WO2001012796A2 - Pkd constructs and screening methods - Google Patents

Abstract

The invention provides an isolated nucleic acid molecule comprising the complete open reading frame of the C. elegans pkd-2 gene. The invention further provides assay methods for use in the identification of compounds which affect the activity of PKD2 and genetic suppressors of pkd-2, which methods are based on correction of an altered mating phenotype observed in male C. elegans which either overexpress the PDK2 protein or carry a deletion mutation in the pkd-2 gene.

Description

PKD constructs and screening methods .

The present invention relates generally to field of signalling pathways mediated by the polycystin family (PKD) . In particular, the present invention relates to the C. elegans homologues of HSPKD1 and HSPKD2, designated CEPKD1 and CEPKD2.

The present invention relates to the cloning of a nucleic acid molecule comprising the complete open reading frame of the C. elegans PKD2 homologue and the regulatory regions of the pkd-2 gene. Also provided by the invention is a C. elegans strain expressing mutant CEPKD2. The invention further provides assay methods for use in the identification of compounds which affect the activity of PKD2 and genetic suppressors of pkd-2, which methods are based on correction of an altered mating phenotype observed in male C. elegans which either overexpress CEPKD2 or carry a deletion mutation in pkd-2. Autosomal Dominant Polycystic Kidney Disease (ADPKD) is one of the most common human genetic disorders, affecting as many as 1 in 1000 people, and accounting for about 10% of all end-stage renal disease (Reeders, Nature Genetics 1:235-237,1992). The disease is characterized by the slow appearance and enlargement of fluid-filled cysts within a random subset of nephrons over the course of decades. Defects in the gene PKD-1 are responsible for about 85% of the known cases of ADPKD, while defects in the highly homologous gene PKD-2 account for another 10% of known cases. Both PKD genes encode large transmembrane proteins, called polycystins. The N-terminal half of the PKD-1 protein comprises a series of Ig-like repeats, followed by a series of at least 7 transmembrane domains in the C-terminal half of the protein. The PKD-2 protein has no region corresponding to the PKD-1 N-terminal half, but is almost entirely homologous to the C-terminal half of PKD-1. This region shows some weak homology to calcium channels, most closely to the sea urchin receptor egg jelly protein. PKD-1 homologues have since been found in other vertebrates. In addition, a gene encoding a protein homologous to the polycystin domain has been found by the C. elegans genome sequencing project (Coulson et al, The physical map of C. elegans Genome, Methods in Cell Biology, Vol 48, Academic Press, San Diego, 1995 ) .

The precise function of the polycystins in maintaining the thin tubular diameter of kidney nephrons is not known. In particular, it is not clear why the genetic condition ADPKD is dominant in man, i.e. why a single copy of the wild-type gene is not sufficient to maintain tubular structure. In addition, the polycystins are widely expressed in epithelial tissues, and patients with PKD often suffer from enlarged hepatic ducts, brain aneurysms and pancreatic cysts. It seems likely, therefore, that these proteins perform a general task in maintaining (but not necessarily in initial formation of) epithelial structure, especially the maintenance of tubule width. Initial studies have shown that the basal membrane localized electrogenic sodium pump, Na-K-ATPase, is mis-polarized and localized to the apical membrane of human ADPKD cystic epithelia, in strict contrast to the restriction to the basolateral renal tubule membrane in observed in normal renal epithelia (Wilson et al., Am. J. Physiol. 260: F420-430, 1991) . The functional consequence of this mis-polarization in ADPKD is osmotic fluid secretion into the cyst lumen. An analogous polarity alteration of the epidermal growth factor (EGF) receptor, leading to aberrantly increased epithelial proliferation is also observed in ADPKD. Other enzymes that show a basal-to-apical alteration include the cytoskeleton proteins ankyrin, α-fodrin, and the calpactins and lipocortin-1, which is functionally associated with the EGF receptor. However, this pattern of basal-to- apical mislocalisation is not universal as some proteins, namely the matrix proteins (type IV collagen, laminin, and heparin sulphate proteoglycan) and the associated receptor proteins ( 2-, 6-, and 1-integrins) , maintain their exclusively basal localization.

In contrast to the basal-to-apical mis- localization discussed above, most apical membrane proteins, such as the renal brush border enzymes Alkaline phosphatase, trehalase, aminopeptidase N, are localized normally. Other transporters are also retained in their normal exclusively apical membrane localization, including the Na/H exchanger (NHE3) , the AQP2 water channels, and the CFTR protein (Hanaoka et al., Am. J. Physiol. 270 : C389-C399, 1996). An apical-to-basal alteration of polarity has been observed for the secretion of the cysteine proteases cathepsins B and L in ADPKD epithelia in vi tro (Hartz and Wilson, Biochem. Mol. Med. , 59:256-263, 1996).

Phenotypic expression and marker analysis studies have demonstrated many similarities in^' the properties of the developmental stages of normal fetal renal epithelia with cystic ADPKD epithelia, including aberrant Pax-2 transcription factor expression, apical located Na-K-ATPases αlβ2-complexes and apical EGF receptors. This suggests that the polarity defects are caused by transcriptional activation of fetal genes or by the absence of transcriptional repression of genes expressed during kidney morphogenesis. Structural analysis of the predicted PKD1 protein suggests that it might function as a membrane protein transducing information between the matrix and the cells of the fetal kidney. In order to gain a better understanding of the ADPKD disease process and therefore develop effective preventative/curative treatments, it is important to elucidate the functions of the polycystins, the signals that they relay to downstream effectors, and the nature of those effectors. Although the polycystins share some homology with other ion channels or pumps, their exact function in epithelial morphology remains extremely unclear. The tiny free-living roundworm C. elegans provides a unique model of renal tubular structure. The excretory system of C. elegans performs an osmotic regulatory function similar to that of vertebrate nephrons (Chitwood, An introduction to nematology, University Park Press, 126-135, 1950) . The C. elegans excretory canals, which grow as long thin tubules that stretch the entire length of the animal, have analogous apical-basal polarities as can be found in certain kidney cells and which are relevant for cellular function. Hence, the excretory canal can be used as a model for the development of drug screens in the area of kidney diseases.

As a first step in the development of nematode models for polycystic kidney disease, the inventors have isolated a nucleic acid molecule which contains the complete open reading frame of the C. elegans pkd-2 gene .

Therefore, in accordance with a first aspect of the invention there is provided an isolated nucleic acid comprising the sequence of nucleotides from position 4480 to 11632 of the sequence of nucleotides set forth in SEQ ID NO: 2.

The sequence of nucleotides from position 4480 to 11632 of the sequence of nucleotides set forth in SEQ ID NO: 2 consists of the promoter region of the C. elegans PKD2 gene {pkd-2) and also a region of PKD2 genomic DNA and a fragment of PKD2 cDNA which together cover the complete PKD2 open reading frame.

Also provided by the invention, as will be understood by reference to the examples included herein, are expression vectors containing the nucleic acid of the invention and transgenic cells and organisms, in particular transgenic C. elegans transformed or transfected with the expression vector. In a further aspect the invention also provides a C. elegans PKD2 protein (denoted herein CEPKD2) comprising the sequence of amino acids set forth in SEQ ID NO: 8 or a sequence of amino acids which differs from that set forth in SEQ ID NO: 8 only in conservative amino acid changes. The sequence set forth in SEQ ID NO: 8 is an amino acid sequence for the CEPKD2 protein, derivable from the cloned fragments containing the complete CEPKD2 open reading frame (in pGB2202 and pGB2203) .

Also provided by the invention is a nucleic acid which encodes the protein of the invention.

The invention further provides a nucleic acid molecule comprising the sequence of nucleotides set forth in SEQ ID NO: 9, this being a full length CEPKD2 cDNA. The nucleic acid molecules according to the invention may, advantageously, be included in a suitable expression vector to express the proteins encoded therefrom in a suitable host. Incorporation of cloned DNA into a suitable expression vector for subsequent transformation of said cell and subsequent selection of the transformed cells is well known to those skilled in the art as provided in Sambrook et al . (1989), molecular cloning, a laboratory manual, Cold Spring Harbour Laboratory Press. An expression vector according to the invention includes a vector having a nucleic acid according to the invention operably linked to regulatory sequences, such as promoter regions, that are capable of effecting expression of said DNA fragments. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. Such vectors may be transformed into a suitable host cell to provide for expression of a protein according to the invention. Thus, in a further aspect, the invention provides a process for preparing proteins according to the invention which comprises cultivating a host cell, transformed or transfected with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the protein, and recovering the expressed protein.

The vectors may be, for example, plasmid, virus or phage vectors provided with an origin of replication, and optionally a promoter for the expression of said nucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable markers, such as, for example, an antibiotic resistance.

Regulatory elements required for expression include promoter sequences to bind RNA polymerase and to direct an appropriate level of transcription initiation and also translation initiation sequences for ribosome binding. For example, a bacterial expression vector may include a promoter such as the lac promoter and for translation initiation the Shine- Dalgarno sequence and the start codon AUG. Similarly, a eukaryotic expression vector may include a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors may be obtained commercially or be assembled from the sequences described by methods well known in the art. Nucleic acid molecules according to the invention may be inserted into the vectors described in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense nucleic acids, including antisense peptide nucleic acid (PNA), may be produced by synthetic means .

In accordance with the present invention, a defined nucleic acid includes not only the identical nucleic acid but also any minor base variations including in particular, substitutions in cases which result in a synonymous codon (a different codon specifying the same amino acid residue) due to the degenerate code in conservative amino acid substitutions. The term "nucleic acid sequence" also includes the complementary sequence to any single stranded sequence given regarding base variations.

The nucleic acid sequences according to the invention may be produced using recombinant or synthetic techniques, such as for example using PCR which generally involves making a pair of primers, which may be from approximately 10 to 50 nucleotides to a region of the gene which is desired to be cloned, bringing the primers into contact with cDNA, or genomic DNA from a human cell, performing a polymerase chain reaction under conditions which brings about amplification of the desired region, isolating the amplified region or fragment and recovering the amplified DNA. Generally, such techniques are well known in the art, such as described in Sambrook et al . (Molecular Cloning: a Laboratory Manual, 1989) .

The nucleic acids or oligonucleotides according to the invention may carry a revealing label. Suitable labels include radioisotopes such as ³²P or ³⁵S, enzyme labels or other protein labels such as biotin or fluorescent markers. Such labels may be added to the nucleic acids or oligonucleotides of the invention and may be detected using known techniques per se.

The protein according to the invention includes all possible amino acid variants encoded by the nucleic acid molecule according to the invention including a protein encoded by said molecule and having conservative amino acid changes . Proteins or polypeptides according to the invention further include variants of such sequences, including naturally occurring allelic variants which are substantially homologous to said proteins or polypeptides. In this context, substantial homology is regarded as a sequence which has at least 70%, preferably 80 or 90% and most preferably 95% amino acid identity with the proteins or polypeptides encoded by the nucleic acid molecules according to the invention. The protein according to the invention may be recombinant, synthetic or naturally occurring, but is preferably recombinant. The invention further provides a host cell or organism, transformed or transfected with an expression vector according to the invention. The host cell or organism may advantageously be used in a method of producing protein, which comprises recovering any expressed protein from the host or organism transformed or transfected with the expression vector.

The invention also provides a transgenic cell, tissue or organism comprising a transgene capable of expressing a protein according to the invention. The term "transgene capable of expressing" as used herein encompasses any suitable nucleic acid sequence which leads to expression of proteins having the same function and/or activity. The transgene, may include, for example, genomic nucleic acid isolated from human cells or synthetic nucleic acid, including DNA integrated into the genome or in an extrachromosomal state. Preferably, the transgene comprises the nucleic acid sequence encoding the proteins according to the invention as described herein, or a functional fragment of said nucleic acid. A functional fragment of said nucleic acid should be taken to mean a fragment of the gene comprising said nucleic acid coding for the proteins according to the invention or a functional equivalent, derivative or a nonfunctional derivative such as a dominant negative mutant, or bioprecusor of said proteins.

The protein expressed by said transgenic cell, tissue or organism or a functional equivalent or bioprecusor of said protein also forms part of the present invention. Recombinant proteins may be recovered and purified from host cell cultures by methods known in the art, including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose, chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography .

The protein of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial yeast, higher plant, insect and mammalian cells in culture) . Depending upon the host employed in a recombinant production procedure, the expressed protein may lack the initiating methionine residue as a result of post-translational cleavage. Proteins which have been modified in this way are also included within the scope of the invention.

The invention still further provides an antibody capable of specifically binding to a protein according to the invention, i.e. protein comprising the sequence of amino acids set forth in SEQ ID NO: 8. An antibody according to the invention may be raised according to standard techniques well known to those skilled in the art by using the protein of the invention or a fragment or single epitope thereof as the challenging antigen.

Cloning of a nucleic acid molecule containing the substantially complete open reading frame of pkd-2 has allowed elucidation of the phenotype associated with overexpression of the CEPKD2 protein. As will be demonstrated in the Examples included herein, overexpression of CEPKD2 in C. elegans does not results in obvious visual phenotypes. However, male C. elegans overexpressing CEPKD2 exhibit altered mating behaviour. Mating in C. elegans is a complex process, which includes various steps, male worms that overexpress a PKD protein, more particularly CEPKD2 or CEPKD1 or the combination of both, have difficulty in performing all the steps necessary for efficient mating. Hence this phenotype can be used to develop assays to select for compounds that alter the activity of PKD or alter the activity of proteins that act in the PKD pathway.

Therefore, in accordance with a second aspect of the invention there is provided a method of identifying a compound with potential pharmacological activity in the PKD2 pathway, which method comprises the steps of: exposing male transgenic C. elegans containing an expression vector comprising a nucleic acid containing the complete open reading frame of the C. elegans pkd-2 gene to a compound under test; and detecting a change in the mating behaviour of the transgenic C. elegans . As mentioned previously, transgenic male nematodes overexpressing CEPKD2 exhibit altered mating behaviour and hence produce reduced offspring when mated with an hermaphrodite strain. The method of the invention allows the selection of compounds which cause these worms to produce increased numbers of offspring or improved mating behaviour. A compound identified using this assay may affect the activity of PKD2 or another component of the PKD2 signalling pathway. Such a compound may be useful in the development of pharmacological preparations for the treatment of ADPKD.

Mating performance of C. elegans can be analysed by measuring the number of eggs or offspring produced from a mating experiment. The offspring can be measured directly by eye or using a so-called ^λFANS device' , which is an apparatus having properties analogous to a fluorescence activated cell scanning and sorting device (FACS) but adapted for use with worms and therefore designated a fluorescence activated nematode scanning and sorting device (FANS) . The FANS device is commercially available from Union Biometrica, Inc, Somerville, MA, USA. The FANS device enables the measurement of nematode properties, such as size, optical density, fluorescence, and luminescence .

Alternatively, specific antibodies and fluorescent antibodies can be used to detect the offspring. Any specific antibody that only recognizes eggs, or LI or L2 or L3 or L4 stage worms, will only recognize offspring. By way of example an antibody that recognizes an antigen on the surface of C. elegans LI larvae has been described by Hemmer et al . , (1991) J Cell Biol , 115(5): 1237-47. Finally, the number of eggs or offspring in each well can be counted directly using the FANS device.

In a particular embodiment, specific hermaphrodite strains (e.g. fer-1 or jer-2) are used which are not able to generate offspring by self-fertilization. Such so-called hermaphrodite 'non-selfers' cannot generate offspring, but hermaphrodites that have mated will generate offspring.

In another embodiment of the invention either the male worms or the hermaphrodite worms can be transgenic worms which stably express a marker molecule such as an autonomous fluorescent protein (GFP or BFP) or a luminescent marker in some or all cell types. The offspring generated from mating of these transgenic worms will also express the marker molecule and hence can be easily measured using a multi-well plate reader or a FANS device. In the case that the male worms are the transgenic worms expressing the marker then the hermaphrodites do not need to be 'non-selfers' since only offspring resulting from the mating of males and hermaphrodites will express the marker whilst offspring generated from hermaphrodite self-fertilization will not harbor the marker molecule. The offspring resulting from mating and self-fertilization can thus be distinguished. In the case that the hermaphrodite worm is the transgenic strain expressing the marker molecule the hermaphrodite strain is preferably also a ^Λnon-selfer' strain.

C. elegans are not able to perform mating in liquid media. The high-throughput screens based on mating behaviour are therefore performed in semi-liquid conditions. A low-melting agarose solution of approximately 0.5% is suitable for this purpose. This semi-liquid medium, or any semi-liquid medium gives sufficient support for the nematodes to move toward each other and to perform mating.

High throughput screens based on altered mating behaviour are preferably carried out in multi-well microtiter plates. Typically, a plurality of tests are run in parallel with different concentrations of the test compound. Usually one of these concentrations serves as a negative control, i.e. zero concentration of test substance. Changes in mating behaviour resulting from exposure to the compound may then be evaluated in comparison to the negative control .

In a particular embodiment, the method of the invention, based on overexpression of a PKD protein, can be performed using transgenic C. elegans containing an expression vector comprising nucleic acid encoding a disease mutant PKD protein. As used herein, the term "disease mutant PKD protein" should be taken to refer to a mutant PKD protein which is expressed by human patients with ADPKD and which is encoded by a disease causing allele of a PKD gene. Also included within the term "disease mutant PKD protein" are mutant variants of wild type C. elegans PKD proteins which mimic the mutant proteins present in human ADPKD patients i.e. amino acids in the C. elegans protein which are identical to the ones mutated in the human patient are mutated in an identical manner. The disease-causing mutations in the human PKD gene have been described by Hughes et al., 1995, Nature Genet. 10: 151-160. Using sequence alignments such as that shown in Figure 1 it is possible to introduce the same of analogous mutations into the CEPKD2 gene, for example using standard site- directed mutagenesis.

PKD genes and proteins are associated with the development of ADPKD. The nematode excretory canal can be considered as the nematode equivalent of the vertebrate nephron, as they perform the similar functions. C. elegans which overexpress PKD in the excretory canal of the nematode hence provide a model for ADPKD, or any other disease whose clinical manifestations include cysts.

Therefore, the invention further provides a method of identifying a compound with potential pharmacological activity in the PKD2 pathway, which method comprises the steps of: exposing transgenic C. elegans containing an expression vector comprising nucleic acid containing the complete open reading frame of the C. elegans pkd-2 gene operably linked to a promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal to a compound under test; and detecting phenotypic changes in .the excretory canal of the C. elegans .

Where a promoter is described herein as being capable of or suitable for directing tissue-specific gene expression in the excretory cell and/or excretory canal this should be taken to mean that the promoter directs a relatively high level of expression in the excretory cell and/or excretory canal and only background expression in other tissues. Preferably the promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal comprises nucleic acid comprising the sequence of nucleotides set forth in SEQ ID NO: 23, or any gene which is part of the PKD pathway or network, such as tensin. In a preferred embodiment, the transgenic C. elegans further contains a second expression vector comprising a promoter capable of directing tissue- specific gene expression in the C . elegans excretory cell and excretory canal operably linked to a reporter gene encoding a reporter protein such a GFP (or other autonomous fluorescent protein) , luciferase or β-galactosidase. Again, the promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal preferably comprises nucleic acid comprising the sequence of nucleotides set forth in SEQ ID NO: 23.

The expression of a marker such as GFP makes it possible to visualize the excretory cell in si tu in the body of the worm without intervening biochemical steps or specialized equipment such as nomarski- microscopy. A GFP-expressing excretory cell can be readily visualized .using binocular microscopy following UV irradiation of the worm. Defects in the morphology or function of the excretory cell, such as cyst formation and abnormal outgrowth can hence be visualized. Such phenotypes are the basis to select for compounds that alter the function of PKD2 or alter the function of proteins in the PKD2 pathway.

In a preferred embodiment, the above method can also be carried out using C. elegans which contain an expression vector comprising nucleic acid encoding a disease mutant PKD protein operably linked to a promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal Routine methods for the construction of transgenic C. elegans are well known in the art, see for example Methods of Cell Biology, volume 84, Caenorhabdi tis elegans : Modern Biological analysis of an Organism Ed. Epstein and Shakes, Academic Press, 1995.

As will be illustrated in the Examples included herein, the present inventors have isolated C. elegans strains which carry deletion mutations in the pkd-2 gene. Surprisingly, it is observed that male worms which carry the deletion exhibit the same alterations in mating behaviour as are observed in worms which overexpress CEPKD2. Hence, nematodes which are mutated in CEPKD2 can be used in assays to select for compounds that reduce the mating reduction phenotype. Such compounds may be useful in the development pharmaceutical preparations for the preventative or curative treatment of ADPKD.

Therefore, in a third aspect the invention provides a method of identifying compounds with potential pharmacological activity in the PKD2 pathway, which method comprises the steps of: exposing mutant C. elegans having a deletion mutation in the pkd-2 gene to a compound under test; and detecting a change in the mating behaviour of the C. elegans .

The deletion mutation will be one which causes a loss-of-function in CEPKD2. In a preferred embodiment the mutant C. elegans will be deleted for the region of the pkd-2 gene shown from position 5273 to 7316 of the sequence illustrated in SEQ ID NO: 11.

Standard methods are known for creating mutant worms with mutations in selected C. elegans genes, see for example J. Sutton and J. Hodgkin in "The Nematode Caenorhabdi tis elegans" , Ed. by William B. Wood and the Community of C. elegans Researchers CSHL, 1988 594-595; Zwaal et al, "Target - Selected Gene Inactivation in Caenorhabdi tis elegans by using a Frozen Transposon Insertion Mutant Bank" 1993, Proc. Natl. Acad. Sci. USA 90 pp 7431 -7435. A population of C. elegans worms may be subjected to random mutagenesis by using EMS, TMP-UV or radiation (Methods in Cell Biology, Vol 48, ibid) . Several selection rounds of PCR may then be performed to select a mutant worm with a deletion ^'in a desired gene in this case the pkd-2 gene. Male mutant worms may then be screened for alterations/defects in mating behaviour which are indicative of a loss-of-function of PKD2.

The inventors have further observed that male C. elegans harboring knockout mutations in either the pkd-1 gene, the pkd-2 gene or both genes exhibit an alteration in 'clumping' behaviour, as compared to wild-type male C. elegans . If wild-type male C. elegans are brought together on an agar plate without hermaphrodites being present they are observed to react on each other, forming clumps of males consisting of up to 15 worms. Because the formation of clumps is dependent upon the responsiveness of the males, clump formation may be used as a read-out of responsiveness in order to discriminate between worms which exhibit wild-type responsiveness and worms, such as pkd-1 and pkd-2 knockout mutants and also lov-1 mutants, which exhibit defective responsiveness and therefore less clumping. Furthermore, clump formation can be used as the basis of a compound screening assay using pkd-1 or pkd-2 mutants. Compounds which induce the clumping phenotype in pkd mutant worms are scored as having potential pharmacological activity in the PKD pathway.

Accordingly, the invention further provides a method of identifying a compound having potential pharmacological activity in the PKD pathway, which method comprises the steps of: contacting a plurality of male mutant C. elegans having a deletion mutation in the pkd-1 gene, the pkd- 2 gene or both genes with a compound under test; and observing and scoring the formation of clumps of C. elegans. Again, the deletion mutation will be one which causes a loss-of-function in the PKD protein. In a preferred embodiment the mutant C. elegans will be a pkd-2 mutant deleted for the region of the pkd-2 gene shown from position 5273 to 7316 of the sequence illustrated in SEQ ID NO: 11. Clumps of C. elegans are defined as a group of three or more males in contact with each other for 30 seconds or more.

The screen may be performed using mutant C. elegans having a mutation in the pkd-1 gene, the pkd-2 gene or both genes. The C. elegans lov-1 mutant and the pkd-1 gene are described by Barr and Sternberg, Science, 1999, 401:386-389

The screening method of the invention is preferably carried out on standard agar plates of the type known in the art for culture of C. elegans, as illustrated in the accompanying Examples. In addition, the screening can also be done in multiwell plates, for example the screening can be done in multiwell plates with 6 wells, 24 wells and 96 wells. Male worms are exposed to the test compound and both the numbers of clumps and the numbers of worms forming each clump are counted and scored at various intervals of time.

Typically, the compound screening assay may involve running a plurality of tests in parallel with different concentrations of the compound under test. Typically, one of these concentrations serves as a negative control, i.e. zero concentration of test substance. Changes in clumping behaviour resulting from exposure to the compound may then be evaluated in comparison to the negative control.

The compound screening method allows the rapid discovery of compounds which suppress the pkd mutation, possibly by acting on components of the PKD pathway itself or a parallel pathway. Compounds identified using the assay may be lead compounds for the development of pharmaceutical agents of potential therapeutic benefit in the treatment of ADPKD.

The mutant C. elegans having a deletion mutation in the pkd-2 gene can also be used as the basis for a suppressor screen to identify mutations which suppress the mutation in pkd-2. Therefore, the invention also provides a method of identifying a suppressor of a mutation in the C. elegans pkd-2 gene, which method comprises the steps of: subjecting a population of mutant C. elegans having a deletion mutation in the pkd-2 gene to random mutagenesis; screening for C. elegans carrying a mutation which suppresses the pkd-2 mutation by detecting changes in the mating behaviour of the C. elegans .

In a preferred embodiment, the mutant C. elegans has the genotype Δpkd-2; plg-1 ; him-5. Preferably the mutant C. elegans contains a pkd-2 gene which is deleted for the region of the pkd-2 gene shown from position 5273 to 7316 of the sequence illustrated in SEQ ID NO: 11. Genes that suppress the CEPKD2 phenotype in a mating assay are called suppressor genes or suppressors of CEPKD { sup^{9 '2}) . The suppressor gene may encode a protein which acts in the same pathway as PKD2 or a protein which acts in a parallel pathway of the PKD2 pathway. In a suppressor screen, worms carrying mutations in CEPKD2 are mutagenized resulting in an additional mutation in another gene. This additional mutation is then tested for suppressing the CEPKD2 phenotype by screening for changes in the mating behaviour of the worms. Worms which carry a second mutation in a suppressor gene will show a reversion towards wild-type mating behaviour i.e. suppression of the altered mating behaviour associated with the pkd-2.

In a final important aspect, the invention provides compound screening methods based on alterations in the sub-cellular localization of a PKD fusion protein.

In particular, the invention provides a method of identifying a compound with potential pharmacological activity in the PKD pathway, which method comprises the steps of: exposing transgenic C. elegans containing an expression vector comprising a nucleic acid sequence encoding a fusion protein, said fusion protein comprising the complete ORF of a PKD gene or a mutant ORF of a PKD gene fused in-frame to a reporter protein, to a compound under test; and detecting a change in the subcellular localization of the fusion protein in cells of the transgenic C. elegans .

The PKD gene for use in this screen may be human PKDl, human PKD 2, C. elegans pkd-1 or C. elegans pkd- 2.

The invention will be further understood with reference to the following Examples, together with the accompanying Figures in which:

Figure 1 is an alignment of the sequences of various species homologues of the PKD2 protein.

Figure 2 shows the expression pattern of cepkd-2 in the C. elegans hermaphrodite head.

Figure 3 shows the expression pattern of cepkd-2 in the C. elegans male tail.

Figure 4 shows the expression pattern of cepkd-2 in the C. elegans male head.

Figure 5 outlines the procedure of screening for pkd-2 suppressors and enhancers.

Figure 6 is a graph to show typical results of a clumping assay.

Figure 7 shows the co-localization of the C-terminal domain of C. elegans PKD-1 to dense bodies in the body wall muscles.

Figure 8 is a representation of plasmid pGB2201.

Figure 9 is a representation of plasmid pGB2202.

Figure 10 is a representation of plasmid pGB2203.

Figure 11 is a representation of plasmid pGB1023.

Figure 12 is a representation of plasmid pGB1024.

Figure 13 is a representation of plasmid pGB1025.

Figure 14 is a representation of plasmid pGB1026.

Figure 15 is a representation of plasmid pGB2114.

Figure 16 is an alignment of the sequences of human and C. elegans PKD proteins. Example 1-Cloning of CEPKD-2 and CEPKD-2 promoter region and endogenous PKD and GFP expression.

Cloning of CEPKD-2 (PGB2201) Analysis of the EMBL HTGS database revealed -the presence of two different incomplete YAC sequences (CEY40H7 (Accession No = AL021389) and CEY73F8 (Accession No = AL22285) ) that contain a C elegans gene with clear homology to human PKD2. The sequence of these YACs was used to design two primers: oGB9 as forward primer: (AATTGTGAAGTTAGGGTGTTGTCT ) and oGB12 as reverse primer:

(GAATCCCGGGGATCCGCGAACATCACTGCAAATCCTC) . oGB12 contains extra EcoRI, Smal and BamHI sites (single underlined sequences) to facilitate in-frame cloning of a part of the CEPKD2 gene with the GFP gene in the pPD95.75 vector (Andrew Fire, Carnegie Institution, Baltimore, U.S.A.). The double underlined sequences hybridize with the template. Long Range PCR with oGB9 and oGB12 primers on genomic DNA isolated from C. elegans generated an amplicon of 6387 bp. This amplicon was blunt-BamHI cloned in the pPD95.75 vector. The resulting vector was named pGB2201 (SEQ ID NO: 1) .

Cloning of full length CEPKD-2 (pGB2202, PGB2203)

The constructs pGB2202 and pGB2203 (SEQ ID NOS: 2 and 3) are both derived from pGB2201 but contain an additional cDNA insert that comprises the coding exons of CEPKD2 which were not included in pGB2201. In pGB2202 the entire CEPKD2 gene is cloned in-frame with the GFP protein, while in pGB2203 the entire CEPKD2 gene is followed by two HA-tags and two stop codons. Consequently, transcripts from pGB2203 do not translate the GFP fragment. Like GFP, the HA-tags can be used to visualize the transgene in pGB2203 transgenic worms. pGB2202 was constructed, starting from the primers: OGB49 (GCGGAATTCGCCGTCACCGTCTCCACTATCTCAC) and oGB58

(GTCTGGCCAATCCCGGGGTTCTTCTTTTTTGTCAGCAATCGAGGTG) . The double underlined sequences hybridize to the template while the single underlined nucleotides were added to facilitate cloning. PCR reactions were performed using oGB49 and oGB58 as primers and EST yk219el.3 (Yuji Kohara clone) as template. yk219el.3 contains a partial CEPKD2 cDNA. The resulting amplicon was approximately 1180 bp in length. A 824 bp Bglll/Xmal amplicon fragment was subcloned into pGB2201 to generate pGB2202 (See SEQ ID NO: 2) .

pGB2203 was constructed, starting from the primers : oGB49 (GCGGAATTCGCCGTCACCGTCTCCACTATCTCAC) and OGB59

(CGCTGGCCACCCGGGTCATTAAGCATAGTCCGGCACATCATACGGATATGCGT AATCAGGTACGTCGTATGGGTATTCTTCTTTTTTGTCAGCAATCGAGGTG) . The double underlined sequences hybridize to the template while the single underlined nucleotides were added to facilitate cloning by the addition of restriction sites. PCR reactions were performed using OGB49 and oGB59 as primers and EST yk219el.3 (Yuji Kohara clone) as template. yk219el.3 contains a partial CEPKD2 cDNA. The resulting amplicon was approximately 1180 bp in length. A 883 bp Bglll/Xmal amplicon fragment was subcloned in pGB2201 to generate pGB2203 (See SEQ ID NO: 3) . Several primers were designed to amplify different parts of the genomic CEPKD2 gene. Long range PCRs on C. elegans genomic DNA using different primer combinations all PCR products of the expected lengths, indicating that cePDK2 had indeed been amplified. However, it only proved possible to sub-clone one genomic fragment of CEPKD2, the fragment amplified with primers oGB9-oGB12. These results clearly indicate that it is difficult to clone the entire CEPKD2 gene or even fragments of it. This is probably due to plasmid recombinations within the transformed bacteria. Consequently, in order to provide a construct encoding the full CEPKD2 ORF under the control of the endogenous PKD2 transcription and translation regulatory sequences it was necessary to make a fusion between genomic DNA and cDNA.

Example 2-Expression of CEPKD2 in C. eleσans .

In a first experiment, the vector pGB2201 was injected into C . elegans, using standard techniques (see Methods in Cell Biology, Vol 48 Ed. H. F. Epstein and D. C. Shakes, Academic Press) and expression of the PKD2:GFP fusion protein was verified by fluorescence microscopy.

Expression of CEPKD2 could be observed in at least 16 cells, mostly neurons. The GFP staining was clearly membrane located and in some cases the axons were clearly stained,^' as could be observed in at least the CEM cell. Apparently no obvious visual phenotypes could be detected by simple microscopy.

In a second experiment, both pGB2202 and pGB2203 were injected into C. elegans, and the expression patterns and phenotypes were observed. The plasmids pGB2202 and pGB2203 both contain the transcription and translation regulatory sequences of the CEPKD2 gene. Accordingly, the expression pattern of the PKD-2: GFP fusion protein reflects the endogenous expression pattern of CEPKD2. Following transfection pattern with each of these vectors an expression pattern for the fusion protein similar to that obtained with pGB2201 was observed.

The above-described transfection experiments were all performed using hermaphrodite nematodes. When analogous experiment were performed in male nematodes, similar expression patterns to those seen in hermaphrodites were obtained. In addition, high expression of the fusion proteins could also be observed in at least 3 male-specific head neurons and in 10 male-specific tail neurons.

Example 3-Expression of the C-terminal part of CEPKD is located to the dense bodies. The C-terminal part of CEPKD-1 was cloned by: 1) performing a standard PCR cloning using the primers

oGBHO:

5 ' -gcgcgaattctcaatctttctccacatcgtttagcc-3 '

and oGB109la:

5 ' -ggcgagaattctacgtcactataattatgttcgagttcg-3 '

The underlined sequences related to the introduction of restriction recognition sites for the restriction enzyme EcoRI.

The template was EST clone ykl55e4, (Yuji Kohara) The resulting fragment was cloned as an EcoRI fragment in plasmid PD118.20 (Fire A., Carnegie Institution) digested with the same enzymes. The resulting vector was designated pGB2114.

The vector was introduced into C. elegans, using standard techniques known in the art and the resulting GFP expression was monitored. This GFP expression could clearly be located at the level of the dense bodies (see Figure 7) . Example 4-Generatinq deletion mutations in CEPKD1 and CEPKD2.

A population of nematodes are mutagenized, preferentially using UV-TMP, and the worms are pooled. The pool is then divided into an appropriate number of fractions. DNA is isolated from each of these fractions and used as a template for PCR selection to select for a CEPKD1 or CEPKD2 gene that has a mutation. To accomplish this, PCR is used to identify the fraction of the original pool containing a CEPKD1 or CEPKD2 mutant. Further rounds of PCR selection finally results in the isolation of a heterozygote C. elegans carrying a mutation in the CEPKD1 or CEPKD2 gene (see Jansen et al., 1997, Nature Genetics 17:119-121) .

Using this strategy a deletion mutant has been isolated for each CEPKD gene, pkd-1 (bg74) and pkd-2 (bg52) . These worm strains have been out-crossed at least twice in order to obtain a line without any other mutation. Furthermore, both deletion mutations have been characterized: the PCR fragment used to identify worms with deletions in CEPKD was cloned into a sequencing vector. The sequence data have provided, that the deletion in CEPKD1 is an in-frame deletion deleting the predicted transmembrane domains 2 to 6.

The deletion in CEPKD2 results in an of frame mutation deleting all six predicted transmembrane domains. The complete sequence of the pkd-2 gene is shown in SEQ ID NO 11. Strain bg52 is deleted for the region from position 5273 to 7316.

Characterization of C. elegans mutated in CEPKD-2.

Although apparently no obvious visual morphological changes could be observed in either hermaphrodites or males carrying the deletion in

CEPKD2, a behaviour phenotype was observed in the male worms. Male worms that carry a deletion mutation in CEPKD2 clearly show an alteration in mating behaviour. In particular, males carrying a deletion mutation in CEPKD2 rarely respond to hermaphrodites. Furthermore, when these males respond to a hermaphrodite they fail to locate the vulva significantly more often than male worms which do not carry a mutation in PKD2. Both the decreased response to hermaphrodites and the defect in vulva localization can lead to a decreased mating efficiency. If a PKD2 mutant male is placed on a plate with one mobile hermaphrodite, the mating efficiency is reduced to 50% in comparison to wild- type males. The mating efficiency can be slightly improved by using immobile hermaphrodites, for example hermaphrodites carrying a mutation in unc-32 and dpy- I. In this case the mating efficiency is restored to 60% of wild-type.

Example 5-Generating a okd-2 (bg52); him-5 (e!467) strain. him-5 (el467) males (available from the Caenorhabditis Genetics Center) were crossed into pkd-2 (bg52) hermaphrodites at 20°C. The resultant progeny (Fl) were cultivated and their progeny (F2) were singled out as follows: Hermaphrodite worms were allowed to lay eggs for 24 hours and a single worm PCR was performed on each of these (F2) to identify hermaphrodites that are homozygous for CEPKD2. The F3 generation were examined for the presence of males as indicator of him-5 phemotype. Worm strains homozygous for the deletion in CEPKD2 and for him-5 were kept.

Example 6- Generating a pkd-1 (bg74); pkd-2 (bg52); him-5 (e!467) strain. pkd-2 (bg52); him-5 (el467) males were crossed into pkd-1 (bg74) hermaphrodites at 20°C. Progeny (Fl generation) were cultivated and their progeny (F2 generation) is singled out as follows: Hermaphrodites were allowed to lay eggs for 24 hours. A single worm PCR was then performed on each of these (F2) to identify all hermaphrodites that are homozygous for CEPKDl. The progeny of these worms (F3 generation) was singled out again, i.e allowed to lay eggs for 24 hours and then screened for homozygosity for CEPKD2 using single worm PCR. Strains homozygous for both

CEPKD genes were kept. Care was taken to single out sufficient numbers of worms to also acquire the triple pkd-1 (bg74); pkd-2 (bg52); him-5 (el467), which occurs with a frequency of one in sixty four.

Example 7- Suppressor screen in C. elegans to find PKD suppressors and enhancers.

Synchronized Δpkd-2; plg-1 ; him-5 hermaphrodites are subjected to EMS and/or TMP/UV mutagenesis and the offspring is cultivated at 20°C. The offspring (Fl) carrying additional mutations Δpkd-2; plg-1 ; him-5; sup/+ are then singled out. The hermaphrodites segregate due to the mutation in him-5 males (F2) with the following genotypes: pkd-2; plg-1 ; him-5; + pkd-2; plg-1 ; him-5; sup/+ pkd-2; plg-1 ; him-5; sup .

These males are used in a mating assay in which they are crossed into hermaphrodites carrying a genetic marker, e.g., a mutation in dpy-1 7, or containing an expression marker like lacZ or GFP. The improvement of mating in a mating assay indicates the presence of a candidate supressor mutation sup^Δpkd'2. In this example, the mutation in plg-1 is used to mark successfully mated hermaphrodites with a mating plug. One could score the amount of hermaphrodites that are mated in a given time period or one could measure the time until the first mating plug appears. An improvement of mating, which may result in more mated hermaphrodites in a given time or which may shorten the time until the first mating plug appears, indicates that the additional mutation sup suppresses the CEPKD2 phenotype. Hermaphrodites of genotype Δpkd-2 ; plg-1 ; him-5; sup/+ are singled out after the mutagenesis (Fl) and individuals which produce males with improved mating are kept. These strains may then be re-tested for mating improvement, tested for dominant or recessive defects of sup^Δpkd'2 , out-crossed and maintained as new a line. The new gene sup^Δpkd~2 may then be phenotypically characterised and cloned by standard positional cloning techniques .

Example 8-Yeast two hybrid (Y2H) experiments. The effects induced in mammalian cells by expression of the C-terminal part of PKD clearly suggest a role of this part of the protein in signal transduction and/or interaction or binding with other proteins.

Since hPKD is expected to be inserted in membranes, the cytoplasmic C-terminal tail of CEPKD1 and CEPKD2 were fused to the Gal4 DNA binding domain in the pAS2 vector for setting up a Y2H screen against C. elegans cDNA libraries. Because the complexity of the C. elegans genome is low, a C. elegans based Y2H screen has positive advantages over a mammalian based Y2H screen. For example, a C. elegans YTH screen results in more clear data, and due to the lower complexity of the C. elegans genome compared to the human or other vertebrate genomes, such a screen results in a better saturation of the experiment. Additionally, CEPKDl and CEPKD2 were fused to the Gal4 activation domain in the pGAD424 vector. The latter plasmids can also be used to check protein-protein interactions.

The following constructs were made for yeast two hybrid experiments:

1A]_ CEPKDl in pAS2 : (pGB1023, SEO ID NO: 4, Figure 11) The C. elegans PKDl insert was amplified from EST ykl55e4 (Yuji Kohara) with the primers oGB37 (CGTTCCATGGCATTCGAGTTCGAGGAAATTCGTAATG) and oGB38 (GGCTCGAGTCGACTCAATCTTTCTCCACATCGTTTAGC) . The sequences hybridizing to CEPKDl are underlined. The 348 bp amplicon was digested with Ncol and Sail and cloned into the Ncol/Sall sites of a pAS2 derived vector (Figure 11) .

(B) CEPKDl in PGAD424: (PGB1024, SEO ID NO: 5, Figure 12)

The C. elegans PKDl insert was amplified from EST ykl55e4 (Yuji Kohara) with the primers oGB37 (CGTTCCATGGCATTCGAGTTCGAGGAAATTCGTAATG) and OGB38 (GGCTCGAGTCGACTCAATCTTTCTCCACATCGTTTAGC) . The sequences hybridizing to CEPKDl are underlined. The 348 bp amplicon was digested with Ncol and Sail and cloned into the Ncol/Sall sites of a pGAD424 derived vector (Figure 12) .

(C) CEPKD2 in pAS2 : (PGB1025, SEO ID NO: 6, Figure 13) The C. elegans PKD2 insert was amplified from EST yk219el (Yuji Kohara) with the primers oGB41 (CGTTCCATGGAAGTGAAAGCAGAGCTGGCTAGAA) and oGB42 (GGCTCGAGTCGACTCATTCTTCTTTTTTGTCAGCAATCGAG) . The sequences hybridizing to CEPKD2 are underlined. The 548bp amplicon was digested with Ncol and Sail and cloned into the Ncol/Sall sites of a pAS2 derived vector (Figure 13)

(D) CEPKD2 in PGAD424: (pGBl026, SEO ID NO: 7 , Figure 14)

The C. elegans PKD2 insert was amplified from EST yk219el (Yuji Kohara) with the primers oGB41 (CGTTCCATGGAAGTGAAAGCAGAGCTGGCTAGAA) and oGB42 (GGCTCGAGTCGACTCATTCTTCTTTTTTGTCAGCAATCGAG) . The sequences hybridizing to CEPKD2 are underlined. The 548bp amplicon was digested with Ncol and. Sail and cloned into the Ncol/Sall sites of a pGAD424 derived vector (Figure 14).

Construction of a C. elegans Library and yeast two hybrid experiments . cDNA libraries were constructed and yeast two hybrid experiments with C. elegans cDNA were performed as described by Elledge et al., Proc. Natl. Acad. Sci., 1991, 88:1731-1735, or using the Matchmaker™ system supplied by Clontech, California, according to the protocols supplied by the manufacturer, or using minor modifications of the aforesaid methods.

Example 9-a mating assay using hermaphrodite non- selfers .

High throughput analysis of nematode mating behaviour was be performed by counting the offspring of the mating experiment. First, equal amounts of male worms were distributed over the wells of multi- well plates. Hermaphrodites were then added over the wells in such a way that the every well contains an equal amount of hermaphrodites. The ratio between males and hermaphrodites can be varied from experiment to experiment. The hermaphrodite chosen in this experiment has a reduced self-offspring or the offspring is non-viable or preferentially the hermaphrodite is self-sterile, such as the hermaphrodites mutant in the fer or spe genes. Furthermore, to enhance mating the self- sterile hermaphrodite has preferentially a reduced movement or no movement phenotype.

Mating behaviour is assessed by measuring the total number of offspring produced.

Example 10-a mating assay hermaphrodite non-selfers expressing GFP

A mating assay can also be performed using a specific self-sterile transgenic hermaphrodite that has a reduced movement phenotype and stably expresses GFP. All offspring of this mating assay will express GFP and hence the number of offspring can easily be detected by measuring the GFP fluorescence using a multi-well plate reader or a FANS device. Hermaphrodites expressing other markers such as luminescent markers can be used in an analogous experiment .

Example 11-a mating assay with males expressing GFP In another variant of the mating assay the hermaphrodites were chosen in following combinations:

a) The hermaphrodites were wild-type hermaphrodites, or hermaphrodites showing a reduced movement phenotype b) The male nematodes expressing GFP.

In this experiment, the offspring of the self- fertilization of the hermaphrodite, and the offspring resulting from the genuine mating can be distinguished by following the fluorescence of the GFP, as only the offspring resulting from a mating will show GFP expression.

Example 12-screening assay based on differences in male clumping behaviour between wild-type C. elegans and okd knockout males. Rationale :

For efficient mating C. elegans males need to react properly when they make contact with a hermaphrodite. The male should arch the posterior third of his body and appease the ventral side of his tail to the body of the hermaphrodite. The male then searches for the vulva by scanning the ventral or dorsal side with his tail using a backward motion. The male can turn from dorsal to the ventral side of hermaphrodite by a deep ventral flexion of his tail. If the male passes the vulva it will abruptly stop his motion or even revert its direction to make contact. It can then insert its spicules to inseminate the hermaphrodite.

The lov-i mutant and pkd-1 and pkd-2 knockout (deletion) mutants do not reacting properly on contact with the vulva (lov = _.location of vulva defective) . However, lov-1 is also described to be not as responsive to initial contact as wild-type males.

If many wild-type males are brought on a small plate without a hermaphrodite present they will react on each other. In this way clumps of males are formed consisting of up to 15 worms. Because the formation of clumps depends on the responsiveness of males it could be used to measure this responsiveness and hence discriminate between wild-type responsiveness and that of the lov-1 and the pkd knockout mutants. Materials :

N2 male stock (N2 Bristol strain, available from CGC, University of Minnesota) , and/or C. elegans mutants that enable fast generating of males (him-5 (el467)).

Pkd-1 mutant male stock, and/or C. elegans double mutants that enable the fast generation of males.

Males can be generated using standard techniques as described in previous examples.

12 well plates with 2 ml NGM, seeded with a thin lawn of E. coli OP50

Method:

30 N2 males were placed into each of two wells of the 12 well plate. 30 pkd-1 males were placed in each of two further wells. At t=0 the plate was dropped to disperse the worms over the surface. Afterwards the plate was handled with care to not disturb the worms. The number of clumps and the number of worms in these clumps where counted with intervals of one hour. The following definition of a clump is used: A group of three or more males in contact with each other for 30 seconds or more.

Results :

The number of the N2 males involved in clumping increased over time, with its maximum around 25 of the 30 involved. The pkd-1 males never reached higher than 8 to 7 worms involved in clumping. A difference was also seen in the number of clumps but was not as striking. Table 1

Table 2

As it is possible to discriminate between wild-type worms and worms harboring a mutation on pkd-1 , pkd-2 or in both genes using clumping it is now possible to select for compounds that affect this phenotype. Prior to and/or during the time course of the assay, compounds are added to the worms. More particularly, compounds are added to the worms harboring a pkd-1 , pkd-2 and/or a double mutation. These compounds can be of diverse nature. The compound selection assay performed using the clumping assay selects for compounds that induce the clumping phenotype in the mutated worms. Such compounds rescue the pkd mutation, and hence are compounds with the putative pharmaceutical effect. Compounds selected using this assay may be lead compounds in the development of pharmaceuticals with potential therapeutic effects in ADPKD.

Example 13-yeast two hybrid high-throughput screening. Protein-protein interaction leads to expression of a reporter protein β-galactosidase in a yeast two hybrid assay. An assay has been developed that is usable in 96 or 384 well plates or microtiter plates with another number of wells. This assay is suitable for high throughput compound screening. Optimal performance of the assay is dependent upon at least two important parameters: lysis of yeast cells and the choice of the β-galactosidase substrate.

The basic protocol for an assay in 96 or 384 well plates is as follows:

A yeast strain containing the Escheri chia coli lacZ gene under the control of the yeast Gal4 promoter is grown overnight (with shaking at 230-270 rpm) then diluted with YPD medium to an OD600 of 0.2. Diluted cultures are grown for an additional 3-5 hr until mid-log phase. Yeast cells are then transferred to either 96- or 384-well plates (100 μl/well or 25 μl/well, respectively) . Alternatively, cells can be cultured in the microtiter plates, eliminating the need for a pipetting step.

The yeast cells are then either lysed by freeze and thaw method (liquid N₂ to freeze, 37°C water bath to thaw) or by use of a Lysis buffer (e.g.: 1% Lithium dodecyl sulphate, 100 mM EDTA and 10 mM Tris-HCl pH 8.0). Non-lysed cells also give a signal, although the variability is increased if the cells are not lysed. Yeast cells can also be permeabilized with various reagents such as isopropanol (15 %).

The substrate sensitivity must be optimised for efficient detection in a screening process . Fluorescein di galactoside (FDG) is a typical low cost fluorescent reagent for the detection of β-galactosidase; it can be used for screening, although autofluorescent compounds can induce a non- desirable background leading to false positives. Alternative substrates are available that become luminescent upon β-galactosidase cleavage, thereby eliminating background problems. An example of such a substrate Galacton-Star® from Tropix. Typically about lμM substrate is added and the plates are incubated at room temperature for 60 minutes. Fluorescence (for FDG) is then measured at 530 nm. It is typically possible to detect as low as 100 cells per well.

As an alternative to the use of β-galactosidase, secreted alkaline phosphatase can be used as a reporter gene. The use of secreted alkaline phosphatase gives equivalent sensitivity to β- galactosidase with the advantage that there is no need to lyse the cells. Fluorescent substrates for alkaline phosphatase are available commercially from Sigma- Aldrich (Bornem, Belgium) or Molecular Probes (Eugene, OR, USA) .

The test compound can be added at various stages of the above procedure. Generally, the compound is added on the plates onto which the yeast are plated. However, the compound can also be added during the second incubation in order to overcome toxicity ptoblems. As a control, it is important to check whether the compound slows down the growth of the yeast. This can be done using turbidity measurements. Example 14-detection of in vivo protein-protein interactions using fluorescence energy transfer (FRET) .

An in vivo FRET assay can be conveniently performed using two different mutants of GFP which absorb and emit light at different wavelengths and which have suitably overlapping emission/absorption spectra, such as EGFP (enhanced green fluorescent protein) and EBFP (enhanced blue fluorescent protein) . When two such variant GFPs are brought into close proximity, within a few nanometers distance, fluorescence energy transfer (FRET) can be detected. Such transfer is characterized by a reduction of fluorescence intensity of the donor fluorophore (EBFP) and re-emission of fluorescence at the acceptor fluorophore (EGFP) wavelengths. Therefore if each fluorophore is fused to a protein domain known to bind to the other the protein-protein interaction can be monitored in vivo using FRET. In a typical example, the FAK binding domain of PKD-2 cloned in fusion with EBFP, whereas FAK is cloned in fusion with EGFP in expression vectors suitable for use in the chosen host cell line or organism. When both fusion proteins are expressed in a cell line or in C. elegans it is possible to monitor and quantify their in vivo interaction by irradiating the cells/worms with light at 488nm. When the donor and acceptor fluorophore are brought into close proximity by binding of the two fusion proteins fluorescent energy transfer results in a measurable decreased in fluorescence from the fluorescence donor at a wavelength within the emission spectrum of the donor. In simple terms, what is measured is a quenching phenomenon since light emitted by the donor fluorophore is trapped by the acceptor fluorophore. NB- The experiment could also be performed by measuring fluorescence from the acceptor fluorophore but this is often less sensitive.

Example 15-homogeneous high throughput screening (HTS) method to measure protein-protein interactions in vi tro.

There are many ways to study protein protein interactions in vitro; they always require prior purification of each proteins. One of the mostly used in HTS is the scintillation proximity assay (SPA, trademark from Amersham) . In order to perform this assay a first protein must be linked onto a bead containing a scintillant. Linking of the protein to the beads can be carried out in many different ways, including, for example, via biotin-streptavidin affinity binding. Streptavidin-SPA beads are commercially available from Amersham and the interacting protein can easily be biotinylated in vi tro or expressed as a biotinylated fusion protein using techniques known in the art. The second protein is labelled with radioactivity. This can be achieved, for example, by synthesising the second interacting protein by in vi tro translation and incorporating a tritiated precursor amino acid. The SPA™ assay protocol is then as follows:

SPA beads linked to the first protein are incubated for 30 minutes to one hour with a sample containing the radioactively labelled second protein. Upon binding of the two interacting proteins, the radioactivity emitted by the labelled protein is brought into close proximity with the bead containing scintillant and therefore induces light emission from the scintillant. The free labelled protein in sample (non-bound) will not be held in sufficiently close proximity to the beads to induce light emission.

Compounds which disrupt the binding of the first and second proteins will cause a decrease in the amount of light emitted during the experiment.

An ELISA type approach to screen for compounds which disrupt binding between two proteins. In these experiments, the wells of a microtiter plate are coated with the first protein or fragments thereof. A sample containing both the compound under test and a second protein is then added to the wells and the plates are incubated to allow time for specific protein-protein binding. The non-immobilised protein is labelled with a tag which is directly or indirectly detectable, typically a fluorescent molecule such as GFP, or a tag which is detectable by specific antibody binding, such as a His-tag or GST-tag. Many other tag molecules which are equally suitable for this purpose are known in the art and are available commercially. The wells are then washed to remove the compound and any interacting proteins which remain unbound. Any tagged protein which has become bound to the immobilised protein is not removed by the washing step and can be detected via the directly or indirectly detectable tag. If the tagged protein is labelled with a GFP tag, then bound proteins are detected by measuring GFP fluorescence; if the tagged protein is labelled with a His-tag or a GST tag, bound proteins are detected with immunological techniques, using an antibody of the appropriate specificity.

Compounds which disrupt the protein-protein interaction will result in more of the protein remaining unbound, hence less protein will be detected after the washing step. SEQUENCE LISTING

SEQ ID NO: 1 complete nucleotide sequence of the plasmid pGB2201.

SEQ ID NO: 2 complete nucleotide sequence of the plasmid pGB2202.

SEQ ID NO: 3 complete nucleotide sequence of the plasmid pGB2203.

SEQ ID NO: 4 complete nucleotide sequence of the plasmid pGB1023.

SEQ ID NO: 5 complete nucleotide sequence of the plasmid pGB1024.

SEQ ID NO: 6 complete nucleotide sequence of the plasmid pGB1025.

SEQ ID NO: 7 complete nucleotide sequence of the plasmid pGB1026.

SEQ ID NO: 8 amino acid sequence of CEPKD2.

SEQ ID NO: 9 cDNA sequence of CEPKD2.

SEQ ID NO: 10 complete nucleotide sequence of the plasmid pGB2114.

SEQ ID NO: 11 genomic sequence of the C. elegans pkd-2 gene.

SEQ ID NO: 12 primer oGBHO

SEQ ID NO: 13 primer oGBl09Ia SEQ ID NO: 14 primer oGB37

SEQ ID NO: 15 primer oGB38

SEQ ID NO: 16 primer oGB41

SEQ ID NO: 17 primer oGB42

SEQ ID NO: 18 primer oGB9

SEQ ID NO: 19 primer OGB12

SEQ ID NO: 20 primer oGB49

SEQ ID NO: 21 primer oGB58

SEQ ID NO: 22 primer oGB59

SEQ ID NO: 23 fragment of the promoter region of the C. elegans UL6 gene. This fragment is capable of functioning as a promoter directing gene expression in the C. elegans excretory cell and excretory canal .

GenBank Accession Numbers :

Human PKDl gene, complete coding sequence: L39891

Human PKD2 gene, complete coding sequence: NM 00297

Claims

Claims :

1. An isolated nucleic acid comprising the sequence of nucleotides from position 4480 to 11632 of

> the sequence of nucleotides set forth in SEQ ID NO: 2.

2. An expression vector comprising the sequence of nucleotides from position 4480 to 11632 of the sequence of nucleotides set forth in SEQ ID NO: 2.

3. A host cell or organism transformed or transfected with the expression vector of claim 2.

4. A protein comprising the sequence of amino acids set forth in SEQ ID NO: 8 or a sequence of amino acids which differs from that set forth in SEQ ID NO: 8 only in conservative amino acid changes .

5. A nucleic acid comprising a sequence of nucleotides which encodes the protein of claim 4.

6. A nucleic acid comprising the sequence of nucleotides set forth in SEQ ID NO: 9.

7. An expression vector comprising the nucleic acid of claim 5 or claim 6.

8. A host cell or organism transformed or transfected with the expression vector of claim 7.

9. An antibody which is capable of specifically binding to the protein claimed in claim 4 or an epitope thereof.

10. A method of identifying a compound with potential pharmacological activity in the PKD2 pathway, which method comprises the steps of: exposing male transgenic C. elegans containing an expression vector comprising a nucleic acid containing the complete open reading frame of the C. elegans pkd-2 gene to a compound under test; and detecting a change in the mating behaviour of the transgenic C. elegans .

11. A method as claimed in claim 10 wherein the expression vector is an expression vector as claimed in claim 2.

12. A method of identifying a compound with potential pharmacological activity in the PKD2 pathway, which method comprises the steps of: exposing transgenic C. elegans containing an expression vector comprising nucleic acid containing the complete open reading frame of the C. elegans pkd-2 gene operably linked to a promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal to a compound under test; and detecting phenotypic changes in the excretory canal of the C. elegans .

13. A method as claimed in claim 12 wherein the transgenic C. elegans further contains a second expression vector comprising a promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal operably linked to a reporter gene.

14. A method as claimed in claim 12 or claim 13 wherein the promoter capable of directing tissue- specific gene expression in the C. elegans excretory cell and excretory canal comprises the sequence of nucleotides set forth in SEQ ID NO: 23 or a fragment thereof.

15. A method as claimed in claim 13 or claim 14 wherein the reporter gene encodes a fluorescent protein, a bioluminescent protein or β-galactosidase.

16. A mutant C. elegans strain having a deletion mutation in the pkd-2 gene, characterised in that the pkd-2 gene is deleted for the sequence of nucleotides from position 5273 to 7316 of the sequence shown in SEQ ID NO: 11.

17. A method of identifying compounds with potential pharmacological activity in the PKD2 pathway, which method comprises the steps of: exposing mutant C. elegans having a deletion mutation in the pkd-2 gene to a compound under test; and detecting a change in the mating behaviour of the C. elegans .

18. A method as claimed in claim 17 wherein the mutant C. elegans is a mutant C. elegans as claimed in claim 16.

19. A method of identifying a compound having potential pharmacological activity in the PKD pathway, which method comprises the steps of: contacting a plurality of male mutant C. elegans having a deletion mutation in the pkd-1 gene, the pkd- 2 gene or both said genes with a compound under test; and observing and scoring the formation of clumps of C. elegans .

20. A method as claimed in claim 19 wherein the mutant C. elegans are pkd-2 deletion mutant C. elegans according to claim 16.

21. A method of identifying a suppressor of mutation in the C. elegans pkd-2 gene, which method comprises the steps of: subjecting a population of mutant C. elegans having a deletion mutation in the pkd-2 gene to random mutagenesis; screening for C. elegans carrying a mutation which suppresses the pkd-2 mutation by detecting changes in the mating behaviour of the C. elegans .

22. A method as claimed in claim 21 wherein the mutant C. elegans having a deletion mutation in the pkd-2 gene has the genotype Δpkd-2 ; plg-1 ; him-5.

23. A method of identifying a compound with potential pharmacological activity in the PKD pathway, which method comprises the steps of: exposing transgenic C. elegans containing an expression vector comprising a nucleic acid sequence encoding a fusion protein, said fusion protein comprising the complete ORF of a PKD gene or a mutant ORF of a PKD gene fused in-frame to a reporter protein, to a compound under test; and detecting a change in the subcellular localization of the fusion protein in cells of the transgenic C. elegans .

24. A method as claimed in claim 23 wherein the PKD gene is human PKDl, human PKD 2, C. elegans pkd-1 or C. elegans pkd-2.

25. A method of identifying a compound with potential pharmacological activity in the treatment of ADPKD, which method comprises the steps of: exposing male transgenic C. elegans containing an expression vector comprising nucleic acid encoding a disease mutant PKD protein to a compound under test; and detecting a change in the mating behaviour of the transgenic C. elegans .

26. A method of identifying a compound with potential pharmacological activity in the treatment of ADPKD, which method comprises the steps of: exposing transgenic C. elegans containing an expression vector comprising nucleic acid encoding a disease mutant PKD protein operably linked to a promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal to a compound under test; and detecting phenotypic changes in the excretory canal of the C. elegans .

27. A method as claimed in claim 26 wherein the transgenic C. elegans further contains a second expression vector comprising a promoter capable of directing tissue-specific gene expression in the C. elegans excretory cell and excretory canal operably linked to a reporter gene.

28. A method as claimed in claim 26 or claim 27 wherein the promoter capable of directing tissue- specific gene expression in the C. elegans excretory cell and excretory canal comprises the sequence of nucleotides set forth in SEQ ID NO: 23 or a fragment thereof.

29. A method as claimed in claim 27 or claim 28 wherein the reporter gene encodes a fluorescent protein, a bioluminescent protein or β-galactosidase.