WO2001046259A1 - Anti-muc5b antibody and assay of muc5b mucin in mucus and other bodily secretions - Google Patents

Abstract

The novel anti-mucin antibodies of the invention provide a means of quantitating specific mucin protein levels in a heterogeneous mucin secretion. The novel antibody of the invention specifically recognizes a non-tandem repeat segment within the D4 domain of the human mucin MUC5B, and binds to apical secretory vesicles of epithelia expressing the MUC5B glycoprotein. The antibody may be polyclonal or monoclonal. A quantitative assay using the antibodies allows measurement of any variance in MUC5B levels in a given tissue or secretion, under changing physiologic conditions. In particular, an assay is provided to determine MUC5B mucin protein levels in the cervical mucus throughout the menstrual cycle. The invention also encompasses a kit for determining MUC5B levels and a method for determining an individual's optimum fertility period, by determining the approximate timepoint in an individual's menstrual cycle at which mucin secretions have significantly greater MUC5B content and hence, decreased viscosity.

Description

TITLE OF THE INVENTION

Anti-MUC5B Antibody and Assay of MUC5B Mucin in Mucus and Other Bodily Secretions.

CROSS REFERENCE TO RELATED APPLICATIONS Not applicable.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR

DEVELOPMENT Not applicable.

BACKGROUND OF THE INVENTION The invention relates to the field of mucins, particularly gel-forming mucin MUC5B, mucin-specific antibodies, and methods of quantitating a specific mucin.

The major structural components of the protective mucus gel covering all wet-surfaced epithelia of the body, are mucins, highly glycosylated proteins of which the major mass are O-linked carbohydrates [1] . Early attempts to make antibodies to deglycosylated mucin proteins failed to recognize native, secreted mucins. However, the antibodies were used to screen cDNA libraries and revealed the existence of several mucin types, which have been characterized by gene sequencing. At least nine distinct mucin genes have been cloned and designated numerically, in order of their discovery, as: MUCs 1, 2, 3, 4, 5A , 53, 6, 7, and 8 [2-6]. All mucins contain a domain of tandemly repeated amino acids rich in serine and threonine, providing many possible sites for attachment of O-linked carbohydrates. The length and primary sequence of the tandem repeat domain is unique to each mucin, but can exhibit, between alleles, polymorphism , thus variation in the variable number of tandem repeat (VNTR) [7] . Interestingly, MUC5B is the only mucin not reported to exhibit VNTR polymorphism [ 1 ] . Mucins are further categorized into three groups based on their structural properties: membrane-spanning mucins (MUCs 1, 3, and 4), gel-forming mucins (MUCs 2, 5AC, 5B, and 6), and small soluble mucins (MUC7) [6,8]. As well, MUC1 and MUC4 are believed to be cleaved extracellularly, and the cleavage product is detectable in secretions [6,8].

The four large gel-forming mucin genes, all of which are clustered on chromosome ll.pl5.5, share several structural features [9]. Each has a large central tandem repeat region and, 5' to the tandem repeat region, three cysteine-rich domains designated Dl, D2 and D3, which share homology with the D domains of von Willebrand Factor. MUCs 2, 5AC and 5B also have a fourth D domain 3' to the central tandem repeat [10- 15] .

Epithelia expressing and secreting mucins often express several of the genes, giving rise to a heterogeneous mucus secretion. All of the cloned human mucins, with the exception of MUCs 3 and 7, have been reported to be expressed by the endocervical epithelium, although MUC2 message seems to be sporadic [16-18] . MUC4 and MUC5B are the predominant mucin mRNA transcripts present in the human endocervix through the menstrual cycle and levels of both correlate inversely with serum progesterone level [19] . Smaller amounts of mRNA for MUCs 5AC and 6 are also expressed [19] . While this latter study provided insight into the expression levels of mucin genes during the menstrual cycle, little is known about specific mucin protein levels in cervical mucus within the cycle. Such data are of importance in understanding the molecular basis for the dramatic changes in the physical properties of the mucin gel that occur at midcycle to facilitate sperm migration [20-22] .

Measurement of specific mucin gene products within mucus secretions has been limited by the availability of specific, well-characterized anti-mucin antibodies and by the volume requirements of the isolation protocols for mucins. The difficulty in measuring levels of a specific mucin in samples containing multiple mucin gene products, is partly due to difficulty in identifying specific gene products. Relatively few, specific antibodies have been characterized based on molecular characterization of the individual mucins. As well, individual human mucin glycoproteins have not been purified in sufficient quantities to generate antibodies. It has been difficult to isolate specific mucins from a mixed mucin secretion (e.g., mucus), because mucins share common biochemical characteristics that prevent isolation by conventional, chromatographic, electrophoretic, or differential centrifugation techniques. These techniques also require large amounts of starting material, e.g., mucus, and such amounts are not available from individual humans. Isolation of distinct mucin species for production of specific antibodies is therefore impractical.

Previous studies to quantify specific gel-forming human mucins from native secretions have required extensive purification protocols followed by fractionation. Thornton et al. proposed an extensive, cesium chloride (CsCl) density centrifugation purification of the mucins followed by direct measurement of the protein in the isolated fractions by mucin-specific antibodies [23,24]. This technique is labor-intensive and requires a large amount of starting material, rendering it impractical for studies of small samples of mucus secretion. Measurement of mucin-like proteins within mucus secretions from human airway lavage samples, has also been done using antibodies to isolates of mucin in combination with a sandwich-type ELISA [25] . This technique showed the feasibility of directly measuring mucins generally within native secretions, without mucin isolation or purification. However, these anti-mucin antibodies were not directed toward a specific mucin gene product, so that they did not provide a measure of levels of a specific mucin gene product. Rather, they merely gave a general measure of total mixed mucin content in situ, in a sample of mucus seretion.

Therefore, there remains a need for well- characterized, human mucin-specific antibodies, which would allow a rapid, reproducible and sensitive assay for large mucin molecules. Antibodies specific to individual human mucins, such as the MUC5B mucin, would be helpful to measure specific mucin levels in human secretions under varying physiological conditions. In particular, an anti-MUC5B antibody would be useful to measure MUC5B content in cervical mucus secretions throughout the hormone cycle, as well as in other tissues and bodily fluids where MUC5B is expressed (e.g., trachea, colon, salivary gland, saliva, sputum).

BRIEF SUMMARY OF THE INVENTION

Reported here is an alternative method to prior art methods of identifying mucin glycoproteins . The invention provides a novel antibody specific to a synthetic polypeptide that mimics a unique non- glycosylated region of the D4 domain of the human mucin MUC5B, in an ELISA-based assay. The peptide sequence was determined by analysis of the whole MUC5B sequence to identify a region that is antigenic and not glycosylated, and thus is available for antibody binding. The novel antibodies of the invention provide a means of quantitating specific mucin protein levels in a mixed sample, such as a heterogeneous mucin secretion. The quantitative assay for a specific mucin allows quantitative measurement of any variance in that specific mucin 's levels under changing physiologic conditions. In particular, the invention encompasses an assay to determine MUC5B mucin protein levels in the cervical mucus throughout the menstrual cycle.

The novel antibody of the invention specifically recognizes MUC5B, and binds to apical secretory vesicles of epithelia expressing the MUC5B glycoprotein. The antibody may be polyclonal or monoclonal. Particularly advantageous are chicken polyclonal antibodies. The antibody is specific for the polypeptide sequence, SEQ ID No. 1: VTFNGQVFQARLPYSLFHN, which represents amino acid residues 418-436 of the MUC5B polypeptide sequence, as deduced by Keates et al. by molecular cloning [11] . The SEQ ID No. 1 polypeptide sequence is a segment within an intercysteine region of the D4 domain of the MUC5B glycoprotein.

The antibodies of the invention are particularly useful in diagnostic applications. Thus, the invention also encompasses a kit for quantifying the relative amount of MUC5B mucin present in a biological sample, the kit comprising: (a) a component for obtaining a biological sample; and (b) a detectable quantity of an anti-MUC5B antibody of the invention.

Another aspect of the invention is a quantitative assay for the presence of a human mucin protein, MUC5B, in a biological sample, such as mucus, comprising:

(a) reacting the biological sample with a detectable amount of an anti-MUC5B antibody of the invention;

(b) detecting any binding of the antibody to any MUC5B protein present in the sample; and (c) determining the amount of MUC5B present in the sample, by comparing the extent of binding of the antibody to the sample, with a reference standard. Advantageously, the reference standard comprises the extent of antibody binding to a control preparation of the biological sample, such as a control mucin preparation.

The quantitative assay of the invention is useful in testing the effect of various topical agents, such as spermicides (e.g., Nonoynol-9) or douches, or the effect of various therapies, such as estrogen replacement, on the MUC5B content of cervical and vaginal fluids. The assay may also be used to show an individual's optimum fertility period within her menstrual cycle. Other objects, features, and advantages of the present invention will become apparent from the detailed description that follows. Although the detailed description and specific examples illustrate the present invention by way of preferred embodiments, those of ordinary skill in the art will be able to achieve various changes and modifications while remaining within the spirit and scope of the invention.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING

FIGS. 1A-1B illustrate the specificity of an anti-

MUC5B antibody of the invention to human mucin MUC5B, by immunoblot (FIG. 1A) and by ELISA (FIG. IB); FIG. 2A-2E depict immunofluorescence microscopy results of applying the anti-MUC5B antibody to different tissues;

FIG. 3 shows a representative standard curve constructed from ELIΞAs using the anti-MUC5B antibody against a "house standard" human cervical mucin preparation;

FIGS. 4A-4C show the changes in cervical mucin content of MUC5B, in three subjects throughout their respective menstrual cycles, as determined by ELISA assay using the anti-MUC5B antibody, while FIGS. 4D-F show, respectively, the subjects' corresponding progesterone levels;

FIGS. 5A-C plot the ratio of MUC5B mRNA to β₂microglobulin mRNA (y-axis) against blood progesterone levels (x-axis) , for the same three subjects as in

FIGS. 4A-4C, throughout their respective menstrual cycles . DETAILED DESCRIPTION OF THE INVENTION

The invention relates to a novel anti-MUC5B antibody, that may be monoclonal or polyclonal. An exemplary, polyclonal antibody, designated #799, specifically recognizes a synthetic peptide mimicking a 19 amino acid segment of an intercysteine region within the D4 domain in the 3' region of the MUC5B protein. The antibody recognizes native as well as denatured MUC5B on immunoblot, is pre-adsorbable with the synthetic peptide, and binds to apical secretory vesicles of epithelia expressing MUC5B. The anti-MUC5B polyclonal antibody was used along with a "house standard" of isolated cervical mucins, in an enzyme- linked immunosorbent assay (ELISA) , to determine the relative amount of MUC5B mucin in samples of human cervical mucus taken through the menstrual cycle. Anti- MUC5B antibodies can also be used to quantify or identify the presence of MUC5B mucin in other tissues and bodily fluids, including salivary glands and saliva, trachea, and colon.

The antibody and quantitative assay were used to demonstrate a peak of MUC5B mucin in samples of human cervical mucus collected at midcycle, as compared to mucus from early or late in the menstrual cycle. This peak in MUC5B content coincides with a change in the mucus character.

The antibody of the invention demonstrates the feasibility of quantifying the geλ-forming mucin MUC5B in small volumes of native human secretions from varying physiologic states. MATERIALS AND METHODS Anti -MUC5B Polyclonal Antibody Production

Polyclonal antibodies were made to a synthetic peptide from the deduced amino acid sequence of MUC5B as disclosed by Keates et al. [11] . The peptide, internally designated "799", represents a unique region, i.e. a non-tandem repeat region, of the D4 domain of MUC5B, and has the sequence SEQ ID No. 1: V T F N G Q V F Q A R L P Y S L F H N, representing residues 418-436 of the deduced amino acid sequence of MUC5B recorded at Genbank Accession No. u78554. Searching for homology, using BLASTP 2.0.8, resulted in matches to MUC5B only, indicating that this region lacks identity to other gel-forming mucins. Peptides were synthesized by solid-phase procedure using Fmoc chemistry, and were conjugated to keyhole limpet hemocyanin (KLH) with glutaraldehyde. Polyclonal antibodies against the KLH-conjugated peptides were produced in chickens. The KLH-conjugated synthetic peptides (630 μg) were injected into white leghorn chickens with Freund's complete adjuvant (Sigma, St. Louis, Mo.). Two boosts (300 μg) were given at monthly intervals, and collection of eggs was initiated 10 days after final injection. Polyclonal chicken IgY was purified as described in the art [26] . Specificity of the polyclonal anti-MUC5B antibody was determined by pre-adsorption of antibody binding with its specific peptide on immunoblot—by ELISA on tissue extracts or secretions from tissues having documented mucin gene expression profiles, and by immunohistochemical localization on tissues having either documented presence or documented absence of MUC5B expression. The antibody titer was determined using an ELISA in which serial dilutions of the antibody (1/400 to 1/3200) were reacted with a standard amount of purified human cervical mucin (1000 pg) . The titer was defined as the lowest dilution giving binding above background levels. The optimal working concentration of the antibody to detect MUC5B mucin over the widest range of amounts of human cervical mucin, was determined using an ELISA in which serial dilutions of the antibody (1/400 to 1/3200) were reacted with serial dilutions of cervical mucin

(7.8 pg to 8000 pg) . The lowest concentration of antibody to give binding above background in a linear fashion over the widest range of antigen, was chosen as the working dilution for subsequent ELISAs.

Anti-MUC5B Monoclonal Antibody Production

Monoclonal antibody production to MUC5B is achieved as follows. Injection of mice with synthetic, MUC5B- derived, non-tandem repeat peptides conjugated to KLH, did not generate monoclonal antibodies (MAbs) . Instead, anti-MUC5B monoclonal antibodies are produced by using a fusion protein encompassing the same synthetic peptide, SEQ. ID No. 1, used to generate polyclonal antibodies. The fusion protein is produced in culture by conventional methods, isolated, and injected into mice for monoclonal antibody production, in accordance with the protocol described in Gipson et al 1992 [45], herein incorporated by reference. Potential monoclonal antibodies are then screened by immunohistochemistry and ELISA as described below. Anti-MUC5B monoclonal antibodies may be used in affinity purification of native MUC5B proteins and in sandwich assays such as an ELISA or an enzyme-linked lectin assay (ELLA) .

Tissues and Secretions

Human cervical mucus, endocervical epithelium, cervical tissue, conjunctival tissue, blood, urine, and saliva were collected in accordance with human study guidelines and were approved by the Schepens Eye Research Institute and Brigham and Women's Hospital Institutional Review Boards. Informed consent was obtained from all subjects in accordance with protocols approved by the Schepens Eye Research Institute and Brigham and Women's Hospital Institutional Review Boards. Human cervical mucus was obtained by swabbing an individual's cervix with Wilshire foam swabs (VWR Scientific products, Bridgeport, NJ) . Human endocervical epithelium was obtained by cytobrush collection as described in the art [19] . Serum, urine, and saliva from volunteers were used for characterization of the anti-MUC5b polyclonal antibody. Endocervix was obtained at the time of hysterectomy, and conjunctival tissue was obtained at the time of surgery from subjects undergoing cataract extraction. Tissue used for immunohistochemistry was frozen within 30 minutes of surgery in Tissue Tek II OCT compound (Lab Tek Products, Naperville, IL) for cryostat sectioning.

Two populations of subjects were used to obtain cervical mucus. The first population consisted of patients at the intrauterine insemination (IUI) clinic and was used to obtain cervical mucus samples for mucin purification. The second population consisted of normal cycling females who were not using intrauterine devices or oral contraceptives. Subjects in the second population were asked to self-report cycle day and to determine the LH surge with a commercially available urinary LH detection kit (Clear Plan Easy, Unipath Ltd., Bedford, UK) . Samples were collected from this population at four time points within each subject's menstrual cycle. Collection points were chosen to be days 4 and 7 after the start of menses and days 1 and 7 after the LH surge at midcycle. When possible, duplicate samples for each time point were taken, but only two collections were done in any cycle, so collection proceeded over four cycles. Cervical mucus samples were collected just prior to the cytobrush collection of endocervical epithelium used for RNA isolation. Blood samples were then drawn for determination of corresponding blood hormone levels at each collection point. Blood levels of estradiol and progesterone were determined by the Reproductive Endocrine Sciences Center Assay Core Laboratory, Massachusetts General Hospital, Boston, MA (funded by NIH Grant #HD28138) as previously described [19].

Purification of Cervical Mucins 50 samples of cervical mucus collected from patients at the IUI clinic were used to obtain a purified cervical mucin preparation that could be used as a "house standard" for determining relative amounts of MUC5B in crude mucus samples obtained from cycling subjects. Cervical mucin was purified from these samples using a modification of a technique previously described [5,27]. Briefly, the mucus was extracted from the swabs by sonication in 0.1 M NH₄HC0₃, 2.0 mM PMSF, 0.5 M NaCl, 5 mM EDTA, 2 mM N-ethylmaleimide, and 0.02% NaN₃ (mucin isolation buffer) and then pooled. The pooled mucus sample was centrifuged 45,000 x g for 45 minutes at 4' C. The resulting supernatant was dialyzed overnight against deuterated water (dH₂0) , lyophilized, and reconstituted in PBS. The mucus solution was then passed over a Sepharose CL 4B size exclusion column. The column was eluted with PBS and the void volume collected, dialyzed against dH₂0, and lyophilized. The mucin preparation was reconstituted in PBS with 1 mM MgS0₄, 0.1 mM PMSF, 0.02% NaN₃, and treated with RNaseA and DNase I (1 mg nuclease/100 mg protein). Following dialysis against dH₂0, mucins were separated by CsCl density centrifugation. Fractions with a density of 1.31 to 1.5 g/ml were dialyzed against dH₂0, protein, hexose content determined, and those fractions with a hexose content at least twice the protein content were pooled, dialyzed against dH₂0, and a final protein concentration was determined using the Pierce BCA

Protein Assay following manufacturer' s recommendations

(Pierce, Rockford, IL) . This preparation of purified cervical mucins was aliquoted and frozen at -80° C for use as the "house standard."

Prepara tion of Cervical Mucus/RNA

Cervical mucus was extracted from each individual swab from the normally cycling women with 1 ml of mucin isolation buffer. Each mucus solution was centrifuged at 16, 000 x g for 30 minutes at 4° C to remove insoluble material. The protein concentration of each supernatant was determined using the Pierce BCA Protein Assay. The supernatants were aliquoted and stored at - 80° C.

Total RNA was isolated from cytobrushes with TRIzol Reagent (Gibco BRL Life Technologies, Gaithersburg, MD) according to the manufacturer's recommended protocol. Yield was measured by optical density using a Shimadzu Spectrophotometer (Shimadzu Scientific Instruments, Braintree, MA). RNA was stored at -80° C.

Immunoblotting and Immunohistochemistry

Cervical mucus protein was run on 6% separating, 4% stacking SDS-PAGE. Protein was transferred to nitrocellulose for immunoblot detection [28] of anti- MUC5b antibody binding. Briefly, nitrocellulose membranes were incubated with the anti-MUC5b antibody diluted 1/100 in tris-buffered saline (TBS) after blocking with 10% NHS in TBS, pH 7.5. Blots were then washed well with TBS and incubated with peroxidase- conjugated rabbit anti-chicken IgG (Sigma) in TBS with 10% NHS. Following three washes in TBS, colorimetric detection of positive binding was developed with diaminobenzidine peroxidase substrate. Cellular localization of anti-MUC5b antibody binding was detected by immunofluorescence microscopy on cryostat sections of human endocervix and conjunctiva as previously described [28]. Cryostat sections were rehydrated in PBS, pH 7.0, blocked with PBS containing 1% bovine serum albumin and incubated with the anti-MUC5b antibody diluted 1/1000 in PBS. After washing with PBS, sections are incubated with fluorescein-conjugated donkey anti-chicken IgG, coverslipped with Vectashield Fluorescence mounting medium (Vector Laboratories, Burlingame, CA) , and viewed on a Nikon microscope.

Enzyme-Linked Immunosorbent Assays (ELISA)

ELISAs were used to determine the relative quantity of MUC5B in cervical mucus samples using standard methods [29] . Briefly, cervical mucus was coated in triplicate (20 ng to 200 ng per well) on CoStar EIA microtiter plates (CoStar, Cambridge, MA) in 0.05 M carbonate/bicarbonate buffer, pH 9.6. Care was taken to coat equivalent amounts of total protein from each sample. The plates were washed four times with PBS and blocked for two hours with PBS containing 3% (w/v) Fish Gel (Sigma) . Following three washes with PBS, the plates were incubated with the anti-MUC5b antibody diluted (1/1600) in PBS containing 1% (w/v) Fish Gel. The plates were washed three times with PBS containing 0.05% (v/v) NP-40, once with PBS and then incubated with peroxidase-conjugated rabbit anti-chicken IgG (Sigma) diluted 1/10,000 in PBS containing 1% (w/v) Fish Gel. Following two washes with PBS containing NP-40 and two washes with PBS, the plates were incubated with the peroxidase substrate, tetramethylbenzidine (Sigma) . The reaction was stopped after 30 minutes by the addition of 0.5 M H₂S0₄. The optical density of each well was read at 450 nm in a SpectraMax microplate spectrophotometer system using SoftMax Pro version 2.1 software (Molecular Devices, Sunnyvale, CA) . Care was taken to run all samples from a single individual in the same ELISA assay. Aliquots of dilutions of the "house standard" cervical mucin (125 pg to 8000 pg) were used with all individuals to generate the standard curve. Semi -Quanti ta tive Reverse Transcription-polymerase Chain Reaction (RT-PCR)

Total RNA was reverse transcribed using the Superscript II First Strand cDNA Synthesis Kit (Gibco/BRL, Gaithersburg, MD) . MUC5B mRNA levels were assayed using RT-PCR methodology previously described [19] . As semi-quantitative RT-PCR is only reliable in the exponential phase of amplification [30], pilot studies were performed to determine the appropriate number of cycles. Accordingly, oligonucleotide primers to a non-tandem repeat region of MUC5B (SEQ ID NO. 2: 5' GACATTGACCGCTTCCAGG 3', SEQ ID NO. 3:

5' GAGATTCCCAAAGCGTGCATG 3') and to the housekeeping gene, β₂microglobulin (Clontech, Palo Alto, CA) , were used for 28 cycles of PCR amplification. The MUC5B PCR product is 405 bp and the β₂microglobulin product is 335 bp in length. PCR products were electrophoresed at 100 volts on standardized 1.0% agarose gels with 0.5 μg/ml ethidium bromide. Gels were photographed using a DC40 digital camera with the EDS Gel Documentation System

(Eastman Kodak Co., Rochester, NY). Densitometry was performed using the EDS Gel Documentation System software. All bands were fitted manually and the sum intensity of the pixels was determined. RESULTS Demonstration of MUC5B Antibody Specificity

Recently, MUC5B transcripts were determined to be the predominant gel-forming mucin messenger RNAs expressed by the human endocervix with two other gel- forming mucins expressed (MUC5AC and MUC6) but at lower levels [19] . The present invention provides a polyclonal antibody specific for MUC5B. It is useful in methods to assay specific mucin gene products in the cervical secretion. This antibody, designated #799, specifically binds to a synthetic peptide, SEQ ID NO. 1: VTFNGQVFQARLPYSLFHN, representing residues 418-436 of the deduced amino acid sequence of the D4 domain of MUC5B [11] . The chosen synthetic peptide sequence is from an intercysteine region and lacks apparent N or 0 glycosylation sites.

The invention is further described with reference to Fig. 1, which demonstrates the specificity of the polyclonal anti-MUC5B antibody by immunoblot (FIG. 1A) and by ELISA (FIG. IB) . In immunoblot staining, human cervical mucus was separated on a 6% SDS-PAGE and transferred to nitrocellulose, and then probed with the anti-MUC5b polyclonal antibody (Fig. 1A, lane 1) or anti-MUC5b antibody pre-adsorbed with 100 μg/ml of MUC5B non-tandem repeat peptide (Fig. la, lane 2) . Note the absence of binding in lane 2, in comparison to the high molecular weight band visible in lane 1 (see arrow) . When used on immunoblots of human cervical mucus run on denaturing SDS-PAGE (6% separating, 4% stacking), the antibody bound to a high molecular weight band that just entered the separating gel (Figure 1A, Lane 1) . The specificity of the antibody to its immunizing peptide was confirmed by loss of binding to this band following preadsorption of the antibody with 100 μg/ml of the unconjugated peptide (Fig. 1A, Lane 2) .

Fig. IB shows the ELISA results. The ELISA demonstrates positive binding of the anti-MUC5B antibody to secretions known to contain MUC5B, and no binding to tissue extract and tissue fluids known to lack MUC5B. The titer of the antibody, as determined by ELISA, is 1/3200, and the optimal working dilution is 1/1600. By ELISA (Fig. IB), strong binding was observed to secretions known to contain MUC5B: cervical mucin [16,19], and saliva [31]. The polyclonal antibody lacked binding to negative control fluids, e.g., serum and urine, and to extracts derived from conjunctiva, a mucin-secreting epithelium that is known to express mucins MUCs 1, 4, and 5AC but not MUC5B [32].

Figs. 2A, 2B, 2C, 2D and 2E depict immunofluorescence microscopy results using the anti- MUC5B antibody against various tissues. Immunohistochemical localization of the MUC5B polyclonal antibody showed discrete binding in the apical region of the epithelial cells of human endocervical tissue at the proliferative stage, when secretory product is stored, as seen in Fig. 2A. The antibody also bound to salivary gland, known to express MUC5B mRNA, as shown in Fig. 2B. The antibody did not bind to the goblet cells of human conjunctiva (Fig. 2C) , which do not express MUC5B but express MUCs 1, 4 and 5AC [32] . The antibody also did not bind to small intestine (Fig. 2D), which expresses MUCs 2 and 3 but not MUC5B. Fig. 2E shows the amount of non-specific binding attributable to background from the secondary antibody.

Mucin Purifica tion and Genera tion of a Standard Curve for Quanti tation of MUC5B Protein

Since there is currently no source of purified MUC5B for the generation of a standard curve for quantitative assays of MUC5B protein, cervical mucins were purified to be used as a "house standard." Cervical mucus was collected from 50 subjects at midcycle and pooled. The high molecular weight mucin species in the mucus were obtained by size exclusion chromatography on a Sepharose 4B column, followed by cesium chloride density centrifugation. Fractions that had a density between 1.31 and 1.5 g/ml and a hexose: protein ratio of at least two were pooled for use as the standard.

Fig. 3 shows a representative standard curve constructed from ELISA using the polyclonal anti-MUC5B antibody and a "house standard" human cervical mucin preparation. Assays were done in triplicate, and at each concentration tested, the standard deviation was less than 0.04. A standard curve was generated for each ELISA. The MUC5B antibody consistently bound by ELISA in a linear fashion to picogram quantities (250 - 4000 pg) of the purified cervical mucin "house standard". This cervical mucin isolate was therefore deemed appropriate to use as a house standard in ELISAs for the relative quantitation of MUC5B nucin in samples of cervical mucus from test subjects that contain nanogram quantities of total protein. Since this "house standard" is a purified mucin fraction that contains all mucins in the cervical mucus, the amount of MUC5B protein is reported as MUC5B units per nanogram of total mucus protein. A MUC5B unit is defined as the picogram amount of house standard corresponding to the optical density reading obtained per sample.

Measurement of MUC5B Protein Levels in Cervical Mucus Taken Through the Menstrual Cycle

In order to determine the amount of MUC5B protein in cervical mucus, a heterogeneous mixture of mucins that changes in physical character under the varying physiologic conditions induced by the hormone cycle, a MUC5B ELISA using the antibody of the invention was developed. ELISAs were performed on the individual mucus samples collected from three subjects each over four hormone cycles. No more than two samples were taken per cycle to prevent inflammation from over sampling. For each subject, cumulatively, two-to-three samples were taken before the LH surge, one around the LH surge, and one-to-two after the LH surge. All samples from a single individual were run in the same ELISA against the same standard curve. To assure the full range of detectability in all samples, the assays were performed on a range of concentrations (20, 50, 100, and 200 ng per well) of the cervical mucus samples taken at the time points in the menstrual cycle indicated in Figure 4.

Figs. 4A-4C show the changes in cervical mucin content of MUC5B, in three subjects over their respective menstrual cycles. The values are expressed as MUC5B Units per ng of total cervical mucus protein, and reflect the amount of MUC5B present relative to the MUC5B present in picogram amounts of house standard cervical mucin. The MUC5B amounts are plotted against the cycle day, relative to LH surge (Day 0, as determined by an urinary LH detection kit) . The progesterone levels for each collection point are shown for each subject (Figs. 4D, 4E, 4F) . Range bars indicate the standard deviation for the 2-3 samples taken for that time point from different cycles.

The reliability and reproducibility of the assay is demonstrated by the observation that at all concentrations of the cervical mucus tested, there was an obvious peak in MUC5B antibody binding to samples from midcycle compared to those from early or late in the cycle . The assays reported in Figure 4 reflect the values obtained from 100 ng cervical mucus per well. These results demonstrate that the amount of MUC5B mucin present per ng of mucus protein displays a dramatic 3-7 fold increase at midcycle (at cycle day LH plus one) . There was no apparent variation in the amount of MUC5B protein from corresponding time points among the three subjects .

MUC5B mRNA Over Menstrual Cycle

Recently reported results, also from the inventor's laboratory, showed that the level of MUC5B mRNA is highest early in the menstrual cycle and drops as blood progesterone levels increase in the later days of the cycle [19] . The results shown in Fig. 5 confirm those earlier mRNA data for additional subjects. Figs. 5A-C plot the ratio of MUC5B mRNA to β₂microglobulin mRNA (y-axis) against blood progesterone levels (x-axis) , for the same three subjects as in FIGS. 4A-4C, throughout their respective menstrual cycles. The y-axis values are expressed as the ratio of MUC5B mRNA to β₂microglobulin mRNA. With the exception of one time data point in subject 3, the amount of MUC5B mRNA is inversely proportional to the amount of serum progesterone. Range bars indicate the standard deviation for the 2-3 samples taken for that time point from different cycles.

As is shown in Fig. 5, the ratio of MUC5B mRNA to β₂microglobulin mRNA in the endocervical cells is highest early in the cycle when progesterone is low and decreases dramatically as progesterone levels rise. Taken together, these mRNA and protein data show an accumulation of message for MUC5B in the endocervical cells but relatively little mucin protein in the secretion during the beginning days of the menstrual cycle. At midcycle, when mucin secretion increases dramatically [33], there is a large increase of MUC5B protein in the cervical mucus followed by a decline of MUC5B mRNA in the endocervical cells and MUC5B protein in the secreted cervical mucus in the second half of the menstrual cycle (Figs. 4, 5).

DISCUSSION

The specificity and binding of antibody #799 to native MUC5B protein may relate not only to the lack of glycosylation sites in the antigenic region, but also to the region's structure conformation, given its position within an intercysteine region of the D4 domain of MUC5B. Such intercysteine sequences in other, well- characterized proteins, typically loop out from associated cysteines, thus providing ready access for antibody binding [34] . Besides surface exposure, the relative flexibility of the looped sequences may more readily replicate appropriate components among the "ensemble" of shapes assumed by small, flexible peptide antigens [35] . Examples of looped epitopes among secreted proteins include the gonadotrophins LH/hCG [36,37] and FSH [38], as well as human growth hormone [39] . In light of the success of antibody # 799, unique intercysteine sequences from the D domains in other regions of MUC5B or in other gel-forming mucins may thus also be candidate sites for developing region- or mucin- specific antibodies.

The data reported here indicate that MUC5B protein levels peak sharply in cervical secretions at midcycle. The corresponding mRNA levels peak at early midcycle and fall off sharply as serum progesterone levels rise, corroborating previously reported data [19] . It appears, then, that MUC5B is actively transcribed early in the cycle leading to a buildup of protein. This protein is then secreted at midcycle as the rate of transcription slows.

The observed peak in MUC5B protein levels in cervical secretions at midcycle is consistent with previous reports of a midcycle peak in total mucus glycoprotein content of the cervical mucus; Wolf et al . [40] and Van Kooij et al. [41] report a peak in the amount of mucin relative to other proteins present in the cervical mucus at midcycle. The fact that the cervical mucus changes character from a thick viscous consistency to a watery and less-viscous consistency around ovulation is well established. The work of Vigil et al.[22] and others has demonstrated that this peri- ovulatory mucus is more easily penetrated by spermatozoa. The data presented here indicates that a peak in secretion of MUC5B occurs at the time of the change in viscosity. This suggests a model of increased mucus secretion together with an increase in hydration at midcycle. The increase in the amount of mucus glycoprotein would help contain the increased volume of water, diminishing viscosity and facilitating sperm migration. Mucins are extraordinarily hydrophilic and the ability of their surfaces to bind water accounts for part of the mucin' s gel-forming and space-filling ability [42].

The results presented here also confirm recently reported findings of an inverse correlation between MUC5B mRNA levels compared to serum progesterone levels [19] . Other studies have described hormonal regulation of mucin genes, mostly in MUC1. There is little information in the literature regarding hormonal regulation of expression of mucin genes other than the membrane-spanning mucins. Recent studies show that sialomucin complex (SMC) mRNA (the rat homologue of the human membrane-spanning mucin, MUC4) is expressed in the uterus of the rat [43] . They studied SMC protein level in ovariectomized rats supplemented with estrogen, progesterone, or a combination of the two by immunoblot of uterine homogenates . They found high levels of the SMC protein in the uterus of the estrogen-supplemented rats, a diminution in estrogen plus progesterone- supplemented rats, and no SMC protein with progesterone supplementation alone. These data suggest that progesterone down-regulated the SMC message, as is the case with MUC5B in the human endocervix. In summary, development of an ELISA for the gel- forming mucin MUC5B, using the antibody of the invention, has facilitated measurement of the mucin in native secretions of endocervical epithelium during the hormone cycle. The peak levels of MUC5B protein at midcycle are consistent with high mRNA levels present in the proliferative phase [19] and with the change in mucin character that facilitates sperm migration. Availability of the MUC5B-specific antibodies of the present invention enables future studies of other aspects of MUC5B character, including post-translational modifications: e.g., glycosylation and potential associations with other components of the mucus gel.

USES In addition to the novel anti-MUC5B antibodies, the invention also encompasses a kit for quantifying the relative amount of MUC5B mucin present in a biological sample (e.g., saliva, sputum, or specimen of trachea or colon, etc.). The kit comprises: (a) a component for obtaining a biological sample (e.g. a swab, a scraper, or a container for a fluid sample) ; and (b) a detectable quantity of the antibody of the invention (e.g., a labeled monoclonal or polyclonal antibody) . The invention also encompasses a method for determining an individual's optimum fertility period, by determining the approximate timepoint in an individual's menstrual cycle at which mucin secretions have significantly greater MUC5B content and hence, increased water content and decreased viscosity. This method includes the following steps:

(a) obtaining a sample of cervical mucus from the individual;

(b) reacting the mucus sample with a detectable amount of an antibody that specifically recognizes the human mucin protein, MUC5B;

(c) detecting any binding of the antibody to any MUC5B protein present in the mucus sample;

(d) determining the amount of MUC5B present in the mucus sample, by comparing the extent of binding of the antibody to the sample, with a reference standard; (e) repeating steps (a) -(d) a plurality of times, wherein, with each repeat, step (a) is performed at a different time in the individual's menstrual cycle; and (f) determining the approximate timepoint at which the cervical mucus content of MUC5B is highest for the individual.

It should be understood that the present invention encompasses the antibodies described herein and any fragment (s) thereof containing the active binding region of the antibody, such as Fab, F(ab')₂, and Fv fragments. Such fragments can be produced from the antibody by using techniques well-established in the art. REFERENCES

1. Carlstedt I, Sheehan JK, Corfield AP, Gallagher JT. Mucous glycoproteins: a gel of a problem. Essays Biochem 1985; 20: 40-76. 2. Strous GJ, Dekker J. Mucin-type glycoproteins. Crit Rev Biochem Mol Biol 1992; 27: 57-92. 3. Gum JR. Mucin genes and the proteins they encode: structure, diversity, and regulation. Am J Respir Cell Mol Biol 1992; 7: 557-564. 4. Bobek LA, Tsai H, Biesbrock AR, Levine MJ. Molecular cloning, sequence, and specificity of expression of the gene encoding the low molecular weight human salivary mucin (MUC7) . J Biol Chem 1993; 268: 20563-20569. 5. Toribara NW, Roberton AM, Ho SB, Kuo WL, Gum E, Siddiki B, Kim YS. Human gastric mucin: identification of a unique species by expression cloning. J Biol Chem 1993; 268: 5879-5885.

6. Gendler SJ, Spicer AP. Epithelial mucin genes. Annu Rev Physiol 1995; 57: 607-634.

7. Vinall LE, Hill AS, Pigny P, Pratt WS, Toribara N, Gum JR, Kim YS, Porchet N, Aubert J-P, Swallow DM. Variable number tandem repeat polymorphism of the mucin genes located in the complex on llpl5.5. Hum. Genet. 1998; 102: 357-366.

8. Moniaux N, Nollet S, Porchet N, Degand P, Laine A, Aubert J-P. Complete sequence of the human mucin MUC4 : a putative cell membrane-associated mucin. Biochem J 1999; 338: 325-333. 9. Pigny P, Gyonnet-Duperat V, Hill AS, Pratt WS, Galiegue-Zouitina S, D'Hooge MC, Laine A, Van- Seuningen I, Degand P, Gum JR. Kim YS, Swallow DM, Aubert J-P, Porchet N. Human mucin genes assigned to llpl5.5: Identification and organization of a cluster of genes. Genomics. 1996; 38: 340-352.

10. Meerzaman D, Charles P, Daskal E, Polymeropoulos MH, Martin BM, Rose MC. Cloning and analysis of cDNA encoding a major airway glycoprotein, human tracheo bronchial mucin (MUC5) . J. Biol. Chem. 1994; 269: 12932-12939.

11. Keates AC, Nunes DP, Afdhal NH, Troxler RF, Offner GD. Molecular cloning of a major human gall bladder mucin: Complete carboxyl-terminal sequence and genomic organization of MUC5B. Biochem. J. 1997; 324: 295-303.

12. Gum JR, Jr., Hicks JW, Toribara NW, Siddiki B, Kim YS . Molecular cloning of human intestinal mucin

(MUC2) cDNA. Identification of the amino terminus and overall sequence similarity to Prepro-Von Willebrand Factor. J Biol Chem 1994; 269: 2440- 2446. 13. Lesuffleur T, Roche F, Hill AS, Lacasa M, Fox M, Swallow DM, Zweibaum A, Real FX. Characterization of a mucin cDNA clone isolated from HT-29 mucus- secreting cells. The 3' end of MUC5AC. J. Biol. Chem. 1995; 270: 13665-13673. 14. Sadler JE, Shelton-Inloes BB, Sorace JM, Harlan JM, Titani K, Davie EW. Cloning and characterization of two cDNAs coding for human von Willebrand factor. Proc. Natl. Acad. Sci. USA. 1985; 82: 6394-6398. 15. Toribara NW, Ho SB, Gum E, Gum J, Jr., Lau P, Kim YS . The carboxyl-terminal sequence of the human secretory mucin, MUC6. J Biol Chem 1997; 272: 16398-16403. 16. Gipson IK, Ho SB, Spurr-Michaud SJ, Tisdale AS, Zhan Q, Toriakovic E, Pudney J, Anderson DJ, Toribara NW, Hill JA, III. Mucin genes expressed by human female reproductive tract epithelia. Biol. Reprod. 1997; 56: 999-1011.

17. Audie JP, Janin A, Porchet N, Cjopin MC, Gosselin B, Aubert JP. Expression of human mucin genes in respiratory, digestive, and reproductive tracts ascertained by in situ hybridization. J. Histochem. Cytochem. 1993; 10: 1479-1485.

18. Audie J-P, Tetaert D, Pigny P, Buisine M-P, Janin A, Aubert J-P, Porchet N, Boersma A. Mucin gene expression in the human endocervix. Human Reprod 1995; 10: 98-102. 19. Gipson IK, Spurr-Michaud S, Moccia R, Zhan Q, Toribara N, Ho SB, Gargiulo AR, Hill JAI . MUC4 and MUC5B transcripts are the prevalent mucin mRNAs of the human endocervix. Biol. Repro. 1999; 60: 58-64.

20. Morales P, Roco M, Vigil P. Human cervical mucus: relationship between biochemical characteristics and ability to allow migration of spermatozoa. Human Reprod 1993; 8: 78-83.

21. Moghissi KS, Lyner FN. Studies on the human cervical mucus: mucoids and their relation to sperm penetration. Fertil Steril 1970; 21: 234-239.

22. Vigil P, Perez A, Neira J, Morales P. Post partum cervical mucus: biological and rheological properties. Hum Reprod 1991; 6: 475-479.

23. Thornton DJ, Carlstedt I, Howard M, Devine PL, Price MR, Sheehan JK. Respiratory mucins: identification of core proteins and glycoforms. Biochem J 1996; 316: 967-975. 24. Thornton DJ, Howard M, Khan N, Sheehan JK. Identification of two glycoforms of the MUC5B mucin in human respiratory mucus. J Biol Chem 1997; 272: 9561-9566. 25. Steiger D, Fahy J, Boushey H, Finkbeiner WE, Basbaum C. Use of mucin antibodies and cDNA probes to quantify hypersecretion in vivo in human airways. Am J Respir Cell Mol Biol 1994; 10: 538- 545. 26. Jensenius J, Andersen I, Hau J, Crone M, Koch C. Eggs: conveniently packaged antibodies. Methods for purification of yolk IgG. Immunol Methods 1981; 46: 63-68.

27. Shekels LL, Lyftogt C, Kieliszewski M, Filie JD, Kozak CA, Ho SB. Mouse gastric mucin: cloning and chromosomal localization. Biochem. J. 1995; 311: 775-785.

28. Inatomi T, Spurr-Michaud S, Tisdale AS, Gipson IK. Human corneal and conjunctival epithelia express MUC1 mucin. Invest Ophthalmol Vis Sci 1995; 36:

1818-1827.

29. Crowther JR. ELISA : Theory and Practice . Totowa, NJ: Humana Press; 1995.

30. Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE. Use of the polymerase chain reaction in the quantitation of mdr-1 gene expression.

Biochemistry. 1990; 29: 10351-10356.

31. Nielsen PA, Bennett EP, Wandall HH, Therkildsen MH, Hannibal J, Clausen H. Identification of a major human high molecular weight salivary mucin (MG1) as tracheobronchial mucin MUC5B. Glycobiology 1997; 7: 413-419. 32. Gipson IK, Inatomi T. Cellular origin of mucins of the ocular surface. In: Sullivan DA (ed.) Advances in Experimental Medicine and Biology. New York: Plenum Publishing Corp.; 1998. 221-228. 33. Troxler RF, Iontcheva I, Oppenheim FG, Nunes DP, Offner GD, Molecular characterization of a major, high molecular weight mucin from human sublingual gland. Glycobiology 1997; 7: 965-973.

34. Hafez ESE. Human Reproduction: Conception and Contraception. In: Hagerstown: Harper and Row;

1980. 221-252.

35. Barlow DJ, Edwards MS, Thornton JM. Continuous and discontinuous protein antigenic determinants. Nature 1986; 322: 747-748. 36. Tainer JA, Getzoff ED, Alexander H, Houghten RA, Olson AJ, Lerner RA, Hendrickson WA. Nature 1984; 312: 127-134.

37. Keutmann HT, Charlesworth MC, Mason KA, Ostrea T, Johnson L, Ryan RJ. A receptor-binding region in human choriogonadotropin/lutropin β-subunit. Proc

Natl Acad Sci USA 1987; 84:2038-2042.

38. Troalen F, Razafindratsita A, Puisieuz A, Voeltzel T, Bohuon C, Bellet D, Bidart J-M. Structural probing of human lutropin using antibodies raised against synthetic peptides constructed by classical and multiple antigen peptide system approaches. Molec Immunol 1990; 27: 363-368.

39. Weiner RS, Andersen TT, Dias JA. Topographic analysis of the α-subunit of human follicle- stimulating homone using sit -specific antipeptide antisera. Endocrinology. 1990; 127: 573-579. 40. Cunningham BC, Jhurani P, Ng P, Wells JA. Receptor and antibody epitopes in human growth hormone identified by homolog-scanning mutagenesis. Science 1989; 243: 1330-1336. 41. Wolf DP, Blasco L, Khan MA, Litt M. Human cervical mucus. I. Rheologic characteristics. Fertil Steril 1977; 28: 41-46.

42. Van Kooij RJ, Roelofs HJ, Kathmann GAM, Kramer MF. Human cervical mucus and its mucous glycoprotein during the menstrual cycle. Fertil Steril 1980; 34:

226-233.

43. Gerken TA. Biophysical approaches to salivary mucin structure, conformation and dynamics. Crit. Rev. Oral Biol. Med. 1993; 4: 261-270. 44. McNeer RR, Carraway CAC, Fregien NL, Carraway KL. Characterization of the expression and steroid hormone control of sialomucin complex in the rat uterus: Implications for uterine receptivity. J. Cell. Physiol. 1998; 176: 110-119. 45. Gipson IK, Yankkaukus M, Spurr-Michaud SJ, Tisdale A, Rinehart W. Characteristics of a Glycoprotein in the Ocular Surface Glycocalyx. Invest. Ophthalmol. Vis. Sci. 1992; 33:218-227.

Claims

CLAIMSWhat are claimed are:

1. An antibody that specifically recognizes a human mucin protein, MUC5B.

2. The antibody of claim 1, which binds to apical secretory vesicles of epithelia expressing MUC5B.

3. The antibody of claim 1, being a chicken polyclonal antibody.

4. The antibody of claim 1, being a monoclonal antibody.

5. The antibody of claim 1, which binds to a segment within an intercysteine region of the D4 domain of MUC5B.

6. The antibody of claim 1, which binds to a protein comprising the polypeptide having the sequence SEQ ID No. 1 (V T F N G Q V F Q A R L P Y S L F H N).

7. A kit for quantifying the relative amount of MUC5B mucin present in a biological sample, the kit comprising:

(a) a component for obtaining a biological sample; and (b) a detectable quantity of the antibody of any of claims 1-6.

8. The kit of claim 7, wherein the antibody recognizes a segment within an intercysteine region of the D4 domain of MUC5B

9. The kit of claim 7, wherein the antibody binds to a protein comprising a polypeptide having the sequence SEQ ID No. 1 (V T F N G Q V F Q A R L P Y S L F H N).

10. The kit of claim 7, further comprising a component to disclose the presence of the antibody, the discloser comprising a detectable label.

11. The kit of claim 11, wherein the discloser is conjugated to said antibody.

12. The kit of claim 11, wherein the discloser is separate from the antibody, and, in use, binds specifically to the antibody.

13. The kit of claim 11, wherein the component for obtaining a biological sample is a component for obtaining saliva or sputum.

14. A quantitative assay for the presence of a human mucin protein, MUC5B, in a biological sample, comprising:

(a) reacting a biological sample with a detectable amount of an antibody that specifically recognizes the human mucin protein, MUC5B; (b) detecting any binding of the antibody to any

MUC5B protein present in the biological sample; and (c) determining the amount of MUC5B present in the biological sample, by comparing the extent of binding of the antibody to the sample, with a reference standard.

15. The assay of claim 14, wherein the reference standard comprises the extent of binding of the antibody to a control preparation of the biological sample.

16. The assay of claim 14 or 15, wherein the biological sample comprises a sample of at least one human mucin.

17. The assay of claim 14 or 15, wherein the biological sample comprises human saliva or sputum.

18. A method of determining an individual's optimum fertility period, comprising:

(a) obtaining a sample of cervical mucus from the individual; (b) reacting the mucus sample with a detectable amount of an antibody that specifically recognizes the human mucin protein, MUC5B; (c) detecting any binding of the antibody to any

MUC5B protein present in the mucus sample; (d) determining the amount of MUC5B present in the mucus sample, by comparing the extent of binding of the antibody to the sample, with a reference standard; (e) repeating steps (a) -(d) a plurality of times, wherein, with each repeat, step (a) is performed at a different time in the individual's menstrual cycle; and (f) determining the approximate timepoint at which the cervical mucus content of MUC5B is highest for the individual.

19. The method of claim 18, wherein the reference standard is a control preparation comprising at least one human mucin, MUC5B.