WO2001048244A2 - Detection of single nucleotide polymorphisms - Google Patents
Detection of single nucleotide polymorphisms Download PDFInfo
- Publication number
- WO2001048244A2 WO2001048244A2 PCT/US2000/034935 US0034935W WO0148244A2 WO 2001048244 A2 WO2001048244 A2 WO 2001048244A2 US 0034935 W US0034935 W US 0034935W WO 0148244 A2 WO0148244 A2 WO 0148244A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- nucleotide
- oligonucleotide
- specific
- hybridization
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention provides methods for rapid detection of single nucleotide polymorphisms (SNPs) in a nucleic acid sample.
- the present invention further provides a novel read-out method for improving the use of mobile solid support-based read-out technologies for detection of nucleic acid polymorphisms in a target nucleic acid
- the methods can be utilized to detect SNPs in genomic DNA as well as amplified DNA, RNA, etc., thus making them useful for a variety of purposes, including genotyping (such as for disease mutation detection and for parentage determinations in humans and other animals), pathogen detection and identification, and differential gene expression.
- the present invention further provides a method for identifying a nucleic acid utilizing a run-off sequencing reaction of a relatively short portion of the nucleic acid.
- the method can be utilized, for example, to identify an EST from only a small portion of the EST and in an analysis of nucleotide polymorphisms.
- the reactions can be multiplexed to increase data readout capacity
- Methods of detecting single base polymorphisms have typically involved hybridization reactions.
- the method of performing a Luminex FlowMetrix-based SNP analysis involves differential hybridization of a PCR product to two differently-colored FACS-analyzable beads.
- the FlowMetrix system currently consists of uniformly-sized 5 micron polystyrene-divinylbenzene beads stained in eight concentrations of two dyes (orange and red).
- the matrix of the two dyes in eight concentrations allows for 64 differently-colored beads (8 ) that can each be differentiated by a FACScalibur suitably modified with the Luminex PC computer board.
- Luminex SNP covalently-linked to a bead is a short (approximately 18-20 bases) "target" oligodeoxynucleotide (oligo).
- the nucleotide positioned at the center of the target oligo encodes the polymorphic base.
- a pair of beads are synthesized; each bead of the pair has attached to it one of the polymorphic oligonucleotides.
- a PCR of the region of DNA surrounding the to-be analyzed SNP is performed to generate a PCR product. Conditions are established that allow hybridization of the PCR product preferentially to the bead on which is encoded the precise complement.
- the PCR product In one format (“without competitor”), the PCR product itself incorporates a flourescein dye and it is the gain of the flourescein stain on the bead, as measured during the FACScalibur run, that indicates hybridization.
- a second format (“with competitor,”) the beads are hybridized with a competitor to the PCR product.
- the competitor itself in this case is labeled with flourescein. And it is the loss of the flourescein by displacement by unlabeled PCR product that indicates successful hybridization. It has been stated that "with competitor” is more discriminating in SNP analysis.
- GBA Genetic Bit Analysis
- the double-stranded PCR product is rendered single-stranded by treatment with the enzyme T7 gene 6 exonuclease, and captured onto individual wells of a 96 well polystyrene plate by hybridization to an immobilized oligonucleotide primer.
- This primer is designed to hybridize to the single-stranded target DNA immediately adjacent from the polymorphic site of interest. Using the Klenow fragment of E.
- the 3' end of the capture oligonucleotide is extended by one base using a mixture of one biotin-labeled, one fluorescein-labeled, and two unlabeled dideoxynucleoside triphosphates.
- Antibody conjugates of alkaline phosphatase and horseradish peroxidase are then used to determine the nature of the extended base in an ELISA format. This paper also describes biochemical features of this method in detail.
- GSA Genetic Bit Analysis
- Double-stranded DNA substrates containing one phosphorothioate residue at the 5' end were found to be hydrolyzed by this enzyme as efficiently as unmodified ones.
- the enzyme activity was, however, completely inhibited by the presence of four phosphorothioates.
- a method for the conversion of double-stranded PCR products into full-length, single-stranded DNA fragments was developed. In this method, one of the PCR primers contains four phosphorothioates at its 5' end, and the opposite strand primer is unmodified. Following the amplification, the double-stranded product is treated with T7 gene 6 exonuclease.
- the phosphorothioated strand is protected from the action of this enzyme, whereas the opposite strand is hydrolyzed.
- the phosphorothioated PCR primer is 5' biotinylated, the single-stranded PCR product can be easily detected colorimetrically after hybridization to an oligonucleotide probe immobilized on a microtiter plate.
- a simple and efficient method for the immobilization of relatively short oligonucleotides to microtiter plates with a hydrophilic surface in the presence of salt was also described.
- DNA analysis based on template hybridization (or hybridization plus enzymatic processing) to an array of surface-bound oligonucleotides is well suited for high density, parallel, low cost and automatable processing [Fluorescence detection applied to non-electrophoretic DNA diagnostics on oligonucleotide arrays. Ives, Jeffrey T.; Rogers, Yu Hui; Bogdanov, Valery L.; Huang, Eric Z.; Boyce-Jacino, Michael; Goelet, Philip L.L.C., Proc. SPIE-Int. Soc. Opt. Eng., 2680 (Ultrasensitive Biochemical Diagnostics), 258-269 (1996)].
- Direct fluorescence detection of labeled DNA provides the benefits of linearity, large dynamic range, multianalyte detection, processing simplicity and safe handling at reasonable cost.
- the Molecular Tool Corporation has applied a proprietary enzymatic method of solid phase genotyping to DNA processing in 96-well plates and glass microscope slides. Detecting the fluor- labeled GBA dideoxynucleotides requires a detection limit of approx. 100 mols/ ⁇ m 2 . Commercially available plate readers detect about 1000 mols./ ⁇ m 2 , and an experimental setup with an argon laser and thermoelectrically-cooled CCD can detect approximately 1 order of magnitude less signal. The current limit is due to glass fluorescence.
- SNP analysis by hybridization is a powerful method, it has several disadvantages. These include; i) a need to synthesize two targets, and possibly two competitor oligonucleotides for each allelic pair, ii) the establishment of the hybridization parameters (buffer content, temperature, time) that will efficiently discriminate between alleles, and iii) an avoidance of regions containing secondary structure that may effect the hybridization parameters.
- the present invention provides a novel system for using a GBA single base chain extension (SBCE) which takes advantage of the powerful matrixing capabilities of a mobile solid support system having multiple dye color/concentration capabilities (e.g., the FlowMetrix system) to overcome the described disadvantages.
- the present invention further provides a method to improve the detection of reaction products from such polymorphism identification methods.
- Various detection methods as described herein and as known in the art, can be enhanced by utilizing the present detection method.
- Such methods can be combined with the present invention to provide a read out format that is time- and cost-efficient as it provides a means of using any given bead for use, individually, with many primers.
- This read-out method can be utilized also with many polymorphism detection methods, such as SBCE, OLA and cleavase reaction/ signal release (Invader methods, Third Wave Technologies).
- Figure 1 shows a 16s rRNA dendrogram for preparation of probes specific for various bacterial contaminants.
- Figure 2 shows a multiplexed genotyping of 7 CEPH DNA samples for 9 SNPs.
- Oligonucleotide ligation was ' conducted using PCR-amplified taget nucleic acid from 7 CEPH patients. Biotintylated reporter and avidin-FITC were used.
- the present invention provides a method whereby a mobile solid support, such as a bead, which is detectably tagged, such as with a dye, a radiolabel, a magnetic tag, or a Quantum Dot® (Quantum Dot Corp.), is utilized in a nucleic acid read out procedure, either a direct readout onto a mobile solid support-linked nucleic acid such as SBCE, OLA or cleavase reaction/signal release (Invader methods, Third Wave Technologies, Madison, Wisconsin) or an indirect readout (in solution) which is then captured by an intermediate nucleic acid such as by a zipcode attached to a mobile solid support, and the readout product is then analyzed on a selected platform, such as by passing the mobile solid support over a detector (such as a laser detection device) or by passing a detector over the mobile solid support.
- a mobile solid support such as a bead
- a detector such as a laser detection device
- the intermediate nucleic acid system presents many advantages. For example, in a ligation reaction, ligation of a reporter probe to a target oligonucleotide in solution is more efficient and reproducible than ligation to target oligonucleotides that have been directly coupled to microspheres.
- ZipCodes allow the use and reuse of a defined set of optimally coupled microspheres.
- One cZipCode-coupled microsphere type may be used to analyze new single nucleotide polymorphisms instead of preparing new microspheres each time a new single nucleotide polymorphisms arises.
- the intermediate nucleic acid system system may also be applied to protein-based systems (for example, anti-cytokine antibody may be coupled to a ZipCode oligo for cytokine analysis).
- the present invention provides a novel system for SNP readout using an encoded mobile solid support which takes advantage of the powerful matrixing capabilities of a mobile solid support system.
- the system uses a GBA single base chain extension (SBCE).
- SBCE GBA single base chain extension
- the system utilizes an oligonucleotide ligation assay.
- the system uses an enzymatic or chemical read-out method whereby an enzyme or chemical is used to modify or endonucleolytically cleave a mismatched base at the polymorphic site, resulting in the loss of an attached reporter or said modification resulting in a labeling means for the identification of the modification.
- the system utilizes an endonuclease cleavase/signal release method (Invader methods, Third Wave Technologies) (see, e.g., Marshall et al. J. Clin. Microbiol. 35(12):3156- 3162 (1997); Brow, et al. J. Clin. Microbiol. 34(12):3129-3137 (1997)).
- FET fluorescence energy transfer
- target nucleic acid e.g., PCR product or genomic DNA
- a cleavase enzyme recognizes the specific structure formed between the target nucleic acid, Invader probe, and Signal probe, and cleaves the Signal probe at the branch site and thereby releases the signal for detection.
- Another Signal probe can then bind to the nucleic acid and the cleavase reaction begins anew. This process is repeated many times and thereby increases the signal amplification.
- the essence for cleavase to work is the presence of an overlapping base of the Invader probe with the signal base.
- Invader Squared two rounds of Invader are performed simultaneously.
- the primary invader reaction involves using SNP-specific target DNA, the resulting cleavase-product becomes functional in a secondary Invader reaction with a universal signal probe and universal complementary target DNA. After the second round invader assay, a linear signal amplification of greater than 10 6 signal/target/hr is obtained.
- the present invention further provides a novel read-out method for improving the use of mobile solid support-based read-out technologies for detection of nucleic acid polymorphisms in a target nucleic acid utilizing a target oligonucleotide having a first complementarity region complementary to the target nucleic acid and a second complementarity region, 5' to the first complementarity region, complementary to a capture oligonucleotide, which capture oligonucleotide is linked to a mobile solid support.
- the improved method can be applied to any of several methods of identifying a nucleic acid polymorphism, such as oligonucleotide ligation assay (OLA) or single base chain extension (SBCE), as described herein.
- the methods can be utilized to detect SNPs in genomic DNA as well as amplified DNA, RNA, etc., thus making it useful for a variety of purposes, including genotyping (such as for disease mutation detection and for parentage determinations in humans and other animals), pathogen detection and identification, and differential gene expression.
- the present invention further provides the development of a simple method for multiplexing short sequencing reads (about 16 bases) in the same lane.
- One application to which this method can be applied is high-throughput yeast two-hybrid analysis. In this analysis, it is desired to sequence short regions of the interacting proteins, and then use a large database to determine the hit identification. Because each bait analyzed generates approximately 100 hits, the present method to increase the efficiency of analysis was needed and therefore developed.
- the invention can be utilized to analyze a nucleic acid sample that comprises genomic DNA, amplified DNA, such as a PCR product, cDNA, cRNA, a restriction fragment or any other desired nucleic acid sample.
- genomic DNA typically the genomic DNA will be treated in a manner to reduce viscosity of the DNA and allow better contact of a primer or probe with the target region of the genomic DNA.
- reduction in viscosity can be achieved by any desired method, which are known to the skilled artisan, such as DNase treatment or shearing of the genomic DNA, preferably lightly.
- Amplified DNA can be obtained by any of several known methods.
- Sources of genomic DNA are numerous and depend upon the purpose of performing the methods, but include any tissue, organ or cell of choice.
- Oligonucleotides can be generated by amplification or by de novo synthesis, for example.
- Complementary nucleic acids i.e., cRNA (obtained from a process wherein DNA is primed with a T7- RNA polymerase/specific sequence primer fusion, then T7 RNA polymerase is added to amplify the first strand to create cRNA) and cDNA, can be obtained by standard methods known in the art.
- nucleic acid includes any of, for example, an oligonucleotide, genomic DNA, a 16s ribosomal RNA, a PCR product, a DNA fragment, an RNA molecule, a cDNA molecule or a cRNA molecule
- the nucleic acid primer is an oligonucleotide, a PCR product, LCR (ligase chain reaction) product, a DNA fragment, an RNA molecule, a cDNA molecule or a cRNA molecule.
- LCR ligase chain reaction
- a and “an” can mean one or more, depending upon the context in which it is used.
- a detectably tagged, mobile solid support such as a bead or a rod, preferably that can be processed for detection of the tag quickly once the desired reaction has taken place, such as by a FACS-type system.
- a detectably tagged, mobile solid support such as a bead or a rod
- a detectably tagged, mobile solid support such as a bead or a rod
- a detectably tagged, mobile solid support such as a bead or a rod
- a detectably tagged, mobile solid support such as a bead or a rod
- octopus octopus
- Any desired tag can be utilized, such as a fluorescent tag, a radiolabel, or a magnetic tag.
- Detection systems can be used, preferably, however, wherein the mobile solid support is passed over a detection device, such as a laser detection device, capable of detecting and discerning the selected tags and labels (see, e.g., PCT publication WO 9714028). Detection systems can also be utilized wherein the mobile solid support, after performing any reactions, is fixed onto a two-dimensional surface and a detection device, such as a laser detection device, is passed over the fixed mobile solid support.
- the mobile solid support can comprise any useful material, such as polystyrene-divinylbenzene. Detection of the mobile solid support and any nucleic acid or nucleotide associated with it, can be performed by FACS-based method, such as the Luminex FlowMetrixTM system.
- the oligonucleotide is designed such that the 5' end is coupled to the bead.
- the 3' base ends at a nucleotide chosen relative to the polymorphic base, depending upon the assay being performed.
- the 3' base of this primer or probe can end at the nucleotide 5' to the polymorphic base, it can end with a base corresponding to the polymorphic base.
- the length of the oligo in the SBCE method is not critical, but it does need to be long enough to support hybridization by a nucleic acid sample, such as a PCR product generated from a region surrounding the SNP.
- the primer or probe can be designed wherein an exact match is required or it may be designed to allow some mismatch upon initial hybridization to the sample nucleic acid.
- nucleotide capable of chain termination is utilized.
- chain termination is a termination event that occurs before the same labeled base occurs again in the target sequence.
- nucleotides are known in the art and include, for example, a dideoxynucleotide (when polymerase is used in the extension reaction), a thiol derivative (when polymerase is used in the extension reaction), a 3' deoxynucleotide (using reverse transcriptase in the extension reaction), or a 3' deoxyribonucleotide (using reverse transcriptase in the extension reaction).
- nucleotides can be, for example, a dinucleotide, a trinucleotide, or a longer nucleic acid.
- a bank of dinucleotides or longer nucleic acids such that within the bank one has optional nucleotides at more than one location.
- the labeling step is typically performed in solution (thus providing efficient hybridization), and the analysis step can be performed either in solution or on a solid, non-mobile support.
- the present invention therefore provides a method of identifying a selected nucleotide in a first nucleic acid comprising
- nucleic acid primer comprises a region complementary to a section of the first nucleic acid that is directly 3' of and adjacent to the selected nucleotide, under hybridization conditions that allow the first nucleic acid and the nucleic acid primer to form a hybridization product;
- performing a primer extension reaction with the hybridization product and a detectably labeled, identified chain-terminating nucleotide under conditions for primer extension;
- a primer is designed such that its 3' base ends at the nucleotide immediately 5' of the polymorphic base. A set of 4 dideoxynucleotide triphosphate mixtures are generated.
- Each mixture contains one of four labeled dideoxynucleotide molecules that have been chemically-coupled to a flourescein molecule (i.e., ddATP-F, ddCTP-F, ddGTP-F or ddTTP-F), and three non-labeled dideoxynucleotide triphosphates.
- a flourescein molecule i.e., ddATP-F, ddCTP-F, ddGTP-F or ddTTP-F
- the PCR product is added to the bead and the bead aliquoted into 2 or more tubes.
- the chain-terminating mixtures are dispensed to the tubes and a polymerase is added to generate the SBCE reaction tubes.
- the polymerase will extend a base onto the 3' end of the bead-attached oligo, this base being the complement of the base at the polymorphic site.
- the reaction tubes are analyzed by FlowMetrix and the appearance of a label in a particular reaction tube on a particular bead will indicate the polymorphic base at the site.
- a comparison of the present method with a hybridization method is illustrative of the utility of the present invention.
- SNP analysis by hybridization 2 oligos on 2 beads in the same tube are used to generate the material to be read for analysis.
- SCBE method the same oligo on the same bead is analyzed in 2 tubes with 2 different labeled dideoxynucleotides.
- the method has been exemplified herein using flourescein as the dye read-out, one can couple this method with biotinylated or other appropriately-modified nucleotides.
- the present methods can be performed wherein the chain terminating nucleotide is a dideoxynucleotide and the primer extension is performed in the presence of one labeled, identified dideoxynucleotide and three different, non-labeled dideoxynucleotides.
- the chain terminating nucleotide is a dideoxynucleotide
- the primer extension is performed in the presence of a first identified dideoxynucleotide labeled with a first detectable label, a second identified dideoxynucleotide labeled with a second detectable label, a third identified dideoxynucleotide labeled with a third detectable label and a fourth identified dideoxynucleotide labeled with a fourth detectable label
- detection of the presence of the first, the second, the third or the fourth detectable label in the hybridization product indicates the identity of the nucleotide complementary to the selected nucleotide as the first, the second, the third or the fourth dideoxynucleotide, respectively.
- the FlowMetrix beads It is possible to thermal cycle the FlowMetrix beads.
- the genomic DNA could be sheared, or treated with DNase to reduce viscosity, and cycled against oligos attached to the beads. Because of the vastly greater complexity of the template DNA, it may necessitate the need for extended hybridization optimization and cycling times. Since one would be essentially performing a Cot analysis on the beads. Use of these beads and SBCE for SNP identification and DNA sequencing should be apparent from the above description.
- the present invention provides a method of determining a selected nucleotide polymorphism in genomic DNA treated to reduce viscosity comprising
- the PCR product can be in single-stranded form.
- the present invention further provides a method of determining a selected nucleotide polymorphism in genomic DNA treated to reduce viscosity comprising (a) performing an amplification of the genomic DNA using as a primer an oligonucleotide comprising a first region having a T7 RNA polymerase promoter and a second region complementary to a section of one strand of the nucleic acid that is directly 5' of the selected nucleotide, and using T7 RNA polymerase to amplify one strand into cRNA and using reverse transcriptase to amplify the second strand complementary to the cRNA strand, under conditions for specific amplification of the region of the nucleotide between the two primers, to form an amplification product;
- the labeled chain -terminating nucleotide can be, for example, a 3'deoxynucleotide, a 3'deoxyribonucleotide, a thiol nucleotide derivative or a dideoxynucleotide.
- the amplification product can be in single-stranded form.
- primers can be the primers used to i) make the first strand cDNA, and, ii) with a set that has attached to it the T7 RNA polymerase, can be used to make cRNA.
- the primers can be made FITC-labeled for the cDNA.
- the present method further provides a method of determining a selected nucleotide polymorphism in genomic DNA treated to reduce viscosity comprising
- the DNA can be in single-stranded form.
- the labeled chain-terminating nucleotide can be, for example, a 3'deoxynucleotide, a 3'deoxyribonucleotide, a thiol nucleotide derivative or a dideoxynucleotide.
- the hybridization time should be of a length sufficient to allow hybridization of the first primer to the genomic DNA since the genomic DNA has not been amplified in this specific embodiment.
- relatively long hybridization times may be utilized, such as, for example, 12 hours, 24 hours, 48 hours, as is known in the art for hybridization to genomic DNA (see, e.g., Sambrook, et al.
- polymerases can be employed, such as a polymerase with a temperature condition for function, or a polymerase with a particular specificity for nucleotides, such as a polymerase that preferentially incorporates dideoxynucleotides (see, e.g., Sambrook, et al).
- a polymerase with a temperature condition for function or a polymerase with a particular specificity for nucleotides, such as a polymerase that preferentially incorporates dideoxynucleotides (see, e.g., Sambrook, et al).
- the skilled artisan is familiar with such polymerases, and new polymerases, as they are discovered, can be incorporated into the methods, given the teachings herein.
- the present invention additionally provides the use of the beads in an oligonucleotide-ligation assay (OLA) format, i.e., in which one can hybridize genomic DNA, cRNA or PCR product to a first nucleic acid attached to the bead, then come in with a second nucleic acid with a fluorescent label, then add ligase, and wherein the second nucleic acid has at its 3' end the polymorphic bases.
- OLA oligonucleotide-ligation assay
- nucleic acid comprises a region complementary to a section of the first nucleic acid that is directly 3' of the selected nucleotide and wherein the second nucleic acid terminates at its 3' end in a test nucleotide positioned to base-pair with the selected nucleotide, and (ii) a third, fluorescently labeled nucleic acid, wherein the third nucleic acid comprises a region complementary to a section of the second nucleic acid that is directly 5' of and adjacent to the selected nucleotide, under hybridization conditions that allow the first nucleic acid and the second nucleic acid to form a hybridization product and the first nucleic acid and the third nucleic acid to form a hybridization product; (b) adding to the hybridization product a ligase under ligation conditions; and
- This oligonucleotide ligation assay can be performed both (a) wherein the polymorphic base is located at the 5' side of either the reporter or acceptor oligonucleotide, or (b) wherein the polymorphic base is located at the 3' side of either the reporter or acceptor oligonucleotide.
- the first nucleic acid can be genomic DNA (treated to reduce viscosity, e.g., by DNase treatment or by shearing), amplified nucleic acid such as a PCR product, an oligonucleotide, a 16s ribosomal RNA, a DNA fragment, an RNA molecule, a cDNA molecule, a cRNA molecule, restriction enzyme-generated DNA fragment, size-selected DNA, Bridge-amplified DNA, 16S RNA, 16S DNA or any other desired nucleic acid.
- Any selected ligase can be used, such as T4 DNA ligase.
- a thermostable ligase would be particularly useful. See, generally Wu and Wallace, Genomics 4: 560-569 (1989).
- the present invention additionally encompasses the use in the OLA readout of degenerate reporter oligonucleotides, preferably the use of 8-mer oligonucleotides wherein 6 of the bases are chosen to be specific to the target nucleic acid and 2 of the bases are variable, or wobble or degenerate, positions.
- the degeneracy can be placed in any position in the reporter oligonucleotide; however, preferable positions can be positions 3, 4, 5, and 6.
- Preferable variable position combinations in a selected oligonucleotide can be positions 3 and 6, positions 4 and 5, and positions 3 and 4.
- the present invention includes an OLA readout wherein the reporter oligonucleotide is an 8-base complementary 8-mer conjugated to a reporter molecule or hapten to which a reporter molecule can be conjugated by means of a hapten- recognizing intermediary (e.g., antibody, avidin, streptavidin).
- a hapten- recognizing intermediary e.g., antibody, avidin, streptavidin
- the present invention further includes an OLA readout wherein the reporter oligonucleotide is an 6-base complementary 8-mer ("6+2 -mer") conjugated to a reporter molecule or hapten to which a reporter molecule can be conjugated by means of a hapten-recognizing intermediary.
- the two non-complementary bases can be any of the four natural bases or can be a non-natural derivative capable of forming a non-helix disturbing duplex structure.
- the non-complementary bases can preferably be located at positions 3 and 6 or positions 4 and 5.
- Non-natural base derivatives and/or 6+2-mers can be components of a kit for use in performing the detection methods described herein. Further, one can employ a 'Taqman' approach wherein one incorporates Dye quenchers and Dye acceptors into the attached oligos and asks for the polymerase to remove the dye quencher in a repair reaction.
- the invention further employs hybridization methods wherein two nucleic acids are hybridized to the sample nucleic acid but the step of ligation can be omitted and a match instead detected by fluorescence energy transfer between the two nucleic acids hybridized to the sample nucleic acid.
- the two hybridizing nucleic acids are designed such that the 3' end of the nucleic acid linked to the bead is a test base, and when it is complementary to the polymorphic base, and a single wavelength of light is directed onto the sample, one can detect a transfer of energy, read as a second wavelength of light. A second reader can be employed for this detection of this second wavelength.
- the present invention provides a method of identifying a selected nucleotide in a first nucleic acid comprising (a) contacting the first nucleic acid with (i) a second nucleic acid linked at its 5' end to a detectably tagged mobile solid support and linked at its 3' end to a fluorescent label, wherein the second nucleic acid comprises a region complementary to a section of the first nucleic acid that is directly 3' of the selected nucleotide and wherein the second nucleic acid terminates at its 3' end in a test nucleotide positioned to base-pair with the selected nucleotide, and
- a third nucleic acid fluorescently labeled at its 5' end wherein the third nucleic acid comprises a region complementary to a section of the second nucleic acid that is directly 5' of and adjacent to the selected nucleotide, (b) under hybridization conditions that allow the first nucleic acid and the second nucleic acid to form a hybridization product and the first nucleic acid and the third nucleic acid to form a hybridization product;
- the present invention also provides a method for determining the sequence of a polymorphic base comprising: a first nucleic acid attached at a 5' end to a mobile solid support and having a 3' end adjacent to a polymorphic base on a second nucleic acid; a third nucleic acid with an attached reporter moiety that is complementary to a region adjacent to the polymorphic base of the second nucleic acid; the first nucleic acid and the third nucleic acid together defining a gap opposite the polymorphic base; a nucleotide that is complementary to one of a set of two possible polymorphic bases, a polymerase, and a ligase; wherein the polymerase is able to polymerize the nucleotide across the gap if the nucleotide is complementary to the polymorphic base; the ligase is able to ligate the newly polymerized nucleotide to the reporter-attached third nucleic acid; and a means for detecting the reporter covalently linked to
- a second nucleic acid linked at its 5' end to a detectably tagged mobile solid support, wherein the second nucleic acid comprises a region complementary to a section of the first nucleic acid that is directly 3' of and immediately adjacent to the selected nucleotide, and
- a third nucleic acid fluorescently labeled wherein the third nucleic acid comprises a region complementary to a section of the second nucleic acid that is directly 5' of and adjacent to the selected nucleotide, under hybridization conditions that allow the first nucleic acid and the second nucleic acid to form a hybridization product and the first nucleic acid and the third nucleic acid to form a hybridization product, wherein the first, second and third nucleic acids form a hybridization product that defines a gap opposite the selected nucleotide;
- the polymerase can preferably be a non-strand displacing polymerase. Further, it can be a thermostable polymerase.
- the ligase can be a DNA ligase.
- the present invention further provides a method of detecting a single base polymorphism comprising using an enzyme or chemical to modify or endonucleolytically cleave a mismatched base at the polymorphic site in a nucleic acid, resulting in the loss of an attached reporter or in a modification, and detecting a loss of the reporter or detecting the modification, thus resulting in a labeling means for the identification of the modification.
- an end-labeled (such as with FITC) genomic fragment or a labeled (such as with FITC) PCR fragment is hybridized to an oligonucleotide and attached to a bead, then the construct is treated with an enzyme that recognizes and/or restricts mispaired DNA (such as FITC-labeled recA, mutS or T7 enzyme) and analyzed for the addition or loss of the label.
- an enzyme that recognizes and/or restricts mispaired DNA such as FITC-labeled recA, mutS or T7 enzyme
- a chemical recognizing single stranded regions of DNA and capable of modifying the region is utilized, and the modification is detected.
- any of the herein described methods can be utilized in a method for quantitating expression of a selected nucleic acid in a sample.
- it can be used, for example, for differential gene expression wherein the expression of a selected gene is quantitated and compared to a standard or some other reference.
- a gene fragment from a region of interest or a region that distinguishes the gene (or allele or haplotype or polymorphism) of interest is linked at its 5' end to a detectably labeled mobile solid support; message (e.g., RNA, cDNA, cRNA) is hybridized to the fragment, and fluorescence is quantitated by performing a primer extension reaction, a ligase reaction or a hybridization/fluorescence energy transfer reaction, such as that described herein.
- the nucleic acid probe can comprise a region complementary to a section of the selected nucleic acid unique to the nucleic acid.
- a standard such as that from a normal subject, or a diseased/ afflicted subject, or a particular tissue or organ, or a particular species, can be used as a comparison reference to draw conclusion regarding the quantity detected in the sample.
- the present invention provides a method of detecting a result from an identification reaction to identify a selected nucleotide in a target nucleic acid comprising: a) contacting a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the second complementarity region is 5' of the first complementarity region and wherein the first complementarity region comprises a region complementary to a section of the target nucleic acid that is directly 3' of and adjacent to the selected nucleotide, with a sample comprising the target nucleic acid, under hybridization conditions that allow the formation of a hybridization product between the first complementarity region of the target oligonucleotide and a region of the target nucleic acid complementary to the first complementarity region of the target oligonucleotide, to form a first hybridization product; b) performing a selected identification reaction with the first hybridization product to determine the identity of the selected nucleotide wherein a selectively labele
- the basic method thus involves the use of a capture oligonucleotide, linked to a mobile solid support (such as a bead), to isolate a reaction product from a reaction.
- a "target oligonucleotide” is designed which comprises, in addition to a first complementarity region, which is a region complementary to a region of the target nucleic acid, a second complementarity region, which is located 5' of the first complementarity region, and which is complementary to the nucleotide sequence of the capture oligonucleotide.
- the capture oligonucleotide can be utilized in a hybridization reaction to isolate the target oligonucleotide in its reacted form (e.g., as a ligation product or as a primer extension product).
- a reaction such as SBCE or OLA
- the capture oligonucleotide can be utilized in a hybridization reaction to isolate the target oligonucleotide in its reacted form (e.g., as a ligation product or as a primer extension product).
- a bead specifically for each oligonucleotide e.g., the "first complementarity region of the target oligonucleotide in the present invention
- the present invention additionally encompasses the use in the OLA readout of degenerate reporter oligonucleotides, preferably the use of 6+2-mers as described herein.
- reporter oligonucleotides can be a component of a useful kit for performing the detection methods herein.
- the capture oligonucleotide can be designed such that it does not specifically hybridize, i.e., is not sufficiently complementary for specific hybridization to occur, to the target nucleic acid. For example, it can include nucleotide usage not typically found in the target species (such as human). If the target sequence is fully known, the capture sequence can be selected as a sequence which does not occur in the target sequence.
- a capture oligonucleotide can be of any desired length so long as it is sufficiently long so as to selectively hybridize to a first complementarity region of a target oligonucleotide (under selective hybridization conditions, e.g., stringent hybridization conditions, as known to one skilled in the art), and not so long as to interfere with either the identification reaction being performed with the target oligonucleotide or the hybridization reaction between the capture oligonucleotide and the target oligonucleotide.
- the capture oligonucleotide length selected can also be a function of how many different capture oligonucleotides one desires to use in any selected use.
- the capture oligonucleotide can be 8, 10, 12, 15, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40 or more nucleotides.
- a preferred length is around 25 nucleotides, such as 23, 24, 25, 26, 27 or 28 nucleotides.
- other oligonucleotide lengths can be utilized.
- Optimal length for any specific use can be determined according to the specific nucleic acid composition, as will be known to those skilled in the art.
- a bank of complementary regions can be maintained for use in generating target oligonucleotides for any specific target nucleic acid.
- the present invention provides a method of detecting a reaction product to identify a selected nucleotide in a target nucleic acid comprising: a) contacting a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the first complementarity region comprises the oligonucleotide primer and the second complementarity region comprises a nucleic acid sequence complementary to a capture oligonucleotide, and wherein the oligonucleotide primer comprises a region complementary to a section of the target nucleic acid that is directly 3' of and adjacent to the selected nucleotide, with a sample comprising the target nucleic acid, under hybridization conditions that allow the formation of a hybridization product between the first complementarity region of the target oligonucleotide and a region of the target nucleic acid complementary to the first complementarity region of the target oligonucleotide, to form a first hybridization product; b) performing a
- the target oligonucleotide is designed such that the 5' end comprises second complementarity region and later allows for hybridization to a complementary capture oligonucleotide linked to a mobile solid support, and the 3' end comprises a first complementarity region complementary a region of the target nucleic acid just 3' of the polymorphic base.
- the 3' base ends at a nucleotide chosen relative to the polymorphic base, depending upon the assay being performed.
- the 3' base of this target oligonucleotide can end at the nucleotide 5' to the polymorphic base, or it can end with a base corresponding to the polymorphic base.
- the present invention additionally provides the use of the beads in an oligonucleotide- ligation assay (OLA) format, i.e., in which one can hybridize genomic DNA, cRNA or PCR product to a target oligonucleotide having a first complementarity region that is complementary to a section of the target nucleic acid that is directly 3' of the selected nucleotide, then come in with a reporter oligonucleotide having a fluorescent label, then add ligase, and wherein the target oligonucleotide has at its 3' end the polymorphic bases.
- OLA oligonucleotide- ligation assay
- the reagents can comprise: a target oligonucleotide containing two regions of complementarity; a first complementarity region of the target oligo is complementary to a region immediately adjacent to a single nucleotide polymorphism to be analyzed, a second complementarity region of the target oligonucleotide which is complementary to a capture oligonucleotide; a capture oligonucleotide that is covalently coupled to a mobile solid support; a reporter oligonucleotide complementary to the region overlapping the SNP and containing a means for readout, and a 3' base on the strand opposite the SNP position; a ligase capable of ligating the reporter and the target if the base on the reporter that is opposite the SNP is complementary.
- the ligation reaction is then added to the capture-oligonucleotide- coupled mobile solid support and hybridization of the second complementarity region to the bead is allowed to occur under standard hybridization conditions.
- Readout of the reporter could be performed using a Luminex LXlOO-type machine.
- the advantages to this system include the reduced number of bead sets needed to analyze many different SNPs, i.e., if given 100 bead colors, then one could synthesize only 100 capture oligonucleotides and use them over and over again in the different wells.
- the present invention provides a method of detecting a result from an identification reaction (OLA) to identify a selected nucleotide in a target nucleic acid comprising: a) hybridizing (i) a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the first complementarity region comprises a region complementary to a section of the target nucleic acid that is directly 3' of and adjacent to the selected nucleotide and the second complementarity region comprises a nucleic acid sequence complementary to a capture oligonucleotide, and (ii) a fluorescently labeled reporter oligonucleotide comprising a region complementary to a section of the target nucleic acid that is directly 5' of and adjacent to the selected nucleotide, to a sample comprising the target nucleic acid, under hybridization conditions that allow specific hybridization between the first complementarity region of the target oligonucleotide and a region of the target nucleic acid
- the target nucleic acid can be genomic DNA treated to reduce viscosity, an oligonucleotide, a 16s ribosomal RNA, a 16S DNA, a PCR product, a DNA fragment, a restriction enzyme-generated DNA fragment, size- selected DNA, Bridge-amplified DNA, an RNA molecule, a cDNA molecule or a cRNA molecule.
- the present invention further provides a method of determining a selected nucleotide polymorphism in genomic DNA treated to reduce viscosity comprising a) performing an amplification of the genomic DNA using a first nucleic acid primer comprising a region complementary to a section of one strand of the nucleic acid that is 5' of the selected nucleotide, and a second nucleic acid primer complimentary to a section of the opposite strand of the nucleic acid downstream of the selected nucleotide, under conditions for specific amplification of the region of the selected nucleotide between the two primers, to form a PCR product; b) contacting the PCR product with a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the first complementarity region is complementary to a section of one strand of the PCR product that is directly 5' of and adjacent to the selected nucleotide, under hybridization conditions to form a first hybridization product; c) performing a
- the present invention further provides a method of determining a selected nucleotide polymorphism in genomic DNA treated to reduce viscosity comprising a) performing an amplification of the genomic DNA using as a primer an oligonucleotide comprising a first region having a T7 RNA polymerase promoter and a second region complementary to a section of one strand of the nucleic acid that is directly 5' of the selected nucleotide, and using T7 RNA polymerase to amplify one strand into cRNA and using reverse transcriptase to amplify the second strand complementary to the cRNA strand, under conditions for specific amplification of the region of the nucleotide between the two primers, to form an amplification product; b) contacting the amplification product with a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the first complementarity region is complementary to a section of one strand of the PCR product that
- the labeled chain-terminating nucleotide can be, for example, a 3'deoxynucleotide, a 3'deoxyribonucleotide, a thiol nucleotide derivative or a dideoxynucleotide.
- the amplification product can be in single-stranded form. Furthermore, one can design and synthesize some primers to sit just downstream of the target oligonucleotides.
- the present method further provides a method of determining a selected nucleotide polymorphism in genomic DNA treated to reduce viscosity comprising a) contacting the genomic DNA with a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the first complementarity region is complementary to a section of one strand of the PCR product that is directly 5' of and adjacent to the selected nucleotide and wherein the second complementarity region is 5' to the first complementarity region, under hybridization conditions for forming a specific first hybridization product; b) performing a primer extension reaction with the specific first hybridization product and a detectably labeled, identified chain-terminating nucleotide under conditions for primer extension; c) isolating the primer extension product by contacting the primer extension product with a capture oligonucleotide that is covalently coupled to a mobile solid support, wherein the capture oligonucleotide comprises a nucleic acid sequence complementary to the
- the DNA can be in single-stranded form.
- the labeled chain -terminating nucleotide can be, for example, a 3'deoxynucleotide, a 3'deoxyribonucleotide, a thiol nucleotide derivative or a dideoxynucleotide.
- the hybridization time should be of a length sufficient to allow hybridization of the first primer to the genomic DNA since the genomic DNA has not been amplified in this specific embodiment.
- relatively long hybridization times may be utilized, such as, for example, 12 hours, 24 hours, 48 hours, as is known in the art for hybridization to genomic DNA (see, e.g., Sambrook, et al).
- any selected ligase can be used, such as T4 DNA ligase.
- a thermostable ligase would be particularly useful. See, generally Wu and Wallace, Genomics 4: 560-569 (1989).
- the invention further employs hybridization methods wherein two nucleic acids are hybridized to the sample nucleic acid but the step of ligation can be omitted and a match instead detected by fluorescence energy transfer between the two nucleic acids hybridized to the sample nucleic acid.
- the two hybridizing nucleic acids are designed such that the 3' end of the target oligonucleotide is a test base, and when it is complementary to the polymorphic base, and a single wavelength of light is directed onto the sample, one can detect a transfer of energy, read as a second wavelength of light. A second reader can be employed for this detection of this second wavelength.
- the present invention provides a method of identifying a selected nucleotide in a target nucleic acid comprising a) contacting the target nucleic acid with i. a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the first complementarity region is complementary to a section of the first nucleic acid that is directly 5' of the selected nucleotide, wherein the target oligonucleotide terminates at its 3' end in an identified test nucleotide positioned to base-pair with the selected nucleotide, and wherein the second complementarity region is 5' to the first complementarity region, and ii.
- a fluorescently labeled reporter oligonucleotide wherein the reporter oligonucleotide comprises a region complementary to a section of the target nucleic acid that is directly 3' of and adjacent to the selected nucleotide, under hybridization conditions that allow the target nucleic acid and the target oligonucleotide to hybridize and the target nucleic acid and the reporter oligonucleotide to hybridize, thus forming a first hybridization product; b) adding to the first hybridization product a ligase under ligation conditions; c) isolating the first hybridization product by contacting the first hybridization product with a capture oligonucleotide that is covalently coupled to a mobile solid support, wherein the capture oligonucleotide comprises a nucleic acid sequence complementary to the second complementarity region of the target oligonucleotide, under hybridization conditions to form an isolated second hybridization product; and d) detecting the presence or absence of the fluorescent label,
- the present invention additionally provides a method of identifying a selected nucleotide in a target nucleic acid comprising a) contacting the target nucleic acid with i. a target oligonucleotide linked at its 3' end to a fluorescent label, wherein the target oligonucleotide comprises a first complementarity region that is complementary to a section of the target nucleic acid that is directly 3' of the selected nucleotide, wherein the target oligonucleotide terminates at its 3 ' end in a test nucleotide positioned to base-pair with the selected nucleotide, and wherein the target oligonucleotide has a second complementarity region 5' of the first complementarity region, and ii.
- a reporter oligonucleotide fluorescently labeled at its 5' end, wherein the reporter oligonucleotide comprises a region complementary to a section of the target nucleic acid that is directly 5' of and adjacent to the selected nucleotide, under hybridization conditions that allow the target nucleic acid and the target oligonucleotide to hybridize and the target nucleic acid and the reporter oligonucleotide to hybridize, to form a first hybridization product; b) isolating the first hybridization product by contacting the first hybridization product with a capture oligonucleotide that is covalently coupled to a mobile solid support, wherein the capture oligonucleotide comprises a nucleic acid sequence complementary to the second complementarity region of the target oligonucleotide, under hybridization conditions to form an isolated second hybridization product; and c) detecting the presence or absence of fluorescent energy transfer between the fluorescent label at the 3' end of the target oligonucleo
- the present invention also provides a method for determining the sequence of a polymorphic base in a target nucleic acid which can utilize a kit comprising one or more of the following: a target oligonucleotide, wherein the target oligonucleotide comprises a first complementarity region and a second complementarity region 5' of the first complementarity region, wherein the first complementarity region is complementary to a section of the target nucleic acid having a 3' end adjacent to and directly 5' of the polymorphic base on the target nucleic acid; a reporter oligonucleotide with an attached reporter moiety that is complementary to a region immediately adjacent to and 3' of the polymorphic base of the target nucleic acid; the target oligonucleotide and the reporter oligonucleotide together defining a gap opposite the polymorphic base; a capture oligonucleotide that is covalently linked to a mobile solid support (such as a polystyrene-div
- the present invention provides a method of identifying a selected nucleotide in a target nucleic acid comprising a) contacting the target nucleic acid with i. a target oligonucleotide, wherein the target oligonucleotide comprises a first complementarity region and a second complementarity region 5' of the first complementarity region, wherein the first complementarity region is complementary to a section of the target nucleic acid that is directly 3' of and immediately adjacent to the selected nucleotide, and ii.
- a reporter oligonucleotide fluorescently labeled wherein the reporter oligonucleotide comprises a region complementary to a section of the second nucleic acid that is directly 5' of and adjacent to the selected nucleotide, under hybridization conditions that allow the target nucleic acid and the target oligonucleotide to form a hybridization product and the target nucleic acid and the reporter oligonucleotide to form a hybridization product, wherein the target nucleic acid, target oligonucleotide and reporter oligonucleotide form a hybridization product that defines a gap opposite the selected nucleotide; b) adding an identified test nucleotide, a polymerase and a ligase, under conditions for polymerization and ligation; c) isolating the first hybridization product by contacting the first hybridization product with a capture oligonucleotide that is covalently coupled to a mobile solid support, wherein the capture oligon
- the polymerase can preferably be a non-strand displacing polymerase. Further, it can be a thermostable polymerase.
- the ligase can be a DNA ligase. Further, it can be a thermostable ligase.
- any of the herein described methods can be utilized in a method for quantitating expression of a selected nucleic acid in a sample.
- it can be used, for example, for differential gene expression wherein the expression of a selected gene is quantitated and compared to a standard or some other reference.
- a gene fragment from a region of interest or a region that distinguishes the gene (or allele or haplotype or polymorphism) of interest is selected for use as the first complementarity region of a target oligonucleotide; message (e.g., RNA, cDNA, cRNA) is hybridized to the target oligonucleotide, and fluorescence is quantitated by performing a primer extension reaction, a ligase reaction or a hybridization/fluorescence energy transfer reaction, such as that described herein.
- a corresponding capture oligonucleotide (complementary to a second complementarity region utilized in the target oligonucleotide) linked to a mobile solid support is utilized to capture the reaction product.
- the first complementarity region of a target oligonucleotide can comprise a region complementary to a section of the selected nucleic acid unique to the nucleic acid.
- a standard such as that from a normal subject, or a diseased/ afflicted subject, or a particular tissue or organ, or a particular species, can be used as a comparison reference to draw conclusions regarding the quantity detected in the sample.
- the present invention provides a method of quantitating expression of a selected nucleic acid in a sample comprising a) contacting (i) message nucleic acid isolated from a selected source with (ii) a target oligonucleotide, wherein the target oligonucleotide comprises a first complementarity region and a second complementarity region 5' of the first complementarity region, wherein the first complementarity region comprises a region complementary to a section of the selected nucleic acid; b) performing a selected identification reaction with the first hybridization product to determine the identity of the selected nucleotide wherein a selectively labeled detection product comprising the second complementarity region of the target oligonucleotide can be formed; c) isolating the detection product by contacting the detection product with a capture oligonucleotide that is covalently coupled to a mobile solid support, wherein the capture oligonucleotide comprises a nucleic acid sequence complementary to the second complementarity
- a sample can be, for example, any body sample that contains message, such as organ tissue and/or cells, such as blood, red or white blood cells, bone marrow, liver, kidney, brain, skin, heart, lung, spleen, pancreas, gall bladder, muscle, neural cells, neurons, precursor cells, ovaries, testicles, uterus, glands.
- organ tissue and/or cells such as blood, red or white blood cells, bone marrow, liver, kidney, brain, skin, heart, lung, spleen, pancreas, gall bladder, muscle, neural cells, neurons, precursor cells, ovaries, testicles, uterus, glands.
- kits for detecting a single base polymorphism comprising a detectably tagged mobile solid support, such as a polystyrene-divinylbenzene bead, and one to four modified (chain-terminating) nucleotide(s), such as a 3' deoxynucleotide,m, a 3' deoxyribonucleotide, a thiol derivative, or a dideoxynucleotide.
- the kit can additionally comprise a polymerase, and in particular, a polymerase that preferentially incorporates the modified nucleotide.
- the kit can additionally comprise a ligase.
- the kit can also comprise one or more fluorescent label for labeling the nucleic acid(s).
- the kit can further comprises a DNase for reducing the viscosity of the DNA.
- the kit can further contain an array of combinations of dinucleotides and/or a collection of combinations of trinucleotides.
- the kits can comprise other reporter probes and labels for use in oligonucleotide ligation assays, allele-specific polymerase assays, cleavase signal release reactions, or polymerase repair reactions.
- the invention provides a method of detecting a result from an identification reaction to identify a selected nucleotide in a target nucleic acid comprising: a. contacting a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the second complementarity region is 5' of the first complementarity region and wherein the first complementarity region comprises a region complementary to a section of the target nucleic acid that is directly 3' of and adjacent to the selected nucleotide, with a sample comprising the target nucleic acid, under hybridization conditions that allow the formation of a first hybridization product; b.
- a selectively labeled detection product comprising the target oligonucleotide and the reporter probe can be formed; c. isolating the detection product by contacting the detection product with a capture oligonucleotide that is covalently coupled directly or indirectly to a mobile solid support, wherein the capture oligonucleotide comprises a nucleic acid sequence complementary to the second complementarity region of the target oligonucleotide, under hybridization conditions to form a second hybridization product; and d. detecting the label of the labeled detection product in the second hybridization product, the presence of the label indicating the identity of the selected nucleotide in the target nucleic acid.
- the capture oligonucleotide (also referred to herein as the cZipCode) can have a GC content of about 50% or greater. Also, the capture oligonucleotide can have a T m of about 60 to70°C. Preferably, the capture oligonucleotide comprises a sequence not present in a cell that contains the target nucleic acid of interest.
- the target nucleic acid can be a sequence present in mammalian cells and the capture oligonucleotide can comprise an oligonucleotide sequence present in a bacterium.
- the capture oligonucleotide can comprise an oligonucleotide sequence present in Mycobacterium tuberculosis. Also, as used throughout, the capture oligonucleotide can further comprise a 5' amine group.
- the capture oligonucleotide can further comprise a luciferase cDNA.
- the luciferase cDNA can have the sequence of CAGGCCAAGTAACTTCTTCG (SEQ ID NO:59).
- the capture oligonucleotide can be directly or indirectly coupled to the mobile solid support.
- the capture oligonucleotide can be indirectly coupled to the mobile solid support by a carbon spacer.
- the capture oligonucleotide can coupled at either its 5' or 3' end to the mobile solid support. Accordingly, the label attached to the oligonucleotide that hybridizes to the probe can be directed toward or away from the mobile solid support without hinderance to the detection of the label.
- the second complementarity region of the target oligonucleotide preferably comprises a nucleic acid of at least 8, 10, 15, or 25 nucleotides. More specifically, the second complementarity region of the target oligonucleotide can comprises a nucleic acid having the sequence selected from the group consisting of SEQ ID NO: 1-58 as show in Table 1.
- the identification reaction of the present invention can be a single base chain extension reaction.
- the single base chain extension reaction comprises performing a primer extension reaction with the first hybridization product; wherein the detectably labeled reporter probe comprises an identified, chain-terminating nucleotide under conditions for primer extension; and wherein the presence of a label in the second hybridization product indicates the incorporation of the labeled nucleotide into the first hybridization product, the identity of the incorporated labeled nucleotide indicating the identity of the nucleotide complementary to the selected nucleotide, thus identifying the selected nucleotide in the target nucleic acid.
- the chain-terminating nucleotide can be a 3'deoxynucleotide, a 3'deoxyribonucleotide, a thiol nucleotide derivative or a dideoxynucleotide.
- the primer extension can be performed in the presence of either (1) one labeled, identified dideoxynucleotide and three different, non-labeled dideoxynucleotides; (2) one labeled, identified dideoxynucleotide and two different, non-labeled dideoxynucleotides; (3) one labeled, identified dideoxynucleotide and one different, non-labeled dideoxynucleotides; or (4) one labeled, identified dideoxynucleotide and in the absence of any different, non-labeled dideoxynucleotides.
- the label of the chain-terminating nucleotide can be selected from the group consisting of a hapten, radiolabel, and fluorescent label.
- the identification reaction can be an oligonucleotide ligation reaction.
- the oligonucleotide ligation reaction comprises performing a ligation reaction between the target oligonucleotide and the reporter probe; wherein the selectively labeled reporter probe comprises a sequence that is complementary to a section of the target nucleic acid directly 5' the selected nucleotide and that terminates at its 3' end in an identified test nucleotide positioned to base-pair with the selected nucleotide of the target nucleic acid, under conditions for ligation; and wherein the detection comprises detecting the presence or absence of a label incorporated into the second hybridization product, the presence of a label indicating the incorporation of the labeled reporter probe in the reaction product, and the identity of the incorporated labeled reporter probe indicating the identity of the nu
- the reporter probe can comprise one or more nucleotides and have a 5' phosphate group. Furthermore, the reporter probe further comprises a 3' label. Preferably, the reporter probe is an oligonucleotide. More preferably, the oligonucleotide of the reporter probe is an 8-mer.
- the identification reaction can be an allelle-specific polymerization reaction (i.e., minisequencing).
- the allelle-specific polymerization reaction can comprise performing a polymerization reaction with a non-proofreading polymerase, wherein a primer for the reaction comprises the first complementarity region of the target oligonucleotide, wherein the reporter probe comprises one or more selectively labeled deoxynucleotides, and wherein the detection comprises detecting the presence or absence of a label incorporated into the second hybridization product, the presence of the label indicating the extension of the primer and the identity of the label indicating the nucleotide complementary to the selected nucleotide, thus identifying the selected nucleotide in the target nucleic acid.
- the nucleic acid primer can be an oligonucleotide, a PCR product, a DNA fragment, an RNA molecule, a cDNA molecule, a cRNA molecule, or genomic DNA.
- the mobile solid support is preferably a bead, and more preferably a polystyrene-divinylbenzene bead.
- the bead can be strepavidin-coated, and the capture oligonucleotide can be biotinylated, and thereby the biotin on the capture probe and the strepavidin on the bead providing a high affinity binding between the capture probe and the bead.
- the strepavidin on the mobile solid support must be saturated with biotin to prevent direct binding of the biotin of the reporter probe to the mobile solid support.
- the mobile solid support can be detectably tagged with a dye, radiolabel, magnetic tag, or a Quantum Dot® (Quantum Dot Corp.).
- the detectable tag can be detected either by passing the mobile solid support over a laser detection device capable of detecting the detectable tag or by placing the mobile solid support on a two-dimensional surface and passing a laser detection device capable of detecting/distinguishing the detectable tag over the solid support.
- the same laser detection device detects or distinguishes the label of the labeled detection product and the detectable tag of the mobile solid support in the same second hybridization product.
- radiolabels or radiotags are used in the present method, an alternative detection device is used.
- radiotags or radiolabels can be detected by embedding the sample to be read in scintillation fluid and using a non-laser detector.
- numerous labels and detectable tags can be detected by the same detection device in the same sample so long as the detection device can differentiate the signal of each label or detectable tag, opportunities for multiplexing are available.
- the mobile solid support for example, can include a set of beads having different detectable tags and selected capture probes selected for that detectable tag.
- Analytical readout platforms include also include both solid supports (gels, chips, glass slides) and mobile supports such as mass- spectrometry and electrophoresis (gel and capillary).
- the methods of the present invention can further comprise performing the selected identification reaction in the presence of more than one reporter probe, wherein each reporter probe comprises a different detectable label and a different nucleotide complementary to the selected nucleotide of the target nucleic acid, to produce detection products with different labels, and detecting the different labels of the labeled detection products in the second hybridization products, the presence of each label indicating the identity of each selected nucleotide in the target nucleic acid.
- the different labels of the labeled detection products in the second hybridization products can be quantified, the quantity of the different labels indicating the relative occurrence of each selected nucleotide in the target nucleic acid.
- each second hybridization product can comprise one or more labels.
- one bead could have two or more selected capture probes.
- Each bead could have its own detectable tag and, upon hybridization of the capture probes with the detection products, have two specific labels associated with the same bead.
- a bead having a specific fluorescence could have both a fluorescein and a rhodamine label attached.
- the detection device could differentiate all three signals on one bead and could read similar signals are beads having different fluorescent wavelengths.
- the multiplexing method could further comprise quantifying the different labels of the labeled detection products in the second hybridization products, the quantity of the different labels indicating the relative occurrence of each selected nucleotide in the target nucleic acid.
- the present invention provides a method of detecting a result from an identification reaction to identify a selected nucleotide in a target nucleic acid can alternatively comprise: a. contacting a target oligonucleotide comprising a first complementarity region and a second complementarity region, wherein the second complementarity region is 3' of the first complementarity region and wherein the first complementarity region comprises a region complementary to a section of the target nucleic acid that is directly 5' of and adjacent to the selected nucleotide, with a sample comprising the target nucleic acid, under hybridization conditions that allow the formation of a first hybridization product; b.
- a selectively labeled detection product comprising the target oligonucleotide and the reporter probe can be formed; c. isolating the detection product by contacting the detection product with a capture oligonucleotide that is covalently coupled directly or indirectly to a mobile solid support, wherein the capture oligonucleotide comprises a nucleic acid sequence complementary to the second complementarity region of the target oligonucleotide, under hybridization conditions to form a second hybridization product; and d.
- the capture oligonucleotide can be coupled at either its 5' or 3' end to the mobile solid support.
- the identification reaction using this 3' to 5' directionality is an oligonucleotide ligation reaction.
- the oligonucleotide ligation reaction can comprise performing a ligation reaction between the target oligonucleotide and the reporter probe; wherein the selectively labeled reporter probe comprises a sequence that is complementary to a section of the target nucleic acid directly 3' the selected nucleotide and that terminates at its 5' end in an identified test nucleotide positioned to base-pair with the selected nucleotide of the target nucleic acid, under conditions for ligation; and wherein the detection comprises detecting the presence or absence of a label incorporated into the second hybridization product, the presence of a label indicating the incorporation of the labeled reporter probe in the reaction product, and the identity of the incorporated labeled reporter probe indicating the identity of the nucleotide complementary to the selected nucleotide, thus identifying the selected nucleotide in the target nucleic acid.
- the reporter probe comprises one or more nucleotides and has a 3' phosphate group.
- the present invention further provides a method of detecting a result from an identification reaction to identify one or more selected nucleotides in one or more target nucleic acids comprising: a. contacting one or more specific target oligonucleotides, wherein each target oligonucleotide comprises a first specific complementarity region and a second specific complementarity region, wherein the second complementarity region of each target oligonucleotide is 5' of the first complementarity region and wherein the first complementarity region of each target oligonucleotide comprises a sequence that is complementary to a section of the target nucleic acid directly 3' of the selected nucleotide and that terminates at its 3' end in an identified test nucleotide positioned to base-pair with the selected nucleotide of the target nucleic acid, with a sample comprising one or more target nucleic acids, under hybridization conditions, to form first hybridization products; b.
- each capture oligonucleotide comprises a nucleic acid sequence complementary to a second complementarity region of a specific target oligonucleotide and wherein the detectable tag is specific for each capture oligonucleotide; and d.
- the identification reaction can be a single base chain extension reaction.
- the single base chain extension reaction comprises performing a primer extension reaction with the first hybridization products; wherein each detectably labeled reporter probe comprises an identified, chain-terminating nucleotide under conditions for primer extension; and wherein the presence of a selected label in the second hybridization product indicates the incorporation of the labeled nucleotide into the first hybridization product, the identity of the incorporated labeled nucleotide indicating the identity of the nucleotide complementary to the selected nucleotide, thus identifying the selected nucleotide in the target nucleic acid.
- the identification reaction can be an oligonucleotide ligation reaction.
- the oligonucleotide ligation reaction comprises performing a ligation reaction between the target oligonucleotides and the reporter probes.
- the identification reaction is an allelle-specific polymerization reaction, wherein the allelle-specific polymerization reaction comprises performing a polymerization reaction with a non- proofreading polymerase, wherein each primer for the reaction comprises the first complementarity region of the target oligonucleotide, wherein the reporter probe comprises one or more selectively labeled deoxynucleotides, and wherein the detection comprises detecting the presence or absence of a label incorporated into the second hybridization product, the presence of the label indicating the extension of the primer and the identity of the label indicating the nucleotide complementary to the selected nucleotide, thus identifying the selected nucleotide in the target nucleic acid.
- the detection device detects or distinguishes the various labels of the labeled detection products and the various detectable tags of the mobile solid support in the same second hybridization products.
- the labels and specific detectable tags in the second hybridization products can be quantified, the quantity of the labels and specific detectable tags in the second hybridization products indicating the relative occurrence of each selected nucleotide in the target nucleic acid.
- the present invention provides a method of detecting a result from an identification reaction to identify one or more selected nucleotides in one or more target nucleic acids comprising: a.
- each target oligonucleotide comprises a first specific complementarity region and a second specific complementarity region, wherein the second complementarity region of each target oligonucleotide is 3' of the first complementarity region and wherein the first complementarity region of each target oligonucleotide comprises a sequence that is complementary to a section of the target nucleic acid directly 5' of the selected nucleotide and that terminates at its 5' end in an identified test nucleotide positioned to base-pair with the selected nucleotide of the target nucleic acid, with a sample comprising one or more target nucleic acids, under hybridization conditions, to form first hybridization products; b.
- each capture oligonucleotide comprises a nucleic acid sequence complementary to a second complementarity region of a specific target oligonucleotide and wherein the detectable tag is specific for each capture oligonucleotide; and d.
- each capture oligonucleotide can be coupled at either its 5' or 3' end to the mobile solid support.
- the identification reaction is an oligonucleotide ligation reaction.
- the reporter probe comprises one or more nucleotides and has a 5' phosphate group and further comprises a 5' label. The 5' phosphate group is required as a substrate for specific ligase enzymes.
- the present invention also provides a method of determining one or more selected nucleotide polymorphisms in genomic DNA comprising a'. performing an amplification of the genomic DNA using a first nucleic acid primer comprising a region complementary to a section of one strand of the nucleic acid that is 5' of the selected nucleotide, and a second nucleic acid primer complimentary to a section of the opposite strand of the nucleic acid downstream of the selected nucleotide, under conditions for specific amplification of the region of the selected nucleotide between the two primers, to form a PCR product;
- a" performing an amplification of the genomic DNA using as a primer an oligonucleotide comprising a first region having a T7 RNA polymerase promoter and a second region complementary to a section of one strand of the nucleic acid that is directly 5' of the selected nucleotide, and using T7 RNA polymerase to amplify one strand into cRNA and using reverse transcriptase to amplify the second strand complementary to the cRNA strand, under conditions for specific amplification of the region of the nucleotide between the two primers, to form a cRNA amplification product; or a'". treating genomic DNA to decrease viscosity; and b.
- each target oligonucleotide comprises a first specific complementarity region and a second specific complementarity region, wherein the second complementarity region of each target oligonucleotide is 5' of the first complementarity region, and wherein the first complementarity region of each target oligonucleotide comprises a sequence that is complementary to a section of the target nucleic acid directly 5' of the selected nucleotide and that terminates at its 3' end in an identified test nucleotide positioned to base-pair with a selected nucleotide of the PCR products, cRNA amplification products, or treated genomic DNA, under hybridization conditions, to form first hybridization products; c.
- each capture oligonucleotide comprises a nucleic acid sequence complementary to a second complementarity region of a specific target oligonucleotide and wherein the detectable tag is specific for each capture oligonucleotide; and e.
- the identification reaction can be a single base chain extension reaction, is an oligonucleotide ligation reaction, or an allelle-specific polymerization reaction, as described above. Also as described above, numerous opportunities for multiplexing can be exploited, including, for example, the method in which more than one capture oligonucleotide covalently coupled to the mobile solid support and wherein each second hybridization product can comprise one or more labels. Accordingly, the method can further comprise quantifying the labels and specific detectable tags in the second hybridization products, the quantity of the labels and specific detectable tags in the same second hybridization products indicating the relative occurrence of each selected nucleotide in the target nucleic acid.
- the present invention further provides a method of detecting results from a cleavase/signal release reaction to identify one or more selected nucleotides in a target nucleic acid comprising: a. contacting a sample comprising the target nucleic acid with (i) one or more signal probes, wherein each signal probe comprises a first complementarity region and a selected second complementarity region that is specific for a test nucleotide, wherein the second complementarity region is 5' of the first complementarity region and comprises a donor fluorophore, and wherein the first complementarity region comprises (a) a sequence that is complementary to a section of the target nucleic acid that is directly 5' of the selected nucleotide, (b) the test nucleotide at its 5' end that is positioned to base-pair with the selected nucleotide of the target nucleic acid, and (c) a quenching fluorophore that is located 3' to the identified test nucleotide and (ii
- each capture oligonucleotide comprises a nucleic acid sequence complementary to a specific second complementarity region of a specific signal probe and wherein the detectable tag is specific for each capture oligonucleotide; and d.
- the method can further comprise repetitions of steps (a) and (b) above to increase the level of detection product or products.
- each capture oligonucleotide can be coupled at either its 5' or 3' end to the mobile solid support.
- the method can further comprise quantifying the occurrence of specific detectable tags and donor fluorophores and the absence of quenching fluorophores in the same non-overlapping hybridization products indicating the relative occurrence of each selected nucleotide in the target nucleic acid.
- the method of detecting results from a cleavase/signal release reaction to identify one or more selected nucleotides in a target nucleic acid comprising the reaction in the opposite 3' to 5' directionality as follows: a. contacting a sample comprising the target nucleic acid with (i) one or more signal probes, wherein each signal probe comprises a first complementarity region and a selected second complementarity region that is specific for a test nucleotide, wherein the second complementarity region is 3' of the first complementarity region and comprises a donor fluorophore, and wherein the first complementarity region comprises (a) a sequence that is complementary to a section of the target nucleic acid that is directly 3' of the selected nucleotide, (b) the test nucleotide at its 3' end that is positioned to base-pair with the selected nucleotide of the target nucleic acid, and (c) a quenching fluorophore that is located 5' to the identified test nu
- each capture oligonucleotide comprises a nucleic acid sequence complementary to a specific second complementarity region of a specific signal probe and wherein the detectable tag is specific for each capture oligonucleotide; and d.
- the presence of the specific detectable tag and the donor fluorophore and the absence of the quenching fluorophore indicating the identity of the selected nucleotide in the target nucleic acid.
- the present invention provides a method of detecting results from a polymerase/repair reaction to identify selected nucleotides in a target nucleic acid comprising: a. contacting a sample comprising the target nucleic acid with (i) one or more signal probes, wherein each signal probe comprises a first complementarity region and a selected second complementarity region that is specific for a test nucleotide, wherein the second complementarity region is 3' of the first complementarity region, and wherein the first complementarity region comprises (a) a sequence that is complementary to a section of the target nucleic acid that is directly 5' of the selected nucleotide, (b) the identified test nucleotide at the 5' end of the signal probe, wherein the test nucleotide is positioned to base-pair with the selected nucleotide of the target nucleic acid, (c) a thiol site located 3' of the test nucleotide, (d) a donor fluorophore that
- a polymerase/repair reaction comprising contacting the first hybridization products with a Taq polymerase that cleaves the signal probes at the thiol site when the test nucleotide and the selected nucleotide are complementary and releases detection products comprising the second complementary region and the portion of the first complementary region of the signal probes that contain the donor fluorophore but lack the quenching fluorophore; c.
- each capture oligonucleotide comprises a nucleic acid sequence complementary to a specific second complementarity region of a specific signal probe and wherein the detectable tag is specific for each capture oligonucleotide; and d. detecting the presence of the donor fluorophore, the absence of the quenching fluorophore, and the presence of the specific detectable tags of the mobile solid support in the same second hybridization products,
- the method can further comprise repetitions of steps (a) and (b) above to increase the amount of detection product.
- the method can also further comprise quantifying the occurrence of specific detectable tags and donor fluorophores and the absence of quenching fluorophores in the same non-overlapping hybridization products indicating the relative occurrence of each selected nucleotide in the target nucleic acid.
- the present invention also provides a method of detecting one or more selected microbial contaminants in a sample comprising: a. contacting the sample with one or more target oligonucleotides, wherein each target oligonucleotide comprises a first complementarity region and a second complementarity region, wherein the first complementarity region comprises a region complementary to a section of a nucleic acid that is specific to a selected microbial contaminant and wherein the second complementarity region comprises a region complementary to a specific labeled reporter probe, under hybridization conditions that allow the formation of hybridization products between the first complementarity region of the target oligonucleotides and a region of the microbial nucleic acid complementary to the first complementarity region of the target oligonucleotide, to form first hybridization products; b.
- each detection product comprises the second complementary of a specific target oligonucleotide and a label; c. isolating the detection products by contacting the detection products with specific capture oligonucleotides that are covalently coupled directly or indirectly to specific detectably tagged mobile solid supports, wherein each capture oligonucleotide comprises a nucleic acid sequence complementary to a second complementarity region of a specific target oligonucleotide and wherein the detectable tag is specific for each capture oligonucleotide; and d.
- the selected microbial contaminants can include, but are not limited to, S. aureus, B. cepacia, E. coli, and Pseudomonas.
- the contaminants can be identified in the same sample using the multiplexing techniques described above.
- the identification reaction can be oligonucleotide ligation reaction, single base chain extension, allelle-specific polymerization reaction, a cleavase/signal release reaction, or a polymerase/repair reaction as described in detail above. It is further understood that the microbial DNA can be amplified, for example, by PCR, prior to the identification reaction.
- the samples that can be tested for microbial contaminants include but are not limited to food samples, drug/pharmacological samples, blood samples, urine samples, and various reagents for use in food and drug preparation. To detect S.
- the method can be practiced using the first complementarity region complementary to a section of a nucleic acid that is specific to S aureus having the nucleic acid sequence GCCGGTGGAGTAACCTTTTAG (SEQ ID NO:60) or GCCGGTGGAGTAACCTTTTAGG (SEQ ID NO:61).
- the method can be practiced using the first complementarity region complementary to a section of a nucleic acid that is specific to B. cepacia having the nucleic acid sequence CTGAGAGGCGGGAGTGCT (SEQ ID NO:62) or CTGAGAGGCGGGAGTGCTC (SEQ ID NO:63).
- the method can be practiced , wherein the first complementarity region complementary to a section of a nucleic acid that is specific to E. coli or Pseudomonas has the nucleic acid sequence AATACCGCATA (SEQ ID NO:64) or AATACCGCATA C/A (SEQ ID NO:65).
- the method can be practiced, wherein the first complementarity region complementary to a section of a nucleic acid that is specific to Pseudomonas or B. cepacia has the nucleic acid sequence of AATACCGCATACG (SEQ ID NO: 66) or AATACCGCATACG T/A (SEQ ID NO:67).
- EP 754240 (based on WO 9521271) (Molecular Tool Inc.)
- EP 736107 (based on WO 9517524) (Molecular Tool
- EP 576558 (based on WO 9215712) (Molecular Tool
- an oligonucleotide ligation assay (OLA) and flow cytometric analysis of fluorescent microspheres was used by adding a fluoresceinated oligonucleotide reporter probe (or reporter sequence) a target oligonucleotide by OLA.
- the target oligonucleotides were designed to hybridize both to genomic 'targets' amplified by polymerase chain reaction and to a separate complementary DNA sequence that has been coupled to a microsphere. These sequences on the target oligonucleotides that hybridize to a sequence coupled to the microsphere are called 'ZipCodes'.
- the OLA- modified target oligonucleotides are hybridized to ZipCode complement-coupled microspheres.
- the use of microspheres with different ratios of red and orange fluorescence makes a multiplexed format possible where many SNPs may be analyzed in a single tube.
- Flow cytometric analysis of the microspheres simultaneously identifies both the microsphere type and the fluorescent green signal associated with the SNP genotypying.
- Multiplexed genotyping of seven CEPH DNA samples for nine SNP markers located near the ApoElocus on chromosome 19 was performed, and the results were verified with genotyping by sequencing in all cases.
- a set of fluorescent latex microspheres, individually identifiable by their red and orange fluorescence and a green fluorochrome were used.
- microspheres with different ratios of red and orange fluorescence made a multiplexed format possible. Many SNPs were analyzed in a single tube. Flow cytometric analysis of the microspheres simultaneously identified both the microsphere type and the fluorescent green signal associated with the SNP genotype.
- Polystyrene microspheres (5.5 ⁇ m in diameter) with a carboxylated surface and different ratios of red and orange fluorescence were purchased from the Luminex Corp. (Austin, TX). All oligonucleotides used for covalent coupling to carboxylated microspheres were synthesized with a 5' amine group, a C15 or C18 spacer, and 45 nucleotides (Oligos Etc, Bethel, ME or PE Biosystems, Foster City, CA).
- the 20 nucleotides nearest the 5' end comprised a common sequence derived from luciferase cDNA (5'-CAG GCC AAG TAA CTT CTT CG-3 * ) (SEQ ID NO: 59) and were used to determine coupling efficiency to the microspheres by hybridization to a complementary fluoresceinated luciferase probe.
- the 25 nucleotide cZipCode at the 3' end were sequences derived from the Mycobacterium tuberculosis genome. This genome was chosen because it was a bacterial genome that had a high GC content. The selected sequences have GC-contents between 56 and 72% and predicted T m values of 61 to 68°C.
- Reporter oligonucleotides were designed with a 5' phosphate group and either a 3' fluorescein or 3' biotin modification (Oligos Etc, Bethel, ME or Biosource/Keystone, Camarillo, CA). Reporter probe T m ranged from 36-40°C except for the 8-base reporters which were 18-24°C.
- Target oligonucleotides had a 25 nucleotide ZipCode sequence at the 5' end (see Table 1) and an allele-specific sequence at the 3' end. Allele-specific sequences were designed to possess a T m of 51-56'C.
- Target nucleic acids 150-462 bp in length, were amplified from 10 to 20 nanograms of genomic DNA (CEPH DNA was obtained from Coriell Cell Repositories, Camden, NJ) using 1.5 units of AmpliTaq Gold (Applied Biosystems, Foster City, CA), 400 ⁇ M dNTPs, 200 ⁇ M forward PCR primer and 200 ⁇ M reverse PCR primer in IX PCR buffer I (Applied Biosystems, Foster City, CA) .
- 30 ⁇ l reactions were carried out in PE Biosystems 9700 thermocyclers for 10 minutes at 95 °C, followed by 40 three-temperature amplification cycles holding at 94°C, 60°C and 72°C for 30 seconds each and ending with an additional 5 minute extension at 72°C. Samples were held at 4°C following the reaction.
- the reaction was occasionally mixed and sonicated during the 60-min room temperature incubation to keep the microspheres unclumped and in suspension.
- the microspheres were washed in 1 ml phosphate buffered saline containing 0.02% Tween 20 (Sigma, St. Louis, MO) and then in 150 ⁇ llO mM tris [hydroxymethyll aminomethane hydrochloride / 1 mM ethylenediamine-tetraacetic acid pH 8.0 (TE).
- TE ethylenediamine-tetraacetic acid pH 8.0
- hybridizations were performed using 10,000 coupled microspheres and 3 picomoles of fluoresceinated oligo complementary to the 20 nucleotides of luciferase sequence on the 5'end of each cZipCode oligo. Hybridization was conducted in 3.3X SSC for 30 minutes at 45 °C following a 2 minute 96°C denaturation. Microspheres were washed with 200 ⁇ l 2X SSC containing 0.02% Tween 20, resuspended in 300 ⁇ l 2X SSC containing 0.02% Tween 20 and analyzed by flow cytometry.
- a set of 58 target oligonucleotides was designed and synthesized. Each oligo possessed a common allele-specific 3' portion, but each contained its own unique 5' ZipCode sequence. Each taget oligonucleotide was used separately in the standard OLA reaction to assay the common genomic target nucleic acid. The resulting set of 58 fluorescently-labeled OLA products were then used individually in the standard hybridization reaction in the presence of 58 microsphere types, each bearing a different complementary ZipCode. After flow cytometric analysis, ZipCodes which hybridized to multiple types of microspheres were discarded. Replacement ZipCodes were designed, new capture probes were synthesized and the modified set of 58 probes were retested.
- the number of oligonucleotides coupled to the microsphere was estimated by converting the mean fluorescence intensity to MESF values. Average cZipCode couplings varied from 100,000 to about 1,000,000 MESF per microsphere. Only microspheres that had average couplings >100,000 MESF per microsphere were used. ZipCodes were validated for specificity of hybridization by incubating a fluoresceinated oligonucleotide (with a given ZipCode sequence) with a multiplexed set of 58 cZipCode-coupled microspheres (only one microsphere type out of the set of 58 contained a perfectly complementary sequence).
- Target nucleic acids double-stranded PCR products, 150-450 base pairs in length
- Target oligonucleotides were used at 3-20 ng. Acceptable green fluorescent signals were observed throughout this concentration range.
- Target oligonucleotides were used at 10 nM and the target oligonucleotide reporter ratio was 1:50.
- Reactions were carried out in 10 ⁇ l ligase buffer which included the following: 0.1 pmoles target oligonucleotide, 5 picomoles reporter oligonucleotide, 3-20 ng dsDNA target nucleic acid (as determined by Picogreen TM staining, Molecular Probes, Eugene, OR), and 10 U Taq DNA ligase.
- Incubations were carried out in PE Biosystems 9700 thermocyclers by heating to 96°C for 2 minutes, followed by 30 cycles of a two-step reaction (denaturation at 94°C for 15 seconds followed by ligation at 35-37°C for 1 minute). Samples were held at 4°C when the cycles were complete. If the 3' base on the target oligonucleotide is complementary to the target SNP; the fluoresceinated reporter will be ligated to the capture probe.
- Taq DNA ligase was used at 10 units per 10 ⁇ l ligation reaction because, at high concentrations of the enzyme (20 to 80 units ligase per 10 ⁇ l reaction volume), the rate of misligation (signal from a capture probe with a mismatched terminal 3' base) was increased 2 to 7-fold.
- Hybridization of Target Oligonucleotide/Reporter Probes to Microspheres after OLA Hybridization of target oligonucleotide/reporter molecules to cZipCode- coupled microspheres was conducted using high salt (750 mM NaCI), small incubation volumes (10-13 ⁇ l), and a minimum of 2 hours incubation.
- cZipCode- coupled microspheres (5,000 to 10,000 of each microsphere type) were added to each ligation reaction.
- the salt concentration was adjusted to 750 mM NaCI by adding a small volume of 5 M NaCI.
- the mixture was heated to 96°C for 2 minutes in a PE Biosystems 9700 thermocycler and then incubated at 45°C from 2 hours to overnight.
- Microspheres were washed with 200 ⁇ l 2X SSC containing 0.02%) Tween 20. When biotinylated reporter probes were used, 5-0 ⁇ l of avidin-FITC (Becton Dickinson, San Jose, CA) were added to washed, hybridized microspheres resuspended in 30 ⁇ l 2X SSC /0.02% Tween 20. The microspheres were incubated for 15 minutes at room temperature and then washed. All microsphere suspensions were resuspended in 300 ⁇ l 2X SSC containing 0.02% Tween 20 just prior to flow cytometric analysis.
- avidin-FITC Becton Dickinson, San Jose, CA
- the target oligonucleotides were each hybridized to a specific fluorescent microsphere through the 25-base cZipCode sequence chemically coupled to the microsphere.
- a potential source of background fluorescence was the formation of 'sandwich' complexes, non-ligated, ZipCode-hybridized, target oligonucleotide-target nucleic acid-reporter complexes.
- the background fluorescence contributed by sandwich formation was determined in the absence of ligase. Incubating the microsphere suspension at 45°C for a minimum of 15 minutes just prior to flow cytometric analysis minimized this background fluorescence (presumably by loss of the short non-ligated reporter molecule from the complex without disturbing the ZipCode hybridization).
- Conversion of raw data from mean fluorescence intensity to MESF offers several advantages. These advantages include the use of a standard fluorescence unit, the ability to compare data between experiments, the ability to compare data between instruments, and normalization of signal variability in an instrument over time (due to laser power shifts or PMT decline).
- the OLA reaction was performed with very short reporter oligonucleotides to explore the feasibility of synthesizing a set of all possible reporter sequences that would be needed to analyze SNPs in a high throughput mode.
- An 8-base sequence that contained either 0 or 2 degenerate sites was used in one set of experiments to minimize the cost of a multiplexing reaction.
- a short 8-base oligonucleotide (5'- CTAAGTTA-3') that constituted a 6+2 mer (an 8-base sequence containing 6 defined and 2 degenerate positions) was designed for SNP and used in the standard OLA reaction.
- the 8-base reporter probe successfully identified the GG homozygous target DNA.
- the signal intensity from the 8-base reporter was 65% of that observed with an 18-base reporter.
- Two 6 + 2 degenerate reporter oligonucleotides were tested; each contained two degenerate sites, one at positions 3 and 6 and the other at positions 4 and 5 .
- the degenerate reporters were used at 16-fold higher concentrations than the non-degenerate sequence. Both degenerate oligonucleotides correctly identified the SNP genotype of the target DNA.
- FIG 2 shows the multiplexed genotyping results from 7 DNA samples for 9 SNPs located near the Apo E locus on chromosome 19 by OLA with a flow cytometric readout.
- the genomic DNA samples were made available through The Centre d'Etude du Polymorphisme Humain (CEPH) reference panel (http:Hwww.cephb.fr/).
- CEPH Centre d'Etude du Polymorphisme Humain
- each OLA reaction included a pooled mixture of nine target oligonucleotides and reporter probes plus the nine target DNA samples.
- the different alleles for a given locus were tested in two separate reaction volumes.
- Each reacted mixture was hybridized to nine microsphere sets in a single step.
- the 18 possible genotypic analyses for a given individual were therefore conducted in two wells (tubes).
- ZipCodes 1, 2, 4, 5, 10, 14, 44, 46,and 49 (Table 1) were used for SNPs 457, 458, 460, 461, 466, 468, 505, 507, and 511, respectively. Biotinylated reporters and avidin-FITC were used in this experiment. Table 2 shows zip codes, target oligonucleotide sequences, reporter sequences, and PCR primers used in this experiment.
- Example 2 A Microsphere-Based Assay for Single Nucleotide Polymorphism Analysis Using Single Base Chain Extension
- SNP single nucleotide polymorphism
- cZipCodes complementary ZipCodes
- querying a polymorphic base involves extending an oligonucleotide containing both a ZipCode and an SNP-specific sequence with a DNA polymerase and a pair of fluoresceinated dideoxynucleotides.
- the ZipCode portion of the oligonucleotide hybridizes with its complementary ZipCodes (cZipCodes) on the microsphere.
- cZipCodes complementary ZipCodes
- Flow cytometry is used for microsphere decoding and SNP typing by detecting the fluorescein label captured on the microspheres.
- the ZipCode system allows multiple sets of SNPs to be analyzed by a limited set of cZipCode attached microspheres. A standard set of noncross reactive ZipCodes was established experimentally as described above, and the accuracy of the system was validated by comparison with genotypes determined by other technologies.
- AmpliTaq, AmpliTaq Gold and AmpliTaq FS (catalog number: 361390) DNA polymerase were purchased from Perkin-Elmer
- Applied Biosystems Fluorescence labeled dideoxynucleotide triphosphates (ddNTPs) were obtained from NEN Life Science Products, Inc. (Boston, MA). Unlabeled ddNTPs were from Amersham Pharmacia (Cleveland, OH).
- oligonucleotides were purchased from Keystone Biosource (Camarillo, CA).
- CEPH DNAs (NA07435, NA07445, NA10848, NA10849, NA07038A, NA06987A and NA10846) are ordered from Coriell Cell Repositories (Camden, NJ).
- Oligonucleotides with 5' amino group were ordered from Oligo Etc. (Wilsonville, OR) or from Perkin-Elmer Applied Biosystems. 2-[N-Morpholino]ethanesulfonic acid (MES) and l-Ethyl-3-(3-
- Dimethylaminopropyl)carbodiimide Hydrochloride were purchased from Sigma (St. Louis, IL) and Pierce (Rockford, IL), respectively.
- DNA polymerase was cloned from Thermatoga neapolitana (Tne) (see U.S. Pat Nos. 5,912,155; 5,939,301; and 5,948,614, which are incorporated herein by reference) and expressed in Escherichia coli (E. coli).
- the Klenow fragment (TneK) lacking the 5' to 3' exonuclease was used for SBCE reactions under the same assay conditions for AmpliTaq.
- Tne, TneK and TneK FS and their performance in SBCE will be submitted elsewhere.
- Carboxylated fluorescent polystyrene microspheres were purchased from the Luminex Corp. (Austin, TX).
- capture oligonucleotides with a 5' amino group were coupled to the carboxyl group on the surface of the microspheres.
- a carbon spacer (C15-18) was synthesized adjacent to the 5' amino group to reduce the potential interference of the oligonucleotide hybridization by the microspheres and the luciferase sequence described above was used to monitor the coupling efficiency of the oligonucleotides to the microspheres.
- a 25-base complementary ZipCode sequence (named cZipCode, see Table 1) was arbitrarily selected from the Mycobacterium tuberculosis genome and validated experimentally (as above).
- PCR reactions were performed in a 96-well plate on a GeneAmp 3700 thermal cycler (Perkin-Elmer).
- a typical 30 ⁇ l reaction mixture contained 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 mM M g Cl 2 , 0.1 mM dNTPs, 0.2 ⁇ M of each primer, AmpliTaq Gold DNA polymerase (1.5 units) and 20 ng genomic DNA.
- the reaction mixture was held at 95°C for 10 min to activate the DNA polymerase and the amplification was carried out for 9 cycles at 94°C for 10 sec, 61°C for 45 sec and 72°C for 90 sec, 9 cycles at 94°C for 10 sec, 56°C for 45 sec and 72°C for 90 sec and another 25 cycles at 94°C for 10 sec, 61°C for 45 sec and 72°C for 90 sec. After another 5 -min extension at 72°C, the reaction mixture was held at 4°C.
- a SBCE reaction mixture was added to a total volume of 10 ⁇ l .
- the mixture consists of 80 mM Tris- HCl (pH 9.0), 2 mM MgCl 2 , 100 nM of target oligonucleotide, 3 units of AmpliTaq FS (Perkin-Elmer), 10 ⁇ M of each allele specific FITC-labeled ddNTP and 30 ⁇ M of unlabeled other three dNTPs.
- the reaction mixture was incubated at 96°C for 2 min followed by 30 cycles of 94°C 30 sec, 55°C for 30 see and 72°C for 30 sec. Reactions were held at 4°C prior to the addition of microspheres.
- thermostable DNA polymerases were evaluated under thermo-cycling conditions for efficacy of fluorescein (FITC) labeled ddNTP incorporation.
- FITC fluorescein
- SNP 18 T/C polymorphism
- SNP 18 sense and anti-sense capture oligonucleotides for T, C, A and G incorporation, respectively. Allele specific incorporation of the correct base was tested using two homozygous (CC and TT) and a heterozygous (CT) PCR fragments generated from genomic DNA samples.
- AmpliTaq FS generated the highest signals and a ratio between positive signals and non-specific incorporation (noise) of greater than 100-fold for both ddATP-FITC and ddGTP-FITC incorporation across the three genotypic possibilities.
- AmpliTaq, KlenTaq and TneK produced much weaker signals and a significantly reduced signal-noise ratio. Similar results were obtained for the incorporation of T and C bases by both AmpliTaq FS and the other DNA polymerases tested. These data clearly demonstrate that a microsphere-based SBCE assay system works well and that AmpliTaq FS is an appropriate choice for incorporating fluorescein-labeled ddNTPs under the conditions used. AmpliTaq FS, an F667Y version of Taq Pol 1, does not discriminate between deoxy- and dideoxynucleotides.
- each of the allele specific extension products was captured by its corresponding microspheres containing the cZipCode complementary sequence.
- a pool of different microspheres was treated with bovine serum albumin (BSA) at 1 mg/ ml for 30-60 min at 37°C and then concentrated by centrifugation at 3000g for 5 min.
- BSA bovine serum albumin
- Approximately 1200 of each fluorescent microsphere were added to the 10 ⁇ l SBCE reaction mixture for a final volume of 15 ⁇ l.
- the concentrations of NaCI and EDTA were adjusted to 1 M and 20 mM respectively.
- the mixture was incubated at 40°C for 2 h or more.
- Microspheres were washed by the addition of 200 ⁇ lof 2x SSC (lx SSC is 8.77 g of NaCI plus 4.41 g of sodium citrate per liter (pH 7.0))-0.02% Tween 20 at room temperature (RT). After centrifugation at 1100 xg for 6 min, the pelleted microspheres were resuspended in 250 ⁇ l 2x SSCO.02% Tween 20 for flow cytomertry analysis.
- lx SSC is 8.77 g of NaCI plus 4.41 g of sodium citrate per liter (pH 7.0)
- Tween 20 room temperature
- Microsphere fluorescence was measured using a FACSCalibur flow cytometer (Becton Dickinson) equipped with Luminex Lab MAP hardware and software (Luminex Corp, Austin, TX) as described above.
- a primary advantage of the LumineXTM fluorescent microsphere technology is the capacity for conducting multiple biological reactions simultaneously in a single reaction vessel (ie. well).
- each fluorescent microsphere becomes the address for a single SNP.
- Each SNP then simply requires an assigned ZipCode encoded in the capture oligonucleotide to permit multiplexing.
- four polymorphisms with T to C changes were assayed in multiplex reactions. PCR products generated from either homozygous (CC or TT) or heterozygous (CT) genomic DNAs were pooled separately and four capture oligonucleotides were mixed as primers in SBCE reactions.
- a titration curve of AmpliTaq FS for SNP 18 in a multiplex reaction of four SNPs was generated.
- a homozygous mixture of PCR products (CC) of the four SNPs was used as template and was assayed for alleles A and G with the anti-sense capture oligonucleotide.
- the specific signal of the G reaction was very high and the A reaction remained low. Similar results were obtained for the other three SNPs. There was no significant increase of signal between 0.5 to 8 units of the DNA polymerase used.
- the signal strengths of SNP 18 at various concentrations of ddNTP -FITC was analyzed. The reactions were performed in the presence of three other SNPs, and the results for the four SNPs were nearly identical. PCR product amplified from homozygous (CC) DNA sample was used as template and the anti-sense capture oligonucleotide was used as primer. Specific incorporation of ddGTP-FITC was found to generate strong signal while the signal for the A reaction was near the background level. Signals were found to remain constant as the concentration of FITC-ddNTP was reduced from 10 ⁇ M to I ⁇ M. A near linear increase of specific signal (G reaction) was observed when the ddNTP was at a much lower concentration (from 20 to 750 nM) in the SBCE reaction.
- a key component of the microsphere-based SBCE system is the target oligonucleotide, which is used both as the primer for the base incorporation and as the anchor for the resultant SBCE products to be hybridized to the appropriate microsphere.
- concentrations of the target oligonucleotide were analyzed under the standard conditions. No significant difference was observed between 10 to 100 nM. The signals were found to be significantly reduced when the target oligonucleotide concentration increased to 125 nM.
- PCR product amplified from homozygous (CC) genomic DNA was used and assayed for either the specific incorporation of a C nucleotide or the non-specific incorporation of a T nucleotide. While the non-specific T incorporation remained near zero, the signal from the C reaction was found to increase with increasing quantity of PCR product (up to 40 ng). The specific signals were proportional to the amount of PCR products used, up to 2.5 ng. The correct genotypes were generated in the presence of as little as 0.5 ng of PCR product, where the MESF values for the C and T reactions were 4400 and 200 respectively. Thus the assay system is fairly sensitive and can tolerate up to an 80-fold variation of template material.
- APOE4 allelic variant of the apolipoprotein
- APOE4 is a significant susceptibility allele or risk factor for younger age of onset of Alzheimer disease.
- SNPs Over a hundred SNPs have been developed around the APOE gene for association studies (Lai, E., Riley, J., Purvis, I. & Roses, A. A 4-MB high-density single nucleotide polymorphism-based map around human APOE. Genomics 54, 31- 38 (1998)). These SNPs were identified by DNA sequencing of amplicons from the seven CEPH DNAs and therefore, nearly all of the genotypes for those SNPs are available (Id.). A total of 58 SNPs were randomly selected from this set and SBCE assays were developed. Each of the SNPs utilized a unique ZipCode sequence (Table
- the genotype can be easily read as GG, AG, GG, AG, GG, AG. Because of the dramatic difference between the signal and noise, all of the remaining 77 genotypes could be easily determined as well.
- the 12 SNPs represent several different types of base substitutions (AG, AT, CG, CT and GT). All of the five examined can be analyzed in a simple multiplex reaction by assaying the four bases.
- a total of 180 genotypes determined by SBCE from 54 SNPs (21 SNPs assayed in 7 DNAs and 33 SNPs in one DNA) were compared to their known genotypes as determined by either DNA sequencing or TaqMan analysis. All of the 180 genotypes generated from our assays were proven to be correct.
- PCR products from 12 SNPs were analyzed using DNA from seven CEPH DNAs.
- the A, C, G and T assays were performed with 10 ng of PCR products for each SNP in a 12 ⁇ l reaction to accommodate the large volume of PCR products.
- the reagents were increased proportionally to what was described above.
- a mixture of 12 different microspheres was pre-treated with 1 mg / ml BSA for 45 min and hybridization was left overnight at 40°C before the flow cytometric analysis. The average MESF values of about 120 microspheres are shown.
- PCR products from 52 SNPs were pooled from a DNA sample that had been analyzed in our system. All of the 52 genotypes determined from this experiment were found to be the same as in the 12 SNP multiplex reactions. Therefore all of the 52 genotypes could be correctly determined in a single multiplex reaction.
- Example 3 A Microsphere-Based Assay for Single Nucleotide Polymorphism Using Minisequencing (Allelle-Specif ⁇ c Polymerization Reaction)
- the SBCE methods described above were modified to perform an allelle- specific polmerization reaction.
- a labeled chain terminating dideoxynucleotide instead of using a labeled chain terminating dideoxynucleotide, a labeled deoxynucleotide was used.
- the allelle-specific polymerization reaction was multiplexed by using more than one labeled deoxynucleotide. The results show that the genotype was properly predicted using allele-specific polymerization as the identification reaction in a single tube or multiple tube format.
- the procedure removes the proteins and cell debris that could potentially inhibit SBCE reaction.
- the following reagents were used: bacterial colonies on nutrient agar, sterile/ DNAse-free water, 5mg/mL lysozyme, 3.75mg/mL lysostaphin, TE buffer (lOmM Tris; ImM EDTA), 0.25M EDTA, IM DTT, 20mg/mL Proteinase K, 10% SDS, Perkin Elmer's PrepMan ⁇ Reagent.
- the cell suspension was then incubated for 45 minutes at 56C.
- the suspension was mixed gently by tapping and subsequently incubated for 1 hour at 37C.
- the PrepMan reagent was vortexed briefly to resuspend the contents, and 500uL of PrepMan reagent was added to the cell suspension.
- the suspension was incubate for 30 minutes at 56C, and then vortexed for 10 seconds.
- the cell suspension was then incubated in a boiling water bath for 8 minutes to lyse the cells.
- the lysed cell suspension was vortexed briefly and centrifuged in a microcentrifuge for 2 minutes at 11,000RPM to pellet the cell debris.
- the DNA was diluted 1 : 10 by adding lOOuL of the supernatant to 900uL sterile water, which can optionally be stored 4C for up to one week. Prior to the PCR reaction, the DNA is further diluted to make a 1 :250 dilution by adding lOOuL of the 1 :10 dilution to 2.5mL sterile water. Ten uL of this 1 :250 dilution will be used in the PCR reaction.
- This method describes the procedure for performing the polymerase chain reaction (PCR) to amplify the 16s region of bacteria genomes in preparation for the SBCE reaction.
- the following reagents were used: AmpliTaq Gold DNA polymerase, Perkin Elmer 10X PCR buffer lOmM dNTP mix (2.5mM each dNTP), PCR primers (27F- 5'- AgAgTTTgATCMTggCTCAg- 3' and 1525R- 5'-AAggAggTgWTCCARCC-3'), sterile/ DNAse-free water, 10X TBE buffer, agarose, Molecular Probes' SYBR green nucleic acid gel stain, gel loading dye, molecular weight marker.
- PCR Reaction Mixtures were prepared as follows: All reagents were thawed at room temperature then store in ice until use. AmpliTaq Gold was diluted 1 :5 in sterile water. Primer 27F and primer 1525R were diluted 1 : 10 in sterile water. A master mix was prepared using the specified volumes per PCR reaction (5.0uL PCR buffer, 4.0uL dNTP mixture, 2.0uL 1 : 5 diluted AmpliTaq Gold, 2.2uL 1:10 diluted primer 27F, 2.4uL 1:10 diluted primer 1525R, 24.4uL sterile/DNAse-free water).
- PCR Thermalcyling was performed using a GeneAmp 9600 thermalcycler: 1 cycle at 95C for 10 minutes; 35 cycles of 94C for 30 seconds, 56C for 45 seconds, and 72C for 90 seconds; 1 cycle of 72C for 5 minutes, and one cycle at 4C. The thermalcycler will n the method for approximately 3 hours.
- the PCR products were subsequently detected using gel electrophoresis.
- the agarose gel was prepared according to methods well known in the art. Ten uL of PCR product was combined with 2uL of gel loading dye, and lOuL of the sample were loaded into a well in the gel. Eight uL of the molecular weight marker was loaded into a separate well, and the gel was n under standard conditions. The gel was subsequently stained in approximately 50mL TBE buffer containing 8uL SYBR Green nucleic acid gel. The gel was then viewed in a UV light to ensure that the size of the PCR product was approximately 1500bp by comparing the band to the control bands in the molecular weight marker.
- the PCR reaction conditions were 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 mM MgCl 2 , 0.001% gelatin, 0.1 mM each of the four dNTPs, 1 unit AmpliTag GOLD DNA polymerase (Perkin- Elmer) and 50 pmol of each primer (27f/1525r or 66f/1392r (R. Ghozzi et al, 1999, J. Clinical Microbiology 37: 3374-3379)). in a total volume of 50 ⁇ l.
- Qiagen' s QiaQuick PCR Purification Kit containing Buffer PB, Buffer PE, QiaQuick columns, and 2mL collection tubes.
- Five volumes of Buffer PB was mixed with 1 volume of PCR reaction mixture in a microcentrifuge tube.
- a QiaQuick spin column was placed in a 2mL collection tube and the entire sample was applied to the QiaQuick column.
- the column was centrifuged for 60 seconds at 11,000RPM. The flow-through was discarded, and the column was placed in the same 2mL tube.
- 0.75mL Buffer PE was added to the column. The column was centrifuged for 60 seconds at 11 ,000RPM.
- the flow-through was again discarded, and the column placed in the same 2mL tube.
- the column was then centrifuged for 60 seconds at 11,000RPM to remove any residual ethanol.
- the flow- through was once again discarded.
- the column was then placed in a clean micrcentrifuge tube.
- the DNA was then quantified using absorbance spectroscopy using a Milton Roy Spectronic 1201.
- Luminex Bead Protocol The following reagents were used in the single base chain extension/bead protocol: shrimp alkaline phosphatase (SAP), Exonuclease I, 5uM probe+zipcode, 5X SBCE buffer, AmpliTaq FS, lOuM ddNTPs, lOuM R6G-ddNTPs, 250nM control oligonucleotides, 5M NaCI, 130mM EDTA, and 22 separate bead sets (1000 of each) (O.luL of lOK/uL).
- SAP shrimp alkaline phosphatase
- Exonuclease I 5uM probe+zipcode
- 5X SBCE buffer 5X SBCE buffer
- AmpliTaq FS AmpliTaq FS
- lOuM ddNTPs lOuM R6G-ddNTPs
- 250nM control oligonucleotides 5M NaCI, 130
- a master mix for the SBCE reaction was prepared with the following reagents: 0.1 ul 5uM Probe/ZipCode, 4.0 ul 5X Buffer, 0.2 ul AmpliTaq FS, 2.0 ul lOuM each cold ddNTP, 2.0 ul lOuM R6G ddNTP, 1.0 ul 250 nM control oligonucleotide, 0.7 water.
- Ten uL of the master mix were added to lOuL of the clean DNA template.
- PCR product 2 ul was transferred to another plate and lOul of the following SBCE reaction mixture was added: 25 nM 5uM probe/ZipCode mix, IX Amplitaq Buffer, 2.8 units/reaction of Amplitaq FS (12u/ul), approximately 10 ng/reaction of PCR product, 3uM cold ddNTP, 1 uM labeled ddNTP (e.g., lOuM R6G-ddATP, -ddCTP, -ddGTP, or -ddUTP).
- the plate was then placed in the thermalcycler and the SBCE reaction was mn under the following conditions: 1 cycle of 96C for 2 minutes; 30 cycles of 94C for 30 seconds, 55C for 30 seconds, 72C for 30 seconds; and 1 cycles at 4C to hold.
- wash solution IX SSC, 0.02% Tween
- the fluorescence of the beads and label were analyzed using the LX100 plate reader and Luminex software. One hundred events/bead as a standard number of events were counted using about 40ul of sample and a flow setting of 60ul/minute.
- SEQ ID NO 1 GATGATCGACGAGACACTCTCGCCA 35 ACGACTGCGAGGTGCGGTAAGCACA SEQ ID NO 30
- SEQ ID NO 6 6 CACCGCCAGCTCGGCTTCGAGTTCG 40 CCCCGGATAGCTGACGAGGCTTACG SEQ ID NO 35
- SEQ ID NO 7 7 CGACTCCCTGTTTGTGATGGACCAC 41 TCCGGACAGGTTGGGGTGCGTTTGG SEQ ID NO 36
- SEQ ID NO 12 CTCGGTGGTGCTGACGGTGCAATCC 49 GCGATAGCCAGTGCCGCCAATCGTC SEQ ID NO 41
- Each reporter sequence has a 5' P0 4 and 3' biotin.
- ⁇ ach of these forward sequence primers has a 5' sequence: 5'-tgtaaaacgacggccagt-3'.
- Each of these reverse sequence primers has a 5' sequence: 5'caggaaacagctatgacc-3'.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU24500/01A AU2450001A (en) | 1999-12-28 | 2000-12-21 | Detection of single nucleotide polymorphisms |
CA002396010A CA2396010A1 (en) | 1999-12-28 | 2000-12-21 | Detection of single nucleotide polymorphisms |
EP00988273A EP1272662A2 (en) | 1999-12-28 | 2000-12-21 | Detection of single nucleotide polymorphisms |
JP2001548756A JP2003522527A (en) | 1999-12-28 | 2000-12-21 | Single nucleotide polymorphism detection |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US17326899P | 1999-12-28 | 1999-12-28 | |
US60/173,268 | 1999-12-28 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001048244A2 true WO2001048244A2 (en) | 2001-07-05 |
WO2001048244A3 WO2001048244A3 (en) | 2002-11-14 |
Family
ID=22631246
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/034935 WO2001048244A2 (en) | 1999-12-28 | 2000-12-21 | Detection of single nucleotide polymorphisms |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1272662A2 (en) |
JP (1) | JP2003522527A (en) |
AU (1) | AU2450001A (en) |
CA (1) | CA2396010A1 (en) |
WO (1) | WO2001048244A2 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001098527A2 (en) * | 2000-06-19 | 2001-12-27 | Epigenomics Ag | Method for the high-parallel analysis of polymorphisms |
WO2003102228A1 (en) * | 2002-06-04 | 2003-12-11 | The Walter And Eliza Hall Institute Of Medical Research | A nucleic acid anchoring system comprising covalent linkage of an oligonucleotide to a solid support |
EP1400601A1 (en) * | 2002-09-20 | 2004-03-24 | Bayer Healthcare LLC | Method for detection of multiple nucleic acid sequence variations |
WO2005069969A2 (en) | 2004-01-21 | 2005-08-04 | University Of Utah Research Foundation | Mutant sodium channel nav1.7 and methods related thereto |
EP3189159A4 (en) * | 2014-06-26 | 2018-05-30 | University of Florida Research Foundation, Inc. | Rapid detection of infectious agents |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP4769041B2 (en) * | 2004-07-28 | 2011-09-07 | 株式会社ビー・エム・エル | Mycobacterial bacteria identification kit |
JP5519964B2 (en) * | 2008-06-30 | 2014-06-11 | ユニバーサル・バイオ・リサーチ株式会社 | Substrates for gene analysis |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993025563A1 (en) * | 1992-06-17 | 1993-12-23 | City Of Hope | A method of detecting and discriminating between nucleic acid sequences |
WO1997022719A1 (en) * | 1995-12-18 | 1997-06-26 | Washington University | Method for nucleic acid analysis using fluorescence resonance energy transfer |
-
2000
- 2000-12-21 AU AU24500/01A patent/AU2450001A/en not_active Abandoned
- 2000-12-21 CA CA002396010A patent/CA2396010A1/en not_active Abandoned
- 2000-12-21 WO PCT/US2000/034935 patent/WO2001048244A2/en not_active Application Discontinuation
- 2000-12-21 JP JP2001548756A patent/JP2003522527A/en active Pending
- 2000-12-21 EP EP00988273A patent/EP1272662A2/en not_active Withdrawn
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993025563A1 (en) * | 1992-06-17 | 1993-12-23 | City Of Hope | A method of detecting and discriminating between nucleic acid sequences |
WO1997022719A1 (en) * | 1995-12-18 | 1997-06-26 | Washington University | Method for nucleic acid analysis using fluorescence resonance energy transfer |
Non-Patent Citations (4)
Title |
---|
CAI ET AL.: "Flow cytometry-based DNA hybridization and polymorphism analysis" PROC SPIE-INT SOC OPT ENG (ADVANCES IN OPTICAL BIOPHYSICS), vol. 3256, 1998, pages 171-177, XP001064684 * |
DATABASE EMBL [Online] 11 June 1998 (1998-06-11) PARKHILL J.: "Mycobacterium tuberculosis H37Rv complete genome; segment 84/162" Database accession no. Z83859 XP002207118 & COLE ET AL.: "Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence" NATURE, vol. 393, 1998, pages 537-544, XP002144873 * |
FULTON R JERROLD ET AL: "Advanced multiplexed analysis with the FlowMetrix system." CLINICAL CHEMISTRY, vol. 43, no. 9, 1997, pages 1749-1756, XP002142645 ISSN: 0009-9147 * |
SHOEMAKER D D ET AL: "QUANTITATIVE PHENOTYPIC ANALYSIS OF YEAST DELETION MUTANTS USING A HIGHLY PARALLEL MOLECULAR BAR-CODING STRATEGY" NATURE GENETICS, NEW YORK, NY, US, vol. 14, no. 4, 1 December 1996 (1996-12-01), pages 450-456, XP002043431 ISSN: 1061-4036 * |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001098527A2 (en) * | 2000-06-19 | 2001-12-27 | Epigenomics Ag | Method for the high-parallel analysis of polymorphisms |
WO2001098527A3 (en) * | 2000-06-19 | 2002-06-27 | Epigenomics Ag | Method for the high-parallel analysis of polymorphisms |
US7741459B2 (en) | 2002-04-06 | 2010-06-22 | Genera Biosystems Limited | Nucleic acid anchoring system comprising covalent linkage of an oligonucleotide to a solid support |
WO2003102228A1 (en) * | 2002-06-04 | 2003-12-11 | The Walter And Eliza Hall Institute Of Medical Research | A nucleic acid anchoring system comprising covalent linkage of an oligonucleotide to a solid support |
US8034911B2 (en) | 2002-06-04 | 2011-10-11 | Genera Biosystems Limited | Nucleic acid anchoring system comprising covalent linkage of an oligonucleotide to a solid support |
EP1400601A1 (en) * | 2002-09-20 | 2004-03-24 | Bayer Healthcare LLC | Method for detection of multiple nucleic acid sequence variations |
WO2005069969A2 (en) | 2004-01-21 | 2005-08-04 | University Of Utah Research Foundation | Mutant sodium channel nav1.7 and methods related thereto |
EP3189159A4 (en) * | 2014-06-26 | 2018-05-30 | University of Florida Research Foundation, Inc. | Rapid detection of infectious agents |
US10640833B2 (en) | 2014-06-26 | 2020-05-05 | University Of Florida Research Foundation, Inc. | Rapid detection of infectious agents |
Also Published As
Publication number | Publication date |
---|---|
CA2396010A1 (en) | 2001-07-05 |
EP1272662A2 (en) | 2003-01-08 |
AU2450001A (en) | 2001-07-09 |
WO2001048244A3 (en) | 2002-11-14 |
JP2003522527A (en) | 2003-07-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP5957039B2 (en) | Methods and compositions for whole genome amplification and genotyping | |
US5849483A (en) | High throughput screening method for sequences or genetic alterations in nucleic acids | |
US6004744A (en) | Method for determining nucleotide identity through extension of immobilized primer | |
JP4216333B2 (en) | Nucleic acid detection and amplification by chemical bonding of oligonucleotides | |
JP4828069B2 (en) | Detection of polymorphism based on amplification | |
EP1668148B1 (en) | Nucleic acid detection assay | |
EP1090138A1 (en) | Nucleotide detection method | |
US7262032B2 (en) | Allele-specific mutation detection assay using an enzyme-disabling agent | |
US20040146866A1 (en) | Quantitative multiplex detection of nucleic acids | |
US20020098484A1 (en) | Method of analyzing single nucleotide polymorphisms using melting curve and restriction endonuclease digestion | |
WO2001042498A1 (en) | Method of detecting nucleotide polymorphism | |
AU2008217678A1 (en) | Method and test kit for determining the amounts of target sequences and nucleotide variations therein | |
US20030104372A1 (en) | Allele specific primer extension | |
US7189512B2 (en) | Methods for variation detection | |
US20020187470A1 (en) | Detection of single nucleotide polymorphisms | |
US20090148849A1 (en) | One-step target detection assay | |
US20050003355A1 (en) | Single nucleotide polymorphism analysis using surface invasive cleavage reactions | |
JP2004535769A (en) | Method for comparative quantification of bound nucleic acids | |
US20020146723A1 (en) | Candidate region mismatch scanning for genotyping and mutation detection | |
EP1272662A2 (en) | Detection of single nucleotide polymorphisms | |
US20030232341A1 (en) | Detection of single nucleotide polymorphisms | |
JP2008507955A (en) | Method for detecting mutations in the gene encoding cytochrome P450-2C19 | |
JP2005245272A (en) | Simple method for detecting genetic polymorphism of alcohol dehydrogenase, and reagent for detection | |
Park et al. | Universal probe amplification: Multiplex screening technologies for genetic variations | |
AU2004270756B2 (en) | Nucleic acid detection assay |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase in: |
Ref country code: JP Ref document number: 2001 548756 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2396010 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000988273 Country of ref document: EP |
|
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 2000988273 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000988273 Country of ref document: EP |