WO2001040462A1

WO2001040462A1 - Method for measuring the extent of skin aging and measurement kit

Info

Publication number: WO2001040462A1
Application number: PCT/JP1999/006711
Authority: WO
Inventors: Ritsuo Yamashita; Yoshikazu Aman
Original assignee: Sony Cp Laboratories Inc.
Priority date: 1998-06-05
Filing date: 1999-11-30
Publication date: 2001-06-07
Also published as: JP4013333B2; JPH11346800A

Abstract

A method for measuring the extent of skin aging which involves: the step of blunt-ending a fragment (TRF), which is obtained by treating a DNA extracted from an epidermal piece with a restriction enzyme and has a sticky end and a telomere-characteristic 3'-cohesive end, at both ends by terminal modification; the step of attaching linkers to both ends of the blunt-ended fragment followed by amplification by PCR; and the step of separating by electrophoresis the thus obtained amplification product which contains at least the whole telomere sequence in its part and detecting the average telomere length based on the distribution by using a labeled probe. By using this method, the extent of skin aging can be quickly and accurately measured with the use of a small amount of DNA.

Description

Description Method for measuring skin aging degree and kit for measurement

The present invention relates to a method for measuring the degree of skin aging. More specifically, it relates to a method for measuring the degree of skin aging by amplifying DNA extracted from skin cells, measuring the average molecular weight of the amplified product, and determining the telomer length. . Background art

In living organisms, physiological functions change with aging, usually a decline in physiological functions, that is, aging. At the individual cell level, aging occurs, which is defined as the regression of cell morphology and function, followed by cell death or growth arrest. It is thought that the cause of such an aging phenomenon is, in addition to impaired metabolism of cells, damage of intracellular DNA and reduced repair function.

Some information has already been obtained on such cell aging. In other words, Goldstein's review reports that in human diploid fibroblasts, the G1ZS boundary of the cell cycle is arrested, so that aging by replication, that is, mitotic aging, is rapid ( S. Goldstein, Science, 24 9: 1129-1132 (1990)). Also, if human fibroblasts obtained from different human donors are established and grown as strains that can be cultured in vitro, telomeres become shorter when cells are passaged repeatedly, and this shortening is reduced. Cell lifespan Related studies have also been reported (RC Allsop, et al., Pro Natl. Acad. Sci. USA, 89: 10114-10118 (1992)).

Here, a telomere refers to a terminal region of a chromosome, which is also referred to as a telomere, and is often composed of a simple repetitive sequence. This region is essential for the stability of chromosomes in eukaryotes.

Therefore, it is thought that the degree of aging can be estimated from the telomer length. However, a method that can easily and quickly measure such telomer length has not been known.

A11sop and colleagues used conventional PCR methods and probes to determine the effects of telomeres on primary culturing of skin cells obtained by surgery or biopsy and aging through repeated passages. Checked by law.

Specifically, Alsop et al., After repeated cell passages, extracted DNA, digested it with restriction enzymes, and hybridized a radioisotope (RI) -labeled probe with a modified method of Mather et al. The X-ray film is exposed to light for 1 to 2 days, and the autoradiogram is detected by densitometry. This method requires a significant amount of DNA, and is time-consuming and tedious to use RI as a label.

Therefore, there is a need to establish a method of accurately knowing the telomere length in a short time using a small amount of DNA, and to clarify the relationship between aging and telomere length. Disclosure of the invention

The inventors of the present invention have made intensive studies to solve the above-mentioned problems. As a result, they found a method for easily and quickly measuring telomere length using a small amount of DNA from skin tissue cells collected without pain and without leaving any trace, and completed the present invention. It is.

That is, in the present invention, both ends of a fragment having one cohesive end and a telomere-specific 3 'protruding end obtained by treating a DNA extracted from skin epidermal debris with a restriction enzyme are converted into blunt-ended fragments by terminal modification. A step of binding a linker to both ends of the blunt-ended fragment, followed by amplification by PCR, and electrophoretically separating the amplification product obtained at least partially containing the entire telomere sequence from the distribution. Detecting the average telomere length with a labeled probe.

Here, the restriction enzyme is characterized in that it is a restriction enzyme selected from the group consisting of Hinfl, Mspl / Hpal I. and Rsal. Further, the blunt-end fragment binds a linker consisting of a double-stranded oligonucleotide having a cohesive end complementary to the cohesive end to the cohesive end, and Two single-stranded oligonucleotides containing a 5'-CCCT AA-3 'repetitive sequence complementary to the sequence of 6 to 24 bases from the 3' end of the protruding end of the fragment with an end It is characterized in that 3 to 12 base pairs of oligonucleotides are ligated, and this is used as a primer to obtain a double-stranded oligonucleotide with blunt ends at both ends using DNA polymerase. And

In the present invention, the DNA subjected to the restriction treatment may be blunt-ended using the linker and DNA polymerase, and may be a double-stranded DNA having a sequence complementary to the cohesive end and the protruding end. Gonucleotides may be used as linkers to make blunt ends.

In addition, the sense primer and the antisense primer A mer is characterized by having a nucleotide sequence contained in each of the above two types of linkers.

Specifically, the primer preferably has the nucleotide sequence of SEQ ID NOS: 3 and 4.

In the present invention, a telomer-containing DNA fragment obtained by treating DNA extracted from skin epidermis debris with a restriction enzyme is labeled with a label selected from the group consisting of radioisotopes, fluorescent compounds and chemiluminescent compounds. This is a method for measuring the degree of skin aging detected by a telomere detection label probe.

Specifically, it is preferable that the telomere-labeled probe has a nucleotide sequence represented by SEQ ID NOS: 5 to 12.

The telomere-labeled probe may be a 5 ′-(TTAGGG) _n −3 ′ and / or a 5 ′-(TAACCC) labeled with a label selected from the group consisting of radioisotopes, fluorescent compounds and chemiluminescent compounds. „-3 ′ (n represents an integer of 3 to 5) is more preferable.

The labeled probe is complementary to 5 ′ — (TTAGGG) „— 3 ′ and Z or 5 ′-(TAACCC)„-3 ′ (n represents an integer of 3 to 5) as a labeled probe. a nucleotide sequence template and a restriction enzyme recognition sequence adjacent to the base sequence, primers containing the restriction enzyme recognition sequence, and [α - ³ H] act DNA poly main hydrolase to substrates containing at least a dNTP To obtain a reaction product, and the reaction product is reacted with the restriction enzyme to obtain a reaction product.

The present invention also provides a kit for measuring the degree of skin aging for carrying out the above-mentioned method, comprising at least two of a device for collecting skin epidermis debris and a tube containing a DNA extraction solution. is there. This kit also provides a DNA amplification kit. It may also include a tube containing the box. The reaction mix for amplification of this kit consists of a PCR solution containing EGTA, an internal standard, a TS gene protein, and a primer of SEQ ID NO: 3 as the upper layer of the wax, and is described in SEQ ID NO: 4. It is characterized in that the PCR solution containing the primer is contained in the reaction vessel as the lower layer of the wax.

The present invention further provides a skin epidermis debris collecting instrument, wherein a rasp including a head having a style of implanting a thorn and a grip connected to the head is used as an instrument for collecting skin epidermis debris. It is a kit for measuring the degree. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a diagram showing a rasp of the present invention.

FIG. 2 is a diagram showing the structure of TRF.

FIG. 3 is a diagram showing a site where the skin epidermis debris is collected on the face.

FIG. 4 is a diagram showing the production of a labeled probe for detecting telomeres. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.

As used herein, “aging” refers to DNA damage or cell damage induced by ultraviolet light, lipid peroxide, ischemia, etc., and the rate of cell proliferation associated with DNA replication and cell division. It refers to the decrease due to a decrease in the ability to proliferate, and includes photoaging, free radical aging, and the like.

Here, the term “reduced proliferative capacity” usually refers to the number of times a cell can proliferate in the future with respect to the number of divisions (cumulative number) of cells that can be multiplied genetically. In the present invention, in order to measure the telomere length, skin epidermal debris or DNA extracted from skin cells is used, and these skin epidermal debris are obtained from a living body. "Skin epidermis debris" refers to cells such as keratinocytes or a part thereof obtained by abrasion without pain, without bleeding, and without any trace on the skin surface at an arbitrary site. Say. In the present invention, a cell line that can be passaged in vitro and a DNA obtained from a primary cultured cell tissue obtained from an extracted biological tissue may be used. Samples obtained from these materials are hereinafter referred to as "skin epidermis debris".

These skin epidermis debris and the like may be obtained by any method. For example, it may be obtained by rubbing the skin surface with a rasp or a sandpaper described later, or a tissue or a part thereof obtained by a surgical operation, biopsy, or the like may be used.

In the present invention, since it is possible to measure the telomer length of a minute amount of DNA, skin epidermis debris and the like can be suitably used.

The site from which these skin debris is collected may be the face, upper arm, back, buttocks, thighs, and other various sites, but is not limited to these sites. Therefore, it is necessary to compare the length of each telomere of DNA obtained from skin collected from a part that is often exposed to sunlight, such as a face, and a part that is less exposed to sunlight, such as a buttock. This makes it possible to examine the degree of photoaging of cells.

皮膚 Select the skin at the intersection of the vertical line L at the corner of the eye, the vertical line L at the corner of the eye in the standing or sitting position, and the horizontal line L _{2 at the} upper end of the nose (Fig. 3). Can also be measured.

Skin debris can be painful if, for example, a dedicated instrument (rasp) is used for collection. There is no bleeding and no traces can be collected. Hereinafter, a case where skin scraping cell debris is collected using a rasp will be described as an example.

That is, Rasp is a device for skin epidermis having a structure as shown in Fig. 1 (a). The rasp 10 includes a head 4 having a thorn 2 implanted therein and a gripper 6 connected to the head, and the head and the gripper are connected so as to be separable.

Here, the zone is a fiber that is implanted in the head of a rasp to obtain skin scraps. The material of the son is not particularly limited, as long as it can be used to scrape the skin so that there is no pain or bleeding and no trace remains, and the skin surface and skin pieces can be collected. From the viewpoints of cost and production cost, it is preferable to use polypropylene, polyacryl, polyethylene, aluminum, stainless steel 18-8, or the like.

The tip of the thorn is made of a fibrous material having a diameter of about 1 to 10 m, as shown in Fig. 1 (c), and the tip has an acute angle. This angle is a maximum of about 30 °, and if it is 0.2 to 5 °, it is suitable for collecting skin debris by rubbing the skin without pain and bleeding and leaving no trace.

The shape of the head of the rasp may be any shape such as a disk, an ellipsoid, a square plate, or a rectangular parallelepiped, and is not particularly limited. Due to the amount of DNA that can be collected, the size is 5 to 20 mm in diameter or 5 to 20 mm on one side in the case of a disc or square plate, and the long axis radius is 5 to 20 in the case of an elliptical disc. In the case of 2 Omm and a short axis radius of l to 5 mm, or in the case of a rectangular plate, one side is preferably about l to 5 mm x 5 to 20 mm.

The thickness is not particularly limited as long as it can be connected to a grip portion described later, and is preferably about 1 to 8 mm. By rubbing the skin in order to collect the skin epidermis debris, about 25-2 25 present cm ² Thorn described above on the head of the above shape, the long saga about 1 from implantation surface of the head Implant so that it is 5mm. Implantation may be performed by a method known to those skilled in the art.

A grip that can be held by the hand is connected to the head thus formed so that it can be separated from the head. The size of the gripping portion is not particularly limited as long as it can be held by hand, and specifically, a cylindrical shape having a length of 30 to 100 mm, a diameter of 2 to 8 mm, and a long axis An elliptic cylinder having a radius of 5 to 20 mm and a minor axis radius of 2 to 10 mm, or a prism having a side of 3 to 15 mm can be given. Such a grip may be formed separately from the head of the rasp, or may be formed integrally with the head. In the case of molding separately from the head, for example, one end of the grip portion can be fitted or screwed into a surface of the above-mentioned head where the thorn is not implanted. In the case of integral molding, for example, by applying an external force with tweezers or the like, an appropriate force is applied between the head and the grip so that the head can be easily separated. It is preferable to make a depth notch 8 (see Fig. 1 (b)).

The material used to make the rasp is not particularly limited.Polyethylene is used because it is easy to obtain, mold, and sterilize the molded product, and it is necessary to reduce the cost of manufacturing disposable rasps. Plastics such as polystyrene, polypropylene, polyacryl, and polyvinyl chloride, and metals such as aluminum, steel, and stainless steel can be suitably used.

In particular, when made of polypropylene or aluminum, there is an advantage that the manufacturing cost of rasp is low or sterilization is easy. As a specific example of the above-mentioned rasp, there can be mentioned a polypropylene made of a rectangular parallelepiped head of about 3Χ10Χ15ΙΠΠ1 and a grip section of about 5 mm in diameter and about 100 mm in length (No. 1 See Figure.) The head of this rasp, Thorn tip angle is about 0.8 degrees, a density of approximately 100 Bruno cm ^2, so that the length from the implantation surface to the tip of about 2D1D1, uniformly implanted Good.

The rasp prepared as described above is packed in a sterile bag and sterilized by, for example, "irradiation.

Gently rub the above rasp onto an appropriate cleaned area and gently rub this area several times to collect skin debris.

Next, the head of the rasp with skin debris attached to the tip of the son is cut off from the gripping part, for example, by pinching it with tweezers and twisting, and the head of this rasp is used with tweezers or the like. Then, transfer to an appropriately sized container containing the aqueous solution, and collect the collected skin epidermis debris.

The aqueous solution used here is preferably sterile water to eliminate microorganism-derived DNase, and a preservative such as sodium azide may be added as appropriate. Further, from the viewpoint of DNA recovery efficiency, it is preferable that about 0.3 to 1.6 mL of the above aqueous solution is placed in a container having a capacity of about 0.5 to 2 mL, and the skin cells are collected here.

For example, in a 5 mL eppendorf tube with a lid, add 1.3 mL of MilliQ purified water containing 0.1% sodium azide, and place the above skin epidermal debris here. Put the head of the collected rasp. If the inner diameter of the Eppendorf tube used at this time is within 7 mm, skin epidermis debris can be collected efficiently.

The skin epithelial cell debris collected as described above can be obtained by a known method as described below. It can be crushed by a method, but is not particularly limited. For example, chemical disruption may be performed using a surfactant, alkali or enzyme, or physical disruption may be performed by freeze-thaw or sonication using a device such as ultrasonic. Alternatively, they may be crushed in combination.

Since the DNA to be extracted is less damaged, it is preferable to freeze-thaw the aqueous solution containing the above collected cells and then completely disrupt the cells using concentrated alcohol. Freezing and thawing may be performed repeatedly.

Examples of the alkali include sodium hydroxide and potassium hydroxide, and these are added to the above aqueous solution to a final concentration of about 5 to 20 mM, and a vortex mixer is used. Vigorous agitation, for example, can increase DNA extraction efficiency.

For cell disruption, for example, immerse the above-mentioned 1.5 mL eppendorf tube with a lid alternately and rapidly in liquid nitrogen and hot water, and freeze and thaw twice. Then, the alkali can be prepared by adding a small amount of concentrated NaOH to a final concentration of 12 mM and stirring vigorously with a Portex mixer. The rasp head in the tube should be spun down and removed with tweezers.

Cell breakage can be caused by freezing and thawing as described above, as well as surfactants such as lauroyl sarcosine, Triton X-100, sodium lauryl sulfate (SDS), proteinase K, and proteinase. It may be carried out by an ordinary method using a precipitant such as protease, RNase or other enzymes, sodium dodecyl sodium / isopropyl alcohol, ethanol or the like.

In the present invention, when extracting DNA with a small amount of liquid, It is preferable that a predetermined amount of mineral oil is overlaid after the cells are crushed and the crushed pieces are settled in order to prevent evaporation of the aqueous solution during the subsequent heating operation.

Examples of such mineral oils include light mineral oil M-5904 (manufactured by Sigma) and the like. The layering amount is about 10%, which prevents evaporation of water, DNA Is preferred for stable extraction.

If alkaline is used, the above aqueous solution containing DNA is neutralized with a high-concentration acid or buffer. Examples of such an acid include hydrochloric acid and the like, and examples of the buffer include a tris-hydrochloric acid buffer (pH 7.0).

For example, after neutralizing with 1 M Tris-HCl buffer (pH 7.0), the solution under the oil layer may be accurately drawn out with a pit.

The DNA from the skin cells obtained as described above may be directly subjected to the processing described below, or may be, for example, stored frozen.

The obtained DNA is digested with a restriction enzyme selected from the group consisting of Hinfl, Mspl / HpalK and RsaI to obtain a terminal restriction DNA fragment (TRF). By digesting with these restriction enzymes, TRF having cohesive ends and protruding ends can be obtained (Fig. 2). Here, the term “telomere-specific 3′-protruding end” refers to a single-stranded oligonucleotide consisting of about 10 to 20 nucleotides, which is present on the 3 ′ side of TRF. In FIG. 2, E represents a portion to be endfilled, A represents a portion having the same sequence as the sense primer, and B represents a portion having the same sequence as the antisense primer. The length of the cohesive end is 1 to 5 bases, and in most cases 4 bases. In the present invention, it is preferable to digest with Hin から from the base sequence of the restriction terminal formed. However, when it is necessary to check the telomere length over time, it is necessary to limit the amount of skin epidermis debris that can be collected at one time from the same collection site, so that digestion with MspI is preferable.

Then, the TRF having the cohesive end and the 3′-protruding end peculiar to the telomere is converted into a blunt-end fragment by an end modification method as described below.

In the first method, a first double-stranded oligonucleotide having a cohesive end complementary to the cohesive end of the TRF is prepared as a linker, and the oligonucleotide is prepared as described above. Attached to cohesive end of TRF. Then, the other end of the TRF having the 3 'protruding end peculiar to the telomere is attached to the 5' side of the oligonucleotide nucleotide portion complementary to the sequence of 6 to 24 bases from the 3 'side of the protruding end. Oligonucleotides of 3 to base pairs of the main strand are linked as a primer, and the endfilling is carried out by a conventional method using, for example, DNA polymerase.

A second double-stranded oligonucleotide (linker) having blunt ends at both ends is ligated to the end-filled protruding end according to a conventional method to obtain a blunt-end fragment.

In the second method, two double-stranded oligonucleotides having a cohesive end and a protruding end complementary to the cohesive end of the TRF obtained as described above and a telomere-specific 3 'protruding end are provided. The linker consisting of the primers is ligated according to a conventional method to obtain blunt-ended fragments. Two double-stranded oligonucleotides having cohesive ends and protruding ends may be simultaneously bound to both ends of the TRF, or may be bound individually.

In the third method, the cohesive end and the protruding end of the TRF obtained as described above are used. In the same manner as in the first method, end-filling is performed to form a blunt end, and two linkers having a blunt end are linked to obtain a blunt-end fragment. The two linkers used here may be bound to both ends of the TRF simultaneously or one of them.

If the plus strand of the linker consisting of the above-described double-stranded oligonucleotide contains a sequence to which the nucleotide sequence of the primer used in the amplification step described later is bound, The blunt-ended fragment can be accurately and rapidly amplified, and the detection is easy.

The linker used in the present invention preferably contains the sequence 5′-AGAGTT-3 ′ in the positive chain of the linker that binds to the subtelomere side,

5 'AATCCGTCGAGCAGAGTTC 3'

More preferably, it comprises the sequence of SEQ ID NO: 3 (SEQ ID NO: 3).

A linker suitable for binding to the subtelomere side of DNA extracted from skin epidermis debris according to the present invention is:

5 'AATCCGTCGAGCAGAGTTC 3'

3 'TTAGGCAGCTCGTCTCAAGTGA 5'

(SEQ ID NO: 1).

Also, in the present invention, the 5'-CCCTAA-3, which is complementary to the sequence of 6 to 24 bases from the 3 'side of the 3' protruding end peculiar to the telomere, ie, the 3 'protruding end peculiar to the telomere, The linker that binds to the 5 'side (Fig. 2) of the single-stranded oligonucleotide containing the' sequence is

5 '(CCCTAA) 3 CCCTAA 3'

(SEQ ID NO: 4). When the linker to be bonded to the telomere is arranged in such a sequence, the nucleic acid to be bonded to the subtelomere is This is because a mismatch with AGAGTT of the nucleotide sequence can be prevented, so that primer-dimer artifacts can be prevented.

Specific linkers that bind to the telomere side of the 3 'protruding end specific to telomeres include

5 '(CCCTAA) 3 CCCTAA 3'

3 '(GGGATT) a GGGATT 5'

Having a blunt end having the sequence (SEQ ID NO: 2) is preferred. In such a linker, each chain is produced by chemical synthesis, and these two synthetic oligonucleotides may be hybridized, or the synthesized plus strand and DNA polymerase may be synthesized. Enzyme synthesis may be carried out using the enzyme.

For example, using a DNA synthesizer (Pharmacia Biotech), it is possible to synthesize a linker comprising the double-stranded oligonucleotide of the present invention in accordance with the phosphoramidite method. it can. The synthesized oligonucleotides were cut out of the column with alkali, and then reversed-phase high-speed using polyacrylamide gel electrophoresis containing 7 M urea or Chroma Spin-10 column (Clontech). It may be purified by liquid chromatography (HPLC).

In the present invention, as described above, the blunt-end fragment is used in a polymerase chain reaction (PCR) in a linker consisting of a double-stranded oligonucleotide used to prepare a blunt-end fragment. The sequences of the sense and antisense primers are included. These primers can be synthesized using a DNA synthesizer according to a conventional method. In addition, the Klenow fragment is allowed to act, and the above-mentioned brass is prepared by a multi-primer method (random primer method), a nick translation method, or the like. You can also combine images.

The length of the nucleotide sequence of these primers is not particularly limited, but is preferably about 15 to 35 nucleotides in terms of ease of synthesis and no occurrence of primer dimer artifacts. Preferably, there is. Here, “primer dimer artifact” means that primers anneal to each other to form a dimer.

The synthesized primers can be obtained by a conventional method using polyacrylamide gel or reversed-phase high-performance liquid chromatography (HPLC) using Chroma spin-10 column (Clontech) as described above. Purify and use on a PC scale.

Examples of linkers and primers comprising double-stranded oligonucleotides used in the present invention include linkers and primers described in SEQ ID NOs: 1 and 2, respectively. it can.

Primers having such a nucleotide sequence do not cause primer-dimeractivities, and can efficiently and precisely form a 铸 -type nucleotide sequence in the amplification step. Can be amplified.

In the present invention, the blunt-ended fragment obtained by the treatment as described above is converted into a template (type 铸) and a TS primer 1 (sense primer 1, SEQ ID NO: 3) having the following sequence.

5 * AATCCGTCGAGCAGAGTTC 3 '

And C X primer (antisense primer, SEQ ID NO: 4)

5 '(CCCTAA) 3 CCCTAA 3'

And amplify the TRF by performing PCR under the usual conditions. The sequence of the CX primer used in the present invention is not a sequence completely complementary to the telomere repeat sequence, but contains a base that becomes a mismatch when annealed. By including such mismatched bases, it is possible to prevent the primer dimer from being formed by annealing to the type III telomeric sequence portion, and to anneal after the second cycle of PCR. By preferentially annealing this sequence, shortening of the amplified fragment can be prevented.

The amplification product thus obtained is electrophoretically separated by various electrophoresis methods such as agarose gel electrophoresis and SDS-PAGE, transferred to a membrane filter, and detected with a labeled probe.

In the present invention,

(TTAGGG) „(where n represents an integer of 3 to 5, SEQ ID NOS: 5 to 7)

Or

(TAACCC) _n (where m represents an integer of 2 to 6, SEQ ID NOS: 8 to 12)

It is preferable to use a probe containing

If n is 2 or less, there is a problem that the binding affinity is weak, and if n is 6 or more, handling as a probe becomes difficult. Also, there is a similar problem when m is 1 or 7 or more.

The use of (TTAGGG) _n (SEQ ID NOS: 5-7) or (TAACCC) _B (SEQ ID NOs: 8-12) as probes improves accuracy, sensitivity, and operability in telomere detection This has the effect.

The template used in here, at a _{minimum, 5'- (TTAGGG) 3 - 3} ' and Z or _{5'- (TAAC CC) 3 - 3} ' complementary to the nucleotide sequence adjacent to the sequences And a restriction enzyme recognition sequence. "Restriction enzyme recognition sequence" And specifically, a base sequence recognized by a restriction enzyme selected from Hinfl, Mspl / Hpa11 and RsaI.

The primer also contains a base sequence recognized by the above restriction enzyme.

The above template, is allowed to act primers and [shed one ³ H] to a substrate consisting of dNTP and DNA polymerase ra one zero under normal conditions - is possible to get a reaction product containing [a ³ H] dNTP it can. When the above-mentioned restriction enzyme is allowed to act on this reaction product under ordinary conditions, a probe with a high labeling rate can be obtained (for example, the method of Harley et al. (Harley CB et al., Nature 345: 458-460 (1999)). 1990); Vaz iri H. et al, EMBO J. 16: 6018-6033 (1997); Kruk PA et al., BBRC 224: 487-492 (1996))).

Here, the term “probe having a high labeling rate” means a probe having a radioactivity of about 0.5 to 9 × 10 ⁷ cpm / pmol when a radioisotope is used as a label. . When a fluorescent compound is used as a label or a chemiluminescent compound is used as a label, two or more sites are labeled instead of a single site such as a conventional 5 'end label, A probe whose fluorescence intensity or luminescence intensity is high.

Examples of the labeling compound used in the present invention include the following, but are not limited thereto. As radioactive labels,

^{^{[3 H], [3 2}} P] is also properly the like ^{[1 4} C].

Non-radioactive labels include fluorescent compounds such as fluorescein isothiosinate (FITC) and red tetramethylrhodamine isothiocyanate (TRITC), horseradish oxidase (HRP), luciferase and the like. Chemiluminescent compounds such as zeolites.

Labeled probes using these non-radioactive labels were prepared according to the method of Langer-Safer et al. (PR Langer-Safer, M. Levine, and DC Ward, Pro Natl. Acad. Sc USA 19: 4381-4385), and Rigby et al. It can be prepared by a method (TWI, Rigby, M. Dieckmann, C. Rhodes, and P. Berg, j. Mo1ec. Bio 1.113 .: 237-251 (1977)).

In the present invention, Piochin labeled dCTP, digoxigenin-labeled dUTP, FIT C-labeled dGTP, fluorescent labels quinuclidine Reochi de such TRITC-labeled ^{dCTP, [α - 3 H]} dN TP, [r - 3 P] dNTP also rather the [ a — ¹⁴ C] Use radioactively labeled nucleotides such as dNTPs or enzyme-labeled nucleotides such as horseradish peroxidase-labeled nucleotides and luciferase-labeled nucleotides. And are preferred for detecting small amounts of DNA from skin epidermis debris with high sensitivity.

When a fluorescent probe is used among these labeled probes, detection with higher sensitivity can be achieved by adding a sensitizer. For example, when using a biotin-labeled dCTP, streptavidin-conjugated horseradish peroxidase (HRP) is bound to a labeled probe, and then the fluorescence intensity is increased by using hydrogen peroxide and a sensitizer. Increase.

As the sensitizer, fluorescein-tyramide (manufactured by NEN Life Science Products), piotin, phlorestin (manufactured by Molecular Probe) and the like can be suitably used.

The use of a non-radioactive labeled probe such as the above-mentioned biotin-labeled dCTP, digoxigenin-labeled dUTP, etc. enables operation outside the radiological safety management facility, and facilitates the measurement of skin aging. The ratio of radiolabeled probes of the present invention, [§ one ^{3 2} P] ATP and T4 polynucleotidyl click Reochi Dokinaze like the 5 'end-labeled prior labeled probe (B. et al Harley (supra)) Activity! The specific activity is several times higher than that of ~ 3 X 10 ⁶ cpm / pmo 1, 2-7 X 10 ⁷ cpm / pniol, so the telomere length can be accurately measured with DNA extracted from a small amount of skin epidermis debris can do. In addition, the use of [ ³ H] labels has the added advantage of being highly safe for researchers using them.

In the present invention, DNA is extracted from skin epidermal debris as described above, treated with a desired restriction enzyme, and blunt-ended by terminal modification. A linker consisting of a double-stranded oligonucleotide containing the desired sequence is bound to this, and an amplification product partially containing the entire sequence of the letter is obtained by PCR. The amplified product is electrophoretically separated, transferred to a membrane filter, and bound to the labeled probe prepared as described above, to obtain an electropherogram.

The obtained electropherogram is taken into an image analyzer such as Molecular Imager (manufactured by Bio Rad), and when a fluorescently labeled probe is used, the mass center of the band emitting fluorescence is determined. Here, the weighted average of the DNA length is called the mass center. The mass center 1 calculates based on the following equation (1) based on the molecular weight of the marker DNA that has been subjected to the electric swim at the same time.

MC _av = ∑ (MWi XFI j) Z∑ (FI i)

Here, MC _av represents the mass center, and MW is the DNA length obtained from the marker DNA that was simultaneously electrophoresed. FI indicates the fluorescence intensity, and I indicates the position of the band. Based on the above equation, the average telomere length can be determined as the average soil standard deviation (kb), and the aging degree of the skin can be known from this value. Example

Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited thereto.

(Example 1) Collection of skin

(1) Selection of sampling site

The skin collection site is selected as follows.

In the case of a face, look at the face in a mirror and select the skin (Fig. 3) at the intersection of the vertical line L at the corner of the eye and the horizontal line L _{2 at the} upper end of the nostril while standing or sitting. Or, without looking in the mirror, touch the top of the bone with a clean finger and select the skin above it. .

For areas other than the face, select areas that are not exposed to sunlight, such as the buttocks and thighs.

(2) Preparation for skin collection

If the skin is to be collected on the face, wash the area around 頰 with stone 鹼 and rinse with water. Preferably, the area around 頰 was wiped with a cotton cottage further containing rubbing alcohol (about 70%).

When the skin was collected on a site other than the face, as in the case of the face, the skin was washed with stone, rinsed with water, and similarly wiped with alcohol.

(3) Skin sampling

A rash was applied to the skin collection site determined in (2) above, and the same site was rubbed several times lightly to collect skin epidermis debris. 1.3 mL of sterilized water (0.1% azide-containing MilliQ ultrapure water) was added to prepare the collected skin epidermis debris. did. The head and handle of the rasp, whose skin was scraped off as described above, were cut off, and the head was pinched with the attached tweezers, placed in this Etbendorf tube, and sealed.

(Example 2) Processing of collected skin samples

(1) Cell frame

The eppendorf tube containing the skin epidermal debris was frozen and thawed by immersing it in liquid nitrogen and then thawing it in warm water twice. Next, a small amount of concentrated NaOH was added to a final concentration of 12 mM, and the cells were disrupted by vigorous stirring with a Portex mixer. After this crushing, the head of the rasp was removed from the tube.

(2) Preparation of test sample

After spinning down the crushed material, it was overlaid with light mineral oil M-5904 (manufactured by Sigma) so as to have a 10% volume, and heated with 95 heat blocks for 10 minutes.

This is followed by the addition of 1 M Tris-HCl buffer (PH 7.0) to neutralize the aqueous solution containing the sample, and the sample under the oil is accurately pipetted out and eppendorf. Transferred to tubes and frozen at -80.

After the sample frozen at 80: was returned to room temperature, extraction was carried out using an IsoQuick Nucleic Acid Extraction Kit (ORCA Research Inc.). The extracted DNA was dissolved in TE (10 mM Tris-HCl (pH 8.0) containing ImM EDTA) and stored at 4. DNA concentration measurement was performed using Mupid mini gel electrophoresis tank (Cosmo Bio), 0.35% agarose (TYPE H, Wako Pure Chemical) gel, 5% glycerin, and 0.025% bromophenol blue (BPB ), A loading buffer containing 0.025% xylene FF was used. A DNA sample weighed by adding 5 L TE to 1 zL DNA solution and 10 L λ DNA (100 ng / mL) prepared for a control sample were applied to separate gels, and 1 XTAE buffer was added. Electrophoresis was performed in one (40 mM Tris-HC1 (pH 8.0) containing 5 mM acetic acid and ImM EDTA) and stopped when BPB reached 2/3 of the gel.

The gel was stained with 2 g / mL ethidium bromide, and each photographed on a UV transilluminator (VILBER LOURMAT TF-40M).

Image analysis (NIH Image) was performed on this photograph, and the DNA concentration was determined in comparison with the control.

(3) Storage of test sample

The collected samples were measured for the amount of keratinocytes and the amount of DNA. The amount of keratinocytes was measured with a Coulter particle size counter, and an average of 1.5 to ⁶ × 10 ⁶ cells was obtained from lmg of skin tissue. Variations in this range from test sample to sample do not affect telomere length measurements. Using Hoechst 33258 as a DNA binding indicator and measuring with a fluorescent plate reader (Millipore), 3.2-9.6 g of DNA was obtained.

The above DNA-containing tubes were stored at 170 until the number of samples collected was somewhat congruent.

(Example 3) Analysis of end-restricted DNA fragment TRF length by Southern blot method (1) Sample preparation

To a 1.5 mL tube, 10XH buffer (Takara Shuzo), 2 L of a DNA solution and sterilized water were added to a total volume of 19 L, and finally Hinfl (6U / ZL, Takara Shuzo) was added.

The reaction was carried out at 37 * C for 3 to 4 hours and subjected to electrophoresis. Samples that did not undergo electrophoresis immediately after the reaction were stored at 1:20.

(2) Agarose gel electrophoresis

Agarose (TYPE I, manufactured by Sigma) gel was prepared so that the bridge portion had a gel concentration of 1%> the pet portion was 0.8% (Marisol KS-8405, 20cm x 14cm). XBoyer buffer (50 mM Tris-HC1 (H8.0) containing 20 mM sodium acetate, 2 mM EDTA, 18 mM NaC1) was used as the electrophoresis buffer. did.

As markers, lkb DNA Ladder (GIBC0 BRL) adjusted to 0.5 g / lane and λ DNA Hind 111 digest (NIPPON GENE) adjusted to 0.3 Mg / lane were used.

A sample to which 3 L of each of a marker and a loading buffer had been added was ablated on a 0.8% agarose gel prepared as described above, pulled in at 85 volts, and then electrophoresed at 35 volts.

(3) Southern transfer,

After completion of the electrophoresis, the agarose gel was cut out, stained with a 2 / ig / mL ethidium mouth tip for 15 minutes, placed on a UV transilluminator, and photographed with a scale.

After photography, the gel was immersed in 0.25N HC1 and shaken at room temperature for 15 minutes, and then washed twice with distilled water. Next, the gel was immersed in a denaturing solution containing 0.2 M NaOH and 0.6 M NaCl, shaken at room temperature for 25 minutes, and then washed three times with distilled water.

This gel is immersed in a neutralization solution (0.2 M Tris-HC1 (pH 7.4) containing 0.6 M NaC1), shaken at room temperature for 30 minutes, and lightly once with distilled water. Washed. Thereafter, the plate was immersed again in the NeiHlazion ion solution and shaken at room temperature for 30 minutes.

In order to prevent air from entering the 3MM filter paper set in the plotting device filled with 6 X SSC, the gel was used. Schleicher & Schuel), 3MM filter paper immersed in 6 XSSC, paper husk, glass plate, and weight (2kg) were placed in this order and subjected to 晚 -blotting.

After the blotting, the membrane filter was immersed in 3X SSC, lightly drained, and the position of the well was marked on the UV transilluminator.

It was sandwiched between filter papers and heated with 80 (baking).

(4) D N A Hybridization

The probe for Purehai yellowtail Dize one cane down, 5'(TTAGGG) ₄ - was used 3 * (Takara Shuzo). The probes using ^{MEGALABEL TM DNA 5'-End La bel} ing ki t ( manufactured by Takara Shuzo), - was [§ ^{3 2} P] 5 'end labeled with ATP (manufactured by Amersham). The labeled probe was recovered by reverse-phase HPLC using a Chroma Spin-10 Column (manufactured by Clontech) according to a conventional method.

After soaking the baked filter in 3X SSC, the hybridization filter (IX Denhardt's solution, 1 M NaCK 50 mM Tris-HCU 1 OmM EDTA, 0.1% SDS, containing 50 g / mL denatured salmon sperm DNA), shaken at 65 for 3-4 hours, and completed prehybridization with the above probe.

After the prehybridization is completed, put the sample filter in a shielded bag, and add the labeled probe and 1 / z L of denatured salmon sperm DNA (10 mg / mL) to the hybridization buffer. 2 mL was added and sealed to prevent bubbles from entering.

Incubation was performed at 50, and hybridization was performed.

(5) Cleaning and autoradiography

After the hybridization, the filter was immersed in a washing buffer (4 × SSC, 0.1% SDS) and shaken at 55 for 15 minutes. After repeating this operation four times, the filter is well drained and covered with a Saran wrap. An X green film (Scientific Imaging Film, manufactured by Kodak) is placed in a cassette with an intensifying screen. ), And performed a default radiography at 180.

(6) Data analysis

The position of the developed film and the filter was aligned, and the position of the jewel was marked by magic. Since the TRF appeared on the smear, the peak of the smear density was detected with a densitometer (Ultra Scan XL Laser Densitometer, manufactured by Pharmacia). The distance from the peak to the peak was defined as the mobility, and the length of the TRF was determined from a calibration curve created from the mobility and the marker.

(Example 4) Measurement of average telomere length using alkaline phosphatase (AP) label and Z or biotin labeled probe (1) Synthesis of linkers composed of double-stranded synthetic oligonucleotides and primers for PCR

(1-1) Synthesis of linker

A linker consisting of a double-stranded oligonucleotide (SEQ ID NOS: 1 and 2) used to obtain a blunt-ended fragment was obtained by the phosphoramidite method using a DNA synthesizer (Pharmacia Biotech). Synthesized. That is, the amidite, which is a reaction substrate, is bound to the 3 'end of the nucleotide immobilized on the column, the unreacted substrate is removed, and the functional group is masked. After removal, the amidite was bonded again and the above procedure was repeated to synthesize. Oligonucleotides synthesized by the alkali treatment were excised from the column, deprotected, purified by reverse phase HPLC, and used as linkers in the following examples. Fractions were collected.

(1-2) Synthesis of primer for PCR

The TS primer (subtelomer primer, SEQ ID NO: 3) and CX primer (telomer primer, SEQ ID NO: 4) used in the PCR were prepared with a DNA synthesizer.

The (TTAGGG) ₄ probe synthesized in the same manner was treated with formaldehyde as a cross-linking agent (bifunctional reagent), and labeled with alkaline phosphatase (AP) directly bound chemically. AlkPhos Direct (Pharmacia) was used for this labeling.

The TRF obtained in Example 3 (1) was fractionated by agarose gel electrophoresis as shown in Example 3 (2). As a marker, a lkb DNA ladder (manufactured by BioRad) was used. (2) TRF detection

The gel electrophoresed as described above was transferred to a nitrocellulose membrane filter (OPTITRAN BA-S, manufactured by Schleider Schuel) using a transplotter (BioRad).

To this filter, 0.2 g / mL of the AP-labeled probe or the biotin-labeled probe obtained as described above was bound. The biotin-labeled probe was prepared by adding 0.3 g / mL of biotin-labeled dCTP (Pharmacia Biotech) and dNTP and reacting with 0.1 g / mL of Klenow fragment (Takara Shuzo). Then, it was obtained by cutting with the restriction enzyme Smal.

Then, in the case of an AP-labeled probe, it reacts with CDP-Star to generate chemiluminescence, and in the case of a biotin-labeled probe, 0.4 gZmL of streptavidin-conjugated HRP (manufactured by Behringer Mannheim) And 25 * C for 15 minutes. This is followed by 100 tM of hydrogen peroxide and 0.8 g / niL of fluorescein starch (manufactured by NEN Life Science Products) and / or 0.3 g / mL of 1,4-bicyclo [2 , 2.2] octane (1, 4-diazobicyclo [2, 2, 2] octane, DABCO) (Molecular Probe) was added to enhance the fluorescence intensity.

This fluorescence was detected by CDP-Star (Pharmacia).

(Example 5) Measurement of average telomere length using radiolabeled probe

(1) Synthesis of linker and PCR primer consisting of double-stranded oligonucleotides

In the same manner as in (1) of Example 4, linkers (SEQ ID NOS: 1 and 2) and PCR primers (SEQ ID NOs: 3 and 4) were synthesized using a DNA synthesizer (Pharmacia Biotech). (2) Obtaining TRF blunt ends

The DNA obtained from the skin epidermis debris obtained in Example 1 was treated with Hinfl (Takara Shuzo) at 37 for 3 to 4 hours to obtain a DNA fragment having cohesive ends and protruding ends. The following sequence is added to the subtelomere side of the DNA fragment (TRF) having the cohesive end and the protruding end obtained in (1) above.

5 'AATCCGTCGAGCAGAGTTC 3'

Linker S having 3 ′ TTAGGCAGCTCGTCTCAAGTGA 5 ′ (SEQ ID NO: 1) was bound (see FIG. 2).

Then, after ligation of linker T (see Fig. 2) to the 3 'protruding end of the telomeric side of the sub-telomere blunt-ended TRF, end-filling with DNA polymerase was performed. A TRF blunt end having a telomeric end was obtained. The linker T contains the base sequence of the primer for the PCR amplification step described later.

-GGTTAGGGTTAG 3 '

-CCAATCCCAATC 5 '

The DNA was ligated using DNA Ligation Kit ver. 1 (Takara Shuzo). A TRF sample having blunt ends at both ends is placed in a microtube, and is incubated using DNA Ligation Kit ver. 1 (Takara Shuzo) according to a conventional method. Then, 4 volumes of ice-cold ethanol was added for precipitation to separate blunt-ended fragments.

(3) Amplification

Using this blunt-ended fragment as type I, the TS primer (sense primer, SEQ ID NO: 3) and the CX primer (antisense primer) synthesized in (112) of Example 4 were used. Using the primer and SEQ ID NO: 4), PCR was carried out in a PCR mixture having the following composition on a Thermal Cycler PC-800 (manufactured by Astec).

20 mM Tris-HC1 (pH 8.3), 68 mM KCU 1.5 mM MgCl ₂ > ImM EGTA, 1.0 5% Tween 20, 5 g ITAS (telomerase Atsusei internal standard), 0.1 ug TS primer (Takara Shuzo), 0.5 / M T4 gene 32 protein ( Boehring er Mannheim), 50 M dNTPs, 2 U Taq poly ra one peptidase (Takara ^{Shuzo), 4 Ci C α - 3} 2 P] dCTP ( manufactured by Ame rsh am), 0. 1 g A PCR reaction mix containing CX primer and Wax for PCR (GIBCOZBRL) was prepared.

The CX primer was isolated at the bottom of the tube by a wax, and the reaction mix containing other components was overlaid thereon. The total volume of this reaction mix was 80 L.

Using a thermal cycler PC-800 (manufactured by Astec), PCR was performed for 32 cycles, each cycle consisting of 94 40 sec / 50 40 sec / U ° C 50 sec.

(4) Electrophoretic separation and detection of amplification products

(4-1) Separation and detection of amplification products

The amplification product amplified in (3) above was treated, and TRF obtained from skin-derived DNA was fractionated by agarose gel electrophoresis. As a marker, 1 kb DNA ladder (manufactured by BioRad) was used.

The telomer-containing DNA fragment and the like electrophoresed in Example 3 were transferred to a nitrocellulose membrane filter (OPTITRANBA-S, manufactured by Schleicher & Schuel) using a gel trans- blotter (manufactured by BioRad).

The filter was bound with a radiolabeled probe of 0.

(4-2) Detection of average telomere length

The electropherogram obtained as described in (4-1) above is The analysis was performed with a history (NIH Image 1.59), incorporated into Molecular Imager (manufactured by BioRad), and the mass center was calculated according to the following equation (1).

MC _av = ∑ (MWj XFI ₍ ) / ∑ (FI i)… Equation (1)

In here, MC _av represents the mass center, MW is a DNA length to determine Ri by Ma one car DNA was subjected to electrophoresis at the same time. FI represents the fluorescence intensity, and I represents the position of the band.

The average of the DNA measured from the top of the metacarpal, below the eye and above the genitalia (hereinafter referred to as the face except the top of the abdomen), and from the dermis skin epidermis debris The telomere length is shown in Table 1 as the average value of TRF soil standard deviation (kb).

[Table 1] Subject mean TRF (Djta-containing end-restricted DNA fragment length (mean soil SD (kb))

(Years) (n) 上 Above the bone section Face parts other than those on the left Buttocks

20-24 24 10.9 ± 0.7 1 1 0 ± 1.8 12.6 ± 0.2

31-38 15 8.0 ± 1.0 9.1 1st 2.5 11.5 Sat 0.3

48—65 14 6.2 ± 2.0 0.3 ± 3.6 10.3 Sat 1.1 As can be seen from Table 1, the average telomere length of any part becomes shorter as the age increases. I was Except for the average telomere length on the 頰 bone apex, the standard deviation (SD) of the average telomere length increased in proportion to age. In addition, the reduction in mean telomere length on the apex of the tibia was the greatest, but the increase in SD was small. The shortening of the hip telomeres was the slowest. Looking further at the average telomere length, It was the buttocks of the face except for the top.

From the above results,

(1) With age, shorten skin telomeres at any site

(2) The degree of shortening of skin telomeres varies greatly with age as individuals age

(3) Does not cause similar telomere shortening in any part of the face

(4) テロ There is little variation in telomere shortening on the bone crest, and it can be used as a good index of skin aging by selecting a specific part.

(5) The degree of shortening of the average telomere length suggests that the buttocks are less susceptible to photoaging.

(6) The average telomere length of the buttocks can be a good criterion for measuring the age of the skin with age of the same individual.

Was revealed. (Example 6) Production of high specific activity radiolabeled probe

(1) Preparation of telomere detection probe and template

Telomeres were prepared as follows. Primer for telomere DNA synthesis that can be cleaved from the telomere by a restriction enzyme at a later step without 5 'end labeling

5 'CACGTGCTCGAGCCC 3' (SEQ ID NO: 13)

Was synthesized using a DNA synthesizer (Pharmacia Biotech).

In addition, the template

3 ′ GTGCACGAGCTCGGG (CCCAAT) ₄ TCTAATCTGA 5 ′ (SEQ ID NO: 14) was also synthesized in the same manner as the above primer. (2) Synthesis of probe for telomere detection

In 67 mM potassium phosphate buffer (PH7.4) containing 6.7 mM MgCl ₂ and ImM 2-mercaptoethanol, 20 M of primer and template synthesized in the above (1) were added; O Li Gore j click Les O Chi de having the sequence 5'- AGATTAGACT- 3 ', of ^{33 / i M [α - 3} H] of dGTP, 22 / z M [α - 3 H] dTTP, and II u the [c one ³ H] dATP in the M, the solution 10 / z L (pH 7.4) mixed combined in containing K Lenow fragment (Takara Shuzo) 0.37 Yuni' Bok and a large fragment of DNA polymerase I of E. coli The reaction was performed at 10 for 60 minutes. By sandwiching between 5'-AGATTAGACT- 3'-oligonucleotides, the labeled probe for telomere detection used in the subsequent step can be PCR-amplified (see Fig. 4). In FIG. 4, 13 represents the oligonucleotide of SEQ ID NO: 13, and 14 represents the oligonucleotide of SEQ ID NO: 14. Also, Smal and Hindlll represent the restriction enzyme cleavage sites and their recognition sites.

The labeled product was purified using a gel filtration column, Quick Spin Column Sephade x G-25 (manufactured by Boehringer Mannheim), and 10 mM tris buffer (pH 8.0) -20 mM KC1.

Then, a restriction enzyme SmaI (manufactured by Takara Shuzo) was added to 10 mM Tris buffer (PH8.0) —2 OmM KC1 to 6 units of ZlOw L, and reacted at 30 ×: for 40 minutes. This digestion product was further purified using a Chroma Spin-10 column (Clontech) and polyacrylamide gel electrophoresis in the same manner as described above, and was further digested with the restriction enzyme Hindlll (Takara Shuzo). After digestion, the digestion product was purified in the same manner in the presence of 7 M urea.

The radiolabeled probe purified in this way was measured by a liquid scintillation counter, and the radioactivity ratio was 2 to 7 × 10 ⁷ cpmZpmol. Activity was obtained.

This value was at least 6 times, and at most 20 times more than the specific activity of ^1-3 × 10 ⁶ of the conventional end-labeled probe with [α- 32 P] dATP. Therefore, the use of this radiolabeled probe can reduce the amount of TRF to be subjected to agarose gel electrophoresis to 1/6 to 1/20 that of a conventional probe. Therefore, it is useful for measuring the degree of skin aging without leaving any trace, such as for facial skin, or when only a very small amount of skin epidermis is obtained. Industrial applicability

According to the method of the present invention, the degree of skin aging can be measured quickly and accurately using a small amount of DNA.

In addition, in the present invention, the use of a radioactive label or the use of a small amount of a radioactive label allows rapid, safe and highly sensitive measurement of skin aging.

Claims

The scope of the claims

1. A step in which both ends of a fragment having one attachment end and a telomere-specific 3 'protruding end obtained by treating DNA extracted from skin epidermal debris with a restriction enzyme into blunt-end fragments by terminal modification; A step of amplifying by PCR after binding a linker to both ends of the blunt-ended fragment, and electrophoretically separating the obtained amplification product containing at least a part of the entire telomere sequence and labeling the average telomere length from the distribution Detecting with a probe.

2. The method according to claim 1, wherein the restriction enzyme is a restriction enzyme selected from the group consisting of Hinfl, MspI / HpalK and Rsa1.

3. The blunt-ended fragment binds a linker consisting of a double-stranded oligonucleotide having a cohesive end complementary to one of the cohesive ends to the cohesive end, and From the 3 'end of the protruding end of the fragment having the 5'-CCCTAA-3' repeat sequence complementary to the 6-24 base sequence at the 5 'end of the single-stranded oligonucleotide moiety containing the 3'-repeated sequence A double-stranded 3 to 12 base pair oligonucleotide is ligated and used as a primer to obtain a double-stranded oligonucleotide with blunt ends at both ends using DNA polymerase. The method for measuring skin aging according to claim 1 or 2, wherein the skin aging degree is measured.

4. The method according to claim 1, wherein the sense primer and the antisense primer used in the amplification step have a nucleotide sequence contained in each of the two types of linkers. The method for measuring the degree of skin aging according to any one of the above.

5. Telos obtained by treating DNA extracted from skin epidermal debris with restriction enzymes A method for measuring the degree of skin aging by detecting a DNA fragment containing a primer with a labeling probe for telomere detection, which is labeled with a label selected from the group consisting of radioisotopes, fluorescent compounds and chemiluminescent compounds.

6. The labeled probe has a base sequence complementary to 5 ′ (TTAGGG) _n 3 ′ and / or 5 ′ (TAACCC) _n 3 ′ (n represents an integer of 3 to 5) as a labeled probe, and template and a restriction enzyme recognition sequence adjacent to a nucleotide sequence, a primer containing the restriction enzyme recognition sequence, and [a - ³ H] on substrates containing at least a dNTP by the action of DNA polymerase ra one peptidase reaction 6. The method for measuring the degree of skin aging according to claim 5, wherein the method is obtained by obtaining a product and reacting the reaction product with the restriction enzyme.

7. Degree of skin aging for carrying out the method according to any one of claims 1 to 6, comprising at least two of an instrument for collecting skin debris and a tube containing a solution for DNA extraction. Measurement kit.

8. The skin according to claim 7, characterized in that a rasp including a head in which a thorn is implanted and a grip connected to the head is used as an instrument for collecting skin epidermis debris. Kit for measuring the degree of aging.

9. A rasp consisting of a head with vertical and horizontal thorns made of fiber with sharp points.

10. The rasp according to claim 9, wherein the grip portion is connected so as to be separable from the head.

11. The rasp according to claim 9 or 10, wherein the fiber diameter is 1 to 10 m.

12. The rasp according to any one of claims 9 to 11, wherein the tip angle of the fiber is 30 ° or less.