WO2001030839A1 - Nouveau polypeptide, proteine humaine 33 de liaison a l'arn, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine 33 de liaison a l'arn, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001030839A1
WO2001030839A1 PCT/CN2000/000381 CN0000381W WO0130839A1 WO 2001030839 A1 WO2001030839 A1 WO 2001030839A1 CN 0000381 W CN0000381 W CN 0000381W WO 0130839 A1 WO0130839 A1 WO 0130839A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
binding protein
human rna
seq
Prior art date
Application number
PCT/CN2000/000381
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Bio Road Gene Development Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Bio Road Gene Development Ltd. filed Critical Shanghai Bio Road Gene Development Ltd.
Priority to AU13783/01A priority Critical patent/AU1378301A/en
Publication of WO2001030839A1 publication Critical patent/WO2001030839A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, A RNA binding protein 33, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • RNA-binding protein also known as quaking protein
  • qkl rat
  • Hqk human
  • Xqua xenopus
  • RNA-binding protein containing a KH domain is an RNA-binding protein containing a KH domain.
  • the KH domain is a conserved sequence in different proteins, and it has a certain effect on RNA metabolism (Gibson e t al., 1993).
  • qkl genomic structure of the mouse has been proved by research, and its research on qkl expression in vivo and in vitro has also yielded results. According to the results of expression profiling studies, qkl is highly expressed in the brain and heart, and is also expressed in other tissues. 3 'UTRs regulate qkl expression (Mamm Genome 1999 July; 10 (7): 662-9).
  • the mRNA sequence encoding the quaking protein is conserved. This conservation also includes the 3 'UTR of the transcription process (Gene 1997 188: 199-206).
  • the quaking protein shows the same biological function whether it is in the model organism "Xenopus" or in mammals, especially in the development of spinal impetus, its function of regulating RNA metabolism is Consistent.
  • Xenopus During the early embryonic development of Xenopus, Xqua is expressed in the nucleus and cytoplasm; in the later development of the embryo, Xqua is mainly expressed in mesoderm cells and neural tissue cells.
  • the function of Xqua in embryonic development mainly affects the accumulation of some important mRNAs (such as Xnot, Xbra, gsc, etc.) during development (Genes Dev 1997 Sep 1; 11 (17): 2176-90) ⁇
  • quaking protein has the following functions in different organisms: (1) quaking protein has RNA binding activity; (2) quaking protein is expressed in different tissues, especially in brain and heart The expression level is high; (3) quaking protein can regulate RNA metabolism and regulate the transcription process; (4) quaking protein has special significance during embryonic development; (5) quaking protein cannot be used during nervous system development lack.
  • the polypeptide of the present invention was inferred and identified as human RNA binding protein 33 (HRBP33), or human quaking protein 33 (H quakingP33).
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human RNA binding protein 33.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human RNA-binding protein 33.
  • Another object of the present invention is to provide a method for producing human RNA-binding protein 33.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human MA binding protein 33.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide-human RNA-binding protein 33 of the present invention.
  • Another object of the present invention is to provide diagnosis and treatment of diseases related to abnormalities of human RNA binding protein 33 Methods.
  • a novel isolated human RNA binding protein 33 is provided.
  • the polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof, or Active fragments, or active derivatives, analogs thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • a polynucleotide encoding these isolated polypeptides, the polynucleotide comprising a nucleotide sequence having at least 100 nucleotides with a nucleotide sequence selected from the group consisting of % Identity: (a) a polynucleotide encoding the aforementioned human RNA binding protein 33; (b) a polynucleotide complementary to the polynucleotide (a).
  • the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 853-1749 in SEQ ID NO: 1; and (b) a sequence having 1-1933 in SEQ ID NO: 1 Sequence of bits.
  • FIG. 1 is a comparison diagram of amino acid sequence homology between human RNA-binding protein 33 and mouse RNA-binding protein of the present invention.
  • the upper sequence is human RNA-binding protein 33, and the lower sequence is mouse RNA-binding protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human RNA-binding protein 33.
  • 33kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state.
  • isolated human RNA-binding protein 33 means that human RNA-binding protein 33 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human RNA binding protein 33 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human RNA binding protein 33 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human RM binding protein 33, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant technology from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human RNA-binding protein 33.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human RNA-binding protein 33 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
  • the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ ) like this
  • a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or prote
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a length of 1933 bases, and its open reading frame (853-1749) encodes 298 amino acids.
  • the polypeptide is 100% homologous to the mouse RNA-binding protein, and it can be inferred that the human RNA-binding protein 33 has a similar structure and function to the mouse RNA-binding protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genes Group DNA or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • the "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least SO-SO nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human RNA binding protein 33.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • polynucleotide sequence encoding the human RNA-binding protein 33 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the D-sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include, but are not limited to: (D-DNA or DM-RNA hybridization; ( 2 ) the presence or absence of marker gene functions; (3) determination of the level of human RNA-binding protein 33 transcripts; (4) immunization Technology or measuring biological activity to detect protein products expressed by genes. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human RNA-binding protein 33 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method for amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE- rapid cDNA end amplification method
  • Primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human RNA binding protein 33 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding the human RNA-binding protein 33 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs. Ding Yi's transcript of stubbornness. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human RNA-binding protein 33 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human RNA binding protein 33 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cell is re- Cultivate for a while.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • the polypeptide of the present invention has many important functions in the human body, including the polypeptide of the present invention has RNA binding activity; the polypeptide of the present invention can regulate RNA metabolism and can regulate the transcription process; the polypeptide of the present invention has special significance in the process of embryonic development The polypeptide of the present invention is also indispensable during the development of the nervous system.
  • the polypeptide of the present invention can be used to treat and diagnose many diseases, such as malignant tumors, endocrine system diseases, neurological diseases, immune diseases, human acquired immune deficiency syndrome (AIDS), and the like.
  • diseases such as malignant tumors, endocrine system diseases, neurological diseases, immune diseases, human acquired immune deficiency syndrome (AIDS), and the like.
  • AIDS human acquired immune deficiency syndrome
  • the polypeptide of the present invention can be used for treating human malignant tumors, including but not limited to gastric cancer, liver cancer, colorectal cancer, breast cancer, lung cancer, prostate cancer, cervical cancer, pancreatic cancer, and esophageal cancer.
  • polypeptides of the present invention can be used to treat human developmental disorders, including but not limited to the following: spina bifida, craniocerebral fissure, anencephaly, malocclusion, foramen deformity, Down syndrome, congenital hydrocephalus, lead Aqueduct malformation, cartilage hypoplasia, dwarfism, spinal epiphyseal dysplasia, pseudochondral dysplasia, Langer-Giedion syndrome, funnel chest, gonad hypoplasia, congenital adrenal hyperplasia, urethral fissure, cryptorchidism, with body Dwarf malformations such as Conradi and Danbolt-Closs syndromes, congenital glaucoma or cataracts, congenital lens position abnormalities, congenital blepharoplasia, retinal dysplasia, congenital optic atrophy, congenital sensory neurological hearing loss , Cracked hand and foot, teratosis, Williams syndrome, Alagille syndrome,
  • polypeptides of the present invention can be used to treat common diseases of the nervous system of humans including:
  • Cerebrovascular disease transient ischemic attack, cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage; intracranial space occupying lesions: glioma, meningiomas, neurofibromas, pituitary adenomas, intracranial 1
  • Nervous system degenerative diseases Alzheimer's disease, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis;
  • Neuromuscular diseases myasthenia gravis, spinal muscular atrophy, muscular pseudohypertrophy, Duchenne muscular dystrophy, tonic muscular dystrophy, myasthenia, retarded dyskinesia, dystonia;
  • neurocutaneous syndrome neurofibromatosis, tuberous sclerosis, cerebral trigeminal neurohemangioma, ataxia capillary dilatation;
  • Peripheral nerve disease trigeminal neuralgia, facial paralysis, bulbar palsy, sciatica, Guillain-Barre syndrome.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human RNA-binding protein 33.
  • Agonists enhance biological functions such as human RM-binding protein 33 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human RNA-binding protein 33 can be cultured together with labeled human RNA-binding protein 33 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human RM binding protein 33 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of human RM-binding protein 33 can bind to human RNA-binding protein 33 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert biological functions.
  • human RNA-binding protein 33 When screening compounds as antagonists, human RNA-binding protein 33 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human RNA-binding protein 33 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human RNA binding protein 33 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human RNA-binding protein 33 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides a needle Antibodies to human RNA-binding protein 33 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human RNA-binding protein 33 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human RNA-binding protein 33 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human RNA-binding protein 33.
  • Anti-human RNA-binding protein 33 antibodies can be used in immunohistochemical techniques to detect human RNA-binding protein 33 in biopsy specimens.
  • Monoclonal antibodies that bind to human RNA-binding protein 33 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human RNA-binding protein 33 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human RNA binding protein 33 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human RNA binding protein 33.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human RNA-binding protein 33.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human RNA-binding protein 33 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of human RNA-binding protein 33 detected in the test can be used to explain the importance of human RM-binding protein 33 in various diseases and to diagnose diseases in which human RNA-binding protein 33 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • Polynucleotides encoding human RNA-binding protein 33 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat cell proliferation caused by non-expression or abnormal / inactive expression of human RNA-binding protein 33 Colonization, development or metabolic abnormalities. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human RNA-binding protein 33 to inhibit endogenous human RNA-binding protein 33 activity.
  • a mutated human RNA-binding protein 33 may be a shortened human RM-binding protein 33 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human RNA-binding protein 33.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human RNA-binding protein 33 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human RM-binding protein 33 can be found in existing literature (Sambrook, et al.).
  • the recombinant polynucleotide encoding human RNA-binding protein 33 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human RNA-binding protein 33 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology. For example, solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human RM-binding protein 33 can be used for the diagnosis of diseases related to human RNA-binding protein 33.
  • the polynucleotide encoding human RNA-binding protein 33 can be used to detect the expression of human RNA-binding protein 33 or the abnormal expression of human RNA-binding protein 33 in a disease state.
  • the DNA sequence encoding human RNA-binding protein 33 can be used to hybridize biopsy specimens to determine the expression of human RNA-binding protein 33.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human RM binding protein 33 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human RNA binding Transcript of protein 33.
  • RNA-binding protein 33 can also be used to diagnose human RNA-binding protein 33-related diseases.
  • Human RNA-binding protein 33 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human RNA-binding protein 33 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine the presence or absence of mutations in a gene.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with the Johns Hopkins University Welch Medica 1 Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human RNA binding protein 33 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human RNA binding protein 33 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA I solat ion Kit (product of Qiegene). 2ug po ly (A) mRNA was reverse transcribed to form cDNA.
  • Directional insertion of cDNA fragments into pBSK (+) using the Smar t cDNA Cloning Kit (purchased from Clontech) DH5 ct was transformed into the multi-cloning site of the vector (product of Clontech), and the bacteria formed a cDNA library.
  • the 0108F07 clone contained a full-length cDNA of 1933 bp (as shown in Seq ID NO: 1), and an open reading frame (0RF) of 897 bp from 853 bp to 1749 bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0108F0 7 and the encoded protein was named human RNA binding protein 33.
  • the sequence of the human RNA-binding protein 33 of the present invention and the protein sequence encoded by the same were analyzed using the Blas t program (Basic loca l al ignment search tool) [Al schul, SF et al. J. Mol. Biol. 1990; 215: 403-10], and perform homology search in databases such as Genbank and Switzerland.
  • the gene with the highest homology to the human RNA-binding protein 33 of the present invention is a known mouse RNA-binding protein, and the accession number encoded by the protein in Genbank is AF090402.
  • the results of protein homology are shown in Figure 1. The two are highly homologous and their identity is 100%; the similarity is drawn.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'- CCTGTTTGGGTGAAAGTGGTTCTAG-3 '(SEQ ID NO: 3)
  • Pr imer2 5'- GCTGAGTTGGAGGACAACAATTTC -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L C1, 10 mmol / L Tris s-Cl, (pH 8. 5), 1.5 ⁇ l / L MgCl 2 , 200 ⁇ ⁇ / L in a reaction volume of 50 ⁇ 1 dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech). Reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min a . Simultaneously set ⁇ -act in as positive during RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invit Rogen). DNA sequence analysis results showed that The D sequence is identical to l-1933bp shown in SEQ ID NO: 1.
  • RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA binding protein 33 coding region sequence 853bp to 1749bp
  • the 32P- labeled probes (about 2 x l0 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM KH 2 P0 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DM. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human RNA-binding protein 33
  • Primer3 5'- CCCCATATGATGATTTTTTCTGGTGGTTGACA-3 '(Seq ID No: 5)
  • Primer4 5'- CCCGGATCCTTACTTGCCGGTGGCGGCTCGGTCT-3' (Seq ID No: 6)
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using pBS-0108F07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ l containing 10 pg of pBS-0108F07 plasmid, primers Primer-3 and Primer-4, and 1 J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The chromatography was performed using an affinity column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
  • the purified human RNA-binding protein 33 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 33 kDa ( Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human RM-binding protein 33-specific peptides:
  • NH 2 -Met-Ile-Phe-Ser-Gly-Gly-Cys-Gln-Glu-Thr-Lys-Asp-Met-Tyr-Asn-COOH SEQ ID NO: 7
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin for methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex with complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human RNA-binding protein 33.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine 33 de liaison à l'ARN, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine 33 de liaison à l'ARN.
PCT/CN2000/000381 1999-10-28 2000-10-27 Nouveau polypeptide, proteine humaine 33 de liaison a l'arn, et polynucleotide codant pour ce polypeptide WO2001030839A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU13783/01A AU1378301A (en) 1999-10-28 2000-10-27 A novel polypeptide-human rna-binding protein 33 and a polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99119885A CN1302812A (zh) 1999-10-28 1999-10-28 一种新的多肽－人rna结合蛋白33和编码这种多肽的多核苷酸
CN99119885.9 1999-10-28

Publications (1)

Publication Number Publication Date
WO2001030839A1 true WO2001030839A1 (fr) 2001-05-03

Family

ID=5281176

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000381 WO2001030839A1 (fr) 1999-10-28 2000-10-27 Nouveau polypeptide, proteine humaine 33 de liaison a l'arn, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1302812A (fr)
AU (1) AU1378301A (fr)
WO (1) WO2001030839A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997046684A1 (fr) * 1996-06-06 1997-12-11 University Of Massachusetts Proteines complexes se liant a des recepteurs non actives

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997046684A1 (fr) * 1996-06-06 1997-12-11 University Of Massachusetts Proteines complexes se liant a des recepteurs non actives

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KONDO T. ET AL.: "Genomic organization and expression analysis of the mouse qkl locus", MAMM. GENOME, vol. 10, July 1999 (1999-07-01), pages 662 - 669 *

Also Published As

Publication number Publication date
AU1378301A (en) 2001-05-08
CN1302812A (zh) 2001-07-11

Similar Documents

Publication Publication Date Title
WO2001072812A1 (fr) Nouveau polypeptide, bromodomaine humain 10, et polynucleotide codant pour ce polypeptide
WO2002020795A1 (fr) Nouveau polypeptide, hexokinase proteine 9.68, et polynucleotide codant ce polypeptide
WO2001031030A1 (fr) Nouveau polypeptide, phosphodiesterase 21 humaine de type acide sphingomyelinase, et polynucleotide codant pour ce polypeptide
WO2001030839A1 (fr) Nouveau polypeptide, proteine humaine 33 de liaison a l'arn, et polynucleotide codant pour ce polypeptide
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001038379A1 (fr) Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001038521A1 (fr) Nouveau polypeptide, proteine humaine 42 de liaison au calcium, et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001030837A1 (fr) Nouveau polypeptide, galectine 15, et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001031022A1 (fr) Nouveau polypeptide, arginyl arnt synthetase 44, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001030827A1 (fr) Nouveau polypeptide, une proteine 56 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001030834A1 (fr) Nouveau polypeptide, proteine 33 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001027148A1 (fr) Nouveau polypeptide, facteur homo 56 riche en glutamine(q), et polynucleotide codant pour ce polypeptide
WO2001027283A1 (fr) Nouveau polypeptide, proteine 16 de type transcriptase humaine inverse, et polynucleotide codant pour ce polypeptide
WO2001030820A1 (fr) Nouveau polypeptide, une proteine 54 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001031001A1 (fr) Nouveau polypeptide, facteur auxiliaire 28 du facteur de demarrage de la traduction, et polynucleotide codant pour ce polypeptide
WO2001029075A1 (fr) Nouveau polypeptide, proteine 129 activant la proteine g, et polynucleotide codant pour ce polypeptide
WO2001030825A1 (fr) Nouveau polypeptide, facteur humain d'epissage 25, et polynucleotide codant pour ce polypeptide
WO2001030826A1 (fr) Nouveau polypeptide, une serine/threonine kinase 29, et polynucleotide codant pour ce polypeptide
WO2001029080A1 (fr) Nouveau polypeptide, une proteine humaine hmg-13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP