WO2001051081A1 - In vivo ctl elicitation by heat shock protein fusion proteins maps to a discrete atp binding domain and is cd4+ t cell-independent - Google Patents
In vivo ctl elicitation by heat shock protein fusion proteins maps to a discrete atp binding domain and is cd4+ t cell-independent Download PDFInfo
- Publication number
- WO2001051081A1 WO2001051081A1 PCT/US2000/032831 US0032831W WO0151081A1 WO 2001051081 A1 WO2001051081 A1 WO 2001051081A1 US 0032831 W US0032831 W US 0032831W WO 0151081 A1 WO0151081 A1 WO 0151081A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- molecule
- binding domain
- heat shock
- atp binding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
- A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- NTH National Institutes of Health
- 5T32-AI-07463 NIH Cancer Center core grant CA- 14051 and NIH research grants AI44476 and AI44478.
- the Government has certain rights in the invention.
- hsps heat shock proteins isolated from tumors can be used as adjuvant-free anti-tumor vaccines in animals; hsp70 and the distantly related chaperones gp96 and calreticulin share this immuno stimulatory activity
- Suto, R. and Srivastava, P.K. Science, 2(59:1585-1588 (1995); Blanchere, N.E., et al, J. Exp.
- T cell (CTL) responses are unknown.
- CTL T cell responses
- soluble proteins Barrios, C, et al, Eur. J. Immunol, 22:1365-1372 (1992); Suzue, K. and Young, R.A., J. Immunol, 755:873-876 (1996); Horwitz, M.S., et al, Nature Med., 4:781-785 (1998) and K ⁇ nen-Waisman, S., et al, J. Infect.
- chaperone function of hsps delivers the fusion protein to intracellular compartments of antigen-presenting cells for processing into short pep tides and loading onto MHC class I (Young, R.A., Ann. Rev. Immunol, 5:401-420 (1990) and Schild, H., et al, Curr. Opinion Imm., 77:109- 113 (1999)).
- An understanding of the ability of hsp70 to stimulate CD8 + CTL responses is needed to provide for more effective immunological prophylaxis and therapy for cancer and infectious diseases caused by intracellular pathogens.
- the present invention is based on the discovery that a heat shock protein (hsp; hsps are also known in the art as stress proteins), or a discrete domain thereof, that is joined to a heterologous molecule can produce a CD8 + cytotoxic (cytolytic) lymphocyte (CTL) response in a host to which it is administered.
- the domain can be, for example, about half (e.g., 40, 45, 50, 55, or 60%) of the adenosinetriphosphate (ATP) binding domain of an hsp.
- the response is independent of CD4 + CTLs.
- compositions that include an hsp, or all or a portion of an hsp ATP binding domain, joined to a heterologous molecule and methods of inducing a CD8 + CTL response to a molecule in an individual (e.g., a patient, such as a human patient, who has a deficiency of CD4 + T cells) by administering that composition to the individual.
- the method can be used to treat a patient who has an acquired immune deficiency syndrome (AIDS) by, for example, administering to the patient an hsp, or a portion of an ATP binding domain of an hsp, that is joined to a molecule associated with a human immunodeficiency virus (HIV), such as an HIV antigen.
- HIV human immunodeficiency virus
- compositions and methods described herein provide for highly effective CD8 + CTL responses. These responses are useful in treating (i.e., preventing or reducing the length or severity of symptoms associated with a disease process or preventing or attenuating the cellular events through which those symptoms are made manifest; treatment may be effective without completely eradicating all symptoms) diseases that are caused by or otherwise associated with intracellular pathogens. Diseases or conditions that are characterized by a deficiency (or complete lack of) CD4 + T cells are particularly amenable to treatment.
- Figure 1A is a graph of effector cell to target cell ratio (E:T) versus % specific lysis illustrating OVA-specific CTL elicited by immunization with OVA.TBhsp70 fusion protein without adjuvant in the splenocytes from wild-type C57/BL/6 mice.
- Figure IB is a graph of E:T versus % specific lysis illustrating OVA-specific CTL elicited by immunization with OVA.TBhsp70 fusion protein without adjuvant in the splenocytes from CD4 + knockout mice (CD4 -/- mice).
- Figure 1C is a graph of E:T versus % specific lysis illustrating OVA-specific
- Figure 2A is a graph of E:T versus % specific lysis illustrating murine hsp70 fusion protein elicits CTL responses in wild-type C57BL/6 mice.
- Figure 2B is a graph of E:T versus % specific lysis illustrating murine hsp70 fusion protein elicits CTL responses in CD4 -/- mice.
- Figure 3 is an illustration of the domains of the full length TBhsp70 which were separated into four segments I, ⁇ , HI and IV and fused to C-terminal of OVA to make OVA.TBhsp70 fusion proteins; the numbers beneath each segment refer to the amino acid positions in TBhsp70.
- Figure 4 is a graph of E:T versus % specific lysis illustrating OVA-specific T cell responses in mice immunized with OVA fused to domains of TBhsp70; splenocyte cultures from mice primed with OVA ( ⁇ ), OVA.TBhsp70 ( ⁇ ), OVA.TBhsp70 I (V), ⁇ ( ⁇ ), m (X) and IV (+) were used as effector cells in the cytotoxicity assay.
- Figure 5 A is the PI peptide amino acid sequence. When liberated from PI,
- SIYRYYGL (boldface) binds to K b to form the peptide-MHC complex recognized by the 2C TCR.
- SIYRYYGL (SEQ ID NO: 1) is flanked 5' and 3' by sequences that lie immediately upstream and downstream, respectively, of peptide bonds that are cleaved (see arrows) in murine cells to liberate naturally occurring peptides (SDNFEKL (SEQ ID NO: 2) from ovalbumin (Ova) and LSPFPFDL (SEQ ID NO: 3) from ⁇ -ketoglutaraldehyde dehydrogenase ( ⁇ KG) (Falk, K., et al, Eur. J. Immunol, 22:1323-1326 (1992); Ukada, K., et al, J. Immunol, 757:670-678 (1996)).
- Figure 5B is a diagram of the hsp65-Pl fusion protein, showing PI at the C- terminus of hsp65.
- Figure 5C are histograms which provide evidence that PI and hsp65-Pl are processed intracellularly to yield the SYRGL (SEQ ID NO: 4) octapeptide.
- Figure 5D is a graph showing normal C57BL/6 mice have T cells that can recognize the SYRGL-K b complex.
- a CD8 + T cell line derived from C57BL/6 mice immunized with the SYRGL (SEQ ID NO: 4) peptide in adjuvant, specifically lysed T2-K b target cells in a peptide-dependent manner.
- a highly cytolytic long-term cultured 2C CTL clone (L3.100) is shown for comparison.
- Figure 6A is a graph showing CD8 CTL that recognize the SYRGL-K b complex are produced in C57BL/6 mice injected with hsp65-Pl in PBS but not in those injected similarly with equimolar amounts of various controls (a mixture of PI and hsp65, the SYRGL (SEQ ID NO: 4) octapeptide, the PI polypeptide itself, hsp65 itself).
- Figure 6B is a graph showing SYRGL- specific CTL in mice injected with a various amounts of hsp65-Pl, 0.015-1.5 nmoles (l-100 ⁇ g) or a control fusion protein in which PI is linked to the C-terminus of a maltose-binding protein (Mal- Pl, 80 ⁇ g); lysis of T2-K b target cells in the absence of added SYRGL (SEQ ID NO: 4) peptide is indicated by unfilled symbols.
- Figure 6C are graphs showing depletion of CD8 + T cells eliminates the SYRGL-specific CTL produced by mice injected with hsp65-Pl .
- Lymph node and spleen cells from C57B1/6 mice immunized with 1.5 nmoles of hsp65 -PI or Mal-Pl were cultured for 6 days and then depleted of CD8 T cells by magnetic sorting.
- the untreated, CD8-depleted, and CD8-enriched populations (30%, 1%, 90%, CD8 + T cells respectively) were analyzed in a 4 hr cytolytic assay; lysis of T2-K b target cells in the absence of added SYRGL peptide is indicated by unfilled symbols.
- spl dc 51 Cr-labeled splenic dendritic cells
- bm-dc bone-marrow derived dendritic cells
- m ⁇ purified macrophages
- Figure 8A illustrates that splenic dendritic cells and peritoneal lavage macrophages were purified by magnetic sorting and incubated for 18-24 hr with equimolar concentrations of hsp65-Pl or Mal-Pl before adding naive 2C T cells.
- Expression of the activation marker CD69, Hsp65-Pl or Mal-Pl were added to purified splenic dendritic cells, macrophages, or to media alone ("no APC") at 15nM ( ⁇ 1 ⁇ g/ml).
- Figure 8B illustrates that splenic dendritic cells and peritoneal lavage macrophages were purified by magnetic sorting and incubated for 18-24 hr with equimolar concentrations of hsp65-Pl or unmodified hsp65 before adding naive 2C T cells. Dendritic cells or macrophages were incubated with hsp65-Pl or hsp65 before adding the naive 2C T cells and incubation was continued for an additional 18 hr (IL-2 assay) or 60 hr (proliferation assay) or 48 hr (IFN- ⁇ assay).
- IL-2 assay IL-2 assay
- 60 hr proliferation assay
- IFN- ⁇ assay 48 hr
- No Ag means the dendritic cells and 2C T cells were present but hsp65-Pl and hsp65 were absent: "No T” cells means the hsp65-Pl was present but the 2C T cells were omitted.
- Figure 8C is a graph illustrating inhibition of responses by a clonotypic monoclonal antibody to the 2C TCR (1B2).
- Bone marrow derived dendritic cells were incubated with lO ⁇ g/ml hsp65-Pl overnight. Equal numbers of naive 2C T cells were then added in the presence or absence of 1B2 Fab fragments (25 ⁇ g/ml). After an additional 18 hr, cells and supernatants were analyzed, respectively, for CD69 expression (left panel) and IL-2 production (3H-thymidine incorporation by IL-2-responsive HT2 cells, right panel).
- Figure 9A is a pair of graphs comparing dendritic cells' and macrophages' ability to stimulate T cell responses at limiting antigen dose in vitro.
- Fresh splenic dendritic cells or macrophages were incubated with various concentrations of hsp65- Pl or Mal-Pl fusion proteins for about 18 hr before adding purified naive 2C T cells (see Figs. 8 A, 8B).
- Supernatants were sampled 18 hr later to determine IL-2 levels (upper panel).
- 3 H-thymidine was added at 48 hr and cells were harvested after an additional 18 hr to assess T cell proliferation (lower panel).
- Figure 9B is a pair of graphs illustrating the behavior of hsp65 fusion protein-activated dendritic cells in vivo. Activation of dendritic cells in vivo. Myeloid dendritic cells from lymph nodes draining a subcutaneous site where hsp654-Pl was injected 24 hr previously show increased expression of MHC- 1 (Kb) (lower panel) compared to myeloid dendritic cells from lymph nodes draining an uninjected site ("no treatment", upper panel).
- Figure 9C is a trio of graphs illustrating the behavior of hsp65 fusion protein- activated dendritic cells in vivo.
- Dendritic cells activated with a noncognate hsp fusion protein (hsp65-NP) and pulsed with 10 "9 M SYRGL (SEQ ID NO: 4) peptide are more effective than nonactivated, similarly pulsed dendritic cells in stimulating naive T cells in vivo.
- 8 x 10 5 dendritic cells were injected into a hind footpad of normal B6 mice that had been injected (iv) with 2 x 10 6 naive 2C TCR+ cells (from 2C TCR transgenic mice RAG-deficient mice). 24 hrs after the footpad injection, 2C CD8 + T cells in the draining popliteal lymph node were examined for CD69 expression.
- Figure 10A is a pair of graphs of dendritic cell MHC class I expression plotted as a function of protein concentration of the added hsp fusion proteins and control proteins. Upper panel; dendritic cells from C57BL/6 mice. Lower panel; dendritic cells from C3H mice.
- hsp65-Pl or other hsp65 fusion proteins having as fusion partners influenza virus nucleoprotein (hsp65-NP) or human papilloma virus, type 16, E7 subunit (hsp65-E7 preparations #1 and #2) or with controls (hsp65 alone, PI alone, E7 alone, an anti-TNP IgG antibody).
- MHC Class I protein levels on the dendritic cells were then determined by flow cytometry by gating on propidium iodide-negative CDl lc + cells and using the Y3 antibody which recognizes both H-2 b (K b ) and H-2 MHC class I.
- MHC class I levels are shown as geometric mean fluorescence; the levels on untreated dendritic cells are represented by a dashed horizontal line.
- Figure 10B is a pair of graphs of the dendritic cell MHC class I expression values from Figure 10A and are plotted as a function of endotoxin concentration (calculated from the endotoxin levels present in the added hsp fusion proteins and other proteins).
- Upper panel dendritic cells from C57BL/6 mice.
- Lower panel dendritic cells from C3H mice.
- Figure IOC is a graph showing that Hsp65-Pl stimulates production of CTL
- mice were injected s.c. twice, one wk apart, with lOO ⁇ g of hsp65-Pl or Mal-Pl in PBS.
- One wk following the second injection cells from spleen and draining lymph nodes were pooled and restimulated with l ⁇ M SYRGL (SEQ ID NO: 4) peptide without addition of exogenous cytokines.
- Figure 11 is the nucleotide (cDNA) (SEQ ID NO: 5) and amino acid (SEQ ID NO: 5)
- FIG. 6 sequences of Mycobacterium tuberculosis hsp70 (TBhsp70) wherein segment II (nucleotides 481-1110; amino acids 161-370) is highlighted.
- Figure 12 is the nucleotide (SEQ ID NO: 7) and amino acid (SEQ ID NO: 8) sequences of segment II of TBhsp70.
- Figures 13A-13B are the nucleotide (SEQ ID NO: 9) and amino acid (SEQ ID NO: 9)
- An immunological response to a molecule that, notably, includes a CD8 + CTL response can be evoked in an individual by administering to that individual either an hsp joined to that molecule or a portion of an ATP binding domain of an hsp joined to that molecule (the molecule being virtually any biological substance, naturally- or nonnaturally-occurring with the exception of a portion of a stress protein).
- the CD8 + CTL response can be evoked in an individual who has a deficiency of CD4 + T cells (i.e. a CD4 + T cell count considered by any routinely used medical standard to be physiologically abnormal). Physicians and others having ordinary skill in the art can identify such individuals, which include patients infected with HIV.
- patients who are infected with HIV, or at risk of becoming so can be treated with either an hsp joined to an HIV antigen (e.g., p24 or gp41) or a portion of an ATP binding domain of an hsp joined to an HIV antigen (e.g. , p24 or gp41).
- an HIV antigen e.g., p24 or gp41
- a portion of an ATP binding domain of an hsp joined to an HIV antigen e.g. , p24 or gp41
- Heat shock proteins useful in the present invention are those that have an ATP binding domain and those that, when administered to an individual, induce a CD8 + T cell response to a molecule to which they are joined.
- Full length hsps e.g., hsp70 and hsp65
- the hsp moiety joined to the molecule can be the amino- terminal portion of the ATP binding domain.
- the hsp moiety joined to the molecule can include or consist of about half of the ATP binding domain.
- the hsp moiety can include or consist of about 25 to about 365 consecutive amino acid residues (e.g.
- the hsp moiety can include or consist of amino acid residues 161-370 of Mycobacterium tuberculosis hsp70 or amino acid residues 190-398 of murine hsp70.
- Portions of hsp65 that are homologous to segment II of hsp70 e.g. mycobacterial hsp65 such as Mycobacterium bovis BCG; mammalian hsp65, such as murine, canine, porcine, equine or human hsp65
- mycobacterial hsp65 such as Mycobacterium bovis BCG
- mammalian hsp65 such as murine, canine, porcine, equine or human hsp65
- nonpolar (hydrophobic) amino acid residues alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine can be substituted one for another; polar neutral amino acid residues such as glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine can be substituted one for another; positively charged (basic) amino acid residues such as arginine, lysine, and histidine can be substituted one for another; and negatively charged (acidic) amino acid residues such as aspartic acid and glutamic acid can be substituted one for another.
- polar neutral amino acid residues such as glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine can be substituted one for another
- positively charged (basic) amino acid residues such as arginine, lysine, and histidine can be substituted one
- the hsp moiety used as described herein can include 1-25% conservative amino acid substitutions.
- Any hsp or any portion of the hsp ATP binding domain can be purified from natural sources, recombinantly produced, or chemically synthesized.
- an hsp or a portion thereof can be obtained from mycobacteria (e.g., Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium leprae, or Mycobacterium smegmatis), mammals (e.g. a murine, canine, porcine, equine, or human), fungi, parasite, or bacteria.
- mycobacteria e.g., Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium leprae, or Mycobacterium smegmatis
- mammals e.g. a murine, canine, porcine, equine, or human
- fungi parasite
- parasite or
- Molecules useful in the present methods include any molecule against which a CD4 + independent immune response is desired.
- a "molecule” includes, but is not limited to, proteins or fragments thereof (e.g. , proteolytic fragments), peptides (e.g. , synthetic peptides or polypeptides), antigens, glycoproteins, carbohydrates (e.g. , polysaccharides and oligosaccharides), lipids, glycolipids, DNA (e.g., recombinant DNA), killed or attenuated whole organisms (e.g., viruses, bacteria, mycobacteria, parasites or fungi) or portions thereof, toxins, toxoids or any other organic molecule.
- proteins or fragments thereof e.g. , proteolytic fragments
- peptides e.g. , synthetic peptides or polypeptides
- antigens e.g. , glycoproteins, carbohydrates (e.g. , polysaccharides
- Molecules useful in the present methods can be obtained from a variety of sources using techniques routinely practiced in the art.
- the molecule can be obtained from pathogens or organisms such as bacteria, mycobacteria, viruses, fungi or parasites.
- pathogens or organisms such as bacteria, mycobacteria, viruses, fungi or parasites.
- the molecule can be isolated (e.g., purified or partially purified (e.g. physically separated from at least 50% of the biological substances with which it naturally associates), it can also be chemically synthesized, recombinantly produced, or purchased from a commercial supplier.
- the hsp or portion thereof is “joined” to a molecule against which an immune response is desired.
- the term “joined” includes covalent attachment of the hsp, or a portion thereof, to the molecule.
- the conjugation can be carried out using techniques routinely practiced in the art (e.g. , by forming a covalent bond between the hsp, or the portion thereof, and the molecule or by reductive amination).
- the term “joined” also includes fused proteins, such as those created by recombinant techniques or chemical synthesis.
- the fusion protein can include the molecule fused to the amino-terminal region or the C-terminal region of the hsp, or the portion thereof.
- the CD8 + CTL responses induced by the methods of the present invention can be used for prophylaxis and/or therapy of diseases or conditions, particularly those characterized by a lack or deficiency of CD4 + T cells. That is, the hsp or portion thereof joined to the molecule against which an immune response is desired can be administered to an individual either before or after a disease or condition is manifested and can result in prevention, amelioration, elimination or delay in the onset or progression of the disease state.
- the present invention can be used to prevent or treat an individual positive for human immunodeficiency virus (HIV) and the opportunistic infections associated with HIV.
- HIV positive individual is deficient in CD4 + T cells.
- an effective amount of the hsp or portion thereof joined to the molecule against which an immune response is desired is administered to an individual (e.g., mammal such as human).
- an "effective amount” is an amount that induces a CD4 + T cell independent immune response to the molecule in an individual.
- an "effective amount” is an amount such that when administered to an individual, it results in an enhanced CD8 + CTL response to the molecule relative to the CD8 + CTL response to the molecule in an individual to whom an effective amount was not administered.
- an effective amount or dosage of the hsp or portion thereof joined to the molecule against which an immune response is desired is in the range of about 50 pmoles to about 5000pmole.
- the dosage range if from about 80pmole to about 3500pmoles; in another embodiment, the dosage range is from about lOOpmoles to about 2000pmoles; and in a further embodiment the dosage range is from aboutl20pmoles to about lOOOpmoles.
- the appropriate dosage of hsp or portion thereof joined to the molecule against which an immune response is desired for each individual will be determined by taking into consideration, for example, the particular hsp and/or molecule being administered, the type of individual to whom the composition is being administered, the age and size of the individual, the condition or disease being treated or prevented and the severity of the condition or disease. Those skilled in the art will be able to determine using no more than routine experimentation the appropriate dosage to administer to an individual.
- the hsp or portion thereof joined to the molecule against which the immune response is desired can be administered to the individual in a variety of ways.
- the routes include intradermal, transdermal, (e.g., slow release polymers), intramuscular, intraperitoneal, intravenous, subcutaneous, oral, epidural and intranasal routes. Any other convenient route of administration can be used, for example, infusion or bolus injection, infusion of multiple injections over time, or absorption through epithelial or mucocutaneous linings.
- the hsp joined to the molecule can be administered with other components or biologically active agents, such as adjuvants, pharmaceutically acceptable surfactants (e.g., glycerides), excipients, (e.g., lactose), liposomes, carriers, diluents and vehicles.
- adjuvants e.g., glycerides
- excipients e.g., lactose
- liposomes e.g., liposomes, carriers, diluents and vehicles.
- the hsp or portion thereof joined to the molecule can be administered by in vivo expression of polynucleotides encoding such into an individual.
- the hsp or portion thereof and/or the molecule can be administered to an individual using a vector, wherein the vector which includes the hsp or portion thereof joined to the molecule is administered under conditions in which the hsp or portion thereof and the molecule are expressed in vivo.
- vector systems such as yeast or vaccinia virus expression systems, or virus vectors can be used in the methods and compositions of the present invention (Kaufman, R.J., J. Meth. Cell and Molec. Biol, 2:221-236 (1990)).
- hsp70 fusion proteins elicit CD8 + CTL in the absence of CD4 + T lymphocytes and this function resides in a 200-amino acid segment of TBhsp70, indicating that chaperone activity is not required.
- hsp70 was dissected to ascertain whether a particular hsp domain is necessary, and knockout mice were used to determine whether the fusion protein's immunogenicity is dependent on CD4 + T lymphocytes. It was found that the ability to elicit CD8 + CTL depends on a discrete 200-amino acid protein domain, indicating that the fusion protein's immunogenicity for CD8 + T cells does not require coupled chaperone function or peptide binding.
- ovalbumin.hsp70 fusion protein elicited anti-ovalbumin CD8 + CTL about equally well in CD4 knockout and wild-type C57BL/6 mice, and also when the hsp70 was of mycobacterial (Mycobacterium tuberculosis) or murine (self) origin.
- Mycobacterial tuberculosis mycobacterial tuberculosis
- murine (self) origin mycobacterial (Mycobacterium tuberculosis) or murine (self) origin.
- the ability of hsp70 fusion proteins to elicit CD4-independent CTL responses indicates that hsp70 fusion proteins can be used for immunological prophylaxis and therapy against disease in CD4 + T cell deficient individuals.
- a mycobacterial heat shock protein 65kDa (hsp65), fused to a polypeptide (PI) that contains an octapeptide (SrYRYYGL (SEQ ID NO: 1)) agonist for a particular T cell receptor (2C TCR) stimulated C57BL/6 mice, as well as CD4-deficient mice, to produce CD8 + cytolytic T lymphocytes (CTL) to the fusion partner's octapeptide.
- 2C TCR T cell receptor
- CTL cytolytic T lymphocytes
- This and other hsp65 fusion proteins but not native hsp65 itself, stimulated dendritic cells, in vitro and in vivo, to upregulate the levels of MHC (class I and II) and costimulatory (B7.2) molecules.
- hsp fusion proteins having fusion partners of widely differing lengths and sequences, elicit CD8 CTL to peptides from the fusion partners, without requiring exogenous adjuvants or the participation of CD4 + T cells.
- fusion partners mycobacterial hsp fused with large protein fragments, termed fusion partners, are injected into mice in saline solution (PBS) without added adjuvants several of them were previously shown to stimulate the production of CD 8 CTL that recognize short peptide epitopes (8-10 amino acids in length) that arose from the fusion partners.
- the fusion partners varied from about 80 to 110 amino acids in length and were derived from ovalbumin (Suzue, K., et al, Proc. Natl. Acad. Sci, USA, 94:13146-13151 (1997)), influenza virus nucleoprotein (Anthony, L., et al, Vaccine, 17:373-383 (1999)), and an entire protein subunit of a human papilloma virus (N.R. Chu, personal communication).
- Example 2 To explore the mechanisms that permit these hsp to be effective with such diverse fusion partners, and that enable the hsp fusion proteins to serve as effective immunogens for CD8 T cells without requiring adjuvants, the immunogenic activities of fusion proteins prepared from the 65 kDa hsp from Mycobacterium bovis, BCG strain (here called hsp65) were studied.
- the principal fusion partner used in Example 2 was a polypeptide that contains an octapeptide sequence, SIYRYYGL (SEQ ID NO: 1) (hereafter called SYRGL (SEQ ID NO: 4), Udaka, K., et al, Cell, 69:989-998 (1992)), which together with K b serves as a potent stimulator of CD8 T cells having the TCR of a CTL clone called 2C (Kranz, D., et al, Proc. Natl. Acad. Sci. USA, 57:573-577 (1984)).
- This peptide was identified in a synthetic peptide library and, so far as is known, does not occur in nature.
- ovalbumin amino acid 230-359, hereafter referred to as OVA
- OVA ovalbumin
- coli DnaK Zhu, X., et al., Science, 272:1606- 1614 (1996) were used.
- the full-length TBhsp70 were separated into four segments I, ⁇ , III and IV.
- the full-length TBhsp70 and each segment were fused to C-terminal of OVA to make OVA.TBhsp70 fusion proteins. (The sequences of these and other PCR primers are listed at the end of the Methods and Materials section).
- the OVA expression vector pQH07 was constructed by subcloning OVA into the Ndel and Nhel sites of pKS 1 lh.
- Full-length TBhsp70 and four truncated TBhsp70 segments I (aa 1-166), II (aa 161-370), IH (aa 360-517) and IV (aa 510- 625) were amplified from plasmid pY3111/8 (kind gift of W. Wu, StressGen Biotechnologies, Vancouver Canada).
- the upstream primer for full-length TBhsp70 and segment I is oQHOOl, and the downstream primers are 0JRO6I and oQHOl 1, respectively.
- the upstream primers for TBhsp70 II, HI and IV are oQH012, oQH014 and 0QHIO6, respectively.
- the downstream primers are oQH013, oQH015 and 0JRO6I, respectively.
- the plasmids pQH06, pQH08, pQH09, pQHIO and pQHl 1, which express OVA fused to TBhsp70, TBhsp70 segment I, segment ⁇ , segment HI and segment IV respectively, were constructed by subcloning the full-length and truncated TBhsp70 PCR products into the BamHI and EcoRI sites of pQH07 (at the C-terminus of OVA).
- Murine hsp70.1 coding sequence (refe ⁇ ed to here as mhsp70) was amplified from plasmid pmhsp70.1 by PCR using the upstream primer oJR102 and the downstream primer oJR103. Plasmid pQH12, expressing OVA.mhsp70 fusion protein, was created by subcloning mhsp70 into the BamHI and EcoRI sites of pQH07. All plasmids were verified by sequencing in both directions with double-stranded DNA templates .
- OVA, OVA.TBhsp70, OVA.TBhsp70 ⁇ , OVA.TBhsp70 m, and OVA.TBhsp70 IV were induced in E. coli (BL21(DE3)pLysS) for 9 hours at 25° in the presence of 0.5-1 mM isopropyl thiogalactoside (IPTG) and were purified as soluble proteins.
- the mycobacterial segment I and murine hsp70 fusion proteins were induced in E. coli for 4 hours at 37° with 1 mM IPTG and purified from inclusion bodies and then refolded as previously described (Suzue, K., et al, Proc. Natl. Acad. Sci.
- mice Six- to eight-week old female C57BL/6, CD4-/- and ⁇ 2m-/- mice were obtained from the Jackson Laboratory (Bar Harbor, ME) and Taconic Farms (Germantown, NY). Both knockout mice have C57BL/6 (H-2 b ) genetic backgrounds. Groups of 3 to 4 mice were injected intraperitoneally (i.p.) with 120 pmoles of recombinant protein in PBS; a second injection was performed subcutaneously (s.c.) two weeks later. The mice were sacrificed 10 days after the boost and splenocytes within groups were pooled (Suzue, K., et al, Proc. Natl. Acad. Sci. USA, 94:13146-13151 (1997)).
- EG7-OVA cells were cultured as previously described (Suzue, K., et al, Proc. Natl.
- OVA-specific CTL elicited by immunization with OVA.TBhsp70 fusion protein without adjuvant were examined.
- the splenocytes from mice immunized with OVA ( ⁇ ) or OVA.TBhsp70 ( ⁇ ) were incubated with i ⁇ adiated EG7-OVA cells for 6 days in the absence of added cytokines and then used as effector cells (E) in a standard 4 hour cytotoxicity assay.
- the 51 Cr-labeled target cells were: T2-K b (dashed line) and T2-K b - ⁇ ulsed with S ⁇ NFEKL peptide (SEQ ID NO: 2) (solid line) at 33 ⁇ g/ml.
- Splenocytes from wild- type C57/BL/6 mice are shown in Figure 1 A; splenocytes from CD4 -/- mice are shown in Figure IB; and splenocytes from ⁇ 2m -/- mice are shown in Figure lC.
- PCRprimers oQH025 (5'- GCAGTACTCATATGATCCTGGAGCTTCCATTTG CCAGTGGGACAATG-3') (SEQ ID NO: 13)
- oQH027 (5'- CTCCGACCTCACCTACGACGTTCGCAGAGACTTC TTAAAATTATCCGATCGCCTAGACCTAGT-3') (SEQ ID NO: 14)
- oQHOOl (5'- ATAGTACTGGATCCATGGCTCGTGCGGTCGGGATC GACCTCGGG- 3') (SEQ ID NO: 15)
- oQHOl 1 (5'- GTCGACGAATTCATCATCAGATTCGCTGCTCCTTCTCGCCC TTGTCGAG-3') (SEQ ID NO: 17)
- oQH012 (5'- GTCGACGGATCCATGGAGAAGGAGCAGCGAATCCTGGT CTTCGACTTG-3') (SEQ ID NO: 18)
- oQH014 (5'- GTCGACGGATCCATGGTGAAAGACGTTCTGCTGCTTGATGTTACCCCG-3') (SEQ ID NO: 19)
- oQHOl 3 (5'-GTCGACGAATTCATCACGGGGTAACATCAAGCAGCAGAA CGTCTTTCAC-3') (SEQ ID NO: 21)
- oQH015 (5'-GTCGACGAATTCATCAGACCAATGTCTCGGCTTGATTACG AACATCGGC-3') (SEQ ID NO:22)
- oJR102 (5'-TCTAGAGGATCCATGGCCAAGAACACGGCGATC-3') (SEQ ID NO: 23)
- oJR103 (5'-TCTAGAGAATTCCTAATCCACCTCCTCGATGGTGGGTCC-3') (SEQ ID NO:24)
- hsp70 fusion proteins provide hsp70-specific cognate CD4 + T cell help to OVA- specific CD8 + CTL by activating shared professional antigen presenting cells (APCs) as suggested by many, and demonstrated recently (Bennett, S.R.M., et al, Nature, 593:478-480 (1998); Ridge, J.P., et al, Nature, 393:474-478 (1998) and Schoenberger, S.P., et al, Nature, 393:480-483 (1998)).
- APIs shared professional antigen presenting cells
- CD4 knockout mice exhibit a range of CD8 + CTL responses: CD4-dependent, weakly dependent, or independent.
- CTL responses to minor histocompatibility antigens (Ridge, J.P., et al, Nature, 393:474-478 (1998), Guerder, S. and Matzinger, P., J. Exp. Med., 77(5:553-564 (1992)) or to ovalbumin loaded into spleen cells (Bennett, S.R.M., et al, J. Exp. Med., 186:65-70 (1997)) are CD4- dependent.
- Some potent CD8 + T cell immunogens including viruses (Bachmann, M.F., et al, J. Immunol, 7(57:5791-5794 (1988)), such as lymphocytic choriomeningitis virus (Leist, T.P., et al, J. Immunol, 735:2278-2281 (1987); Ahmed, R., et al, J. Virol, 62:2102-2106 (1988); Rahemtulla, A., et al, Nature, 353:180-184 (1991) and von He ⁇ ath, M., et al, J.
- viruses Bacillus, M.F., et al, J. Immunol, 7(57:5791-5794 (1988)
- lymphocytic choriomeningitis virus Leist, T.P., et al, J. Immunol, 735:2278-2281 (1987); Ahmed, R., et al, J. Virol,
- TBhsp70 was divided into four linear segments and OVA and a glycine/serine linker were fused to the amino-terminus of each segment, creating OVA.TBhsp70s I-IV ( Figure 3).
- each segment co ⁇ esponds to a distinct structural domain of hsp70 as described by Flaherty, K.M., et al, Nature, 346:623-628 (1990) and Zhu, X., et al, Science, 272:1606-1614 (1996).
- the amino-terminal ATP -binding domain was divided into its two structural lobes: I (aa 1-160) and II (aa 161-362).
- the carboxy-terminal peptide-binding domain was divided into a ⁇ -sandwich domain, IH (aa 364-512), and an ⁇ -helical domain, IV (aa 512-625).
- the data described herein support a model in which hsp70 bypasses the need for CD4 + help by directly or indirectly activating or affecting the maturation state of APCs such as dendritic cells in a manner similar to some viruses (Ruedl, C, et al, J. Exp. Med., 759:1875-1883
- hsp70 fusion proteins likely activate few CD8 + T cells to release immunostimulatory cytokines in draining lymph nodes. These cytokines, in turn, provide the help required to upregulate expression of costimulatory molecules on APCs in the lymph node, leading to further CD8 + T cell activation (Ruedl, C, et al, J. Exp. Med., 759:1875-1883 (1999)).
- cytokines provide the help required to upregulate expression of costimulatory molecules on APCs in the lymph node, leading to further CD8 + T cell activation (Ruedl, C, et al, J. Exp. Med., 759:1875-1883 (1999)).
- Recent studies demonstrate that exposure of macrophages to bacterial and human hsp60 (Chen, W., et al, J. Immunol, 7(52:3212-3210 (1999); Kol, A., et al, J. Clin. Invest.
- hsp70 can be used as a vehicle for the development of prophylaxis and therapy of diseases or conditions characterized by a lack or deficiency of CD4+ cells, such as HIV-l and its opportunistic infections. Infections by HIV and its simian cousin SIV can lead to a substantial reduction of CD4 + T cells, thereby crippling the host's immune response to HIV and other pathogens. This loss of CD4 + cells is thought to impair the development and maintenance of CD8 + CTL responses (Kalams, S.A., et ⁇ /., J. Virol, 73:6715-6720 (1999)).
- HlV-specific CTL responses are required to keep HIV-l infection in check and to destroy HlV-infected cells (Ha ⁇ er, T., et al, AIDS Res. Hum. Retro., 72:585-592 (1996); Harrer, T., et al, J. Immunol, 756:2616-2623 (1996); Yang, O.O., et al, J. Virol, 70:5799-5806 (1996); Yang, O.O., et al, J. Virol, 77:3120-3128 (1997); Matano, T., et al, J. Virol, 72:164-169 (1998) and Wagner, L., et al, Nature, 397:908-911 (1998)).
- mice C57BL/6 (H-2 b ), Cd4-deficient (CD4 tmlMak, H-2 ), and C3H/HeJ mice (H- 2 k ) were obtained from The Jackson Laboratories (Bar Harbor, ME), maintained in barrier cages under specific pathogen free conditions, and immunized between 4- and 10-weeks of age.
- 2C TCR transgenic mice (H-2 b ) contain the rearranged transgenes encoding the ⁇ TCR from a 2C CTL clone (Sha, W., et al, Nature, 335:271-27 A (1988)).
- 2C TCR transgenic mice deficient for the recombination activating gene-1 (termed 2C/RAG) (Manning, T., et al, J. Immunol, 759:4665- 4675 (1997)) were used as a source of naive T cells for in vitro assays (Cho, B., et al, Proc. Natl. Acad. Sci. USA, 96:2976-2981 (1999)).
- 2C CTL clone. L3.100 has been previously described (Sykulev, Y., et al, Immunity, 9:475-483 (1998)).
- EL4 cells were obtained from the ATCC (Rockville, MD) and T2-K b cells were a generous gift from Peter Creswell, Yale University.
- Plasmids, peptides, and proteins In the PI polypeptide the sequences flanking the - and C- termini of the PI polypeptide the sequences flanking the - and C- termini of the PI polypeptide the sequences flanking the - and C- termini of the PI polypeptide the sequences flanking the - and C- termini of the
- SYRGL octapeptide (Fig. 5 A), from ovalbumin (ova251-257) and - ketoglutaraldehyde dehydrogenase, respectively, were modified by addition of a lysine residue penultimate to the N-terminus (out of ubiquitination consideration) (Eisenlohr, L., et al, J. Exp. Med., 75:481-487 (1992); York, LA. and Rock, K.L., Annu. Rev. Immunol, 74:369-396 (1996)), and an isoleucine and a tyrosine residue were added at the - and C-termini for cloning purposes.
- Complementary oligonucleotides encoding PI were synthesized and cloned into a mammalian expression vector VR1055 (Vical, San Diego, CA), and subsequently subcloned as an in-frame fusion at the 3' end of M. bovis BCG hsp65 gene (hsp65-Pl) into the bacterial expression vector pET28A+ (Novagen, Madison, WI). The PI sequence was also subcloned into the 3' end of the gene encoding E.
- hsp65 fusion proteins used in this example, as well as the unmodified hsp65 were produced as recombinant proteins in E coli.. They were purified under denaturing conditions from the soluble fraction of bacterial lysates and fractionated successively on butyl-Sepharose, Q-Sepharose (and Ni-Sepharose when applicable), and finally by dialysis against PBS. Mal-Pl was purified by amylose affinity chromatography (New England Biolabs, Beverly, MA). SDS-PAGE analysis of purified hsp65-Pl revealed a major species at
- Protein concentrations were estimated by bicinchoninic acid or amino acid analyses and were expressed in molar terms to facilitate comparisons between proteins and polypeptides of differing molecular masses. Endotoxin concentrations of recombinant protein preparations were determined by the Limulus assay, using reagents and conditions according to Associates of Cape Cod (Falmouth, MA). Peptide concentrations were estimated by W/V or based on amino acid analyses.
- bone marrow was flushed from the femur and tibia, red blood cells were lysed, and the remaining cells were cultured at 10 6 cells/ml in RPMI 1640 medium (supplemented with 10% heat-inactivated fetal calf serum, 2mM L-glutamine, lOmM HEPES, 50 ⁇ m ⁇ -mercaptoethanol, 100 U/ml penicillin and lOO ⁇ g/ml streptomycin) containing 20 ng/ml murine GM-CSF (R&D Systems, Minneapolis, MN).
- the medium was replaced on days 2 and 4, and on day 6 the cells (immature dendritic cells) were harvested for use.
- In vitro assays were performed with purified cell populations unless otherwise noted. Magnetic cell sorting (MACS) was carried out according to the manufacturer's instructions (Miltenyi Biotec. Auburn, CA). Dendritic cells (splenic or bone ma ⁇ ow-derived) were isolated by positive sorting using anti-CD 1 lc antibody (purity ranged from 70-97%).
- Peritoneal lavage macrophages were purified by treating them with biotinylated antibodies specific for CDl lc, GR.l, and B220, followed by washing and incubating them with magnetic microbeads coated with anti-CD4 or anti-CD8 antibodies or with streptavidin and then passing them over a negative sorting column. Macrophage purity was typically >90%.
- lymph node and spleen cells were coated with anti-CD8 magnetic beads (an average of 2 beads per cell) and positively sorted as above (purity >93%).
- APC showed no increase in B7.2, MHC class I, or cell diameter, and T cells showed no CD69 upregulation after 24 hr in culture. There was also no significant 3 H-thymidine incorporation by T cells after 48 hr incubation.
- 51 Cr-labeled T2-K b cells were used as target cells. They were incubated with effector cells derived from either fusion protein-injected mice or from cultured 2C T cell clones for 4 hr in the presence or absence of
- dendritic cells and macrophages were used as target cells. Each of these cell populations was purified by MACS and then 51 Cr-labeled for 1 hr at 37°C. The labeled cells were then incubated with hsp65-Pl together with the 2C CTL clone (L3.100) at a CTL: target cell (E:T) ration of 5:1. Assays were performed in triplicate using 96-well round bottom plates and cell supernatants were counted in a ⁇ spectrometer after 4 hr. Specific lysis was calculated as above. Transient transfection and antigen processing assays
- EL4 cells (5 x 10 6 ) were electroporated with 15 ⁇ g of the parent plasmids or plasmids containing the genes for PI (in VR1055) or hsp65-Pl (in pClneo). 48 hr after transfection, the cells were subjected to centrifugation in Ficoll-Paque (Pharmacia Biotech., Piscataway, NJ) (2200rpm, 20 min) and 10 6 live cells were incubated with an equal number of splenocytes from naive 2C/RAG mice.
- Ficoll-Paque Pharmacia Biotech., Piscataway, NJ
- the cells were stained with 1B2, anti-CD69, and anti-CD8 antibodies (labeled with FITC, PE, and allophycocyanin, respectively) and 2C T cells were evaluated for upregulation of CD69 by flow cytometry, gating on propidium iodide-negative, 1B2 + , CD8 + cells.
- Purified dendritic cells and macrophages were incubated with various concentrations of proteins or peptides in 96-well (5 x 10 4 cells/well) flat bottom plates for 24 hr at 37°C. The following day an equal number of purified naive 2C T cells were added to each well (final volume: 200 ⁇ l for the 96-well plates, 600 ⁇ l for the 48-well plates). After 18 hr., the 48-well plates were separated into i) cell pellets to analyze 2C T cells for expression of the acute activation marker CD69 by flow cytometry, gating on propidium iodide-negative.
- 1B2 + CD8 + cells and ii) cell supernatants to measure IL-2 secretion (in triplicate, using HT2 cells in a standard bioassay) (Watson, J., J. Exp. Med., 750:1510-1519 (1979)).
- the 96- well plates were assayed for IFN- ⁇ secretion (using 50 ⁇ l of cell supernatants and a capture ELISA assay (R&D Systems, Minneapolis, MN), and for T cell proliferation (1 mCi 3 H-thymidine (NEN, Boston, MA) was added per well and 16 hr later the cells were harvested to measure H-thymidine-incorporati on).
- 1B2 Fab fragments were added to naive 2C T cells at a final concentration of 25 ⁇ g/ml.
- Immature bone ma ⁇ ow-derived dendritic cells (day 6 of culture) were purified by magnetic sorting (>95% CDl lb + CDl lc + ) and incubated (2.5 x 10 5 cells/well in 96-well round bottomed plates) with various fusion proteins or control proteins. The following day, cells were analyzed by flow cytometry for expression of B7.2 and MHC class I and class II molecules, gating on propidium iodide- negative, CDl lc + cells.
- the principal fusion protein used herein contains the polypeptide PI fused to the C-terminus of hsp65.
- PI includes the octapeptide, SYRGL, that behaves, in association with K b , as a strong agonist for the TCR on 2C T cells (Sykulev, Y., et al, Immunity, 4:565-571 (1996)).
- PI polypeptide alone or linked as a fusion partner to hsp65, could be cleaved intracellularly to liberate the SYRGL octapeptide
- transfected plasmids containing sequences for PI or hsp65-Pl were transfected into EL4 cells (H-2 b ). Because relatively few of the transiently transfected cells were expected to express PI or hsp65-Pl, the transected cell population was not used in cytolytic assays as targets for 2C CTL. Instead, their ability to stimulate naive 2C T cells were examined. As shown in Fig.
- naive T cells 80-90% of these naive T cells were stimulated to express the acute activation marker CD69 in response to EL4 cells transfected with either the PI or hsp65-Pl plasmids, while virtually none of the naive T cells were activated by cells transfected with the empty plasmids (vector, shaded histograms, Fig. 5C). These results indicate that in these transfected cells PI and hsp65-Pl can be cleaved to release the octapeptide, which is then presented by K b .
- mice produce SYRGL-specific CD8 + cytolytic T cells in response to hsp65-Pl
- mice Before immunizing mice with hsp65-Pl, it was first ensured that CD8 T cells that can recognize the SYRGL octapeptide (SEQ ID NO: 4) are present in normal C57BL/6 (H-2 b ) mice. The mice were therefore injected with SYRGL peptide (SEQ ID NO: 4) in adjuvant (TiterMaxGold), their spleen cells were maintained in culture for several weeks (see Methods) and subsequently tested in a standard cytotoxicity assay. As shown in Fig.
- the cell line's lysis of K b+ target cells was SYRGL (SEQ ID NO: 4)-dependent, indicating the presence in these mice of T cells that can respond to SYRGL-K b complexes.
- mice normal C57BL/6 mice were injected subcutaneously (s.c.) with the fusion protein in saline without added adjuvants. Each mouse received two injections, one wk apart. 7 days after the 2 nd injection cells from regional lymph nodes and spleen were restimulated in culture with SYRGL (1 ⁇ M) in the absence of exogenous cytokines, and tested after 6 days for CTL activity in a 4 hr cytolytic assay, using 51 -Cr labeled K b+ target cells (T2-K b ; see Methods).
- mice Of 40 injected mice, 35 produced CTL whose lysis of the K b+ target cells was SYRGL-dependent (see Fig. 6A for a representative response).
- As little as l ⁇ g (0.015 nmoles) of hsp65-Pl could elicit an anti-SYRGL CTL response.
- a control fusion protein made by fusing the PI sequence to the C- terminus of another bacterial protein chosen simply for ease of purification (the E.
- coli maltose binding protein here called Mal-P 1
- Mal-P 1 was around 10- 100 times less effective in these assays (Fig. 6B) and without any detectable effect in others (Figs. 7, 8A-8C, 9A-9C, 10A-10C).
- Fig. 7, 8A-8C, 9A-9C, 10A-10C Removal of CD8 T cells by magnetic sorting showed that the cytolytic response to hsp65-Pl was due to CD8 T cells (Fig. 6C).
- Dendritic cells and macrophages differ in ability to serve as antigen-presenting cells for hs ⁇ 65-Pl
- APC antigen presenting cells
- the PI peptide was exceptional in that it exhibited some activity; with both dendritic cells and macrophages it stimulated CD69 expression and with dendritic cells, but not with macrophages, it induced proliferation and EL-2 secretion by the naive 2C T cells. It is likely that the PI peptide itself is subject to proteolysis by these APC, particularly by dendritic cells, but whether extracellularly or in some intracellular compartment is not clear. Whatever the explanation, it should be noted that the PI polypeptide did not stimulate CD8 CTL production in vivo under conditions where the hsp65-Pl fusion protein was consistently effective (Fig. 6A).
- PI also failed to activate dendritic cells (see Figs. 10A-10C).
- these cells were incubated with various concentrations of the fusion proteins and then evaluated their ability to stimulate naive 2C T cells.
- Fig. 9A the naive cells proliferated and produced substantial amounts of IL-2 in response to dendritic cells that had been incubated with concentrations of hsp65-Pl in the 0.1- .01 ⁇ M range.
- hsp65-Pl The distinctive ability of hsp65-Pl to stimulate naive 2C (anti-SYRGL) T cells in vitro only in the presence of dendritic cells led to the examination of the effect of hsp65-Pl on dendritic cells directly.
- Fig. 10A when immature bone-ma ⁇ ow derived dendritic cells (day 6 in culture) were incubated overnight with various concentrations of hsp65-Pl the dendritic cell surface level of an MHC class I molecule (K b ) was increased.
- hsp65-Pl concentration a series of control proteins and peptides (hsp65 alone, PI alone, SYRGL, Mal-Pl, or a monoclonal IgG antibody [anti-2,4,6, trinitrophenyl]).
- Other hsp65 fusion proteins having various fusion partners (influenza virus nucleoprotein or the E7 subunit of human papilloma virus) also elicited increased expression of K b on the dendritic cells (Fig. 10A). It is important to note, however, that unmodified hsp65 ("hsp65 only" in Fig.
- the hsp fusion proteins stimulated increased expression of MHC class ⁇ and B7.2 (CD86) (the Table); the level of CD40 was, however, only marginally affected. Native hsp65 did not affect expression of MHC class Et or B7.2, just as it failed to affect levels of MHC class I.
- Heat shock fusion proteins stimulate increased expression of MHC and costimulatory (B7.2) molecules on dendritic cells
- Dendritic cells from bone marrow of C3H/HeJ mice were incubated for 18 hrs with 1.5 x 10 "6 M of various heat shock proteins or the control PI peptide prior to cell surface staining.
- CD4 knockout mice (CD4 ⁇ ' ⁇ ) were immunized using the same regimen as before (Fig. 6A-6C) and their ability to produce SYRGL-specific CTL was assessed. As seen in a representative response in Fig.
- mycobacterial hsp65 fused to the PI polypeptide activates dendritic cells and stimulates, in the absence of CD4 + T cells, the production of CD8 + CTL that recognize a short peptide derived from P 1.
- the findings extend the number and diversity of hsp fusion proteins that can elicit CD 8 T cell responses and suggest a potential mechanism by which the fusion proteins exert their effects in the absence of added adjuvants, a prominent feature of the in vivo responses to all hsp fusion proteins.
- CD4 T cell help and adjuvants are required for CD8 T cell responses, it is likely that they function by activating dendritic cells (Bennett, S., et al, Eur. J.
- HSP fusion proteins activate dendritic cells directly
- hsp65-Pl as well as each of the other hsp65 fusion proteins tested, is capable of directly stimulating dendritic cells to increase their surface expression of MHC class I and II and costimulatory (B7.2) molecules.
- Dendritic cells infected with mycobacteria, including BCG, or streptococci, or Leishmania have been shown to upregulate MHC and costimulatory molecules B7.1 and B7.2 and, in addition, to secrete IL-12 (Deblock, C, et al, Eur. J. Immunol, 29:1972-1979 (1999); Henderson, R., et al, J. Immunol, 759:635-643 (1997); Konecny, P., et al, Eur. J. Immunol, 29:1803-1811 (1999); Rescigno, M., et al, Proc. Natl. Acad. Sci. USA, 95:5229-5234 (1998)).
- microbial cell hsp molecules are responsible for these effects. If so, the findings described herein (of a difference between hsp65 fusion proteins and unmodified hsp65) indicate that upregulation of these activation molecules are due to the hsp in a modified form, resembling perhaps the hsp65 fusion proteins studied here, rather than naive hsp molecules. Dendritic cells infected with certain viruses, e.g., influenza virus (Ridge, J., et al, Nature, 393:474-478 (1998)), likewise become activated.
- viruses e.g., influenza virus (Ridge, J., et al, Nature, 393:474-478 (1998)
- the hsp fusion proteins appear, so far, to be the only soluble immunogenic proteins that directly activate dendritic cells, in vitro and in vivo, to upregulate expression of MHC and costimulatory molecules.
- the experimental system described herein is useful for investigating the pathways by which hsp fusion proteins are processed and presented by dendritic cells and the mechanisms by which MHC and costimulatory molecules are up-regulated.
- Hsp fusion protein stimulation of CD8 T cell production does not depend upon CD4 T cells
- hsp65 can serve as an effective carrier molecule in the classic sense: i.e., when chemically coupled to nonimmunogenic hapten-like molecules (polysaccharides, a malarial peptide) the conjugates elicited IgG antibodies to the adducts in responses that were presumably T-cell dependent (Barrios, C, et al, Eur. J. Immunol, 22:1365-1372 (1992)).
- This mechanism is clearly not essential, because CD4 " _ mice injected with hsp65-Pl produced cytolytic CD8 T cells to the fusion partner's peptide. Nevertheless, it is entirely possible that in normal animals the response may be enhanced by CD4 T cells specific for peptides derived from the hsp moiety.
- CD8 T cell responses could not be elicited in CD4 ⁇ ' ⁇ mice (DiRosa, F. and Matzinger, P., J. Exp.
- CD8 CTL responses in CD4 "/_ mice were virtually the same as in normal mice (Rahemtulla, A., et al, Nature, 353:180-184 (1991); Rock, K. and Clark, K, J. Immunol, 756:3721-3726 (1996); Stevenson, P., et al, Proc. Natl. Acad. Sci. USA, 95:15565-15570 (1998)). That CD4 T cells are not required for the CD8 T cell response to hsp65-Pl indicates that hsp fusion proteins are relatively potent immunogens for CD8 T cells.
- hsp65 In the several hsp fusion proteins examined here the only common element is hsp65. The question arises as to how the hsp moiety can directly activate dendritic cells (and thereby elicit CD8 CTL production), regardless of wide variations in length and sequence of the fusion partners. It is particularly notable, in contrast, that unmodified ("native") hsp65 lacks this critical activity.
- the hsp moiety adopts a particular conformation or displays a linear sequence or peptide motif or pattern that is i) necessary for eliciting the dendritic cell response, ii) retained despite wide variations in the fusion partner sequences, and iii) absent or masked in unmodified ("native") hsp65.
- the intensity of cu ⁇ ent interest in CD8 vaccines for HIV-l and other persistent intracellular pathogens, as well as for cancer cells, is reflected in recent studies of diverse genetic vaccines and of several bacterial toxins fused to antigenic peptides or polypeptides as stimulators of CD8 CTL production.
- nonapeptide sequences inserted into a truncated subunit of anthrax toxin or pertussis toxin could elicit CD8 CTL in vivo (Ballard, J., et al, Proc. Natl. Acad. Sci. USA, 93:12531-12534 (1996) and render target cells susceptible to lysis by cognate CD8 CTL in vitro (Goletz, T., et al, Proc. Natl. Acad. Sci. USA, 94:12059-12064 (1997); Carbonetti, N, et al, Infect. Immun., 67:602-607 (1999)).
- the hsp fusion proteins as a class are candidate vaccines for use with populations of MHC-disparate individuals.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- AIDS & HIV (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002396384A CA2396384A1 (en) | 2000-01-14 | 2000-12-01 | In vivo ctl elicitation by heat shock protein fusion proteins maps to a discrete atp binding domain and is cd4+ t cell-independent |
| DE60042704T DE60042704D1 (de) | 2000-01-14 | 2000-12-01 | Induktion zytotoxischer lymphozyten durch hitzeschockprotein-fusionsproteine hängt von der atp-bindungsdomäne in hsp ab und is cd4+ unabhängig |
| JP2001551504A JP2003519668A (ja) | 2000-01-14 | 2000-12-01 | 熱ショックタンパク質融合タンパク質による、cd4+t細胞非依存性のインビボctl惹起による個別atp結合ドメインのマッピング |
| EP00980947A EP1253939B1 (en) | 2000-01-14 | 2000-12-01 | In vivo ctl elicitation by heat shock protein fusion proteins maps to a discrete atp binding domain and is cd4+ t cell-independent |
| AT00980947T ATE438408T1 (de) | 2000-01-14 | 2000-12-01 | Induktion zytotoxischer lymphozyten durch hitzeschockprotein-fusionsproteine hängt von der atp-bindungsdomäne in hsp ab und is cd4+ unabhängig |
| AU18141/01A AU1814101A (en) | 2000-01-14 | 2000-12-01 | In vivo CTL elicitation by heat shock protein fusion proteins maps to a discrete ATP binding domain and is CD4+ cell-independent |
| US09/761,534 US6875435B2 (en) | 2000-01-14 | 2001-01-16 | In vivo CTL elicitation by heat shock protein fusion proteins maps to a discrete domain and is CD4+ T cell-independent |
| US10/885,523 US7501125B2 (en) | 2000-01-14 | 2004-07-01 | Vivo CTL elicitation by heat shock protein fusion proteins maps to a discrete domain and is CD4+ T cell-independent |
| AU2006201114A AU2006201114B2 (en) | 2000-01-14 | 2006-03-17 | In vivo CTL elicitation by heat shock protein fusion proteins maps to a discrete ATP binding domain and is CD4+ T cell- independent |
| US12/400,774 US20100040645A1 (en) | 2000-01-14 | 2009-03-09 | In vivo ctl elicitation by heat shock protein fusion proteins maps to a discrete domain and is cd4+ t cell-independent |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17614300P | 2000-01-14 | 2000-01-14 | |
| US60/176,143 | 2000-01-14 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/761,534 Continuation US6875435B2 (en) | 2000-01-14 | 2001-01-16 | In vivo CTL elicitation by heat shock protein fusion proteins maps to a discrete domain and is CD4+ T cell-independent |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2001051081A1 true WO2001051081A1 (en) | 2001-07-19 |
Family
ID=22643163
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/032831 Ceased WO2001051081A1 (en) | 2000-01-14 | 2000-12-01 | In vivo ctl elicitation by heat shock protein fusion proteins maps to a discrete atp binding domain and is cd4+ t cell-independent |
Country Status (8)
| Country | Link |
|---|---|
| US (3) | US6875435B2 (https=) |
| EP (1) | EP1253939B1 (https=) |
| JP (1) | JP2003519668A (https=) |
| AT (1) | ATE438408T1 (https=) |
| AU (2) | AU1814101A (https=) |
| CA (1) | CA2396384A1 (https=) |
| DE (1) | DE60042704D1 (https=) |
| WO (1) | WO2001051081A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003029288A3 (en) * | 2001-09-27 | 2004-03-11 | Idm Immuno Designed Molecules | Polypeptides derived from inducible hsp70 and pharmaceutical compositions containing the same |
| JP2005529848A (ja) * | 2002-02-13 | 2005-10-06 | デューク・ユニバーシティ | 非ペプチド結合ストレス応答性ポリペプチドによる免疫応答の調節 |
| US7501125B2 (en) | 2000-01-14 | 2009-03-10 | Whitehead Institute For Biomedical Research | Vivo CTL elicitation by heat shock protein fusion proteins maps to a discrete domain and is CD4+ T cell-independent |
| US7501234B2 (en) | 1989-06-15 | 2009-03-10 | Whitehead Institute For Biomedical Research | Stress proteins and uses therefor |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2404041A1 (en) * | 2000-03-28 | 2001-10-04 | The Regents Of The University Of California | Methods for increasing a cytotoxic t lymphocyte response in vivo |
| US20090118173A1 (en) * | 2006-01-24 | 2009-05-07 | Universiteit Utrecht Uu Holding B.V. | Treatment and prevention of inflammatory bowel diseases |
| RU2333767C2 (ru) * | 2006-03-31 | 2008-09-20 | Автономная некоммерческая организация "Институт молекулярной диагностики" (АНО "ИнМоДи") | Вакцинные композиции, способы их применения для профилактики и лечения меланомы и генетические конструкции для получения действующих компонентов композиции |
| US8742068B2 (en) * | 2007-07-06 | 2014-06-03 | Universiteit Utrecht Holding B.V. | Treatment and prevention of inflammatory diseases and autoimmune diseases |
| EP2550362B1 (en) | 2010-03-25 | 2017-01-04 | Oregon Health&Science University | Cmv glycoproteins and recombinant vectors |
| CA2832109C (en) | 2011-06-10 | 2021-07-06 | Oregon Health & Science University | Cmv glycoproteins and recombinant vectors |
| EP2568289A3 (en) | 2011-09-12 | 2013-04-03 | International AIDS Vaccine Initiative | Immunoselection of recombinant vesicular stomatitis virus expressing hiv-1 proteins by broadly neutralizing antibodies |
| US9402894B2 (en) | 2011-10-27 | 2016-08-02 | International Aids Vaccine Initiative | Viral particles derived from an enveloped virus |
| EP2679596B1 (en) | 2012-06-27 | 2017-04-12 | International Aids Vaccine Initiative | HIV-1 env glycoprotein variant |
| EP2848937A1 (en) | 2013-09-05 | 2015-03-18 | International Aids Vaccine Initiative | Methods of identifying novel HIV-1 immunogens |
| US10058604B2 (en) | 2013-10-07 | 2018-08-28 | International Aids Vaccine Initiative | Soluble HIV-1 envelope glycoprotein trimers |
| EP3069730A3 (en) | 2015-03-20 | 2017-03-15 | International Aids Vaccine Initiative | Soluble hiv-1 envelope glycoprotein trimers |
| EP3072901A1 (en) | 2015-03-23 | 2016-09-28 | International Aids Vaccine Initiative | Soluble hiv-1 envelope glycoprotein trimers |
| US20170260286A1 (en) * | 2016-03-10 | 2017-09-14 | The General Hospital Corporation | Antigen-Binding Fusion Proteins with Modified HSP70 Domains |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997026910A2 (de) * | 1996-01-27 | 1997-07-31 | Max-Delbrück-Centrum für Molekulare Medizin | Tumorimpfstoff für die immuntherapie von malignen tumoren |
| WO1998035705A1 (en) * | 1997-02-18 | 1998-08-20 | Whitehead Institute For Biomedical Research | Use of heat shock proteins to deliver moieties into cells |
| WO1999007860A1 (en) * | 1997-08-05 | 1999-02-18 | Stressgen Biotechnologies Corporation | Immune responses against hpv antigens elicited by compositions comprising an hpv antigen and a stress protein or an expression vector capable of expression of these proteins |
Family Cites Families (43)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4666847A (en) * | 1981-01-16 | 1987-05-19 | Collaborative Research, Inc. | Recombinant DNA means and method |
| US4557931A (en) | 1982-12-02 | 1985-12-10 | Regents Of The University Of California | Antigenic compositions and methods for using same |
| IE56720B1 (en) | 1983-02-07 | 1991-11-20 | Battelle Memorial Institute | Methods and compositions for expression of competent eukaryotic gene products |
| US4797359A (en) * | 1983-05-10 | 1989-01-10 | Board Of Regents, The University Of Texas System | Heat shock regulated production of selected and fused proteins in yeast |
| GB8404280D0 (en) | 1984-02-17 | 1984-03-21 | Stanford J L | Biological preparations |
| IL71683A0 (en) | 1984-04-27 | 1984-09-30 | Yeda Res & Dev | Pharmaceutical compositions for treating arthritis type diseases comprising fractions obtained from mycobacteria |
| US4918164A (en) * | 1987-09-10 | 1990-04-17 | Oncogen | Tumor immunotherapy using anti-idiotypic antibodies |
| US4784941A (en) * | 1985-04-08 | 1988-11-15 | Genetic Systems Corporation | Expression and diagnostic use of pENV-3 encoded peptides which are immunologically reactive with antibodies to LAV |
| AU6713287A (en) | 1986-01-06 | 1987-07-09 | F. Hoffmann-La Roche & Co. | Expression of htlv-iii gag-gene |
| US4734362A (en) * | 1986-02-03 | 1988-03-29 | Cambridge Bioscience Corporation | Process for purifying recombinant proteins, and products thereof |
| US4906742A (en) | 1986-07-31 | 1990-03-06 | Whitehead Institute For Biomedical Research | Encoding antigens of M. Leprae |
| NL8701163A (nl) | 1986-09-09 | 1988-04-05 | Nederlanden Staat | Gebruik van een peptide voor de bereiding van preparaten voor het verlichten, het behandelen en de diagnose van autoimmuunziekten, in het bijzonder arthritische toestanden, verbindingen die met dit peptide verwant zijn, alsmede farmaceutische en diagnostische preparaten en testkits. |
| WO1988005823A2 (en) | 1987-02-02 | 1988-08-11 | Whitehead Institute For Biomedical Research | Mycobacterium tuberculosis genes encoding protein antigens |
| US4952395A (en) | 1987-02-26 | 1990-08-28 | Scripps Clinic And Research Foundation | Mycobacterial recombinants and peptides |
| US5504005A (en) | 1987-03-02 | 1996-04-02 | Albert Einstein College Of Medicine Of Yeshiva University | Recombinant mycobacterial vaccine |
| WO1990015873A1 (en) | 1989-06-19 | 1990-12-27 | Whitehead Institute For Biomedical Research | Vector-mediated genomic insertion and expression of dna in bcg |
| US4918166A (en) | 1987-04-10 | 1990-04-17 | Oxford Gene Systems Limited | Particulate hybrid HIV antigens |
| US5256767A (en) * | 1987-06-10 | 1993-10-26 | The Immune Response Corporation | Retroviral antigens |
| NL8703107A (nl) | 1987-12-22 | 1989-07-17 | Nederlanden Staat | Polypeptiden en derivaten daarvan, alsmede de toepassing daarvan in farmaceutische en diagnostische preparaten. |
| US5204259A (en) * | 1988-05-06 | 1993-04-20 | Pharmacia Genetic Engineering, Inc. | Methods and systems for producing HIV antigens |
| WO1989012455A1 (en) | 1988-06-15 | 1989-12-28 | Whitehead Institute For Biomedical Research | Stress proteins and uses therefor |
| WO1994029459A1 (en) | 1993-06-04 | 1994-12-22 | Whitehead Institute For Biomedical Research | Stress proteins and uses therefor |
| US5114844A (en) | 1989-03-14 | 1992-05-19 | Yeda Research And Development Co., Ltd. | Diagnosis and treatment of insulin dependent diabetes mellitus |
| WO1990012030A1 (en) | 1989-04-06 | 1990-10-18 | Washington State University Research Foundation, Inc. | Rickettsial antigens for vaccination and diagnosis |
| GB8919321D0 (en) | 1989-08-25 | 1989-10-11 | Univ London | Treatment of chronic inflammatory conditions |
| GB9007194D0 (en) | 1990-03-30 | 1990-05-30 | Wellcome Found | Live vaccines |
| GB9024320D0 (en) | 1990-11-08 | 1990-12-19 | Univ London | Treatment of uveitis |
| CA2095855C (en) | 1990-11-08 | 2003-04-29 | Graham A.W. Rook | Mycobacterium as adjuvant for antigens |
| GB2251186A (en) | 1990-12-04 | 1992-07-01 | Randall Neal Gatz | Polypeptide for use in treatment of autoimmune disease |
| EP0521220A1 (en) | 1991-06-14 | 1993-01-07 | Institut Pasteur | Recombinant immunogenic actinomycetale |
| IT1262896B (it) * | 1992-03-06 | 1996-07-22 | Composti coniugati formati da proteine heat shock (hsp) e oligo-poli- saccaridi, loro uso per la produzione di vaccini. | |
| US5580563A (en) | 1992-05-01 | 1996-12-03 | Tam; James P. | Multiple antigen peptide system having adjuvant properties, vaccines prepared therefrom and methods of use thereof |
| IL102687A (en) | 1992-07-30 | 1997-06-10 | Yeda Res & Dev | Conjugates of poorly immunogenic antigens and synthetic pepide carriers and vaccines comprising them |
| ATE303160T1 (de) * | 1993-08-11 | 2005-09-15 | Jenner Technologies | Impfstoff gegen prostatakrebs |
| US5961979A (en) | 1994-03-16 | 1999-10-05 | Mount Sinai School Of Medicine Of The City University Of New York | Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens |
| IL109790A0 (en) | 1994-05-25 | 1994-08-26 | Yeda Res & Dev | Peptides used as carriers in immunogenic constructs suitable for development of synthetic vaccines |
| GB9419979D0 (en) | 1994-10-04 | 1994-11-16 | Medeva Holdings Bv | Vaccine compositions |
| WO1997006821A1 (en) | 1995-08-18 | 1997-02-27 | Sloan-Kettering Institute For Cancer Research | Heat shock protein-based vaccines and immunotherapies |
| US5935576A (en) * | 1995-09-13 | 1999-08-10 | Fordham University | Compositions and methods for the treatment and prevention of neoplastic diseases using heat shock proteins complexed with exogenous antigens |
| US6455493B1 (en) * | 1996-09-20 | 2002-09-24 | University Of New Mexico | Methods for using heat shock proteins |
| JP4484969B2 (ja) | 1996-11-26 | 2010-06-16 | ヌベンタ バイオファーマスティカル コーポレイション | ストレスタンパク質を含む組成物を使用する免疫応答 |
| CA2378097A1 (en) * | 1999-07-08 | 2001-01-18 | Stressgen Biotechnologies Corporation | Induction of a th1-like response in vitro |
| JP2003519668A (ja) * | 2000-01-14 | 2003-06-24 | ホワイトヘッド インスチチュート フォアー バイオメディカル リサーチ | 熱ショックタンパク質融合タンパク質による、cd4+t細胞非依存性のインビボctl惹起による個別atp結合ドメインのマッピング |
-
2000
- 2000-12-01 JP JP2001551504A patent/JP2003519668A/ja active Pending
- 2000-12-01 DE DE60042704T patent/DE60042704D1/de not_active Expired - Lifetime
- 2000-12-01 AT AT00980947T patent/ATE438408T1/de not_active IP Right Cessation
- 2000-12-01 CA CA002396384A patent/CA2396384A1/en not_active Abandoned
- 2000-12-01 WO PCT/US2000/032831 patent/WO2001051081A1/en not_active Ceased
- 2000-12-01 AU AU18141/01A patent/AU1814101A/en not_active Abandoned
- 2000-12-01 EP EP00980947A patent/EP1253939B1/en not_active Expired - Lifetime
-
2001
- 2001-01-16 US US09/761,534 patent/US6875435B2/en not_active Expired - Fee Related
-
2004
- 2004-07-01 US US10/885,523 patent/US7501125B2/en not_active Expired - Fee Related
-
2006
- 2006-03-17 AU AU2006201114A patent/AU2006201114B2/en not_active Ceased
-
2009
- 2009-03-09 US US12/400,774 patent/US20100040645A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997026910A2 (de) * | 1996-01-27 | 1997-07-31 | Max-Delbrück-Centrum für Molekulare Medizin | Tumorimpfstoff für die immuntherapie von malignen tumoren |
| WO1998035705A1 (en) * | 1997-02-18 | 1998-08-20 | Whitehead Institute For Biomedical Research | Use of heat shock proteins to deliver moieties into cells |
| WO1999007860A1 (en) * | 1997-08-05 | 1999-02-18 | Stressgen Biotechnologies Corporation | Immune responses against hpv antigens elicited by compositions comprising an hpv antigen and a stress protein or an expression vector capable of expression of these proteins |
Non-Patent Citations (3)
| Title |
|---|
| HUANG Q ET AL: "In vivo cytotoxic T lymphocyte elicitation by mycobacterial heat shock protein 70 fusion proteins maps to a discrete domain and is CD4(+) T cell independent.", JOURNAL OF EXPERIMENTAL MEDICINE, (2000 JAN 17) 191 (2) 403-8., XP000974127 * |
| SUZUE K ET AL: "ADJUVANT-FREE HSP70 FUSION PROTEIN SYSTEM ELICITS HUMORAL AND CELLULAR IMMUNE RESPONSES TO HIV-1", JOURNAL OF IMMUNOLOGY,US,THE WILLIAMS AND WILKINS CO. BALTIMORE, vol. 156, 1996, pages 873 - 879, XP002070468, ISSN: 0022-1767 * |
| SUZUE K ET AL: "HEAT SHOCK FUSION PROTEINS AS VEHICLES FOR ANTIGEN DELIVERY INTO THE MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I PRESENTATION PATHWAY", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,US,NATIONAL ACADEMY OF SCIENCE. WASHINGTON, vol. 94, 1 November 1997 (1997-11-01), pages 13146 - 13151, XP002070395, ISSN: 0027-8424 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7501234B2 (en) | 1989-06-15 | 2009-03-10 | Whitehead Institute For Biomedical Research | Stress proteins and uses therefor |
| US7501125B2 (en) | 2000-01-14 | 2009-03-10 | Whitehead Institute For Biomedical Research | Vivo CTL elicitation by heat shock protein fusion proteins maps to a discrete domain and is CD4+ T cell-independent |
| WO2003029288A3 (en) * | 2001-09-27 | 2004-03-11 | Idm Immuno Designed Molecules | Polypeptides derived from inducible hsp70 and pharmaceutical compositions containing the same |
| JP2005529848A (ja) * | 2002-02-13 | 2005-10-06 | デューク・ユニバーシティ | 非ペプチド結合ストレス応答性ポリペプチドによる免疫応答の調節 |
Also Published As
| Publication number | Publication date |
|---|---|
| US6875435B2 (en) | 2005-04-05 |
| DE60042704D1 (de) | 2009-09-17 |
| US7501125B2 (en) | 2009-03-10 |
| US20100040645A1 (en) | 2010-02-18 |
| US20050048079A1 (en) | 2005-03-03 |
| EP1253939B1 (en) | 2009-08-05 |
| AU2006201114B2 (en) | 2008-10-23 |
| AU2006201114A1 (en) | 2006-04-13 |
| ATE438408T1 (de) | 2009-08-15 |
| US20020146426A1 (en) | 2002-10-10 |
| AU1814101A (en) | 2001-07-24 |
| JP2003519668A (ja) | 2003-06-24 |
| EP1253939A1 (en) | 2002-11-06 |
| CA2396384A1 (en) | 2001-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100040645A1 (en) | In vivo ctl elicitation by heat shock protein fusion proteins maps to a discrete domain and is cd4+ t cell-independent | |
| Huang et al. | In vivo cytotoxic T lymphocyte elicitation by mycobacterial heat shock protein 70 fusion proteins maps to a discrete domain and is CD4+ T cell independent | |
| US5856187A (en) | Immunogenic chimeras comprising nucleic acid sequences encoding endoplasmic reticulum signal sequence peptides and at least one other peptide, and their uses in vaccines and disease treatments | |
| US7097965B2 (en) | Targeting antigens to the MHC class I processing pathway with an anthrax toxin fusion protein | |
| US20070122421A1 (en) | Innate immune system-directed vaccines | |
| US8414899B2 (en) | Vaccines comprising multimeric HSP60 peptide carriers | |
| US20070160623A1 (en) | Innate immune system-directed vaccines | |
| WO1994029459A1 (en) | Stress proteins and uses therefor | |
| US11925679B2 (en) | H3.3 CTL peptides and uses thereof | |
| EP1322326A1 (en) | Innate immune system-directed vaccines | |
| AU2001286405A1 (en) | Innate immune system-directed vaccines | |
| DK2453914T3 (en) | ANTIGEN-SPECIFIC MULTIPLE PIT-BASED ANTI-INFECTIOUS VACCINES | |
| US20040204363A1 (en) | Use of heat shock proteins to deliver moieties into cells | |
| JP2005512518A (ja) | 熱ショックタンパク質の使用 | |
| WO2003051305A2 (en) | Innate immune system-directed vaccines | |
| WO2018162450A1 (en) | New inmunostimulatory compositions comprising an entity of cold inducible rna-binding protein with an antigen for the activation of dendritic cells | |
| EP2374813A1 (en) | Use of phenol-soluble modulins for vaccine development | |
| Ebrahimi et al. | Role of mycobacterial heat shock protein 70 (mHSP70) as genetic vaccine adjuvants | |
| WO2012123269A1 (en) | Immunogenic compositions and methods for their use | |
| Amorena Zabalza et al. | Immunogenic compositions and methods for their use | |
| AU2007204086A1 (en) | Innate immune system-directed vaccines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 09761534 Country of ref document: US |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 18141/01 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2396384 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2001 551504 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000980947 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000980947 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |