gelatinase B-like enzyme 1 polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound was not incubated is identified as a compound which binds to a gelatinase B-like enzyme 1 polypeptide.

EXAMPLE 3

Identification of a test compound which decreases gelatinase B-like enzyme 1 activity

Cellular extracts from the human colon cancer cell line HCT116 are contacted with test compounds from a small molecule library and assayed for gelatinase B-like enzyme 1 activity. Control extracts, in the absence of a test compound, also are assayed.

Gelatinase B-like enzyme 1 is activated with 4-aminophenylmercuric acetate (APMA). The enzymatic assay is carried out with the peptide-like substrate, DnpProChaGlyCys(Me)HisAlaLys(Nma)NH₂ (SEQ ID NO. 3). This substrate is cleaved between the glycine and cysteine so as to produce a fluorescent derivative, as described by Bickett et al, Anal. Biochem. 212, 58-64 (1993). The reactions are carried out in 50 mM Tris buffer containing 200 mM NaCl, 5 mM CaCl₂, 0.1% Brij, pH 7.7. The reactions are initiated with 20 μM substrate in a total volume of 100 μl at 37°C. Fluorescence is read after 6 hours using a fluorimeter with a 340 nm filter for excitation and a 440 nm filter for emission. A test compound which decreases gelatinase B-like enzyme 1 activity of the extract relative to the control extract by at least 20% is identified as a gelatinase B-like enzyme 1 inhibitor.

EXAMPLE 4

Identification of a test compound which decreases gelatinase B-like enzyme 1 gene expression

A test compound is administered to a culture of the breast tumor cell line MDA-468 and incubated at 37°C for 10 to 45 minutes. A culture of the same type of cells incubated for the same time without the test compound provides a negative control.

RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18,

5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a ³²P-labeled gelatinase B-like enzyme 1 -specific probe at 65 ° C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from SEQ ID NO. 1. A test compound which decreases the gelatinase B- like enzyme 1 -specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of gelatinase B-like enzyme 1 gene expression.

EXAMPLE 5

Treatment of a breast tumor with a reagent which specifically binds to a gelatinase B-like enzyme 1 gene product

Synthesis of antisense gelatinase B-like enzyme 1 polypeptide ohgonucleotides comprising the following contiguous nucleotides (1-25) of SEQ ID NO.l

(CTGAACTTTTGAACCTAGGACTTCG) is performed on a Pharmacia Gene Assembler series synthesizer using the phosphoramidite procedure (Uhlmann et al, Chem. Rev. 90, 534-83, 1990). Following assembly and deprotection, ohgonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate- buffered saline (PBS) at the desired concentration. Purity of these ohgonucleotides is tested by capillary gel electrophoreses and ion exchange HPLC. Endotoxin levels in the oligonucleotide preparation are determined using the Limulus Amebocyte Assay (Bang, Biol. Bull. (Woods Hole, Mass.) 105, 361-362, 1953).

An aqueous composition containing the antisense ohgonucleotides at a concentration of 0.1-100 μM is injected directly into a breast tumor with a needle. The needle is placed in the tumors and withdrawn while expressing the aqueous composition within the tumor.

The breast tumor is monitored over a period of days or weeks. Additional injections of the antisense ohgonucleotides can be given during that time. Metastasis of the breast tumor is suppressed due to decreased gelatinase B-like enzyme 1 activity of the breast tumor cells.

REFERENCES

1. Nicolson (1988) Organ specificity of tumor metastasis: Role of preferential adhesion, invasion and growth of malignant cells at specific secondary sites. Cancer Met. Rev. 7, 143-188.

2. Liotta et α/. (1983) Tumor invasion and the extracellular matrix. Lab. Invest.

49, 639-649.

3. Vlodavsky et al (1987) Endothelial cell-derived basic fibroblast growth factor: Synthesis and deposition into subendothelial extracellular matrix. Proc. Natl. Acad. Sci. USA 84, 2292-2296. 4. Folkman et al. (1980) A heparin-binding angiogenic protein— basic fibroblast growth factor— is stored within basement membrane. Am. J. Pathol. 130, 393400.

5. Cardon-Cardo et al. (1990) Expression of basic fibroblast growth factor in normal human tissues. Lab. Invest. 63, 832-840.

6. Vlodavsky et al. (1991) Extracellular sequestration and release of fibroblast growth factor: a regulatory mechanism? Trends Biochem. Sci. 16, 268-271.

7. Vlodavsky et al. (1993) Extracellular matrix-bound growth factors, enzymes and plasma proteins. In BASEMENT MEMBRANES: CELLULAR AND MOLECULAR ASPECTS Rohrbach & Timpl, eds., pp327-343. Academic Press Inc., Orlando, Fla.

8. Ross (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature (Lond). 362, 801-809.

Claims

1. An isolated polynucleotide encoding a gelatinase B-like enzyme 1 polypeptide and being selected from the group consisting of:

a) a polynucleotide encoding a gelatinase B-like enzyme 1 polypeptide comprising an amino acid sequence selected from the group consisting of amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO. 2 and the amino acid sequence shown in SEQ ID NO. 2.

b) a polynucleotide comprising the sequence of SEQ ID NO.1 ;

c) a polynucleotide which hydridizes under stringent conditions to a polynucleotide specified in (a) and (b);

2. An expression vector containing any polynucleotide of claim 1.

3. A host cell containing the expression vector of claim 2.

4. A substantially purified gelatinase B-like enzyme 1 polypeptide encoded by a polynucleotide of claim 1.

5. A method for producing a gelatinase B-like enzyme 1 polypeptide, wherein the method comprises the following steps:

a) culturing the host cell of claim 3 under conditions suitable for the expression of the gelatinase B-like enzyme 1 polypeptide; and

b) recovering the gelatinase B-like enzyme 1 polypeptide from the host cell culture.

6. A method for detection of a polynucleotide encoding a gelatinase B-like enzyme 1 polypetide in a biological sample comprising the following steps:

a) hybridizing any polynucleotide of claim 1 to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and

b) detecting said hybridization complex.

7. The method of claim 6, wherein before hybridization, the nucleic acid material of the biological sample is amplified.

8. A method for the detection of a polynucleotide of claim 1 or a gelatinase B- like enzyme 1 polypeptide of claim 5 comprising the steps of contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the gelatinase B-like enzyme 1 polypeptide.

9. A diagnostic kit for conducting the method of any one of claims 6 to 8.

10. A method of screening for agents which decrease the activity of a gelatinase B-like enzyme 1, comprising the steps of: contacting a test compound with any gelatinase B-like enzyme 1 polypeptide encoded by any polynucleotide of claim 1;

detecting binding of the test compound of the gelatinase B-like enzyme 1 polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a gelatinase B-like enzyme 1.

11. A method of screening for agents which regulate the activity of a gelatinase B-like enzyme l,rtomprising the steps of:

contacting a test compound with a gelatinase B-like enzyme 1 polypeptide encoded by any polynucleotide of claim 1; and

detecting a gelatinase B-like enzyme 1 activity of the polypeptide, wherein a test compound which increases the gelatinase B-like enzyme 1 activity is identified as a potential therapeutic agent for increasing the activity of the gelatinase B-like enzyme 1, and wherein a test compound which decreases the gelatinase B-like enzyme 1 activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the gelatinase B-like enzyme 1.

12. A method of screening for agents which decrease the activity of a gelatinase B-like enzyme 1, comprising the steps of:

contacting a test compound with any polynucleotide of claim 1 and

detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of gelatinase B-like enzyme 1.

13. A method of reducing the activity of gelatinase B-like enzyme 1, comprising the steps of:

contacting a cell with a reagent which specifically binds to any polynucleotide of claim 1 or any gelatinase B-like enzyme 1 polypeptide of claim 4, whereby the activity of gelatinase B-like enzyme 1 is reduced.

14. A reagent that modulates the activity of a gelatinase B-like enzyme 1 polypeptide or a polynucleotide wherein said reagent is identified by the method of any of the claims 10 to 12.

15. A pharmaceutical composition, comprising: the expression vector of claim 2 or the reagent of claim 14 and a pharmaceutically acceptable carrier.

16. Use of the pharmaceutical composition of claim 15 for modulating the activity of a gelatinase B-like enzyme 1 in a disease.

17. Use of claim 16 wherein the disease is a neoplastic disease.