WO2001049853A1 - A novel polypeptide, phosphoribosyl glycinamide synthetase 9 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, phosphoribosyl glycinamide synthetase 9, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammations, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel phosphoribosyl glycinamide synthetase 9.

Description

A new polypeptide monophosphate ribosylglycine synthetase 9 and a polynucleotide encoding such a polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide monophosphate ribose glycinamide synthetase 9 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.

# 术 背景

 The biosynthesis of nucleotides is an extremely important process for all cells, because cells cannot take up nucleotides from the surrounding medium, but nucleotides are necessary precursors for the synthesis of RNA and DNA. Metabolic degradation pathways are also important for organisms. Some genetic defects cause these pathways to block and can cause serious illness.

 Phosphoribosylglycine synthetase (GARS) catalyzes the second step of de novo biosynthesis of purine organisms by linking 5-phosphate ribosylamine to glycine to form 5'-phosphate ribosylglycine amide, a reaction that is ATP-dependent. In bacteria, GATS is a single-function enzyme (encoded by the purD gene); in yeast, it forms a bifunctional enzyme (formerly glycine nucleotide cyclization ligase (AIRS)) with a 7 gene) encoding; in higher eukaryotes, the above two and ribose glycosylglyceryl formyltransferase (GART) constitute a trifunctional enzyme (GARS-AIRS-GART). The GARS sequence is highly conserved, and its characteristic conserved sequences are: R- F-G-D-P-E-x- [QM]

 As described above, ribophosphate glycine amide synthase 9 protein plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more phosphoribosyl glycine involved in these processes Amide synthetase 9 protein, especially the amino acid sequence of this protein is identified. Isolation of the neophosphoribosylglycine synthetase 9 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM.

Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide mono-ribose-glycosyl-glycine synthetase 9 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a ribose glycine amide synthetase 9.

It is another object of the present invention to provide a genetically engineered host cell comprising a polynucleotide encoding a phosphoribosylglycine synthetase 9. It is another object of the present invention to provide a method for producing a phosphoribosylglycine synthetase 9.

 Another object of the present invention is to provide an antibody against the polypeptide monophosphoribosylglycine synthetase 9 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide monophosphate ribose glycinamide synthetase 9 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in phosphoribosylglycine synthetase 9.

Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 207-464 in SEQ ID NO: 1; and (b) a sequence having 1-1677 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of phosphoribosylglycine synthetase 9 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of ribose glycosylamide synthase 9 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the preparation of a medicament of the polypeptide and / or polynucleotide of the present invention for the treatment of cancer, developmental or immune disease or other diseases caused by abnormal expression of phosphoribosylglycine synthetase 9 the use of.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of 77-amino acid and domain phosphoribosyl-glycine synthetase characteristic proteins of the present invention. The upper sequence is ribophosphate glycine amide synthase 9 and the lower sequence is the characteristic protein domain of phosphoribosyl glycine amide synthetase.

 "And": "" and "." Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated phosphoribosylglycine synthetase 9. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.

Summary of the Invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to natural, recombinant or synthetic proteins and fragments thereof in suitable The ability to induce a specific immune response in an animal or cell and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with phosphoribosylglycine synthetase 9, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to phosphoribosylglycine synthetase 9.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of phosphoribosylglycine synthetase 9 when combined with phosphoribosylglycine amide synthase 9. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to ribose phosphoglycylamide synthase 9.

 "Regulation" refers to a change in the function of ribose glycine amide synthase 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological property, function, or immunity of ribose glycine amide synthase 9 Change of nature.

 "Substantially pure '" means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify ribose glycinamide synthase 9 using standard protein purification techniques. Substantially pure phosphoribosyl-glycine synthetase 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the phosphoribosyl-glycine synthase 9 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern blot or Nor thern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods (Muster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method checks all pairings The distance between them arranges each group of sequences into clusters. Then the clusters are assigned in pairs or groups. Two amino acid sequences, such as sequence A and sequence B, are 100% identical The fraction is calculated by the following formula:

Number of residues matching between sequence ^ ₁₀₀

The residues in the sequence ^ - ^ interval residues in the sequence - the sequence of residues interval [delta] ^ ^Χ

 The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in enzymo logy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. The "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and 1 ^, which specifically bind to the antigenic determinants of phosphoribosylglycine synthetase 9.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

As used herein, "isolated ribose-glycosyl-glycine synthetase 9" means that ribose-glycosyl-glycine synthetase 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify phosphoribosylglycine synthetase 9. Base Inherently pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the ribose phosphoglycine synthase 9 polypeptide can be analyzed by amino acid sequence.

 The invention provides a new polypeptide monophosphate ribose glycine amide synthetase 9 which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.

 The present invention also includes fragments, derivatives, and analogs of phosphoribosylglycine synthetase 9. As used in the present invention, the terms "fragment", "derivative", and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the phosphoribosylglycine synthetase 9 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protein sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence that is 1,677 bases in length, and its open reading frame 207-464 encodes 85 amino acids. This polypeptide has a characteristic sequence of a characteristic protein of phosphoribosylglycine synthetase, and it can be deduced that the characteristic feature of the characteristic protein of phosphoribosylglycinamide synthase is that of this protein.

The polynucleotide of the present invention may be in the form of DM or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention. The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /. Fi co ll, 42 ° C, etc .; or (3) only in two sequences Hybridization occurs when the identity between at least 95% and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 And active.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding phosphoribosylglycine amide synthetase 9.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence of the present invention encoding phosphoribosylglycine synthetase 9 can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences. The standard method for isolating the cDNA of interest is to isolate the mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid Or phage CDM library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the transcript of ribose glycine amide synthase 9; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the ribose glycine amide synthase 9 gene.

 A method using DNA technology to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used, and the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a ribose glycine amide synthetase 9 coding sequence, and recombinant technology to produce the present invention. Polypeptide method. In the present invention, a polynucleotide sequence encoding a ribose glycine amide synthetase 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a phosphoribosylglycine synthetase and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a ribose glycine amide synthetase 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower true Nuclear cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS, or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the Ca ₂ method. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant phosphoribosylglycine synthetase 9 (Scence, 1984; 224: 14 31). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human phosphoribosylglycine synthetase 9 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immunological diseases.

Nucleotide biosynthesis is an extremely important process for all cells, because cells cannot take up nucleotides from the surrounding medium, but nucleotides are necessary precursors for the synthesis of RNA and DM. The pathway of metabolic degradation of nucleotides is also important for organisms. Some genetic defects cause these pathways to be blocked, which can cause serious Disease. Phosphoribosylglycine synthetase (GARS) catalyzes the second step of de novo biosynthesis of purine organisms, linking 5-phosphoribosylamine to glycine to form 5'-phosphoribosylglycinamide. This reaction is ATP-dependent.

 It can be seen that the abnormal expression of the specific phosphoribosyl glycine amide synthetase mot if will cause the abnormal function of the polypeptide containing this mot if, resulting in the abnormal biosynthesis of nucleotides and the generation of related diseases such as purines. And pyrimidine metabolism defects, amino acid metabolic disorders, organic acidemia, tumors, embryonic development disorders, growth and development disorders, etc.

 It can be seen that the abnormal expression of ribose glycosylamide synthetase 9 of the present invention will produce various diseases, especially purine and pyrimidine metabolism deficiency diseases, amino acid metabolism disorders, organic acidemia, tumors, embryonic development disorders, growth and development. Disorders, including but not limited to:

 Purine and Pyrimidine Metabolism Defects: Abnormal purine metabolism such as Ray-niney syndrome, xanthineuria, pyrimidine metabolic abnormalities such as orotic aciduria, adenine deaminase deficiency

 Amino acid metabolism deficiency diseases: Phenylketonuria, tyrosine metabolism deficiency diseases such as albinism, sulfur amino acid metabolism deficiency disease, tryptophanemia, branch amino acid metabolism deficiency disease, glycineemia, proline and hydroxyproline Acid metabolism deficiency disease, glutamate metabolism deficiency disease, urea cycle metabolism deficiency disease, histidine metabolism deficiency disease, lysine metabolism deficiency disease,

 Organic acidemia: propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylase deficiency, glutarate type I

 Fetal developmental disorders: congenital abortion, limb loss, limb differentiation disorder, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, atrial septal defect, ventricular septal defect, pulmonary artery stenosis, neural tube defect, congenital glaucoma or Cataract, congenital deafness

 Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia disorders such as congenital skin relaxation, Alzheimer's disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma

The abnormal expression of the ribose glycosylamide synthetase 9 of the present invention will also produce certain hereditary, hematological and immune system diseases. The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially purine and pyrimidine metabolism deficiency diseases, amino acid metabolism disorders, organic acidemia, tumors. , Embryo developmental disorders, growth and development disorders, certain hereditary, blood diseases and immune system diseases.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) ribose phosphate glycine amide synthase 9. Agonists enhance biological functions such as phosphoribosylglycine synthetase 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing phosphoribosylglycine synthase 9 can be cultured with labeled phosphoribosylglycine synthase 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.

 Antagonists of phosphoribosylglycine synthetase 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of ribophosphate glycylamide synthetase 9 can bind to and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

 When screening compounds as antagonists, ribophosphate glycine amide synthetase 9 can be added to a bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between ribophosphate glycine amide synthase 9 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to phosphoribosylglycine synthetase 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9 molecules of phosphoribosylglycine synthetase should be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against a phosphate ribosylglycine synthetase 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by direct injection of phosphoribosylglycine synthetase 9 into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to ribose glycine amide synthase 9 include, but are not limited to, hybridoma technology (Kohler and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morris on etal, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4946778) It can also be used to produce single chain antibodies against phosphoribosylglycine synthetase 9.

 Antibodies against phosphoribosylglycine synthetase 9 can be used in immunohistochemical techniques to detect phosphoribosylglycine synthase 9 in biopsy specimens.

 Monoclonal antibodies that bind to phosphoribosylglycine synthetase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, high-affinity monoclonal antibodies such as ribose glycosylamide synthase 9 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill phosphoribosylglycine synthase 9 positive Cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to phosphoribosylglycine synthetase 9. Administration of an appropriate dose of antibody can stimulate or block the production or activity of phosphoribosylglycine synthetase 9.

 The invention also relates to a diagnostic test method for quantitative and localized detection of the level of phosphoribosylglycine synthetase 9. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of ribosylphosphoglycine synthetase 9 detected in the test can be used to explain the importance of riboglycosylglycine synthetase 9 in various diseases and to diagnose the role of ribophosphoglycine disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding phosphoribosylglycine synthetase 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of phosphoribosylglycine synthetase 9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated phosphoribosylglycine synthetase 9 to inhibit endogenous phosphoribosylglycine synthetase 9 activity. For example, a variant phosphoribosyl-glycine synthetase 9 may be a shortened phosphoribosyl-glycine amide synthetase 9 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of phosphoribosylglycine synthetase 9. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding a ribose glycine amide synthetase 9 into a cell. Construction Carrying Encoded Ribophosphate Methods for recombinant viral vectors of glycine synthetase 9 polynucleotides can be found in the literature (Sambrook, eta l.). In addition, a recombinant polynucleotide encoding phosphoribosylglycine synthetase 9 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit ribophosphate glycylamide synthase 9 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RM, DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis technology has been widely used. Antisense RM molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 Polynucleotides encoding ribophosphate glycine amide synthetase 9 can be used for the diagnosis of diseases related to ribose glycine amide synthase 9. Polynucleotides encoding ribo-glycosyl-glycine-amide synthetase 9 can be used to detect the expression of ribo-glycosyl-glycine amide synthetase 9 or abnormal expression of ribo-glycosyl-glycine amide synthetase 9 in disease states. For example, a DNA sequence encoding a ribose glycine amide synthase 9 can be used to hybridize biopsy specimens to determine the expression of ribose glycine amide synthase 9. Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are available commercially. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (M icroa rr ay) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis. RNA-polymerase chain reaction (RT-PCR) amplification using in vitro specific primers of phosphoribosyl-glycine synthase 9 can also detect the transcription products of ribose-phosphoglycine synthase 9.

Detecting mutations in the ribose glycine amide synthase 9 gene can also be used to diagnose diseases related to the ribose glycine amide synthase 9. Phosphoribosyl-glycine synthetase 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type phosphoribosyl-glycosylamide synthase 9 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the use of Nort hern blotting and Wes tern blotting can indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for the identification of dye kernels. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergaraon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases. The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Phosphoribosylglycine synthetase 9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of ribose glycine amide synthase 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1 Cloning of Ribophosphate Glycine Synthetase 9

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poiy (A) mRM was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. A Smart cDM cloning kit (purchased from CI on tech) was used to insert the 00 ^ fragment into a multi-cloning site of a pBSK (+) vector (Clontech) to transform DH5α to form a cDM library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequence of all clones and the 3 'end. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0895D10 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the 0895D10 clone contains a full-length cDNA of 1677bp (as shown in Seq IDN0: 1), and a 258bp open reading frame (0RF) from 207bp to 464bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0895D10 and the protein was named phosphoribosylglycine synthetase 9. Example 2 Domain analysis of cDNA clones

The sequence of the phosphoribosylglycine synthetase 9 of the present invention and the protein sequence encoded by the same are used in GCG Profile scan program (Basic local alignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], and perform domain analysis in databases such as prosite. The phosphoribosyl-glycine synthetase 9 of the present invention is homologous with the characteristic protein of the domain phosphoribosyl-glycine synthetase at 2-78, and the homology result is shown in FIG. Is 13.25. Example 3 Cloning of the gene encoding phosphoribosylglycine amide synthase 9 by RT-PCR method. Total fetal brain cells were used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDM. PCR amplification with the following primers:

 Primerl: 5'- CTTGGTTTCTAATTTTTAAATTTC-3 '(SEQ ID NO: 3)

 Primer2: 5'- AGACAGAGTCTCACTCTGTCACCC -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Amplification conditions: 50 μl of KC1, 10 μl of ol / L Tris-HCl, pH 8.5, 1.5mraol / L MgCl ₂ , 200 μπιο1 / ί dNTP, lOpmol primer, 1U in a 50 μ1 reaction volume Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min. During RT-PCR, set P-act in as a positive control and template blank as a negative control. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1677bp shown in SEQ ID NO: 1. Example 4 Northern blot analysis of the expression of the phosphoribosylglycine synthetase 9 gene Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA was precipitated at 70 ° / °. Wash with ethanol, dry and dissolve in water. Using 20 μ§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DM probe used was the PCR-amplified phosphoribosylglycine synthase 9 coding region sequence (207bp to 464bp) shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4) - 5 χ SSC- 5 χ Denhardt's solution and 200μ ₈ / πι1 salmon sperm DNA. After hybridization, place the filter in 1 x SSC- 0.1 ° /. 55 in SDS. C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5 In Vitro Expression, Isolation, and Purification of Recombinant Phosphoribosyl Glycine Synthetase 9 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Priraer3: 5'- CCCCATATGATGCTTCTATTCCATGTTTTTGTA -3 '(Seq ID No: 5) Priraer4: 5'- CCCAAGCTTTTACCTAAAATGGTAGGACTGTTT -3' (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and Hindlll restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the target gene are followed, respectively. The Ndel and Hindll I restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site. The PCR reaction was performed using pBS-0895D10 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0895D10 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and Hindlll were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. Ligation products were transformed by the calcium chloride method bacteria Escherichia coli DH5cc, after (final concentration of 30μ ε _/ ιη1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (PET-0895D10) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration ^ g / l), the host bacteria BL21 (pET-0895Dl0) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1mmol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The chromatography was performed using an affinity column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). A purified target protein, phosphoribosylglycine synthetase 9 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 9 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-phosphoribosylglycine synthetase 9 antibodies

 A peptide synthesizer (product of PE company) was used to synthesize the following specific peptides of phosphoribosylglycine synthetase 9:

NH ₂ -et-Leu-Leu-Phe-His-Val-Phe-Val-Phe-Gly-Lys-Asp-Ser-Lys-Leu-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Use 4mg of the above hemocyanin polypeptide The complex was added to complete Freund's adjuvant to immunize rabbits. After 15 days, the hemocyanin polypeptide complex was added to complete Freund's adjuvant to boost the immunity once. A titer plate coated with a 15 μ _§ / ηι1 bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the anti-peptide antibody was separated from the total I gG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to phosphoribosylglycine synthetase 9. Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70%, non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85½ or there are more than 15 consecutive bases, the primary selection probe should generally not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)

 5'- TGCTTCTATTCCATGTTTTTGTATTTGGGAAGGATTCAAAG -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1:

 5'- TGCTTCTATTCCATGTTGGTGTATTTGGGAAGGATTCAAAG -3 '(SEQ ID NO: 9) For other common reagents and their preparation methods not listed in the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (U998 Second Edition) [US] Sambruck et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (about 10 ml / g) with a cold paddle buffer (0.25 mol / L sucrose; 25 cryptol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the original tissue sample), and then take the following

2, DN A phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ^s cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may Large agglomerates are formed which are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C gently shake overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, ¹⁰⁶ cells per 1-5 χ extracted plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix and set at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

4) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours. Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase, to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) The ³² P-Probe (the second peak is free γ- ³² P-dATP) to be prepared after the collection solution of the first peak is combined.

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS for 15 minutes at 40 ° C (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 ° / oSDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 40. Wash for 15 minutes (twice) and dry at room temperature.

X-ray autoradiography:

-70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot). Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.

Claims

Rights request

1. An isolated polypeptide-phosphoribosylglycine synthetase 9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 207-464 in SEQ ID NO: 1 or the sequence of positions 1-1677 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having phosphoribosylglycine synthetase 9 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing phosphoribosylglycine synthetase 9;

 (b) Isolating a polypeptide having phosphoribosylglycine synthetase 9 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to phosphoribosylglycine synthetase 9.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of phosphoribosylglycine synthetase 9.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of phosphoribosylglycine synthetase 9 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of phosphoribosylglycine synthetase 9; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of phosphoribosylglycine synthetase 9.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.