WO2001021791A2

WO2001021791A2 - Stargazin-like neuronal ca2+-channel gamma subunit polypeptides

Info

Publication number: WO2001021791A2
Application number: PCT/GB2000/003685
Authority: WO
Inventors: Jeffrey John Clare; Mary Plumpton; Fraser John Moss; Philippe Sanseau
Original assignee: Glaxo Group Limited
Priority date: 1999-09-23
Filing date: 2000-09-25
Publication date: 2001-03-29
Also published as: WO2001021791A3; AU7304600A; GB9922571D0; GB2361923A; GB0112374D0

Abstract

A stargazin-like polypeptide comprises: (i) the amino acid sequence of SEQ ID NO: 4, 6 or 2; or (ii) a variant thereof capable of modulating the steady state inactivation of an α1 pore-forming subunit of a voltage-gated calcium channel.

Description

NOVEL PROTEIN

Field of the Invention

The present invention relates to stargazin-related polypeptides.

Background of the Invention

Ion channels are involved in a wide variety of neurological and other disorders in man. Defects in genes encoding voltage-gated calcium channels cause epilepsy phenotypes in mice. The stargazer mouse shows spike wave seizures similar to absence epilepsy. Recently, the gene responsible for this phenotype has been identified and shown to encode a protein with structural homology to the gamma subunit of skeletal muscle calcium ion channels (CACNLG) Letts et al, Nature Genetics 1998 19:340-347. The gene product, stargazin, is the first gamma- like subunit found to be expressed in the brain and is now known as γ2. Stargazer mice carry a mutation of the γ 2 gene. The seizure phenotype can be explained in terms of altered electrophysiological properties of the calcium channels with which it would normally associate. In the normal state, both muscle and neuronal γ subunits modulate the properties of the voltage-sensing ion- translocating γl subunit. γ2 causes the channels to inactivate at more negative potentials. In the stargazer mutant, absence of the subunit would be expected to give decreased channel inactivation at resting membrane potentials, facilitating increased entry of calcium into the cell, and potentially leading to increased neurotransmitter release.

Summary of the Invention

Stargazin-like polypeptides are now provided which are screening targets for the identification and development of novel pharmaceutical agents, including agonists and antagonists of the stargazin-like polypeptides. These agents may be used in the treatment and/or prophylaxis of disorders such as epilepsy, episodic ataxia, spinocerebellar ataxia, hypertension, ischemic heart disease, arrhythmia, angina, pain, cerebal ischemia, Alzheimer's disease, neuroprotection, stroke, diabetes, cerebral vasospasm, atherosclerosis, tardive diskinesia, peripheral vascular disease, immunosuppression, cancerous diseases, migraine, headache, bipolar disorder, unipolar depression, anxiety, Parkinson's disease, cognitive disorders, opthalmic diseases neuromuscular disorders and tinnitus. Accordingly, the present invention provides an isolated stargazin-like polypeptide comprising

(i) the amino acid sequence of SEQ ID NO: 4, 6 or 2; or (ii) a variant of sequence (i). Such a variant is typically capable of modulating the steady state inactivation of an 1 pore-forming subunit of a voltage-gated calcium channel.

According to another aspect of the invention there is provided a polynucleotide encoding a polypeptide of the invention. Preferably the nucleotide sequence is a cDNA sequence. A suitable comprises:

(a) the nucleic acid sequence of SEQ ID NO: 3, 5 or 1 and/or a sequence complementary thereto;

(b) a sequence which hybridises under stringent conditions to a sequence as defined in (a);

(c) a sequence that is degenerate as a result of the genetic code to a sequence as defined in (a) or (b); or (d) a sequence having at least 60% identity to a sequence as defined in

(a), (b) or (c).

The invention also provides: an expression vector which comprises a polynucleotide of the invention and which is capable of expressing the polypeptide of the invention; - a host cell comprising an expression vector of the invention; a method of producing a polypeptide of the invention comprising maintaining a host cell of the invention under conditions suitable for obtaining expression of the polypeptide; an antibody specific for a polypeptide of the invention; - a method for identification of a substance that exhibits stargazin-like calcium channel modulating activity, comprising contacting a polypeptide of the invention in the presence of an 1 subunit of a calcium channel with a test compound and monitoring for calcium channel activity; a method for identification of a substance that modulates the interaction between α or β calcium channel subunits and a polypeptide of the invention comprising contacting the polypeptide with a test substance in the presence of or β calcium channel subunit and monitoring the interaction between the subunit and the polypeptide; a method for the identification of a substance that modulates voltage-gated calcium channel γ -subunit activity and/or expression, which method comprises:

(i) contacting a test substance and a polypeptide, a polynucleotide, an expression vector or a host cell according to the invention, and (ii) determining the effect of the test substance on the activity and/or expression of the said polypeptide or the polypeptide encoded by said polynucleotide, thereby to determine whether the test substance modulates voltage-gated calcium channel γ-subunit activity and/or expression, a substance which modulates calcium channel activity and which is identifiable by the method referred to above; - a method of treating a subject having a disorder that is responsive to modulation of calcium channel activity, which comprises administering to said patient an effective amount of a substance of the invention; and use of a substance that modulates stargazin activity in a method of formulating a medicament for treatment or prophylaxis of a disorder that its responsive to modulation of stargazin activity, in a human patient.

Preferably the disorder is selected from epilepsy, episodic ataxia, spinocerebellar ataxia, hypertension, ischemic heart disease, arrhythmia, angina, pain, cerebal ischemia, Alzheimer's disease, neuroprotection, stroke, diabetes, cerebral vasospasm, atherosclerosis, tardive diskinesia, peripheral vascular disease, immunosuppression, cancerous diseases, migraine, headache, bipolar disorder, unipolar depression, anxiety, Parkinson's disease, cognitive disorders, opthalmic diseases neuromuscular disorders and tinnitus.

Brief Description of the Figures

Figure 1. Shows a multiple alignment of the amino acid sequences of various human Stargazin-like genes identified with the mouse Stargazin sequence. They are described as CACNG4, CACNG9 and CACNG8. Identical amino acids shared by all three protein sequences are shaded and boxed. Identical amino acids shared by CACNG4 and CACNG9 are shaded but not boxed. Figure 2. Shows the amino acid sequence of CACNG4. Predicted transmembrane regions are underlined and potential N-glycosylation site and predicted kinase phosphorylation sites are marked. Figure 3. Shows the amino acid sequence of CACNG9. Predicted transmembrane regions are underlined and potential N-glycosylation sites and predicted kinase phosphorylation sites are marked.

Figure 4. Shows the amino acid sequence of CACNG8. Predicted transmembrane regions are underlined, potential N-glycosylation site and, predicted protein kinase phosphorylation sites are marked.

Brief Description of the Sequences

SEQ ID No 1 is the DNA and amino acid sequence of human protein CACNG8 and its encoding DNA.

SEQ ID No 2 is the amino acid sequence alone of CACNG8. SEQ ID No 3 is the DNA and amino acid sequence of human protein CACNG4 and its encoding DNA.

SEQ ID No 4 is the amino acid sequence alone of C ACNG4. SEQ ID No 5 is the DNA and amino acid sequence of human protein CACNG9 and its encoding DNA

SEQ ID No 6 is the amino acid sequence of CACNG9. SEQ ID No 7 is the DNA and amino acid sequence of the long form of human protein CACNG9 named CACNG9L. SEQ ID No 8 is the amino acid sequence of the long form of human protein CACNG9 named CACNG9L.

Detailed Description of the Invention Throughout the present specification and the accompanying claims the words

"comprise" and "include" and variations such as "comprises", "comprising", "includes" and "including" are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows. The present invention relates to voltage-gated calcium channel γ-subunits.

Human stargazin-like or CACNG proteins, referred to herein as CACNG8, 4, 9 and 9L, and variants thereof are provided. Sequence information for CACNG8, 4, 9 and 9L is provided in SEQ ID NOS: 1, 3, 5 and 7 (nucleotide and amino acid) and in SEQ ID NOS: 2, 4, 6 and 8 (amino acid) respectively. A polypeptide of the invention may thus consist essentially of the amino acid sequene of SEQ ID NO: 2, 4, 6 or 8 or a variant sequence. A polynucleotide of the invention may therefore consist essentially of the nucleic acid sequence of SEQ ID NO: 1, 3, 5 or 7 and/or a sequence complementary or hybridisable under stringent conditions thereto.

In the context of this invention the term "isolated" is intended to convey that the protein is not in its native state, insofar as it has been purified at least to some extent or has been synthetically produced, for example by recombinant methods. The polypeptide may be mixed with carriers or diluents which will not interfere with the intended purposed of the polypeptide and still be regarded as substantially isolated. The term "isolated" therefore includes the possibility of the protein being in combination with other biological or non-biological material, such as cells, suspensions of cells or cell fragments, proteins, peptides, expression vectors, organic or inorganic solvents, or other materials where appropriate, but excludes the situation where the protein is in a state as found in nature.

A polypeptide of the invention may also be in a substantially purified form, in which case it will generally comprise the polypeptide in a preparation in which more than 50%, e.g. more than 80%, 90%, 95% or 99%,-by weight of the polypeptide in the preparation is a polypeptide of the invention. Routine methods, as further explained in the subsequent experimental section, can be employed to purify and/or synthesise the proteins according to the invention. Such methods are well understood by persons skilled in the art, and include techniques such as those disclosed in Sambrook et al, Molecular Cloning: a Laboratory Manual. 2^nd Edition. CSH Laboratory Press. (1989) the disclosure of which is included herein in its entirety by way of reference.

By the term "variant", what is meant throughout the specification and claims is that other peptides or proteins which retain the same essential character of the stargazin proteins for which sequence information is provided, are also intended to be included within the scope of the invention. For example, other peptides or proteins with greater than about 65% identity preferably at least 80% or at least 90% and particularly preferably at least 95% at least 97% or at least 99% identity, with the amino acid sequences of SEQ ID NO: 2, 4, 6 or 8, are considered as variants of the proteins. Identity is calculated using the CGC distances software (correction method). Such variants may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids within the protein sequence, as long as the peptide maintains the basic biological functionality of the stargazin proteins. Amino acid substitutions may be made, for example from 1, 2 or 3 to 10, 20 or 30 substitutions. The modified polypeptide generally retains activity as a γ subunit of a neuronal calcium channel. Conservative substitutions may be made, for example according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other.

Shorter polypeptide sequences are within the scope of the invention. For example, a peptide of at least 20 amino acids or up to 50, 60, 70, 80, 100, 150 or 200 amino acids in length is considered to fall within the scope of the invention as long as it demonstrates the basic biological functionality of a CACNG8, 4, 9 or 9L protein. In particular, but not exclusively, this aspect of the invention encompasses the situation when the protein is a fragment of the complete protein sequence and may represent a ligand-binding region. Polypeptides of the invention may be chemically modified, e.g. post- translationally modified. For example, they may be glycosylated or comprise modified amino acid residues. They may also be modified by the addition of histidine residues to assist their purification or by the addition of a signal sequence to promote their secretion from a cell. Such modified polypeptides and proteins fall within the scope of the term "polypeptide" of the invention.

The CACNG4 and CACNG8 proteins described herein are expressed in neuronal tissue. CACNG8 shows some homology to CACNG2 and CACNG3. CACNG2 is the human orthologue of the stargazin gene identified initially in mice. CACNG4 and CACNG9 show more homology to each other and may represent a sub-group of the calcium channel subunit family. The polypeptides of the invention preferably function as gamma subunits of calcium ion channels and especially neuronal calcium ion channels. Modulation of the steady state inactivation of an αl pore-forming subunit of a voltage-gated calcium channel can be determined according to Letts et al 1998. The invention also includes nucleotide sequences that encode for CACNG8, 4, 9 or 9L proteins or variants thereof as well as nucleotide sequences which are complementary thereto. The nucleotide sequence may be RNA or DNA including genomic DNA, synthetic DNA or cDNA. Preferably the nucleotide sequence is a DNA sequence and most preferably, a cDNA sequence. Nucleotide sequence information is provided in SEQ ID NOS 1, 3, 5 and 7. Such nucleotides can be isolated from human cells or synthesised according to methods well know in the art, as described by way of example in Sambrook et al.

Typically a polynucleotide of the invention comprises a contiguous sequence of nucleotides which is capable of hybridizing under selective conditions to the complement of the coding sequence of SEQ ID Nos: 1, 3, 5 or 7.

A polynucleotide of the invention and the complement of the coding sequence of SEQ ID Nos: 1, 3, 5 or 7 can hydridize at a level significantly above background. Background hybridization may occur, for example, because of other cDNAs present in a cDNA library. The signal level generated by the interaction between a polynucleotide of the invention and the complement of the coding sequence of SEQ ID Nos: 1, 3, 5 or 7 is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides and the coding sequence of SEQ ID Nos: 1, 3, 5 or 7. The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with ³²P. Selective hybridisation may typically be achieved using conditions of low stringency (0.03M sodium chloride and 0.03M sodium citrate at about 40°C), medium stringency (for example, 0.03M sodium chloride and 0.03M sodium citrate at about 50°C) or high stringency (for example, 0.03M sodium chloride and 0.03M sodium citrate at about 60°C or from 0.1 to 0.2 x SSC at 60°C up to 65°C ). A nucleotide sequence which is capable of selectively hybridizing to the complement of the DNA coding sequence of SEQ ID Nos: 1, 3, 5 or 7 will generally have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the coding sequence of SEQ ID Nos: 1, 3, 5 or 7 over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID Nos: 1 , 3, 5 or 7. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul (1993) J. Mol. Evol. 36:290-300; Altschul et al (1990) J. Mol. Biol. 215:403-10.

Software for performing BLAST analyses is publicly available through the National Centre for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, 1990). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters , T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands. The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define polynucleotides of the invention, with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred. Thus, for example a polynucleotide which has at least 90% sequence identity over 25, preferably over 30 nucleotides forms one aspect of the invention, as does a polynucleotide which has at least 95% sequence identity over 40 nucleotides.

The coding sequence of SEQ ID Nos: 1, 3, 5 or 7 may be modified by nucleotide substitutions, for example from 1, 2 or 3 to 10, 25, 50 or 100 substitutions. The polynucleotide of SEQ ID NOS: 1, 3, 5 or 7 may alternatively or additionally be modified by one or more insertions and/or deletions and/or by an extension at either or both ends. The modified polynucleotide generally encodes a polypeptide which has stargazin activity. Degenerate substitutions may be made and/or substitutions may be made which would result in a conservative amino acid substitution when the modified sequence is translated, for example as shown in the Table above.

The nucleotides according to the invention have utility in production of the proteins according to the invention, which may take place in vitro, in vivo or ex vivo. The nucleotides may be involved in recombinant protein synthesis or indeed as therapeutic agents in their own right, utilised in gene therapy techniques. Nucleotides complementary to those encoding CACNG proteins, or antisense sequences, may also be used in gene therapy, such as in strategies for down regulation of expression of the proteins of the invention.

Polynucleotides of the invention may be used as a primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors.

Such primers, probes and other fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length. Probes and fragments can be longer than 150 nucleotides in length, for example up to 200, 300, 400, 500, 600, 700 nucleotides in length, or even up to a few nucleotides, such as five or ten nucleotides, short of the coding sequence of SEQ ID Nos: 1, 3, 5 or 7.

The present invention also includes expression vectors that comprise nucleotide sequences encoding for the proteins or variants thereof of the invention. Such expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for protein expression. In particular, one embodiment of the invention utilises the pMT2 expression vector. Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al, the disclosure of which is included herein in its entirety. Polynucleotides according to the invention may also be inserted into the vectors described above in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense polynucleotides may also be produced by synthetic means. Such antisense polynucleotides may be used as test compounds in the assays of the invention or may be useful in a method of treatment of the human or animal body by therapy. Preferably, a polynucleotide of the invention or for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence, such as a promoter, "operably linked" to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.

The vectors may be for example, plasmid, virus or phage vectors provided with a origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistence gene in the - 1Z- case of a bacterial plasmid or a resistance gene for a fungal vector. Vectors may be used in vitro, for example for the production of DNA or RNA or used to transfect or transform a host cell, for example, a mammalian host cell. The vectors may also be adapted to be used in vivo, for example in a method of gene therapy. Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed. For example, yeast promoters include S. cerevisiae GAL4 and ADH promoters, S. pombe nmt\ and adh promoter. Mammalian promoters include the metallothionein promoter which can be induced in response to heavy metals such as cadmium. Viral promoters such as the SV40 large T antigen promoter or adenovirus promoters may also be used. All these promoters are readily available in the art.

Mammalian promoters, such as β-actin promoters, may be used. Tissue- specific promoters are especially preferred. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the S V40 promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV promoters (such as the HSV IE promoters), or HPV promoters, particularly the HPV upstream regulatory region (URR). Viral promoters are readily available in the art.

The vector may further include sequences flanking the polynucleotide giving rise to polynucleotides which comprise sequences homologous to eukaryotic genomic sequences, preferably mammalian genomic sequences, or viral genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of eukaryotic cells or viruses by homologous recombination. In particular, a plasmid vector comprising the expression cassette flanked by viral sequences can be used to prepare a viral vector suitable for delivering the polynucleotides of the invention to a mammalian cell. Other examples of suitable viral vectors include herpes simplex viral vectors and retroviruses, including lentiviruses, adeno viruses, adeno-associated viruses and HPV viruses. Gene transfer techniques using these viruses are known to those skilled in the art. Retrovirus vectors for example may be used to stably integrate the polynucleotide giving rise to the polynucleotide into the host genome. ReplicatiOn-defective adenovirus vectors by contrast remain episomal and therefore allow transient expression.

The invention also includes host cells that have been modified to express the stargazin-like proteins. Such cell lines include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, lower eukaryotic cells, such as yeast or prokaryotic cells such as bacterial cells. Particular examples of cells which can be modified by insertion of vectors encoding for a polypeptide according to the invention include mammalian HEK293T, CHO, HeLa and COS cells. Preferably the cell line selected will be one which is not only stable, but also allows for mature glycosylation and cell surface expression of a polypeptide. Expression may be achieved in transformed oocytes, especially oocytes from Xenopus laevis. The oocytes can be modified to express the stargazin-like polypeptides of the invention by microinjection into the nucleus of cRNA produced by in vitro transcription of cDNA encoding such a polypeptide or of a vector encoding such a polypeptide. It is also possible for the proteins of the invention to be transiently expressed in a cell line or on a membrane, such as for example in a baculovirus expression system. Such systems, which are adapted to express the proteins according to the invention, are also included within the scope of the present invention.

According to another aspect, the present invention also relates to antibodies (either polyclonal or preferably monoclonal antibodies) which have been raised by standard techniques and are specific for the proteins or variants thereof according to the invention. Such antibodies could for example, be useful in purification, isolation or screening involving immunoprecipitation techniques and may be used as tools to further ellucidate the protein function, or indeed as therapeutic agents in their own right. Antibodies may also be raised against specific epitopes of the proteins according to the invention.

An important aspect of the present invention is the use of proteins according to the invention in screening methods to identify compounds that may act as ligands or which may be useful to modulate protein activity. The proteins of the invention may also be used in investigations looking at the mechanism of calcium channel regulation or action. In general terms, such screening methods may involve contacting a protein of the invention with a test compound and then detecting modulation of protein activity or indeed detecting inactivity which results. This includes identifying agents which bind to the proteins of the present invention. Alternatively, the protein of the present invention may be co-expressed with other calcium channel subunits such as the γ 1 pore-forming subunit in appropriate host cells. The effect of the test compound on calcium current passing through the pore may be monitored.

The present invention also includes within its scope those compounds that are identified as possessing useful CACNG modulation activity or affect calcium current through interaction or modulation with CACNG subunits, by the screening methods referred to above. The screening methods comprehended by the invention are generally well known to a person skilled in the art. An example of such an approach is the use of fluorescent calcium-binding dyes such as Fura-2, Fura-red, Fluo3, Fluo4 or calcium green to monitor changes in the level of intracellular calcium as the activity of the channel is modulated by the effect of test compounds on the CACNG subunit.

Alternatively, voltage sensitive dyes, such as DiBac, can be used to monitor changes in membrane potential caused by altered calcium influx through the channel as its activity is modulated by the effect of test compounds on the CACNG subunit. These dyes can be readily detected using fluorimetric instruments such as the

Fluorescence Imaging Plate Reader (FLIPR, Molecular Devices, Sunnyvale, CA, USA). Another example of such an approach is the use of electrophysiological procedures to monitor activity of the channel, preferably using a voltage clamp technique such as whole cell patch clamp for mammalian cells or two electrode voltage clamp for oocytes. Another screening method is to use an assay that measures protein-protein interactions, such as the yeast two-hybrid assay, which can be used to detect test compounds that disrupt the interaction between the CACNG subunit and the calcium channel. Such methods are generally well known to a person skilled in the art, see Young et al, Nature Biotechnology 16, 946-950, 1998 for a similar example.

Another aspect of the present invention is the use of polynucleotides encoding the CACNG proteins to identify mutations in CACNG genes which may be implicated in neurological or other disorders. Identification of such mutations may be used to assist in diagnosis of neurological or other disorders or susceptibility to such disorders and in assessing the physiology of such disorders. Another aspect of the present invention is the use of substances that have been identified by screening techniques referred to above in the treatment or prophylaxis of disorders which are responsive to regulation of calcium channel activity. Typically, such a modulator is administered to a human patient. Modulation of CACNG8, 4, 9 or 9L activity may thus be achieved. By the term "modulation" what is meant is that there will be either agonism or antagonism of protein activity and in particular affect activity of the calcium channel with which the protein is associated.

Gamma subunits of calcium channels have been implicated as regulators of calcium channels. Modulation of the action of these subunits may be effective in the treatment of neurological or other disorders. In particular, the compounds identified using the screening techniques according to the invention may be used for treatment and/or prophylaxis of disorders such as epilepsy, episodic ataxia, spinocerebellar ataxia, hypertension, ischemic heart disease, arrhythmia, angina, pain, cerebal ischemia, Alzheimer's disease, neuroprotection, stroke, diabetes, cerebral vasospasm, atherosclerosis, tardive diskinesia, peripheral vascular disease, immunosuppression, cancerous diseases, migraine, headache, bipolar disorder, unipolar depression, anxiety, Parkinson's disease, cognitive disorders, opthalmic diseases neuromuscular disorders and tinnitus. It is to be understood that mention of these specific disorders is by way of example only and is not intended to be limiting on the scope of the invention as described.

The substances identified according to the screening methods outlined above may be formulated with standard pharmaceutically acceptable carriers and/or excipients as is routine in the pharmaceutical art, and as fully described in Remmington's Pharmaceutical Sciences, Mack Publishing Company, Eastern Pennsylvania, 17th Ed, 1985, the disclosure of which is included herein in its entirety by way of reference. The substances may be administered via enteral or parenteral - lo- routes such as via oral, buccal, anal, pulmonary, intravenous, intraarterial, intramuscular, intraperitoneal, topical or other appropriate administration routes.

A therapeutically effective amount of a modulator is administered to a patient. The dose of a modulator may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. A physician will be able to determine the required route of administration and dosage for any particular patient. A typical daily dose is from about 0.1 to 50 mg per kg of body weight, according to the activity of the specific modulator, the age, weight and conditions of the subject to be treated, the type and severity of the degeneration and the frequency and route of administration. Preferably, daily dosage levels are from 5 mg to 2 g.

The following Examples illustrate the invention.

Example 1: Identification of human ESTs related to the mouse stargazin sequence by in silico analysis

The full length mouse stargazin sequence (Letts et al, 1998) was used as a query sequence using the tBlastn (Altschul et al, J. Mol. Biol. 215, 403-410, 1990) alignment program to identify related human genes in the dbEST (Boguski et al,

Nature Genetics 4,332-333, 1993) and Incyte (Palo Alto, California, USA) databases. Several human ESTs were identified and those with similarities greater than 40% selected for further analysis. All human EST's from both databases were clustered to identify overlapping identical ESTs belonging to the same transcript. The GCG package (Wisconsin Package Version 9.0, Genetics Computer Group and a program developed in-house termed ESTBlast (Gill et al, Computer Applications in Biosciences (CABIOS) 13, 453-457, 1997) were used to build up these clusters. In total 37 ESTs derived from different tissue sources and both EST databases were clustered into 4 groups named CACNG2, CACNG3, CACNG4 and CACNG8. For each EST the tissue source was assigned according to the annotations in the dbEST and Incyte databases. The longest cluster (CACNG3) was 1065bp long and the other clusters ranged from 259bp long (CACNG4) up to 852bp (CACNG2). Since the CACNG2, CACNG4 and CACNG8 clusters were shorter than the mouse stargazin open reading frame (969bp) and possessed no obvious start codon these were unlikely to represent full length stargazin-related genes. The consensus nucleotide sequences from the four clusters were searched with the tBlastx program against the mouse stargazin amino acid sequence to identify the most likely open reading frame. The predicted amino acid sequences for CACNG2 and CACNG3 showed 100% sequence identity to the subsequently published human neuronal voltage-gated calcium channel γ-2 and and γ-3 genes respectively (Black & Lennon, Mayo. Clin. Proc. 74, 357-361, 1999).

The CACNG8 cluster comprised five overlapping EST's, four from human brain and one from human kidney. The incomplete CACNG8 amino acid sequence predicted from the in silico-derived nucleotide sequence was 154 amino acids long. The CACNG4 cluster comprised 4 ESTs, three from brain and one from an hNT2 cell line (Stratagene). The incomplete CACNG4 amino acid sequence predicted from the in stVzco-derived nucleotide sequence was 161 amino acids long.

Example 2: Identification and analysis of a human genomic sequence related to CACNG4 The in silico-dexived CACNG4 nucleotide sequence was used as a query sequence using the tBlastx program to identify related human genes in the genomic sequence division of Genbank. A human genomic bacterial artificial chromosome clone (accession number AC005988) with sequence identity of greater than 60% was identified. The genomic sequence was analysed using the gene prediction program Genscan (Burge et al, J. Mol. Biol. 268, 78-94, 1997). Genscan predicted that AC005988 contained 5 genes (predicted genes 1-5) and the predicted peptide sequences corresponding to these genes were used as query sequences using the tblastn program to identify which of these genes was related to the C ACNG4 sequence. The protein sequence of predicted gene 2 (peptide 2) contained a stretch of

275 amino acid residues with 70% amino acid identity compared to the full length CACNG4 sequence. The region of high sequence identity between peptide 2 and full length CACNG 4 started at residue 50 (methionine) of peptide 2 and continued to the end. Therefore predicted peptide 2 was 49 amino acid residues longer than the full length CACNG4 peptide and contained an extended N- terminal region not shared by CACNG4.

In order to determine which start methionine is used in vivo to generate predicted peptide 2 the full length transcript will need to be isolated and sequenced. The full length predicted peptide 2 was named CACNG9L and the shorter version of this sequence containing 275 residues with 70% sequence identity to full length CACNG4 was named CACNG9. No ESTs representing CACNG9L or CACNG9 could be found in either the public or Incyte EST databases. The cloning of the full length cDNA corresponding to CACNG9 is required to establish whether both long and short forms are expressed.

The Table below shows the percentage amino acid identities (id) and similarities (sim) between CACNG4, CACNG9 and CACNG8. Amino acid identity calculated using the CGC distances software (correction method). Amino acid similarity calculated using the GCG olddistances_34 software with the blosum 62 scoring matrix.

Example 3; Isolation and cloning of the CACNG8 cDNA

The partial sequence of cacngδ predicted by in silico data was confirmed by amplifying this fragment from human brain total RNA using RT-PCR, and sequencing the cloned products. First strand cDNA was synthesised using the Superscript Preamplification System (GibcoBRL; random hexamer protocol). 25ng of this cDNA was used in a PCR reaction containing 25pmol each of primers FM20 (5'-CTTCCAGGGATCTATAAAGGG-3\ corresponding to nucleotides 1-21 of the in silico prediction) and FM21 (5'-CACAGGGGTCGTCCGTCGGTTCAGCA-3\ complimentary to nucleotides 748-774 of the in silico prediction), lx thermophilic buffer, 2.5U of Taq DNA polymerase (Amersham) and 0.5mM deoxyribinucleotide trisphosphate mix (dNTPs) in a final volume of 50ml. After a hot start (94°C for 1 min) 30 cycles were performed (94°C for 30 sec, 50°C for 30 sec, 72°C for 30sec) in a programmable thermocycler ending with a final extension step (72°C for 10 min). The amplified band was purified from an agarose gel using the Qiaex II protocol (Qiagen), cloned into the pCR2.1-TOPO vector (Invitrogen), and sequenced using the universal primers T7 (5'-TAATACGACTCACTATAGGG-3') and M13 Reverse (5'-CAGGAAACAGCTATGAC-3'). Analysis of multiple clones from different PCR reactions confirmed the computer predictions.

Sequences missing from the 5 '-end of this partial clone were then isolated by a nested PCR RACE protocol using cDNA synthesised with the SMART PCR cDNA Synthesis Kit (Clontech). Reactions for the first stage PCR contained 25ng SMART synthesised total brain cDNA plus the SMART PCR primer (5'- AAGCAGTGGTAACAACGCAGAGT-3'), and primer FM33 (5'- GAGGAGGTACTCCGAGCTGT-3', complimentary to nt.71-90 at the 5'- end of the partial cacngδ sequence), with the remaining components being the same as described above. 30 cycles (94°C for 30 sec, 50°C for 30 sec, 72°C for 30sec) were performed. Reactions for the second stage (i.e. nested) PCR contained 2ml of reaction product from the first stage plus lOpmol of a nested SMART primer (FM57, 5'-AAGCAGTGGTAACAACGCAGAGTACG-3') and lOpmol of a FM33-nested primer, FM34 (5'-TCGTAGTCATTGTCCTCTGG-3\ complimentary to nt. 46-65 of the partial cacngδ sequence). After a hot start (94°C for 1 min), 30 cycles were performed (94°C for 30 sec, 55°C for 30 sec, 72°C for 30sec) yielding a product of approximately 340bp which was cloned and sequenced. A clone was identified which contained a 60nt region of overlap with the cacng8 sequence identified in silico and which extended to a putative in-frame start codon upstream of the rest of the cacng8 ORF. This clone contained a 203 nucleotide stretch which had 100% identity to nucleotides 163453-163655 of human chromosome 17 clone AC005988. Analysis of this in silico genomic sequence revealed an 18 nt. stretch (ATGGTGCGATCGGACCGC) immediately upstream and in-frame with the cloned sequences which was preceded by a consensus translation initiation sequence (Kozak, Nucl. Ac. Res. 15, 8125-8133, 1987) and which contained the putative ATG start codon.

To isolate the predicted full-length (984bp) cacngS cDNA, PCR reactions were carried out using 25ng Superscript total human brain cDNA and 25pmol each of the primers FM43 (5'-GCGGCCGCACCATGGTGCGATGCGACCGCG-3\ corresponding to nt. 1-19 of the predicted full-length cacngδ, plus a 5' extension consisting of a Notl restriction site and a consensus translation initiation sequence) and FM44 (5'-GCTAGCCTCGAGTCACACAGGGGTCGTCCGTC-3\ complimentary to nt. 965-984 of the predicted full-length cacng8 plus recognition sites for Nhel and Xhol) with the remaining components being as described above. After a hot start (94°C for 1 min), 30 cycles were performed (94°C for 30 sec, 50°C for 30 sec, 72°C for 30sec). The amplified fragment was purified from an agarose gel, cloned into pCR2.1-TOPO and the sequence of the full-length cacngδ was confirmed using T7, Ml 3 reverse and gene specific primers.

This cDNA sequence predicts a protein of 327 amino acids (MW 36577.93 Daltons) (SEQ ID NO: 1). The predicted transmembrane topology of the deduced γ_g protein comprises four transmembrane domains with the amino- and carboxy-termini localised intracellulary.

Example 4: Tissue distribution of CACNG8 mRNA

The tissue distribution of cacng8 mRNA was examined by Northern blotting using a specific probe corresponding to nt.594-804. This was obtained by PCR amplification using 25pmol each of primers FM28 (5'-

GGGCGTCCTGGCTGTAAA-3') and FM29 (5'-GGCCCCTGTGATCTTCAG-3') in 50ml of reaction mix consisting of lx thermophilic buffer, 0.5mM dNTPs, and 2.5U Pfu Turbo DNA polymerase. After a hot start (2 minutes at 94°C) 30 cycles were carried out (94°C, 1 min; 50°C, 1 min; 72°C, lmin) ending with a final 10 minute 72°C extension step. The band was purified from an agarose gel using Qiaex II (Qiagen) and then incubated with 1.5U Taq DNA polymerase and 0.5mM dNTPs at 72°C for 15 minutes to enable cloning into pCR2.1-TOPO. This clone was verified by sequencing and used to prepare a ³²P radiolabelled DNA probe by PCR amplifying the same fragment, purifying on an agarose and radiolabelling according to the Strip-EZ DNA Probe Synthesis and Removal Kit (Ambion) gel. This was then used to probe human multiple tissue and multiple brain region Northern blots (Clontech) using ExpressHyb hybridisation solution (Clontech) following the protocol for cDNA probes recommended by the manufacturer, and washing the blots at high stringency before exposing them to x-ray film at -70°C. A specific band of about 4 kb was detected and that, of the tissues tested, cacng8 was found to be expressed only in brain. Furthermore it was present at varying levels in most brain regions, showing a particularly strong signal in the putamen and caudate nucleus.

Example 5: Cellular immunolocalisation of CACNG8 protein

Polyclonal antisera specific for human γ₂, γ₃, and γ₈ subunits were prepared against polypeptide peptide sequences specific to parts of the C-terminal portion of each of the γsubunits. The regions chosen correspond to amino-acids 211-228, 291- 307, and 303-321 of γ₂, γ₃, and γ₈ respectively. Rabbits were immunised with peptide-PPD conjugates, and terminal bleeds performed once adequate titres were reached. The immunoglobulins were isolated from each antiserum by affinity chomatography on appropriate immobilised peptide matrices. Specificity of the antibodies for the three γ subunits was verified by ELISA and immuno fluorescence analysis of untransfected COS-7 cells, vector only transfected COS-7 cells and COS-7 cells transiently expressing γ₂, γ₃ or γ₈ subunits alone or together with VDCC α_1A, β₄ andα₂δ.[ subunits.

Cells were cultured in T75 flasks containing DMEM growth medium supplemented with 10%NBCS and lOOUnits/lOOμg penicillin/streptomycin. 2h prior to transfection the confluent monolayer of cells washed twice with 5ml sterile PBS and then dissociated from the flask using 1ml 0.25%trypsin (Gibco BRL). The cell mass re-suspended in 9ml of media and was gently triturated using a sterile Pasteur pipette. 2ml of cell suspension was placed on each poly-L-lysine coated coverlip and left to settle. The α,_A, β₄, α₂δ.,, and γcDNAs in the vector pMT2 were used at 15, 5, 5, 5μg per transfection, respectively. Blank pMT2 vector was included where necessary to maintain the total cDNA at 30μg per transfection. Each transfection was performed using the GenePORTER transfection reagent (Gene Therapy Systems). Following transfection, cells were maintained at 37°C for about 48h, after which they were dissociated from their wells and re-plated onto poly-L-lysine coated coverslips using non-enzymatic cell dissociation medium (Sigma), and maintained at 27°C for 2h prior to fixing.

The cells were washed twice in Tris-buffered saline (TBS; 154mM NaCl, 20mM Tris, pH7.4), then fixed in 4% paraformaldehyde in TBS as described (Brice et al, Eur J Neurosci. 1997 Apr; 9(4): 749-59). The cells were permeabilised in 0.02% Triton X-100 in TBS, and incubated with blocking solution (20% (v/v) goat serum, 4% (w/v) bovine serum albumin (BSA), 0.1% (w/v) DL-lysine in TBS). The cells were incubated for 14h at 4°C with appropriate primary antibody diluted to the appropriate concentration in 10% goat serum, 2% BSA, 0.05% DL-lysine. The primary antibodies were detected using biotin-conjugated goat anti-rabbit IgG (1 :200) (Sigma), then Texas Red (1 :500) (Molecular probes, Eugene, OR, USA). The nuclei were detected with a two-minute incubation in DAPI stain (1 :200). Cells were examined in a Leica laser scanning confocal microscope, with all parameters (gain, aperture) identical between experiments.

As expected from analysis of the predicted amino acid sequence, CACNG8 protein was found to be localised almost exclusively at the cell surface whether expressed alone or in the presence of the other calcium channel subunits.

Example 6: Immunolocalisation of CACNG8 protein in human CNS

To examine the immunolocalisation of CACNG8 protein in human CNS, 7μm sections of paraffin embedded human cerebellum, hippocampus and spinal cord were cut on a Microm HM3555S microtome and floated onto a warm water bath -ZJ-

(43°C). Once expanded the section were collected on polylysine coated slides and placed in an incubator at 37°C overnight before use. The paraffin was removed by de-waxing in 2 x 2min incubations in xylene. The sections were re-hydrated in a graded series of ethanol (absolute 2 x 2 min, 90% 2 min, 70% 2 min) followed by 2 min in running tap water and finally 5 min in distilled water. During paraffin processing, the antigen of interest can often be masked. A microwave antigen retrieval protocol was followed to enhance the signals produced in the study. De- waxed, re-hydrated sections were microwaved in 0.01M citrate buffer pH6 at 100°C (HDS supplies) for 5 min then left to stand in the buffer for another 5 min. This process was then repeated. Endogenous peroxidase activity was blocked by incubation with 3% H₂O₂ in water for 20 min.

The sections were then washed in running tap water for 5 min, placed in distilled water for 5 min, then washed in running distilled water for 5 min. Nonspecific protein interactions were blocked with 5% milk powder, diluted in PBS + 0.1% Triton X- 100 for 3 Omin. Sections were incubated with the affinity -purified primary antibody (according to the optimal working dilution in 3% goat serum + 0.1% Triton X-100) at 4°C in a moist chamber overnight. The following day, the sections were washed 3 5 min in PBS before a 20 min incubation with the secondary antibody (Biogenex Biotinylated antirabbit Ig link, pre-diluted) at a dilution of 1 :20 stock. The sections were then washed once more 3 x 5 min in PBS before incubation with HRP-conjugated strepavidin (Biogenex prediluted 1 :20) for 20min. Sections were washed 3 x 5 min in PBS then bound antibodies were detected using 3,3'-diaminobenzidine tetrahydrochloride (DAB) made up according to the Vector SK-4100 kit to produce a brown reaction product. The reaction was terminated by transferring of the sections to distilled water. Sections were dehydrated in a graded series if ethanol (70%, 90%, 2 x absolute) followed by 2 x 2min immersions in xylene. Coverslips were applied were applied using a few drops of xylene and left to dry overnight before viewing.

Light staining was seen in both the molecular (M) and granule layers (G) of the cerebellum (fig Xa). The granule cells themselyes were only lightly stained with the immuno-reactivity being mainly in stellate cells(s). Purkinje (P) cells were densely stained throughout the soma and dendrites. The g4 subunit appears to be absent from the deep cerebellar nuclei (N) but give a strong signal in the surrounding collateral fibres (fig Xb). In the hippocampus punctate staining for g4 is observed in the soma of CAl, CA2 and CA3 cells of Ammons horn and the stratum granulosum of dentate gyrus (DG) (figure Xc). The staining is more diffuse in the surrounding neuropile. Dense immunoreactivity in motorneurones and the surrounding grey matter (gm) was seen in the dorsal horn of spinal cord.

Example 7: Isolation and cloning of the CACNG4 cDNA

Two additional gamma subunits, CACNG4 and CACNG9, were identified by in silico analysis. The predicted as sequences of cacng4 (partial) and cacng9 (complete) share 70% identity. They have relatively low overall identity to cacng2 (-27%) Sp and cacngl but this is similar to the level of identity shared by CACNG2 and CACNG 1. Nevertheless, they have similar predicted membrane topology and share up to 50% identity within the predicted transmembrane domains. Thus CACNG4 and CACNG9 appear to represent a third subfamily of gamma subunits.

In more detail, the 485bp cacng4 sequence predicted by in silico analysis was confirmed by amplifying this fragment from human brain total RNA using RT-PCR, and sequencing the cloned products. First strand cDNA was synthesised using the Superscript Preamplification System (GibcoBRL; random hexamer protocol). 25ng of this cDNA was used in a PCR reaction using Taq polymerase and the same components previously described except containing 25pmol each of the primers FM49 (5'-CGGGAGAAAGGTCGCTGT-3\ corresponding to nt. 1-20 of the predicted sequence) and FM50 (5'-TCATTTGGATGGACACGTCG-3\ complimentary to nt. 466-485). After a hot start (94°C for 1 min) 30 cycles were performed (94°C for 30 sec, 50°C for 30 sec, 72°C for 30sec). The amplified product was purified from an agarose gel and cloned into pCR2.1-TOPO. Sequence analysis of multiple clones from different PCR reactions confirmed the in silico predictions. To obtain the missing 5' and 3' regions the central portion of the predicted cacng4 cDNA, was extended by 5' and 3' RACE protocols using Marathon Ready total human brain cDNA (Clontech). The missing 5' region was obtained by carrying out three successive PCR steps using nested primers derived from the known CACNG4 cDNA sequence. Reactions for the first 5 'RACE step contained standard components (see above) plus 0.5ng of Marathon Ready total brain cDNA template, and lOpmol each of primers Adaptor Primer 1 (API, 5'-

CCATCCTAATACGACTCACTATAGGGC-3') and FM50 in a final volume of 50ml. After a hot start (94°C for 1 min) 30 cycles (94°C for 30 sec, 50°C for 30 sec, 72°C for 30sec) were performed in a programmable thermocycler ending with a final extension step (72°C for 10 min). An aliquot of this RACE product was electrophoresed on an agarose gel to confirm successful amplification, and the rest was used as template for the subsequent step. For the second (nested) 5' RACE step the same reaction mix was used except that instead of the Marathon Ready cDNA and primers APland FM50, 2ml of the product from the first 5' RACE product and lOpmol each of Adapter Primer 2 (AP2, 5'-ACTCACTATAGGGCTCGAGCGGC- 3', nested to API) and FM52 (5'-GTGGCCGATGTTGCTGATGA-3', nested to FM50) were substituted. The reaction was performed in the thermocyler as before, except the annealing temperature was raised to 55°C to increase the specificity of amplification. Again, part of this RACE product was electrophoresed on an agarose gel to confirm amplification, and the remainder of used as template in the final step. In the third and final 5' RACE step identical conditions for the reaction were used as in the previous step but this time using lOpmol each of primers AP2 and FM51 (5'- CGTAGGAAGAGGCTGACCAT-3', nested to FM50 and FM52 ) and using 5ml of the RACE product from the second step as template. The band from this final PCR was isolated from an agarose gel using the Qiaex II protocol (Qiagen), cloned into pCR2.1-TOPO and sequenced using the T7 and M13R universal primers.

The missing 3 ' region was obtained by carrying out two successive PCR steps using nested primers derived from the known CACNG4 cDNA sequence. The reaction conditions used were exactly the same as that described for the 5 'RACE except that for the first 3 'RACE step the primers were API and FM56 (5'- ATCTCCAGCATCAACGACGA-3 ') and for the second step the primers were AP2 and FM55 (5'-TCTCAGCGACTGCTCCGACT-3\ nested to FM56). -Zo-

Sequence analysis of clones from these RACE experiments confirmed that they included putative in-frame initiator ATG and stop codons at the 5' and 3' ends respectively and contained the missing parts of the gene, as judged by alignment with the sequences of the other gamma subunits.

The full-length cacng4 cDNA was assembled from three overlapping fragments using a splice-overlap PCR approach. A fragment containing the 5' end (ntl-331) was produced by PCR amplification using 25pmol each of FM85 (5'- GCGGCCGCCACCATGAGTCACTGCAGCAGCCG-3', corresponding to nt 1-20 of the predicted full-length cacng4 plus a 5' extension containing a Notl restriction site and a consensus translation initiation site; Kozak, 1987) and FM51. A fragment containing the central portion (nt278-763) was produced by PCR amplification using 25pmol each of primers FM49 and FM50. A fragment containing the 3' end (nt660- 828) was amplified using primers FM55 and FM84 (5'-

GCTAGCCTCGAGTCAGCAGGGCGAGGTGGAGA-3', complementary to nt 809-828 of full-length cDNA plus a 5' extension containing Nhel and Xhol restriction sites). The reaction mix for amplification of each of these fragments consisted of lx thermophilic buffer, 0.5mM dNTPs, and 2.5U Pfu Turbo DNA polymerase in a final volume of 50ml. After hot start (94°C for 2 mins), 30 cycles (94°C for 1 min, 50°C for 1 min, 72°C for lmin) were performed ending with a final extension step (72°C for 10 min). The bands were purified from an agarose gel using the Qiaex II protocol.

The complete cacng4 sequence was then amplified in a single splice-overlap PCR reaction containing approximately 50ng of each of these three fragments using primers FM84 and FM85. The reaction mix consisted of lx thermophilic buffer, 0.5mM dNTPs, and 2.5U Pfu Turbo DNA polymerase in a final volume of 50ml. After a hot start (94°C for 2 min) 30 cycles (94°C for 1 min, 50°C for 1 min, 72°C for lmin) were performed ending with a final extension step (72°C for lOmin). The 828bp band was purified from an agarose gel and cloned into pCR2.1-TOPO. Sequence analysis using T7, Ml 3 reverse and gene specific primers, confirmed the amplification of full length cacng4 cDNA (Fig. 2). The sequence predicts a protein of 275 amino acids (molecular weight of 31001.72 Daltons) with a transmembrane topology predicting four membrane-spanning regions with intracellular amino- and carboxy- termini, like the rest of the previously cloned γ subunits (Black & Lennon, 1999; Letts et al, 1998; Powers et al, 1993). The identity with other gamma sequences is 70% with cacng9, 25% with cacng2 and 28% with cacngδ.

Example 8: Tissue distribution of CACNG4 mRNA

The tissue distribution oϊcacng4 mRNA was examined by Northern blotting using a specific 187bp probe corresponding to nt.578-764. This was obtained by PCR amplification using lOpmol each of primers FM120 (5'- GGCGTGATGTCCGTGTACCT-3') and FM121 (5'-

TCATTTGGATGGACACGTCG-3') in 50ml of reaction mix consisting of lx thermophilic buffer, 0.5mM dNTPs, and 2.5U Pfu Turbo DNA polymerase. After a hot start (2 minutes at 94°C) 30 cycles were carried out (94°C, 1 min; 50°C, 1 min; 72°C, lmin) ending with a final 10 minute 72°C extension step. The band was purified from an agarose gel using Qiaex II (Qiagen) gel extraction kit. 25ng of the resulting DNA was used as the template to synthesise a ³²P radio-labelled DNA probe according to the Strip-EZ DNA Probe Synthesis and Removal Kit (Ambion). This was then used to probe a human multiple tissue northern blot (Clontech) using ExpressHyb hybridisation solution (Clontech) following the protocol for cDNA probes recommended by the manufacturer, and washing the blots at high stringency before exposing them to x-ray film at -70°C. Specific messages of about 3.8.kb and 2.5kb were detected in brain. The 3.8kb message may also be present at a much lower level in thymus and the 2.5kb message at an equally low level in skeletal muscle.

Example 9; Tissue distribution of CACNG9 mRNA

The tissue distribution of cacng9/9L mRNA was examined by Northern blotting using a specific oligonucleotide probe, FM98 (5'-

GCTGGGTGTTCATGGGCATCACATATTCTATGGTGAAGCAACGCCCCCG- 3') which is complimentary to nt-349-397 of the long cacng9 (cacng9L) in silico predicted sequence. lOpmol of FM98 was radio-labelled with [γ-³²PdATP] according to the KinaseMax 5' End-Labeling Kit (Ambion) forward reaction protocol. This was then used to probe a human multiple tissue Northern blot (Clontech) using ExpressHyb hybridisation solution (Clontech) following the protocol for oligonucleotide probes recommended by the manufacturer, and washing the blots at low stringency before exposing them to x-ray film at -70°C. A hybridising band of about 7.5kb was observed in heart, skeletal muscle and placenta (Fig. 5) which is similar in size to the stargazin message (Letts et al., 1998) but somewhat larger than that of cacngδ. Hybridising bands of lower molecular weight can also be observed in these tissues, and in addition in kidney and liver, which may be due to mRNA processing events (e.g. splicing), mRNA degradation, or to cross hybridisation of the probe due to the low stringency conditions required when using short oligonucleotide probes.

Example 10: Expression in oocytes and functional characterisation

The full-length cacngδ cDNA was excised from pCR2.1-TOPO by restriction digest with Notl and Nhel. This fragment was isolated by agarose gel electrophoresis and then ligated, using T4 phage DNA ligase (New England Biolabs), into vector pMT2LR that had been linearised by restriction digest with Notl and Spel. Correct insertion of the gene into the vector was confirmed both by restriction digest and sequencing. This vector was then linearised and transcribed into cRNA using T7 polymerase and capped with m'G(5')pp(5')GTP (Promega Wizard kit). cRNA was also prepared in a similar manner for the calcium channel αlA, β4 and β2δ subunits.

Adult female Xenopus laevis (Blades Biologicals) were anaesthetised using 0.2% tricaine (3-amino benzoic acid ethyl ester), sacrificed and and the ovaries rapidly removed. Oocytes were de-folliculated by collagenase digestion (Sigma typel, 1.5mg/ml) in divalent cation-free OR2 solution (82.5mM NaCl, 2.5mM KC1, lmM MgCl₂, 1.8mM CaCl₂, 5mM HEPES, pH7.5 at 25°C). Single stageV and stage VI oocytes were transferred to ND96 solution (96mM NaCl, 2mM KC1, lmM MgCl₂, 1.8 CaCl₂, 5mM HEPES, pH7.5 at 25°C) which contained gentamycin and stored at 18°C. A mixture of CACGN8 cRNA and cRNA for α_1A, β₄ and cc₂δ was injected into oocytes (20-50nl of lug/ul per oocyte) and whole-cell currents were recorded using two-microelectrode voltage-clamp (Geneclamp amplifier, Axon Instruments Inc.) 3-5 days after RNA injection. Microelectrodes had a resistance of 0.5-2M ohms when filled with 3M KC1. In all experiments oocytes were voltage-clamped at a holding potential of B90mV in ND96 solution (superfused at 2ml/min) and test compounds were applied by the addition of extracellular solution. Current- voltage curves were constructed by applying 800ms voltage-clamp pulses from the holding potential of B90mV to test potentials between B85mV and +30mV.

Example 11: Screening for compounds which exhibit stargazin-like protein modulating activity

Mammalian cells, such as Hek293, CHO and HeLa cells over-expressing the stargazin-like protein of choice together with appropriate calcium channel subunits are generated for use in the assay. 96 and 384 well plate, high throughput screens (HTS) are employed using fluorescence based calcium indicator molecules, including but not limited to dyes such as Fura-2, Fura-Red, Fluo 3, Fluo 4 or calcium green (Molecular Probes). Secondary screening involves electro-physiological assays utilising two electrodes, voltage clamp or patch clamp technology. Tertiary screens involve the study of modulators in rat and mouse models of disease relevant to the target.

A brief screening assay protocol based on a calcium binding flourescent dye is as follows. Mammalian cells stably over-expressing the the stargazin-like protein together with appropriate calcium channel subunits protein are cultured in 96 or 384 well plates. One T225cm ³ flask is sufficient for setting up ten 96 well plates with a volume of 100ml cell culture medium in each well. These plates are set up the night before each assay run. The culture media is removed and 100ml of assay buffer (125mM Choline chloride, 50mM HEPES, 5.5mM Glucose, 0.8mM MgSO_4> 5mM KC1, pH 7.4) added. The cells are then loaded with the calcium indicator dye of choice for 30 minutes. The test compounds are added to the wells and pre-incubated for a period of 10 minutes. The channel is activated by depolarisation with 33mM potassium chloride, or if using an L-type channel readout upon the addition of a known agonist such as BayK 8644. Modulation of the stargazin-like protein results in either an increase or a decrease in the activity of the channel and the change in intracellular calcium can be measured directly in a Fluorescence Imaging Plate Reader, (Molecular Devices). This protocol thus allows identification of agonists or antagonists of the stargazin-like protein.

1. An isolated polypeptide comprising

(i) the amino acid sequence of SEQ ID NO: 4, 6 or 2; or (ii) a variant thereof capable of modulating the steady state inactivation of an αl pore-forming subunit of a voltage-gated calcium channel.

2. A polypeptide according to claim 1 wherein the variant (ii) has at least 80%) identity to the amino acid sequence of SEQ ID NO: 4, 6 or 2.

3. A polypeptide according to claim 1 or 2 comprising the amino acid sequence of SEQ ID NO: 8 or a said variant thereof. 4. A polynucleotide encoding a polypeptide according to any one of the preceding claims.

5. The polynucleotide according to claim 4 which is a cDNA sequence.

6. A polynucleotide which encodes a polypeptide capable of modulating the steady state inactivation of αl pore-forming subunit of a voltage-gated calcium channel and which comprises:

(b) a sequence which hybridises under stringent conditions to a sequence as defined in (a); (c) a sequence that is degenerate as a result of the genetic code to a sequence as defined in (a) or (b); or (d) a sequence having at least 60% identity to a sequence as defined in (a), (b) or (c).

7. A polynucleotide according to claim 6, comprising: (a') the nucleic acid sequence of SEQ ID NO: 7 and/or a sequence complementary thereto; (b') a sequence which hybridises under stringent conditions to a sequence as defined in (a'); (c¹) a sequence that is degenerate as a result of the genetic code to a sequence as defined in (a¹) or (b¹).

(d¹) a sequence having at least 60% identity to a sequence as defined in (a'), (b') or (c').

8. An expression vector comprising a polynucleotide sequence according to any one of claims 4 to 7.

9. A host cell comprising an expression vector according to claim 8. 10. An antibody specific for a polypeptide according to any one of claims l to 3.

11. A method for identification of a substance that exhibits calcium channel modulating activity comprising contacting a polypeptide according to any one of claims 1 to 3 in the presence of an α 1 subunit of a calcium channel with a test substance and monitoring for calcium channel activity.

12. A method for identification of a substance that modulates the interaction between α or β calcium channel subunits and a polypeptide according to any one of claims 1 to 3 comprising contacting the polypeptide with a test substance in the presence of α or β calcium channel subunit and monitoring the interaction between the subunit and the substance.

13. A method for the identification of a substance that modulates voltage- gated calcium channel γ -subunit activity and/or expression, which method comprises:

(i) contacting a test substance and a polypeptide according to any one of claims 1 to 3, a polynucleotide according to any one of claims 4 to 7, and expression vector according to claim 8 or a host cell according to claim 9, and

(ii) determining the effect of the test substance on the activity and/or expression of the said polypeptide or the polypeptide encoded by said polynucleotide, thereby to determine whether the test substance modulates voltage-gated calcium channel γ-subunit activity and/or expression.

14. A method according to claim 13 wherein the polypeptide is expressed in a cell.

15. A method according to claim 14 wherein the cell expresses a voltage- gated calcium channel αl -subunit. 16. A method according to claim 15 wherein step (ii) comprises monitoring any voltage-gated channel activity.

17. A method according to claim 15 wherein step (ii) comprises monitoring any interaction between the said polypeptide with the said voltage-gated calcium channel αl -subunit.

18. A substance which modulates calcium channel activity and which is identifiable by a method according to any one of claims 11 to 17.

19. A method of treating a subject having a disorder that is responsive to calcium channel modulation, which comprises administering to said subject an effective amount of a substance according to claim 18.

20. A method according to claim 19 wherein the disorder is a neuronal disorder.

21. Use of a substance as defined in claim 18 in the manufacture of a medicament for treatment or prophylaxis of a disorder that is responsive to calcium channel modulation .

22. Use according to claim 21 wherein the disorder is selected from epilepsy, episodic ataxia, spinocerebellar ataxia, hypertension, ischemic heart disease, arrhythmia, angina, pain, cerebal ischemia, Alzheimer's disease, neuroprotection, stroke, diabetes, cerebral vasospasm, atherosclerosis, tardive diskinesia, peripheral vascular disease, immunosuppression, cancerous diseases, migraine, headache, bipolar disorder, unipolar depression, anxiety, Parkinson's disease, cognitive disorders, opthalmic diseases neuromuscular disorders and tinnitus.

23. A method of producing a polypeptide according to any one of claims 1 to 3, which method comprises maintaining a host cell line as defined in claim 9 under conditions suitable for obtaining expression of the polypeptide.