WO2001011033A2 - Balayage de genes bacteriens essentiels et de genome dans haemophilus influenzae en vue de l'identification de « genes essentiels » - Google Patents

Balayage de genes bacteriens essentiels et de genome dans haemophilus influenzae en vue de l'identification de « genes essentiels » Download PDF

Info

Publication number
WO2001011033A2
WO2001011033A2 PCT/US2000/021176 US0021176W WO0111033A2 WO 2001011033 A2 WO2001011033 A2 WO 2001011033A2 US 0021176 W US0021176 W US 0021176W WO 0111033 A2 WO0111033 A2 WO 0111033A2
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
sequence
group
essential
polypeptide
Prior art date
Application number
PCT/US2000/021176
Other languages
English (en)
Other versions
WO2001011033A3 (fr
Inventor
Linda E. Chovan
Paul E. Hessler
Karl A. Reich
Original Assignee
Abbott Laboratories
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Abbott Laboratories filed Critical Abbott Laboratories
Publication of WO2001011033A2 publication Critical patent/WO2001011033A2/fr
Publication of WO2001011033A3 publication Critical patent/WO2001011033A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1082—Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/285—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pasteurellaceae (F), e.g. Haemophilus influenza

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides, and their production, methods and uses, as well as variances, isolated from Haemophilus influenzae, the polynucleotide sequences of which are required for survival.
  • Haemophilus influenzae is Gram negative human pathogen. It is responsible for both invasive and non-invasive disease in both children and adults. The usual infections include middle ear (otitis media) and upper respiratory tract infections. There is an effective pediatric vaccine that has reduced the incidence of invasive disease in children (at least in the first world where the vaccine is given) but this has led to no decrease in adult disease - probably because the organism is normal resident of the human naso-pharyxn.
  • Haemophilus influenzae often referred to a H. flu for convenience, is a family of bacteria all of which can cause diseases in people. (The bacteria does not have anything to do with influenza, but when first identified it was thought to cause flu, hence the name.)
  • H. flu There are six sero types of H. flu known; most H. ⁇ tw-related disease is caused by type B, or " ⁇ IB".
  • ⁇ IB was one of the two most common causes of otitis media, sinus infections, and bronchitis. More important, ⁇ IB was also the most common cause of meningitis, and a frequent culprit in cases of pneumonia, septic arthritis (joint infections), cellulitis (infections of soft tissues), and pericarditis (infections of the membrane surrounding the heart).
  • septic arthritis joint infections
  • cellulitis infections of soft tissues
  • pericarditis infections of the membrane surrounding the heart.
  • One of the most dangerous results of ⁇ IB infection was epiglottis, an infection of the "flap" at the top of the windpipe that could kill a child by blocking air to the lungs.
  • the vaccine Before the vaccine was introduced, there were about 20,000 serious cases of HIB infections in the United States every year, most of which were of meningitis.
  • the vaccine is given 2-3 times in the first 6 months of life after birth, as a newborn, followed by a single dose at age 12-18 months. (There are two different HIB vaccines available; they are both very effective, but the dosage schedule differ between the two types.)
  • haemophilus influenzae type B (Hib) is one of the leading causes of invasive bacterial infection. It is the leading cause of meningitis* in this age group, killing 5 percent of infected children even when antibiotics are used to fight the disease.
  • the infection strikes most frequently between 6 and 12 months of age; 75 percent of all cases occur before 24 months of age.
  • Certain groups including African- Americans, Hispanics, Native American Indians and children who attend day-care centers — are at a higher risk of infection.
  • HIB infections in adults are rare, they occur more frequently when the patient is compromised by respiratory problems, diabetes, AIDS, or alcoholism. Infection is manifested as pneumonia.
  • haemophilus influenzae infection often resemble those of a cold, with a fever and headache.
  • iinfection reaches the covering of the brain (miningitis), nausea, vomiting and seizures may occur, making this a serious medical emergency.
  • Haemohhilus species make up a substantial portion of the indigenous microflora of the upper respiratory tract. Nearly all individuals over the age of 1 year are carriers for one or more species of Haemophilus. Species found in the upper respiratory tract include H. influenzae, H, parainfluenzae, H. haemolyticus, and H par aphaemolyticus. Of these species H influenzae is the most pathogenic.
  • H. influenzae is fastidious in its growth requirements. It grows best on chocolate agar or enriched media supplemented with two nutritional factors called X (hemin) and V
  • H influenzae (nicotinamide-adenine dinucleotide [NAD]). Colonies of H. influenzae increase in size if they are cultivated in the vicinity of other bacterial colonies, staphylococci, for example. This cooeprative effect is called the satellite phenomenon and is due to the production of NAD by the staphylococcal colonies. H influenzae can be divided into two groups: encapsulated and nonencaptsulated.
  • Infection with H. influenzae occurs following inhalation of respiratory droplets from patients or carriers.
  • Most invasive infections in the upper respiratory tract are caused by type b encapsultated strains ( ⁇ IB).
  • ⁇ IB serotypes are associated primarily with systemic infections that are the result of invasion of the bloodstream, for example, meningitis, epiglottitis, cellulitis, septic arthritis, and pneumonia.
  • Type b serotypes are the principal cause of bacterial meningitis in children under 4 years old. In this group of children, meningitis, even after chemotherapy, can lead to serious sequelae such as mental retardation.
  • ciliary epithelium For example, smoking or prior viral infection could cause loss of ciliary epithelium. As the epithelial surface becomes damaged, host receptors could be exposed, leading to interaction with bacterial adhesins. Bacteria invade the bloodstream, where they multiply and cross the blood-brain barrier. The capsule of ⁇ IB organisms appears to protect them from intravascular clearance mechanisms. Bacterial products as well as cell wall lipopolysaccharide (LPS) and peptidoglycan may play a role in the inflammation and tissue damage associated with meningitis.
  • LPS cell wall lipopolysaccharide
  • peptidoglycan may play a role in the inflammation and tissue damage associated with meningitis.
  • H influenzae is found in the upper respiratory tract of most healthy individuals.
  • ⁇ IB serotypes are found in the upper respiratory tract of less than 1 percent of children 6 months or younger.
  • maternal antibody provides protection from infection by HIB strains.
  • the majority of HIB meningitis infections occur in chidlren between the ages of 2 and 18 months. From the ages of 2 months to 5 years, HIB serotypes can be found in 5 percent of the children. Most children over the age of 5 years and adults will have naturally acquired immunity to HIB serotypes. Consequently 95 percent of HIB disease is found in children less than 4 years old. Nonencapsulated strains become less prevalent as commensals with increasing age.
  • H. influenzae strains in the upper respiratory tract are nonencapsulated.
  • Nonencapsulated strains rarely cause systemic disease.
  • Mucous membrane infections such as otitis media, sinusitis, bronchitis, alveolitis, conjunctivitis, and infections involving the female genital tract during parturition, however, common.
  • Pneumonia caused by nonencapsulated strains is more common in the elderly and in patients with chronic bronchitis.
  • These strains (along with Streptococcus pneumoniae) are the most frequent cause of otitis media in children between the ages of 6 and 24 months. By the age of 3 years, more than two-thirds of children have had one or more episodes of acute otitis media. Meningitis occurs primarily in predisposed patients. Of all meningitis cases in adults, about 50 percent are caused by nonencapsulated strain.
  • Ampicillin and chloramphenicol were once considered the most effective drugs in treating infections caused by H. influenzae, but drug-resistant strains have now become prevalent and as a result, sensitivity tests must be performed on clinical isolates before an antimicrobial regimen is begun.
  • This invention relates to essential bacterial genes are necessary for the bacterium's growth and survival, which could serve as potential anti-bacterial targets.
  • Another aspect of the invention relates to a method for the identification of essential genes.
  • Two methods are contemplated: 'mutation exclusion' or 'zero-time analysis'. Mutation exclusion consists of growing an insertional library and identifying open reading frames that do not contain insertional elements: in a growing population of bacteria, insertions in essential genes are excluded.
  • Zero-time analysis consists of following the fate of individual insertions after transformation in a growing culture: the loss of inserts in essential genes are followed over time. Both methods of analysis permit the identification of genes required for bacterial survival.
  • mutant organism e.g., strain
  • routine techniques may be used for transformation, amplification, isolation, purification, and sequencing the gene carrying the mutation.
  • Essential survival genes are required for growth (e.g., metabolism, division, or reproduction).
  • Such genes and gene products are useful in developing therapeutic agents such as antifungal, antibacterial, and antiparasitic agents; insecticidal agents; and preventive antimicrobial agents.
  • Therapeutic agents can reduce or prevent growth, or decrease pathogenicity or virulence, and preferably, kill the organism.
  • the genes and gene products identified by the invention can also be used to develop antimicrobial agents which are effective in preventing microbial infection, e.g., agents which are useful in the treatment of an established infection.
  • Therapeutic agents can be developed from the identification of essential genes of organisms such as bacteria or fungi.
  • a gene product e.g., a protein or an RNA molecule
  • identified by the methods disclosed herein is distinct from the gene products targeted by existing drugs such as antibiotic or antifungal agents.
  • the disclosed gene selection methods establish that the gene product is essential for survival of the organism.
  • Such an identified gene product therefore serves as a novel target for therapeutics based on a mechanism which is likely distinct from the mechanisms of existing drugs.
  • distinct from known compounds is a compound which inhibits the function of a gene product identified by methods disclosed herein, for example, by producing a phenotype or morphology similar to that found in the original mutant strain.
  • FIG. 1 Features and Partial Restriction Maps of in vitro Transposition Cassettes. Relevant restriction sites, positions of start and stop codons and position of open reading frame coding for antibiotic resistance determinants are indicated. Solid bars indicate position of U3 terminii recognized by Ty-1 transposase. Upper diagram: AT-2, lower diagram: AT-Cm. Position of AT-Cm specific insert anchored primer is indicated by the half arrow.
  • FIG. 1 Southern Analysis of Antibiotic Resistant H. influenzae Isolates.
  • Panel A Genomic Southern of trimethoprim resistant colonies.
  • Panel B Genomic Southern of chloroamphenicol resistant colonies. Lanes 1-24, 1 colony/lane, Lanes 25-30, three colonies/lane.
  • Panel A lanes 1-31, EcoRI digest; lanes 31-36 EcoRI/BamRl double digest.
  • Panel B lanes 1-36, EcoRI digest.
  • Lane + positive controls for Southern hybridization using AT-2 and AT-Cm, respectively.
  • Figure 3 Detection of met ⁇ Insert Mutant by PCR and Southern Analysis. Southern blot of dilutions of met ⁇ mutant DNA with genomic DNA from small insert library. Positions of known met ⁇ insert and library mutants are shown. Genome equivalents indicate the calculated copies of PCR template in the reactions. Schematic shows position of the PCR primers relative to met ⁇ coding region and AT-Cm insert.
  • Figure 4. Zero time' Analysis of met ⁇ Insertion Loss. Aliquots from growing cultures were removed at the indicated times and processed for PCR and Southern analysis (see text). Results from minimal media with (upper panel) and without (lower panel) methionine. The optical density of bacterial cultures (right hand panel) for mimimal media with (solid line) and without (dashed line) methionine are shown. Schematic illustrates the position of PCR primers used in the analysis.
  • Figure 5. 'Mutation Exclusion analysis' of HI#991-998. Ethidium stained agarose gel and Southern analysis of insert anchored PCR reactions using primers specific for HI#991- 998 (lanes 2-9 )(see text for details). ORF map of chromosomal region; arrows indicate direction of transcription and relative sizes of open reading frames. The position and orientation of ORF specific primers are shown by the half arrows. The deduced location of inserts are indicated by the vertical bars above the ORF map.
  • Essential genes are defined as genes, which, if they loose their function via mutation or some other occurance, will cause the death of a bacterium. In other words, a mutation in an essential gene results in bacterial death either immediately or over several generations.
  • a polynucleotide "derived from” or “specific for” a designated sequence refers to a polynucleotide sequence that comprises a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence.
  • the sequence may be complementary or identical to a sequence that is unique to a particular polynucleotide sequence as determined by techniques known in the art. Comparisons to sequences in databanks, for example, can be used as a method to determine the uniqueness of a designated sequence. Regions from which sequences may be derived, include but are not limited to, regions encoding specific epitopes, as well as non-translated and/or non-transcribed regions.
  • the derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest under study, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, that is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide. In addition, combinations of regions corresponding to that of the designated sequence may be modified in ways known in the art to be consistent with the intended use.
  • a "fragment" of a specified polynucleotide refers to a polynucleotide sequence that comprises a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the specified nucleotide sequence.
  • primer denotes a specific oligonucleotide sequence that is complementary to a target nucleotide sequence and used to hybridize to the target nucleotide sequence.
  • a primer serves as an initiation point for nucleotide polymerization catalyzed by either DNA polymerase, RNA polymerase or reverse transcriptase.
  • probe denotes a defined nucleic acid segment (or nucleotide analog segment, e.g., PNA as defined hereinbelow) which can be used to identify a specific polynucleotide present in samples bearing the complementary sequence.
  • Encoded by refers to a nucleic acid sequence that codes for a polypeptide sequence, wherein the polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 to 5 amino acids, more preferably at least 8 to 10 amino acids, and even more preferably at least 15 to 20 amino acids from a polypeptide encoded by the nucleic acid sequence. Also encompassed are polypeptide sequences that are immunologically identifiable with a polypeptide encoded by the sequence. Thus, a "polypeptide,” “protein,” or “amino acid” sequence has at least about 50% identity, preferably about 60% identity, more preferably about 75-85% identity, and most preferably about 90-95% or more identity with a BS325 amino acid sequence.
  • the BS325 "polypeptide,” “protein,” or “amino acid” sequence may have at least about 60% similarity, preferably at least about 75% similarity, more preferably about 85% similarity, and most preferably about 95% or more similarity to a polypeptide or amino acid sequence of the present invention.
  • a recombinant or encoded polypeptide or protein is not necessarily translated from a designated nucleic acid sequence. It also may be generated in any manner, including chemical synthesis or expression of a recombinant expression system.
  • synthetic peptide as used herein means a polymeric form of amino acids of any length, which may be chemically synthesized by methods well known to the routineer. These synthetic peptides are useful in various applications.
  • polynucleotide as used herein means a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modifications, such as methylation or capping and unmodified forms of the polynucleotide.
  • polynucleotide “oligomer,” “oligonucleotide,” and “oligo” are used interchangeably herein.
  • similarity means the exact amino acid to amino acid comparison of two or more polypeptides at the appropriate place, where amino acids are identical or possess similar chemical and/or physical properties such as charge or hydrophobicity. A so-termed “percent similarity” then can be determined between the compared polypeptide sequences.
  • Techniques for determining nucleic acid and amino acid sequence identity also are well known in the art and include determining the nucleotide sequence of the mRNA for that gene (usually via a cDNA intermediate) and determining the amino acid sequence encoded thereby, and comparing this to a second amino acid sequence.
  • identity refers to an exact nucleotide to nucleotide or amino acid to amino acid correspondence of two polynucleotides or polypeptide sequences, respectively.
  • Two or more polynucleotide sequences can be compared by determining their "percent identity.”
  • Two or more amino acid sequences likewise can be compared by determining their "percent identity.”
  • the percent identity of two sequences, whether nucleic acid or peptide sequences is the number of exact matches between two aligned sequences divided by the length of the shorter sequences and multiplied by 100.
  • An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be extended to use with peptide sequences using the scoring matrix developed by Dayhoff,
  • Polynucleotide refers to a polynucleotide of interest or fragment thereof that is essentially free, e.g., contains less than about 50%, preferably less than about 70%, and more preferably less than about 90%, of the protein with which the polynucleotide is naturally associated.
  • Techniques for purifying polynucleotides of interest include, for example, disruption of the cell containing the polynucleotide with a chaotropic agent and separation of the polynucleotide(s) and proteins by ion- exchange chromatography, affinity chromatography and sedimentation according to density.
  • Polypeptide or “purified protein” means a polypeptide of interest or fragment thereof that is essentially free of, e.g., contains less than about 50%, preferably less than about 70%, and more preferably less than about 90%, cellular components with which the polypeptide of interest is naturally associated. Methods for purifying polypeptides of interest are known in the art.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or DNA or polypeptide, that is separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotide could be part of a vector and/or such polynucleotide or polypeptide could be part of a composition, and still be isolated in that the vector or composition is not part of its natural environment.
  • Polypeptide and “protein” are used interchangeably herein and indicate at least one molecular chain of amino acids linked through covalent and or non-covalent bonds. The terms do not refer to a specific length of the product. Thus peptides, oligopeptides and proteins are included within the definition of polypeptide. The terms include post- translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. In addition, protein fragments, analogs, mutated or variant proteins, fusion proteins and the like are included within the meaning of polypeptide.
  • a “fragment" of a specified polypeptide refers to an amino acid sequence which comprises at least about 3-5 amino acids, more preferably at least about 8-10 amino acids, and even more preferably at least about 15-20 amino acids derived from the specified polypeptide.
  • Recombinant host cells refer to cells that can be, or have been, used as recipients for recombinant vector or other transferred DNA, and include the original progeny of the original cell that has been transfected.
  • replicon means any genetic element, such as a plasmid, a chromosome or a virus, that behaves as an autonomous unit of polynucleotide replication within a cell.
  • a “vector” is a replicon in which another polynucleotide segment is attached, such as to bring about the replication and/or expression of the attached segment.
  • control sequence refers to a polynucleotide sequence that is necessary to effect the expression of a coding sequence to which it is ligated. The nature of such control sequences differs depending upon the host organism. In prokaryotes, such control sequences generally include a promoter, a ribosomal binding site and terminators; in eukaryotes, such control sequences generally include promoters, terminators and, in some instances, enhancers.
  • control sequence thus is intended to include at a minimum all components whose presence is necessary for expression, and also may include additional components whose presence is advantageous, for example, leader sequences.
  • operably linked refers to a situation wherein the components described are in a relationship permitting them to function in their intended manner.
  • a control sequence "operably linked" to a coding sequence is ligated in such a manner that expression of the coding sequence is achieved under conditions compatible with the control sequence.
  • open reading frame refers to a region of a polynucleotide sequence that encodes a polypeptide. This region may represent a portion of a coding sequence or a total coding sequence.
  • a "coding sequence” is a polynucleotide sequence that is transcribed into mRNA and translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5' -terminus and a translation stop codon at the 3' -terminus.
  • a coding sequence can include, but is not limited to, mRNA, cDNA and recombinant polynucleotide sequences.
  • transfection refers to the introduction of an exogenous polynucleotide into a prokaryotic or eucaryotic host cell, irrespective of the method used for the introduction.
  • transfection refers to both stable and transient introduction of the polynucleotide, and encompasses direct uptake of polynucleotides, transformation, transduction, and f-mating.
  • the exogenous polynucleotide may be maintained as a non-integrated replicon, for example, a plasmid, or alternatively, may be integrated into the host genome.
  • the term "individual” as used herein refers to vertebrates, particularly members of the mammalian species and includes, but is not limited to, domestic animals, sports animals, primates and humans; more particularly, the term refers to humans.
  • sense strand or "plus strand” (or “+) as used herein denotes a nucleic acid that contains the sequence that encodes the polypeptide.
  • antisense strand or "minus strand” (or “-) denotes a nucleic acid that contains a sequence that is complementary to that of the "plus” strand.
  • Purified product refers to a preparation of the product that has been isolated from the cellular constituents with which the product is normally associated and from other types of cells that may be present in the sample of interest.
  • PNA denotes a "peptide nucleic acid analog” that may be utilized in a procedure such as an assay described herein to determine the presence of a target.
  • MA denotes a
  • morpholino analog that may be utilized in a procedure such as an assay described herein to determine the presence of a target. See, for example, U.S. Patent No. 5,378,841, that is inco ⁇ orated herein by reference.
  • PNAs are neutrally charged moieties that can be directed against RNA targets or DNA.
  • DNA probes are used. These advantages include manufacturability, large scale labeling, reproducibility, stability, insensitivity to changes in ionic strength and resistance to enzymatic degradation that is present in methods utilizing DNA or RNA.
  • PNAs can be labeled with ("attached to") such signal generating compounds as fluorescein, radionucleotides, chemiluminescent compounds and the like. PNAs or other nucleic acid analogs such as MAs thus can be used in assay methods in place of DNA or RNA. Although assays are described herein utilizing DNA probes, it is within the scope of the routineer that PNAs or MAs can be substituted for RNA or DNA with appropriate changes if and as needed in assay reagents.
  • Haemophilus influenzae strain BC200 (the kind gift of Jane Setlow) was cured of plasmid pDM2 by growth in brain heart infusion supplemented with
  • NP200 for No Plasmid
  • Competent Cell Preparation NP200 competent cells were prepared using competence-inducing MIV medium (4). Cells were stored at -80°C in 1.0 mL aliquots.
  • Chloramphenicol was added to a final concentration of 1.5 ⁇ g/mL and the cells for grown for an additional 90 mins. The culture was then plated on sBHI-agar containing 1.5 ⁇ g/ml chloroamphenicol.
  • Genomic DNA preparation The CTAB method (3) was used for the isolation of genomic DNA from H. influenzae with the addition of 10 ⁇ l of RNase A (50 ⁇ g/ml) and incubation at 37°C for 15 mins, prior to the second phenol extraction.
  • DNA Quantification DNA was quantified fluorometrically (Turner Designs) relative to lambda standards using Pico green (Molecular Probes).
  • influenzae genomic DNA was mixed with transposase buffer, 0.2 ⁇ g of AT-Cm and 3 ⁇ l of transposase, in a final volume of 30 ⁇ l, for 3 hr at 30°C.
  • the reaction was terminated by the addition of proteinase K and EDTA.
  • the DNA was precipitated with ammonium acetate and single stranded gaps, introduced by the in vitro insertion reaction, were subsequently repaired.
  • PCR reactions TaKaRa taq polymerase was used according to the manufacturer in 50 ⁇ l reactions with 50 ng of genomic DNA as template. A three step PCR reaction was used: 94°C (5 min)[l cycle]; 94°C (1 min), 62°C (30 sec), 68°C (2.5 min)[35 cycles]; 68°C (10 min)[l cycle].
  • molecular weight markers (542 bp, 975 bp, 2151 bp and 4244 bp) that hybridize with an AT-Cm probe were constructed as follows: the 542 bp fragment was PCR amplified from AT-Cm using a primer pair consisting of primer AT-Cm (+) and primer AT-Cm 542; the 975 bp marker was Xmnl digested AT- 5 Cm; the 2151 bp fragment was Scal/EcoRY digested p AC YC 184 and the 4244 bp marker was linearized pACYC184.
  • PCR primers specific for At-Cm and metE were designed using OLIGO (MBInsights) with a calculated Tm of 70°C (metE 5'-ATGACAACATCACA- l o TATTTTAGGCTTTC; metE 3 '-CGCTAATTCCGC ACGTAATTTT).
  • Genomic sequencing H. influenzae genomic DNA (3-5 ⁇ g) was used as a template for PCR cycle sequencing (Perkin Elmer) using oligonucleotide primers AT-Cm Seq (+) ATTGGTGCCCTTAAACGCCTG and AT-Cm Seq (-) TTACGTGCCGATCAACGTCTC.
  • influenzae genomic DNA as target. After in vitro reaction and repair (see Methods) the DNA was transformed into competent H. influenzae and the transformation mix plated on selective media 5 (trimethoprim for AT-2 and chloroamphenicol for AT-Cm). The resultant antibiotic resistant colonies for the number and randomness of insertions into the H influenzae chromosome were examined by Southern analysis (Fig. 2). Genomic DNA from overnight cultures inoculated from single colonies or three independently picked colonies was isolated, digested with EcoRI (Fig. 2, panel A and B, lanes 1-23) or with EcoRI/it ⁇ /-n ⁇ I (Fig. 2, panel A, lanes 31-36), separated by agarose gel electrophoresis and transferred to nylon membranes.
  • EcoRI Fig. 2, panel A and B, lanes 1-23
  • EcoRI/it ⁇ /-n ⁇ I Fig. 2, panel A, lanes 31-36
  • a Southern hybridizing band can clearly be seen that migrates with the same apparent molecular weight as authentic AT-2 (Fig. 2, panel A, lanes 30-35) confirming that the in vitro reaction, transformation and selection proceeds such that an entire antibiotic cassette is randomly inserted into high molecular weight DNA.
  • a similar analysis was performed on chloroamphenicol resistant clones (Fig. 2, panel B).
  • the AT-Cm cassette contains a unique internal EcoRI site (Fig. 1), therefore a single insertion will yield two Southern hybridizing bands when an EcoRI digested genomic Southern is probed with a randomly primed 33 P-labelled AT-Cm. The observed pattern was interpreted to indicate that for the AT-Cm cassette, insertions are also randomly distributed in the H influenzae chromosome.
  • influenzae genomic sequence (Fleischmann, R. D., M.D. et al., "Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.”, Science, 269(5223):496-512, (1995)).
  • the DNA template for the sequencing reactions was the genomic DNA used for Southern analysis (see above).
  • Table 1 show that the in vitro reaction can insert AT-2 and AT-Cm into a variety of DNA elements: open reading frames, intergenic regions and ribosomal operons. No sequence preferences for insertion sites were observed. Comparison of the sequence data derived from the outward reading primers (appropriate to each cassette) with the published H. influenzae genome, revealed no deletions or insertions near the transposon insertion sites.
  • AT-Cm 10 contained an AT-Cm insert in metE (codon 603) and a strain bearing this mutation was reconstructed from isolated genomic DNA using standard techniques (see Methods).
  • the strategy for identifying essential genes uses a technique for mapping the location of inserts, relative to deduced open reading frames, in a population of growing bacteria.
  • a pilot experiment using genomic DNA from a small AT-Cm insertional mutant library (-5000 inserts) was 'spiked' with known quantities of metE mutant DNA and used as a template for PCR and Southern analysis.
  • metE mutant DNA was serially diluted into genomic DNA prepared from the insertional library and these dilutions were used in PCR reactions with a primer pair consisting of one primer specific for AT-Cm (see Methods) and another primer specific for the 5' coding sequence of metE (Fig. 3).
  • This primer combination ('insert anchored' primers) was ⁇ 10 4 fold more sensitive for detecting the metE insertions from the mixed template than 'ORF specific' primers: PCR primer pairs that spanned the coding region of metE (data not shown).
  • PCR reactions using the serially diluted templates were separated by agarose gel electrophoresis, transferred to a nylon membrane and probed with a 33 P-random labeled AT-Cm probe. The results show a significant signal from as few as -10 copies of metE insert DNA in a background of ⁇ 10 7 wild type metE genes (Fig. 3, lane 7).
  • genomic DNA from the insertional library was used as a PCR template, we observed several Southern hybridizing bands (Fig.
  • metE insert strain persists throughout the growth of the culture in the samples derived from the minimal media containing methionine, (Fig. 4, upper panel).
  • the samples from minimal media lacking methionine clearly show the disappearance of the metE mutant strain over time (Fig. 4, lower panel).
  • metE is an essential function and cells bearing inserts in this gene are lost from the population. This loss is specific to a subset of mutants, as the growth rate and final cell density of the cultures in both media (with and without methionine) are essentially identical (Fig. 4, graph).
  • Each reaction contained a primer pair consisting of a primer specific for AT-Cm and a primer specific for an open reading frame.
  • the ORF specific primers were chosen from a single strand of the chromosome.
  • the ethidium stained (Fig. 5, panel A) and resulting Southern analysis (Fig. 5, panel B) was generated from these reactions.
  • the position of the AT-Cm inserts relative to the deduced ORFs in this region of the H. influenzae chromosome were mapped by calculating the size of the Southern hybridizing bands in each lane and are shown above the ORF map (Fig. 5, vertical bars). There are clearly regions that do not contain AT-Cm inserts: these areas map to both annotated and hypothetical open reading frames.
  • a method of identifying regions of the H. influenzae chromosome that are required for viability, making use of an in vitro transposition reaction, complete and accurate genomic sequence data and the sensitivity of PCR and Southern analysis to map the chromosomal locations of a selectable marker is the subject of this invention.
  • This approach is generally applicable, though the efficiency of transformation, the accuracy of the genomic sequence and the number of generated insertions will modulate the confidence in the results.
  • Organisms that are naturally competent and whose genome sequence are available, are clear candidates for extending this technique (e.g. Streptococcus pneumoniae, Helicobacter pylori, Neisseria sp.).
  • ORF's essential open reading frames
  • chloroamphenicol fewer mutants
  • chloroamphenicol acetyl- transferase (CAT) promoter in AT-Cm is only weakly transcribed in H. influenzae.
  • a weak CAT promoter will reduce possible polar effects of transposase generated insertions on surrounding chromosomal genes, simplifying our analysis.
  • Mutation exclusion analysis of ⁇ I#991 -999 identifies a known essential gene, dnaA (HI#993) (Donachie W.D., "The cell cycle of Escherichia coli", Annu. Rev. Microbiol, 47: 199-230, (1993); Marians, K. J., "Replication Fork Propagation", In F.C.
  • dnaN HI#992
  • dnaN HI#992
  • insertions in the 5' and 3' regions of -this gene were consistently found.
  • the central region of dnaN remained devoid of insertions.
  • Zero time analysis of this gene clearly showed inserts along the entire length of dnaN immediately after transformation, however mutations in the central third of the gene were never seen after selection on solid media, perhaps defining a protein domain required for viability.
  • the unannoted genes HI#996, 997 and 999 are also essential by our analysis: they do not contain At-Cm insertions.
  • HI#998 ribosomal protein L34
  • inserts in this gene would have been revealed by the overlapping PCR reactions specific for HI#999 (and by exclusion analysis using ORF specific primers derived from the opposite chromosomal strand for HI#997). As expected, this gene is also essential.
  • the transferrins binding proteins (HI#994, 995) are clearly dispensable in rich media, though in an iron limiting environment or in an animal host, these mutants might be non- viable and H. influenzae strains bearing At-Cm inserts in these genes might disappear from the population (Cornelissen, C. N. and P. F. Sparling. "Iron piracy: acquisition of transferrin-bound iron by bacterial pathogens", Mol. Microbiol, 14:843-850 (1994)).
  • broth culture were noted in initial experiments, and sBHI-agar was chosen for generating the mutant libraries.
  • Other culture conditions could be tested, including various minimal media, partial oxygen pressure, heat shock, cold shock, growth in serum, limiting iron, etc. Identifying functions required for survival in stationary phase could also be considered.
  • Post-genomic approaches include a systematic 'knock-out' strategy, being undertaken by the yeast community, 'in silico' analysis to determine common, shared and unique open reading frames (Arigoni, F., et al, "A genome based approach for the identification of essential bacterial genes " Nature Biotech, 16:851-856,(1998)), systematic complementation of temperature sensitive alleles and a similar in vitro transposition mutagenesis strategy that has recently been described in "Systematic Identification of essential genes by in vitro mariner mutagensis", herein incorporated by reference Akerley, B. J., et al., “Systematic Identification of essential genes by in vitro mariner mutagensis", Proc. Natl. Acad. Sci.
  • the present inventors have developed and used a well characterized in vitro transposition system to generate a large mutant insert library and analyzed the library by mapping the location of inserts relative to open reading frames and by monitoring the rate of loss of particular mutants.
  • the ability to follow the disappearance of a particular mutant over time provides both a positive control for the ORF of interest (that the in vitro transposition reaction targeted the ORF) and biological information concerning the open reading frame itself.
  • the rate of gene loss will be modulated by a number of factors, including the steady state level of expression of the protein, its the half life, the cell doubling time and the cellular function that is abrogated. This additional data will be relevant to choosing targets for anti-bacterial drug discovery.
  • This facile system could also be used to generate transcriptional fusions with reporter genes (e.g. GFP or ⁇ -galactosidase) for cell sorting and identification.
  • reporter genes e.g. GFP or ⁇ -galactosidase
  • Genome scanning provides an experimental technique for assigning a rudimentary annotation to the large fraction of bacterial genomes that have no known function. This method, and its variations, will provide solutions to understanding and predicting the minimal gene complement required for autonomous bacterial survival.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Virology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

L'invention concerne des gènes bactériens essentiels et un procédé d'identification de « gènes essentiels » (c.-à-d. de gènes essentiels à la survie d'une bactérie) grâce à un système de transposition in vitro, un petit (975 bp) élément d'insertion contenant une cassette de résistance aux antibiotiques et cartographiant ces inserts par rapport aux phases de lecture ouvertes déduites de H. influenzae par amplification en chaîne par polymérase et par la technique d'analyse de Southern.
PCT/US2000/021176 1999-08-04 2000-08-03 Balayage de genes bacteriens essentiels et de genome dans haemophilus influenzae en vue de l'identification de « genes essentiels » WO2001011033A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US36838299A 1999-08-04 1999-08-04
US09/368,382 1999-08-04

Publications (2)

Publication Number Publication Date
WO2001011033A2 true WO2001011033A2 (fr) 2001-02-15
WO2001011033A3 WO2001011033A3 (fr) 2002-01-17

Family

ID=23450986

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/021176 WO2001011033A2 (fr) 1999-08-04 2000-08-03 Balayage de genes bacteriens essentiels et de genome dans haemophilus influenzae en vue de l'identification de « genes essentiels »

Country Status (1)

Country Link
WO (1) WO2001011033A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002018601A2 (fr) * 2000-08-25 2002-03-07 Abbott Laboratories Genes bacteriens essentiels et lecture du genome dans haemophilius influenzae pour l'identification de 'genes essentiels'
US20170362287A1 (en) * 2014-12-09 2017-12-21 Oncotherapy Science, Inc. Gpc3 epitope peptides for th1 cells and vaccines containing the same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996033276A1 (fr) * 1995-04-21 1996-10-24 Human Genome Sciences, Inc. Sequence nucleotidique du genome haemophilus influenzae rd, des fragments de ce dernier, ainsi que ses applications

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996033276A1 (fr) * 1995-04-21 1996-10-24 Human Genome Sciences, Inc. Sequence nucleotidique du genome haemophilus influenzae rd, des fragments de ce dernier, ainsi que ses applications

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
AKERLEY ET AL: "SYSTEMATIC IDENTIFICATION OF ESSENTIAL GENES BY IN VITRO MARINER MUTAGENESIS" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,US,NATIONAL ACADEMY OF SCIENCE. WASHINGTON, vol. 95, July 1998 (1998-07), pages 8927-8932, XP002140726 ISSN: 0027-8424 cited in the application *
ARIGONI F ET AL: "A genome-based approach for the identification of essential bacterial genes" NATURE BIOTECHNOLOGY,NATURE PUBLISHING,US, vol. 16, September 1998 (1998-09), pages 851-856, XP002124132 ISSN: 1087-0156 cited in the application *
CHUN, K.T. AND GOEBL, M.G.: "The indentification of transposon-tagged mutantions in essential genes that affect cell morphology in Saccharomyces cerevisiae" GENETICS, vol. 142, 1996, pages 39-50, XP000995589 *
FLEISCHMANN R D ET AL: "Whole-genome random sequencing and assembly of Haemophilus influenzae Rd" SCIENCE,US,AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, vol. 269, 28 July 1995 (1995-07-28), pages 496-512, XP002124976 ISSN: 0036-8075 cited in the application & DATABASE EMBL [Online] AC U32686; H. influenzae Rd sect. 1 of 163, 9 August 1995 (1995-08-09) FLEISCHMANN, R.D. ET AL.: *
MUSHEGIAN A R ET AL: "A minimal gene set for cellular life derived by comparison of complete bacterial genomes" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,NATIONAL ACADEMY OF SCIENCE. WASHINGTON,US, vol. 93, September 1996 (1996-09), pages 10268-10273, XP002126189 ISSN: 0027-8424 *
NELSON, K.E. AND DOUGHERTY, B.A.: "Identification of the minimal essential gene set of Haemophilus influenzae via transposon mutagenesis" ABSTRACTS OF THE GENERAL MEETING OF THE AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 97, 1997, page 321 XP000994943 *
REICH, K.A. ET AL.: "Genome scanning in Haemophilus influenzae for identification of essential genes" JOURNAL OF BACTERIOLOGY, vol. 181, no. 16, July 1999 (1999-07), pages 4961-4968, XP000994882 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002018601A2 (fr) * 2000-08-25 2002-03-07 Abbott Laboratories Genes bacteriens essentiels et lecture du genome dans haemophilius influenzae pour l'identification de 'genes essentiels'
WO2002018601A3 (fr) * 2000-08-25 2003-02-06 Abbott Lab Genes bacteriens essentiels et lecture du genome dans haemophilius influenzae pour l'identification de 'genes essentiels'
US20170362287A1 (en) * 2014-12-09 2017-12-21 Oncotherapy Science, Inc. Gpc3 epitope peptides for th1 cells and vaccines containing the same

Also Published As

Publication number Publication date
WO2001011033A3 (fr) 2002-01-17

Similar Documents

Publication Publication Date Title
Blum et al. Excision of large DNA regions termed pathogenicity islands from tRNA-specific loci in the chromosome of an Escherichia coli wild-type pathogen
Podbielski et al. The group A streptococcal virR49 gene controls expression of four structural vir regulon genes
EP0355147B1 (fr) Sonde a base d'adn specifique a la listeria pathogenique
Biswas et al. Regulation of the glucosyltransferase (gtfBC) operon by CovR in Streptococcus mutans
White et al. pH dependence and gene structure of inaA in Escherichia coli
US20200109395A1 (en) Genetic systems that defend against foreign dna and uses thereof
Fuller et al. Identification of in vivo induced genes in Actinobacillus pleuropneumoniae
Ike et al. Hyperhemolytic phenomena associated with insertions of Tn916 into the hemolysin determinant of Enterococcus faecalis plasmid pAD1
Robertson et al. Vancomycin tolerance induced by erythromycin but not by loss of vncRS, vex3, or pep27 function in Streptococcus pneumoniae
KR100391483B1 (ko) 비유형 헤모필러스 인플루엔재(Haemophilus influenzae)의 LKP필린 구조유전자 및 오페론
Boyle et al. Role of emm and mrp genes in the virulence of group A streptococcal isolate 64/14 in a mouse model of skin infection
US20090298713A1 (en) Polynucleotides which are of nature b2/d+ a- and which are isolated from e. coli, and biological uses of these polynucleotides and of their polypeptides
Liu et al. Biological role of Actinobacillus pleuropneumoniae type IV pilus proteins encoded by the apf and pil operons
US20100261618A1 (en) Identification of genes implicated in the virulence of streptococcus agalactiae
KR20140002463A (ko) 디포신 및 그의 사용 방법
CA2436530C (fr) Genes de streptococcus suis environnementalement regules
JP2004512817A (ja) 大腸菌から単離される、ｂ２／ｄ＋ａ−型のポリヌクレオチド、ならびにこれらのポリヌクレオチドとそのポリペプチドの生物学的使用
US20030021813A1 (en) Essential bacteria genes and genome scanning in Haemophilus influenzae for the identification of 'essential genes'
WO2001011033A2 (fr) Balayage de genes bacteriens essentiels et de genome dans haemophilus influenzae en vue de l'identification de « genes essentiels »
JPH09510866A (ja) ミコバクテリア毒力因子およびその同定のための方法
WO2002018601A2 (fr) Genes bacteriens essentiels et lecture du genome dans haemophilius influenzae pour l'identification de 'genes essentiels'
AU690121B2 (en) Methods and compositions for detecting and treating mycobacterial infections using an inhA gene
US5686590A (en) Methods and compositions for detecting and treating mycobacterial infections using an INHA gene
WO1999032657A1 (fr) Genes essentiels de staphylococcus aureus histidine proteine kinase
JPH09501308A (ja) 接触仲介性溶血素のレギュレーター

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA JP MX

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): CA JP MX

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP